CN113652474A - Detection method for DMD gene exon copy number variation and application thereof - Google Patents

Abstract

The invention discloses a method for detecting DMD gene exon copy number variation and application thereof; belongs to the technical field of molecular biology. 79 exons of the DMD gene are amplified in PCR reaction liquid, one or more than two groups of internal reference genes are used for monitoring the PCR reaction efficiency, DMD female contrast with 2 copy numbers of the DMD gene is used for calculating PCR products through capillary electrophoresis analysis, 79 exon copy numbers of the DMD gene are relatively quantitatively detected, the DMD gene with 0, 1, 2 and 3 copy numbers is calculated, the normal copy numbers, deletion mutation and repeated mutation of the DMD gene exons are distinguished, and small deletion and mutation can be prompted. The result can be obtained within 4 hours from the DNA sample, the DMD gene exon copy number condition can be detected only by one PCR experiment, the detection technical process is simple, and the standardization is easy to realize.

Description

Detection method for DMD gene exon copy number variation and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a method for detecting DMD gene exon copy number variation and application thereof.

Background

Progressive muscular dystrophy (Progressive muscular dystrophy) is a heterogeneous group of genetically deficient diseases with Progressive skeletal muscle atrophy as the main clinical manifestation. May be associated with central nervous system, cardiac, skeletal, respiratory and gastrointestinal tract involvement. The different types of diseases have different onset times, progression speeds, affected ranges and severity degrees. Duchenne Muscular Dystrophy (DMD), the most common progressive muscular dystrophy, with a neonatal boy infant incidence of 1/3500; becker Muscular Dystrophy (BMD), with a neonatal male infant incidence of 1/30000.

The pathogenic gene of DMD/BMD is the DMD gene, located at Xp21.2, and the encoded protein is called Dystrophin (Dystrophin), distributed on the cell membranes of skeletal muscle and cardiac muscle, and plays a role of a scaffold to protect the muscle cell membranes from being damaged during muscle contraction. Due to the DMD gene defect, the dystrophin on the muscle cell membrane is abnormal in function, the muscle cell is damaged, progressive necrosis, atrophy and the like occur, and the symptoms and signs of muscle weakness appear clinically. Duchenne Muscular Dystrophy (DMD) usually occurs in 2-5 years, and is manifested by slight retardation of motion development, progressive weakness and atrophy of skeletal muscles, influence on limb motion function, gradual gait abnormality, limited upper limb movement, and loss of walking ability in natural course of disease usually around 10 years old. Thereafter, scoliosis, joint contracture, respiratory muscle weakness, dilated cardiomyopathy occur, and death occurs due to respiratory failure and cardiac failure in about 20 years old. The patients with hypothermia of 1/3 patients can see pseudohypertrophy of both gastrocnemius muscles, and also pseudohypertrophy of both forearms and tongue muscles, positive character of Gower's, lumbar lordosis, etc. Becker Muscular Dystrophy (BMD) occurs late, has light symptoms and slow progress, mostly lives on a wheelchair after 16 years old, and the life can reach 40-50 years old. The disease condition is obviously lighter than Du's muscular dystrophy because the DMD gene function is not completely lost. Can be ill in young or even adult, and part of patients do not affect the survival period. The pseudohypertrophy is obvious in sign, and when the limbs of some patients are weak, the patients firstly have obvious dilated cardiomyopathy.

The DMD gene is one of the largest genes in human, is located in Xp21, spans 2.5Mb on the genome, comprises 79 exons, 78 introns and 8 promoters, has an mRNA sequence with the full length of 1.4Kb, and is mainly expressed in skeletal muscle and cardiac muscle, and is slightly expressed in brain tissue. The DMD gene has various mutation forms, about 60-70% of DMD/BMD patients are caused by deletion mutation of one or more exons of the DMD gene, about 5-10% of DMD/BMD patients are caused by repeat mutation, and the rest DMD/BMD patients are caused by micro mutation (including base substitution, small deletion or insertion, intron mutation, chromosome rearrangement and the like). Unlike deletion or repeat mutations, minor mutations have no apparent distribution hot spots, and are randomly distributed throughout the gene. Among the pathogenic mutations of the DMD gene, deletion or repeat mutations of 80% of the copy number variation are the main mutation types of DMD/BMD.

Internationally, the most approved product for DMD/BMD is the multiplex Ligation-dependent Probe amplification (MLPA) detection technology of MRC-Holland. The method can rapidly and simultaneously identify deletion, insertion and copy number of dozens of genes, is widely applied to 900 laboratories all over the world at present, and has nearly thousands of papers published by using the technology. Detecting 79 exons and internal reference genes of the DMD gene in a DMD gene detection probe group containing P034 and P035, distinguishing the lengths of fragments with different sizes by capillary analysis, calculating the abundance ratio of PCR products of the DMD exons represented by amplified product fragments and PCR products of the internal reference genes, judging whether each exon of the DMD gene is deleted or repeated, and carrying out semi-quantitative analysis on the copy number of the exons of the DMD gene. However, the detection method is complicated, 79 exons need two tubes to be hybridized, connected and PCR amplified with target sequence DNA, and then two-hole capillary analysis is carried out, and the result can be obtained within two days.

Accordingly, there is a need for an improved method for determining whether a human subject is a patient, carrier or normal with Duchenne/Behcet muscular dystrophy by detecting 79 exon copy number variations of the DMD gene of a human subject in an accurate, specific and faster manner, and identifying deletion and repeat mutations of large fragments.

Disclosure of Invention

The present invention is directed to solving the above problems and to providing a method for detecting DMD gene exon copy number variation and the use thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

a PCR amplification reaction detection method for DMD gene exon copy number comprises the following steps: performing PCR amplification reaction, and simultaneously amplifying 79 exons, reference genes and SRY genes of the DMD gene; wherein the primers for amplifying 79 exons and reference genes of the DMD gene at least comprise two different primers; the first primer is bonded with 79 exons of the DMD gene and the upstream region of the internal reference gene, and the 5' end of the first primer contains a whole or partial non-human genome sequence primer SEQ ID NO. 1; the second primer is bonded with 79 exons of the DMD gene and the downstream region of the reference gene, and the 5' end of the second primer contains all or part of non-human genome sequence primer SEQ ID NO. 2; wherein the primers used to amplify the SRY gene comprise at least two different primers, a first primer binding to the upstream region of the SRY gene and a second primer binding to the downstream region of the SRY gene.

In the detection method, the reference gene is selected from one or more of GAPDH, ACTB, HBB, CFTR, HPRT, RPP30 or RPP 40.

The primers used for amplifying 79 exons of the DMD gene in the detection method comprise sequences shown as SEQ ID NO. 3-160.

The primer for amplifying the SRY gene in the detection method comprises the sequence shown in SEQ ID NO. 161-162.

In the detection method, in the PCR amplification reaction, the primer at least comprises more than one fluorescent group; the fluorescent group is selected from any one of FAM, VIC, HEX, JOE, TMR, NED, PET and ROX.

A DMD gene copy number detection kit comprises the following components: DMD reaction liquid, DMD primer mixed liquid, DNA polymerase, DMD female control, DMD male control and DMD blank control;

the DMD primer mixed solution comprises the primer for amplifying 79 exons and reference genes of the DMD gene and the primer for amplifying the SRY gene.

Further, the DMD primer mixture comprises primers SEQ ID NO.1/2SEQ ID NO.3-160, SEQ ID NO.161/162, ACTB upstream/downstream primer and HBB upstream/downstream primer.

Further, the DMD primer mixture may include: DMD primer mixture 1: primers SEQ ID NO.1-84, SEQ ID NO.161/162, ACTB upstream/downstream primer and HBB upstream/downstream primer; DMD primer mixture 2: primers SEQ ID NO.1/2, SEQ ID NO.85-160, ACTB upstream/downstream primers and HBB upstream/downstream primers.

The DMD reaction liquid comprises: 10 Taq Buffer at a final concentration of 1.5X; 25mM MgCl2 at a final concentration of 0.5 mM; dATP/dTTP/dGTP/dCTP at a final concentration of 0.5 mM; enhancer at a final concentration of 2.0M; the enhancer comprises one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

The use method of the detection kit in the detection of the DMD gene exon copy number variation comprises the following steps:

(1) processing the sample;

(2) preparing an amplification reagent;

(3) PCR amplification and analysis by a capillary electrophoresis apparatus; carrying out PCR amplification reaction on a DNA sample to be detected to generate a PCR product, and analyzing the size and abundance of the fragment by using a capillary electrophoresis apparatus;

(4) and (3) calculating a detection peak ratio: after the reaction program is finished, carrying out fragment size analysis on the PCR amplification product; dividing the detection peak area of 79 exons and two reference genes of the DMD gene of the sample to be detected and the DMD female control by the total area of the reference genes respectively, and dividing the value corresponding to each point of the DMD female control by the sample to be detected to obtain the detection peak ratio of each point;

(5) and (4) interpretation of results:

(a) the detection peak ratio of the internal reference gene falls between 1.80 and 2.38;

detection peak ratio of 79 exons of DMD gene: the detection peak ratio is less than 0.25, and the copy number is 0; the detection peak ratio is more than or equal to 0.25, R is less than 1.45, and the copy number is 1; detecting the peak ratio of 1.45-2.53, wherein R is less than or equal to 2.53, and the copy number is 2; detecting the peak ratio of 2.53-3.80, and copy number of 3;

(b) judging the detection type:

if SRY wave, judging the type according to the male sample: DMD exon gene copy number is 0, and a male sample is of a hemizygous deletion type; the copy number of the DMD exogene is 1, and a male sample is a normal type; DMD exon gene copy number is 2, and the male sample is a half-synthetic duplication type;

if there is no SRY wave, judging the type according to the female sample: DMD exon gene copy number is 1, and female samples are heterozygous deletion type; DMD exon gene copy number is 2, and the female sample is normal; DMD exon gene copy number 3, female samples were heterozygous replicates.

The detection kit is applied to DMD gene detection.

TABLE 1 amplification composition information

Wherein the single line part is non-human genome

The primer sequences SEQ ID NO.1 and SEQ ID NO.2 are as follows:

SEQ ID NO.1：TCGACGCACGCTCCTGCACAG；

SEQ ID NO.2：AGCGAGACGCTACCATGGCTAT；

the invention has the beneficial effects that:

(1) in terms of detection time, the whole process comprises fluorescence PCR amplification and capillary electrophoresis fragment analysis, and the result can be obtained within 4 hours. The invention greatly shortens the detection time, has simple detection technical process and is easy to realize standardization.

(2) In the aspect of reagent performance, through the design of special primers and a PCR reaction system, the following more excellent performance performances can be achieved:

a, more comprehensive specification design: PCR reaction is carried out for one time, capillary electrophoresis analysis is carried out for one hole, the copy number of a DMD gene at No. 1-79 exon is detected, the male sex determination gene SRY gene interpretation type is matched, the copy number normality, deletion mutation and repeated mutation of the DMD gene exon are distinguished, small deletion and mutation can be prompted, and the distinction of a DMD normal person, a carrier and a patient is realized.

More sensitive detection results: the sample concentration is as low as 15ng/ul, and the copy number of the DMD gene exon can still be accurately judged.

Combining two-stage amplification reaction design, increasing amplification consistency and providing more accurate detection results: a non-human genome sequence is designed at the 5 ends of the upstream and downstream primers of 79 exons and an internal reference gene of the DMD gene, and comprises two stages of PCR amplification reactions. First-stage amplification: the first primer and the second primer respectively amplify amplification products of 79 exons and reference genes of the DMD gene, wherein the 5 'end of the DMD gene comprises all or part of the non-human genome sequence SEQ ID NO.1, and the 3' end of the DMD gene comprises all or part of the non-human genome sequence SEQ ID NO. 2; and (3) second-stage amplification: and performing secondary amplification by using the amplification products of 79 exons and internal reference genes of the DMD gene of which the 5 'end comprises all or part of the non-human genome sequence SEQ ID NO.1 and the 3' end comprises all or part of the non-human genome SEQ ID NO.2 amplified in the first stage as templates and using EQ ID NOs 1 and SEQ ID NO. 2. The special multiple primers are designed and matched with the non-human genome sequence, so that the problems of multiple PCR quantitative systems and amplification consistency are solved, and the accuracy of relative quantification of copy number is improved. Meanwhile, the PCR reaction system adopts double-gene internal control, and the ratio is calculated by contrast with a DMD normal female, so that the efficiency of PCR amplification reaction can be effectively monitored.

(3) The mutation of the small deletion and insertion of the DMD gene prompts that the design of the primer covers the No. 1-79 exon region of the DMD gene, and when amplification products which do not accord with the size of an expected fragment appear through capillary electrophoresis fragment analysis, the primer amplification region is prompted to have rare gene mutation or gene polymorphism (polymorphism) of deletion or insertion, and the sequence confirmation of the deletion or insertion can be further carried out by matching with first-generation sequencing.

(4) Drug administration guidance, 2016, 9/19 days, the first drug, Exondies 51, approved by the U.S. Food and Drug Administration (FDA) for the treatment of Duchenne Muscular Dystrophy (DMD) patients by Sarepta corporation^TMTo accelerate marketing applications. Exondies 51^TMIs suitable for confirming that the patients with DMD carrying the exon 51 jump mutation of the DMD gene account for 13 percent of all patients with DMD, and the other drug Vyongys 53^TMAlso preferably approved by FDA, Vyondys 53^TMThis is applicable to DMD patients identified as carrying the exon 53 skipping mutation of the DMD gene, accounting for approximately 8% of all DMD patients, and these drugs need to meet a specific exon deletion mutation pattern in order to select an appropriate therapeutic agent. Therefore, the detection of the invention can be used as a medication guide.

Description of the drawings:

fig. 1 is a graph of the electrophoresis results of DMD normal male individuals, which shows the analysis results of DNA samples extracted from normal male individuals according to example 4 of the present disclosure. The analysis result shows that the gene has SRY detection peak, the copy number of the DMD gene exon is 1 copy, and the detection result is normal.

FIG. 2 is a graph of the results of DMD female normal individuals, which is a graph showing the analysis results of DNA samples extracted from female normal individuals according to example 4 of the present disclosure. The analysis result shows that the SRY detection peak is absent, the DMD gene exon copy number is 2 copies, and the detection result is a normal type.

FIG. 3 is a carrier of exon 45-47 heterozygous deletion mutation of the DMD gene, which is an analysis result of DNA samples extracted from carriers of normal Duchenne/Behcet muscular dystrophy according to example 4 of the present disclosure. The analysis result shows that no SRY detection peak exists, the copy number of the 45-47 exons of the DMD gene is 1 copy, the rest exons are 2 copies, and the detection result is a 45-47 exon heterozygous deletion type.

FIG. 4 is a patient with exon 45-50 hemizygous deletion mutation in the DMD gene, which is analyzed by DNA samples from patients with Duchenne/Behcet muscular dystrophy according to example 4 of the present disclosure. The analysis result shows that no SRY detection peak exists, the copy number of the 45-50 exons of the DMD gene is 0 copy, the rest exons are 1 copy, and the detection result is a 45-50 exon semizygosis deletion type.

FIG. 5 is a patient with exon 2 hemizygous repeat mutation of the DMD gene, which is an analysis result of a DNA sample extracted from a patient with normal Duchenne/Behcet muscular dystrophy, according to example 4 of the present disclosure. The analysis result shows that no SRY detection peak exists, the copy number of the No.2 exon of the DMD gene is 2 copies, the rest exons are 1 copy, and the detection result is a No.2 exon hemizygous duplication type.

The specific implementation mode is as follows:

example 1 primer design

According to NCBI database, 79 exons, SRY, ACTB and HBB genes of the DMD gene are searched, and specific primers are designed. The SRY gene is used as a male and female sample for interpretation, and two reference genes (ACTB and HBB) are used for monitoring the PCR efficiency.

Preparing DMD reaction liquid and DMD primer mixed liquid

TABLE 2 DMD reaction liquid component preparation Table

Components	Final concentration per reaction
		10X Taq Buffer(Thermo)	1.5X
25mM MgCl2	0.5mM
		dATP/dTTP/dGTP/dCTP	0.5mM each
Betaine	2.0M

TABLE 3 Table for preparing 1 component of DMD primer mixture

The 5' end of SEQ ID NO.1 and SEQ ID NO.161 in Table 3 modifies FAM fluorophore.

TABLE 4 DMD primer mixture 2 Components preparation TABLE

Primer name	Final concentration (μ M)	Primer name	Final concentration (μ M)	Primer name	Final concentration (μ M)
						SEQ ID NO.1	3.00	SEQ ID NO.111	0.57	SEQ ID NO.139	0.50
SEQ ID NO.2	3.00	SEQ ID NO.112	0.57	SEQ ID NO.140	0.50
						SEQ ID NO.85	0.47	SEQ ID NO.113	0.53	SEQ ID NO.141	0.57
SEQ ID NO.86	0.47	SEQ ID NO.114	0.53	SEQ ID NO.142	0.57
						SEQ ID NO.87	0.33	SEQ ID NO.115	0.47	SEQ ID NO.143	0.47
SEQ ID NO.88	0.33	SEQ ID NO.116	0.47	SEQ ID NO.144	0.47
						SEQ ID NO.89	0.40	SEQ ID NO.117	0.53	SEQ ID NO.145	0.40
SEQ ID NO.90	0.40	SEQ ID NO.118	0.53	SEQ ID NO.146	0.40
						SEQ ID NO.91	0.43	SEQ ID NO.119	0.60	SEQ ID NO.147	0.30
SEQ ID NO.92	0.43	SEQ ID NO.120	0.60	SEQ ID NO.148	0.30
						SEQ ID NO.93	0.57	SEQ ID NO.121	0.73	SEQ ID NO.149	0.60
SEQ ID NO.94	0.57	SEQ ID NO.122	0.73	SEQ ID NO.150	0.60
						SEQ ID NO.95	0.67	SEQ ID NO.123	0.40	SEQ ID NO.151	0.27
SEQ ID NO.96	0.67	SEQ ID NO.124	0.40	SEQ ID NO.152	0.27
						SEQ ID NO.97	0.53	SEQ ID NO.125	0.37	SEQ ID NO.153	0.40
SEQ ID NO.98	0.53	SEQ ID NO.126	0.37	SEQ ID NO.154	0.40
						SEQ ID NO.99	0.47	SEQ ID NO.127	0.50	SEQ ID NO.155	0.67
SEQ ID NO.100	0.47	SEQ ID NO.128	0.50	SEQ ID NO.156	0.67
						SEQ ID NO.101	0.50	SEQ ID NO.129	0.47	SEQ ID NO.157	0.63
SEQ ID NO.102	0.50	SEQ ID NO.130	0.47	SEQ ID NO.158	0.63
						SEQ ID NO.103	0.53	SEQ ID NO.131	0.47	SEQ ID NO.159	0.33
SEQ ID NO.104	0.53	SEQ ID NO.132	0.47	SEQ ID NO.160	0.33
						SEQ ID NO.105	0.47	SEQ ID NO.133	0.57	ACTB upstream primer	0.48
SEQ ID NO.106	0.47	SEQ ID NO.134	0.57	ACTB downstream primer	0.48
						SEQ ID NO.107	0.47	SEQ ID NO.135	0.37	HBB upstream primer	0.37
SEQ ID NO.108	0.47	SEQ ID NO.136	0.37	HBB downstream primer	0.37
						SEQ ID NO.109	0.43	SEQ ID NO.137	0.40
SEQ ID NO.110	0.43	SEQ ID NO.138	0.40

The 5' end of SEQ ID NO.1 in Table 4 modifies NED fluorophore.

In the above DMD primer mixture 1 and 2, the following:

ACTB upstream primer sequence:

TGACCGTCTGCGCCTCGTTCCATGTACGTTGCTATCCAGGC，

ACTB downstream primer sequence:

TCGACGCACGCTCCTGCTACAGCTCATTGCCAATGGTGATGAC，

HBB upstream primer sequence:

TGACCGTCTGCGCCTCGTTCACACAACTGTGTTCACTAGC，

HBB downstream primer sequence:

TCGACGCACGCTCCTGCTACATGGTCTCCTTAAACCTGTCTTG。

the remaining primer sequences are shown in Table 1.

Example 2 PCR amplification and result analysis

1、Sample treatment: extracting human genome DNA for subsequent PCR reaction by a nucleic acid extractor (MagCore) and a nucleic acid extraction Kit (MagCore Genomic DNA Wholeblood Kit), wherein the DNA concentration is 2.5 ng/uL-60ng/uL, and OD₂₆₀nm/OD₂₈₀The ratio of nm is between 1.6 and 2.0.

2. Preparing an amplification reagent:

(1) taking out the DMD reaction solution, the DMD primer mixed solution 1 and the DMD primer mixed solution 2 from the kit, thawing at room temperature, reversing the mixture from top to bottom, mixing the mixture uniformly, and then centrifuging the mixture by using a microcentrifuge for a short time to settle all the liquid at the bottom of the tube.

(2) Preparing an amplification reagent: amplification reagents were prepared as set forth in Table 5 below

TABLE 5 amplification reagent preparation Table

Amplification reagent 1	Amplification reagent 2	Per reaction volume
			DMD reaction liquid	DMD reaction liquid	14.5μL
DMD primer mixture 1	DMD primer mixture 2	3μL
			DNA polymerase	DNA polymerase	0.5μL
Total volume	General ofProduct of large quantities	18μL

In order to reduce the separation error, it is recommended to prepare an amplification reagent by taking (n +1) parts of the reaction solution and the mixed enzyme, respectively, based on the number of samples (n). n is the number of samples to be tested +1 part of DMD blank +1 part of DMD female control.

(3) Add 18. mu.L of prepared amplification reagent into PCR reaction tube, transfer to sample processing area for sample loading.

3. Sample adding: adding 2 μ L of sample genome DNA to be detected, DMD female control and DMD blank control into corresponding PCR reaction tube containing 18 μ L of amplification reagent, respectively, and covering the PCR reaction tube for short time

And (5) performing temporary centrifugation.

4. PCR amplification and capillary electrophoresis analysis:

(1) placing the PCR reaction tube into a PCR instrument to set a reaction program (95 ℃/5 min; 95 ℃/30s,57 ℃/30s,72 ℃/1min,25 cycles; 72 ℃/30 min; 4 ℃/O/N), setting a reaction volume: 20 mu L of the solution;

(2) analyzing PCR amplification products by capillary electrophoresis: the detection was carried out by using ABI3130, ABI3730, ABI3500Dx, or ABI SeqStudio genetic Analyzer capillary Gene Analyzer, and 1. mu.L of amplified product 1, 1. mu.L of amplified product 2, and 10. mu.L of 1% GeneScan 500LIZ Size Standard (prepared by adding 10. mu.L of GeneScan 500LIZ Size Standard to 990. mu.LHi-Di Formamide, that is, 1% vol of GeneScan 500LIZ Size Standard) were denatured at 95 ℃ for 3 minutes, immediately placed on ice for 2 minutes, and then detected on a machine.

5. Software analysis:

after the reaction program is finished, the GeneMapper software is used for carrying out fragment Size Analysis on PCR amplification products, Analysis Method, Panel and Size Standard files required by Analysis can be downloaded from a website, and for specific information of data import, Analysis parameter setting and result Analysis, see GeneMapper user manual.

6. And (3) calculating a detection peak ratio: the detection peak ratio (R) of each site is obtained by dividing the detection peak areas of 79 exons and two reference genes of the DMD gene of the sample to be detected and the DMD female contrast by the total area of the reference genes and dividing the value corresponding to each site of the DMD female contrast by the sample to be detected.

7. And (4) interpretation of results:

(1) the detection peak ratio (R) of the internal reference gene falls between 1.80 and 2.40, and the copy number interpretation of the detection peak ratios of 79 exons of the DMD gene is carried out according to the following table

Copy number interpretation	Detection of the Peak ratio (R) Range
		0	R≤0.25
1	0.25≤R<1.45
		2	1.45≤R<2.53
3	2.53≤R<3.80

(2) If the detection peak ratio value falls outside the detection peak ratio value range, re-detection is needed, and the detection result is interpreted according to the table.

(3) Judging the type according to the following table, and if the SRY wave exists, judging the type according to a male sample; if there is no SRY wave, the type is judged according to the female sample.

(4) If rare gene mutation or gene polymorphism (polymorphism) of deletion or insertion occurs in the primer amplification region, detection peak ratio calculation can be incorporated for copy number interpretation, and further mutation or gene polymorphism information is confirmed by sequencing or other detection methods in combination with clinical symptoms.

Example 3 validation of reagent Performance

1. Assessing diagnostic accuracy of the reagents of the invention

And detecting 9 accurate reference substances, namely respectively detecting high, medium and low concentrations, wherein the sample concentrations are 60ng/uL, 25ng/uL and 15ng/uL, three-time repeated tests are carried out on each concentration, three batches of reagents are detected, and the copy number of the DMD gene exon meets the requirement.

TABLE 6 accuracy reference DMD Gene exon mutation types

2. Specific reference product coincidence rate

And detecting 4 parts of the deletion reference substances, wherein high, medium and low concentrations are respectively detected in the following table, the sample concentrations are respectively 60ng/uL, 25ng/uL and 15ng/uL, three repeated tests are carried out on each concentration, three batches of reagents are detected, and the specificity coincidence rate of the detection result is 100%.

TABLE 7 Special reference DMD Gene exon mutation types

3. Repeatability of

And 2 parts of repetitive reference substances are detected, ten times of repetitive detection is carried out on each concentration, three batches of reagents are detected, the copy number judgment is correct, and the detection results are all in line.

TABLE 8 repetitive references DMD Gene exon mutation types

4. Detection limit

And (3) detecting 13 detection limit reference substances, wherein the sample concentrations are respectively diluted to 20 ng/mu L and 15 ng/mu L as shown in the table below, each sample concentration is repeatedly tested for 20 times, three batches of reagents are detected, and the number of repeated detection results meets the requirement.

TABLE 9 detection-limiting reference DMD Gene exon mutation types

5. National reference detection

And detecting a set of 46 national reference products, wherein the detection result accords with the deletion and repeated mutation results in the detection range of the reagent, and the detection result accords with the type requirement of the national reference products as shown in the table 10.

Watch 10

Example 4

1. 150 samples of EDTA-anticoagulated whole blood were collected and prepared by MRC-Holland, Netherlands

Probemix P034 and

probemix P035 was used as a reference method to verify consistency between results.

2. Collecting EDTA anticoagulated whole blood sample by adopting nucleic acid extractor (Magcore) and nucleic acid extraction kit(MagCore Genomic DNA Wholeblood Kit) and detecting the concentration and purity of the DNA by using a micro-spectrophotometer, wherein the concentration of 150 samples is 15ng/uL-60ng/uL, and the OD is_260nm/OD_280nmThe ratio of (A) to (B) is between 1.6 and 2.0.

3. DNA was applied to the sample according to the procedure of example 2, and the reaction was carried out using a PCR apparatus,

4. the results of the analyses performed according to the procedure of example 2 were as follows, all of which meet the DMD exon copy number requirements, wherein 51 samples were tested in DMD patients, 22 samples were tested in DMD carriers, 77 samples were tested in DMD normal individuals, and 150 samples were tested (table 11).

Table 11150 sample test results

MLPA: multiplex ligation probe amplification method as a positive control group of the present disclosure.

From the results shown in Table 10 and FIGS. 1 to 4, the present invention can precisely determine the copy number of the DMD gene exon in a human individual, thereby identifying patients with Duchenne/Behcet muscular dystrophy, carriers of Duchenne/Behcet muscular dystrophy and normal individuals, and it should be understood that the foregoing description of the embodiments is given by way of example only and that various modifications can be made by those having ordinary skill in the art. The above specification, examples and experimental results provide a complete description of the structure and use of exemplary embodiments of the invention. Although various embodiments of the present invention have been disclosed in the foregoing detailed description, it should be understood that the invention is not limited to the specific embodiments disclosed, but is capable of numerous changes and modifications without departing from the spirit and scope of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> Shengya Biotechnology (Xiamen) Co., Ltd

<120> detection method for DMD gene exon copy number variation and application thereof

<130> 166

<160> 166

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> SEQ ID NO. 1

<400> 1

tcgacgcacg ctcctgcaca g 21

<210> 2

<211> 22

<212> DNA

<213> SEQ ID NO. 2

<400> 2

agcgagacgc taccatggct at 22

<210> 3

<211> 39

<212> DNA

<213> SEQ ID NO. 3

<400> 3

gacgcacgct cctgcacaga gaatcctggc atcagttac 39

<210> 4

<211> 44

<212> DNA

<213> SEQ ID NO. 4

<400> 4

cgagacgcta ccatggctat gaaaagtgta tatcaaggca gcga 44

<210> 5

<211> 42

<212> DNA

<213> SEQ ID NO. 5

<400> 5

tcgacgcacg ctcctgcaca gagatgaaag agaagatgtt ca 42

<210> 6

<211> 41

<212> DNA

<213> SEQ ID NO. 6

<400> 6

cgagacgcta ccatggctat cacaacttag atcttaaaag t 41

<210> 7

<211> 43

<212> DNA

<213> SEQ ID NO. 7

<400> 7

tcgacgcacg ctcctgcaca gaggatccac aagagttcat gcc 43

<210> 8

<211> 41

<212> DNA

<213> SEQ ID NO. 8

<400> 8

cgagacgcta ccatggctat agggtactac ttacattatt g 41

<210> 9

<211> 44

<212> DNA

<213> SEQ ID NO. 9

<400> 9

tcgacgcacg ctcctgcaca gtcatggctg gattgcaaca aacc 44

<210> 10

<211> 42

<212> DNA

<213> SEQ ID NO. 10

<400> 10

cgagacgcta ccatggctat cttacctatg actatggatg ag 42

<210> 11

<211> 43

<212> DNA

<213> SEQ ID NO. 11

<400> 11

tcgacgcacg ctcctgcaca gtgtagtgtt aatgtgctta cag 43

<210> 12

<211> 43

<212> DNA

<213> SEQ ID NO. 12

<400> 12

cgagacgcta ccatggctat acctgttgag aatagtgcat ttg 43

<210> 13

<211> 41

<212> DNA

<213> SEQ ID NO. 13

<400> 13

gacgcacgct cctgctacag gaagctcctg aagacaagtc a 41

<210> 14

<211> 41

<212> DNA

<213> SEQ ID NO. 14

<400> 14

cgagacgcta ccatggctat tgcttgcaat gtgtcctcag c 41

<210> 15

<211> 42

<212> DNA

<213> SEQ ID NO. 15

<400> 15

tcgacgcacg ctcctgcaca gtacttacat ccttctcaat gt 42

<210> 16

<211> 42

<212> DNA

<213> SEQ ID NO. 16

<400> 16

cgagacgcta ccatggctat gttgtacttg gcgttttagg tc 42

<210> 17

<211> 42

<212> DNA

<213> SEQ ID NO. 17

<400> 17

tcgacgcacg ctcctgcaca gtgtctcttc tccaggtatt gg 42

<210> 18

<211> 44

<212> DNA

<213> SEQ ID NO. 18

<400> 18

agcgagacgc taccatggct atctgttctt cagtaagacg ttgc 44

<210> 19

<211> 42

<212> DNA

<213> SEQ ID NO. 19

<400> 19

tcgacgcacg ctcctgcaca ggattactcg ctcagaagct gt 42

<210> 20

<211> 42

<212> DNA

<213> SEQ ID NO. 20

<400> 20

gagacgctac catggctatt agtcagtcac agaagaatcc ag 42

<210> 21

<211> 42

<212> DNA

<213> SEQ ID NO. 21

<400> 21

tcgacgcacg ctcctgcaca gcaagcctca gaacaactga ac 42

<210> 22

<211> 44

<212> DNA

<213> SEQ ID NO. 22

<400> 22

agcgagacgc taccatggct atagcagtag ttgtcatctg ctcc 44

<210> 23

<211> 40

<212> DNA

<213> SEQ ID NO. 23

<400> 23

acgcacgctc ctgcacaggc caccaatgcg ctatcaggag 40

<210> 24

<211> 41

<212> DNA

<213> SEQ ID NO. 24

<400> 24

gagacgctac catggctatt gtgaatgctt gataagcgtg c 41

<210> 25

<211> 42

<212> DNA

<213> SEQ ID NO. 25

<400> 25

tcgacgcacg ctcctgcaca gtctcgtttc agaatcacat ac 42

<210> 26

<211> 41

<212> DNA

<213> SEQ ID NO. 26

<400> 26

gagacgctac catggctatc tgaatcccca agggcaggcc a 41

<210> 27

<211> 37

<212> DNA

<213> SEQ ID NO. 27

<400> 27

cgcacgctcc tgcacaggat ctatcagaga tgcacga 37

<210> 28

<211> 42

<212> DNA

<213> SEQ ID NO. 28

<400> 28

agacgctacc atggctatct gctttctgta attcatctgg ag 42

<210> 29

<211> 39

<212> DNA

<213> SEQ ID NO. 29

<400> 29

acgcacgctc ctgcacagca tgttggcatg agttattgt 39

<210> 30

<211> 40

<212> DNA

<213> SEQ ID NO. 30

<400> 30

agacgctacc atggctatca gtgctgagtg ataacatagt 40

<210> 31

<211> 40

<212> DNA

<213> SEQ ID NO. 31

<400> 31

tcgacgcacg ctcctgcaca gtgttcagca ggattacaga 40

<210> 32

<211> 43

<212> DNA

<213> SEQ ID NO. 32

<400> 32

agcgagacgc taccatggct atctgaggca tttgagctgc gtc 43

<210> 33

<211> 42

<212> DNA

<213> SEQ ID NO. 33

<400> 33

tcgacgcacg ctcctgcaca gtacaagatg tctccatgaa gt 42

<210> 34

<211> 39

<212> DNA

<213> SEQ ID NO. 34

<400> 34

agacgctacc atggctattc caatgcaggc aagtgcatc 39

<210> 35

<211> 43

<212> DNA

<213> SEQ ID NO. 35

<400> 35

tcgacgcacg ctcctgcaca gcgatgtcat ctgccctaga cag 43

<210> 36

<211> 39

<212> DNA

<213> SEQ ID NO. 36

<400> 36

agacgctacc atggctattc catatctgta gctgccagc 39

<210> 37

<211> 39

<212> DNA

<213> SEQ ID NO. 37

<400> 37

acgcacgctc ctgcacagat accagaaaca catggaaac 39

<210> 38

<211> 39

<212> DNA

<213> SEQ ID NO. 38

<400> 38

agacgctacc atggctattg ctaccttaag cacgtcttc 39

<210> 39

<211> 44

<212> DNA

<213> SEQ ID NO. 39

<400> 39

gacgcacgct cctgcacagt gattagttta gcaacaggag gttg 44

<210> 40

<211> 43

<212> DNA

<213> SEQ ID NO. 40

<400> 40

cgagacgcta ccatggctat accatatctt tattgaagtc ttc 43

<210> 41

<211> 43

<212> DNA

<213> SEQ ID NO. 41

<400> 41

tcgacgcacg ctcctgcaca gcttagcttc ctatacatgg gtc 43

<210> 42

<211> 41

<212> DNA

<213> SEQ ID NO. 42

<400> 42

gagacgctac catggctatc aatgtcatcc aagcatttca g 41

<210> 43

<211> 42

<212> DNA

<213> SEQ ID NO. 43

<400> 43

tcgacgcacg ctcctgcaca gcgtgaagaa acgatgatgg tg 42

<210> 44

<211> 41

<212> DNA

<213> SEQ ID NO. 44

<400> 44

agacgctacc atggctatgt gaaagtcaaa atgccatcat g 41

<210> 45

<211> 40

<212> DNA

<213> SEQ ID NO. 45

<400> 45

gacgcacgct cctgcacagc tgcaggcgat ttgacagatc 40

<210> 46

<211> 41

<212> DNA

<213> SEQ ID NO. 46

<400> 46

gagacgctac catggctatt cttcagcaca tctggactct t 41

<210> 47

<211> 42

<212> DNA

<213> SEQ ID NO. 47

<400> 47

tcgacgcacg ctcctgcaca gctttctcca ggctagaaga ac 42

<210> 48

<211> 39

<212> DNA

<213> SEQ ID NO. 48

<400> 48

agacgctacc atggctatat taccttgact tgctcaagc 39

<210> 49

<211> 44

<212> DNA

<213> SEQ ID NO. 49

<400> 49

cgacgcacgc tcctgcacag caggtttcca gagctttacc tgag 44

<210> 50

<211> 41

<212> DNA

<213> SEQ ID NO. 50

<400> 50

gagacgctac catggctatt aggcacaggg accactgcaa t 41

<210> 51

<211> 40

<212> DNA

<213> SEQ ID NO. 51

<400> 51

gacgcacgct cctgcacaga tctgagctct gagtggaagg 40

<210> 52

<211> 41

<212> DNA

<213> SEQ ID NO. 52

<400> 52

gagacgctac catggctatt agctagagcc aaagagaatg g 41

<210> 53

<211> 44

<212> DNA

<213> SEQ ID NO. 53

<400> 53

tcgacgcacg ctcctgcaca gtccgaggta ctccggaatg tctc 44

<210> 54

<211> 44

<212> DNA

<213> SEQ ID NO. 54

<400> 54

agcgagacgc taccatggct atcttcgatc cgtaatgatt gttc 44

<210> 55

<211> 42

<212> DNA

<213> SEQ ID NO. 55

<400> 55

tcgacgcacg ctcctgcaca gatgaagtac aagaacacct tc 42

<210> 56

<211> 39

<212> DNA

<213> SEQ ID NO. 56

<400> 56

agacgctacc atggctattt gcatctactg tatagggac 39

<210> 57

<211> 39

<212> DNA

<213> SEQ ID NO. 57

<400> 57

gcacgctcct gcacagccag tggcagacaa atgtagatg 39

<210> 58

<211> 40

<212> DNA

<213> SEQ ID NO. 58

<400> 58

gagacgctac catggctatg cattgatatt ctctgttatc 40

<210> 59

<211> 42

<212> DNA

<213> SEQ ID NO. 59

<400> 59

cgacgcacgc tcctgcacag gatgtttatc acaacctgga tg 42

<210> 60

<211> 39

<212> DNA

<213> SEQ ID NO. 60

<400> 60

gagacgctac catggctatt atccaaacgt ctttgtaac 39

<210> 61

<211> 41

<212> DNA

<213> SEQ ID NO. 61

<400> 61

gacgcacgct cctgcacagc gctttcctca ttaacagata g 41

<210> 62

<211> 40

<212> DNA

<213> SEQ ID NO. 62

<400> 62

agacgctacc atggctatgg atgggctgct ccgtcaccac 40

<210> 63

<211> 40

<212> DNA

<213> SEQ ID NO. 63

<400> 63

gacgcacgct cctgcacagc agtaggttac cctcttgttc 40

<210> 64

<211> 39

<212> DNA

<213> SEQ ID NO. 64

<400> 64

agacgctacc atggctatgg ctgccaggat cccttgatc 39

<210> 65

<211> 44

<212> DNA

<213> SEQ ID NO. 65

<400> 65

tcgacgcacg ctcctgcaca gccgtagcat agagcaaaca ttac 44

<210> 66

<211> 45

<212> DNA

<213> SEQ ID NO. 66

<400> 66

agacgctacc atggctatcc tatcctcaca aatattacca tgaac 45

<210> 67

<211> 44

<212> DNA

<213> SEQ ID NO. 67

<400> 67

acgcacgctc ctgcacagct ataccacttt agtcttcaca gaac 44

<210> 68

<211> 41

<212> DNA

<213> SEQ ID NO. 68

<400> 68

cgagacgcta ccatggctat acagcaaagg gccttctgca g 41

<210> 69

<211> 47

<212> DNA

<213> SEQ ID NO. 69

<400> 69

tcgacgcacg ctcctgcaca gtcacacatc attgagcact ttactcc 47

<210> 70

<211> 40

<212> DNA

<213> SEQ ID NO. 70

<400> 70

gagacgctac catggctatt tacatctgta cttgtcttcc 40

<210> 71

<211> 40

<212> DNA

<213> SEQ ID NO. 71

<400> 71

cgacgcacgc tcctgcacag tgatatacac ctcctttgcc 40

<210> 72

<211> 43

<212> DNA

<213> SEQ ID NO. 72

<400> 72

agcgagacgc taccatggct attcctaata cctgaatcca atg 43

<210> 73

<211> 44

<212> DNA

<213> SEQ ID NO. 73

<400> 73

tcgacgcacg ctcctgcaca gcaaattaga acgtggtaga aggt 44

<210> 74

<211> 41

<212> DNA

<213> SEQ ID NO. 74

<400> 74

gagacgctac catggctatc tgcagtattg tacaaaactg a 41

<210> 75

<211> 43

<212> DNA

<213> SEQ ID NO. 75

<400> 75

tcgacgcacg ctcctgcaca gtagactaca tcaggagaag atg 43

<210> 76

<211> 40

<212> DNA

<213> SEQ ID NO. 76

<400> 76

gagacgctac catggctatg tgttctgctt ttgctactac 40

<210> 77

<211> 41

<212> DNA

<213> SEQ ID NO. 77

<400> 77

gacgcacgct cctgcacaga atggcgcagg tgtaaactat t 41

<210> 78

<211> 42

<212> DNA

<213> SEQ ID NO. 78

<400> 78

agacgctacc atggctattg cgtgaatgag tatcatcgtg tg 42

<210> 79

<211> 40

<212> DNA

<213> SEQ ID NO. 79

<400> 79

gacgcacgct cctgcacagt ccagcattac tgccaaagtt 40

<210> 80

<211> 42

<212> DNA

<213> SEQ ID NO. 80

<400> 80

cgagacgcta ccatggctat gtcattggta tgcagagtgc at 42

<210> 81

<211> 44

<212> DNA

<213> SEQ ID NO. 81

<400> 81

tcgacgcacg ctcctgcaca gtaatgtaat gatgtatagt ctca 44

<210> 82

<211> 38

<212> DNA

<213> SEQ ID NO. 82

<400> 82

acgctaccat ggctatcgga gcagcatagg ctgactgc 38

<210> 83

<211> 46

<212> DNA

<213> SEQ ID NO. 83

<400> 83

cgacgcacgc tcctgcacag tgacgtcttc tggatcatgt tatctg 46

<210> 84

<211> 40

<212> DNA

<213> SEQ ID NO. 84

<400> 84

agacgctacc atggctattc tcactaacct ctctcattgg 40

<210> 85

<211> 42

<212> DNA

<213> SEQ ID NO. 85

<400> 85

gacgcacgct cctgcacagt cttcggcaga ttaattatgc ac 42

<210> 86

<211> 44

<212> DNA

<213> SEQ ID NO. 86

<400> 86

agcgagacgc taccatggct atctgtcagg ccttcgagga ggtc 44

<210> 87

<211> 41

<212> DNA

<213> SEQ ID NO. 87

<400> 87

acgcacgctc ctgcacagca actaggcatt tggtctctta c 41

<210> 88

<211> 40

<212> DNA

<213> SEQ ID NO. 88

<400> 88

gagacgctac catggctatt catcaggatt cttacctgcc 40

<210> 89

<211> 45

<212> DNA

<213> SEQ ID NO. 89

<400> 89

tcgacgcacg ctcctgcaca ggcatggaag taaatctcat ggaac 45

<210> 90

<211> 39

<212> DNA

<213> SEQ ID NO. 90

<400> 90

agacgctacc atggctatat gttccagtcg ttgtgtggc 39

<210> 91

<211> 42

<212> DNA

<213> SEQ ID NO. 91

<400> 91

tcgacgcacg ctcctgcaca gctaccatgt tggaaagtag tc 42

<210> 92

<211> 40

<212> DNA

<213> SEQ ID NO. 92

<400> 92

agacgctacc atggctattc cgtgtagggt cagaggtggt 40

<210> 93

<211> 41

<212> DNA

<213> SEQ ID NO. 93

<400> 93

cgacgcacgc tcctgcacag accgatttac ctagagttct a 41

<210> 94

<211> 39

<212> DNA

<213> SEQ ID NO. 94

<400> 94

agacgctacc atggctatca gcttacttcc caattgtag 39

<210> 95

<211> 43

<212> DNA

<213> SEQ ID NO. 95

<400> 95

tcgacgcacg ctcctgcaca ggtgcttcaa gaagatctag aac 43

<210> 96

<211> 38

<212> DNA

<213> SEQ ID NO. 96

<400> 96

agacgctacc atggctatgt atcagaatta tggaattc 38

<210> 97

<211> 41

<212> DNA

<213> SEQ ID NO. 97

<400> 97

acgcacgctc ctgcacagtg tgtcatgtgt gagaaactag c 41

<210> 98

<211> 41

<212> DNA

<213> SEQ ID NO. 98

<400> 98

agacgctacc atggctatgt tgtgtgaatc ttgttcactg c 41

<210> 99

<211> 41

<212> DNA

<213> SEQ ID NO. 99

<400> 99

acgcacgctc ctgcacagag attgaactat agtggtgtat g 41

<210> 100

<211> 41

<212> DNA

<213> SEQ ID NO. 100

<400> 100

acgctaccat ggctattaac ctgtgctgta ctcttttcaa g 41

<210> 101

<211> 39

<212> DNA

<213> SEQ ID NO. 101

<400> 101

gacgcacgct cctgcacagt gatctgaagg tcaatctac 39

<210> 102

<211> 41

<212> DNA

<213> SEQ ID NO. 102

<400> 102

agacgctacc atggctatca gtaatctgcc tcttcttttg g 41

<210> 103

<211> 42

<212> DNA

<213> SEQ ID NO. 103

<400> 103

tcgacgcacg ctcctgcaca gagattcacg tgataagctg ac 42

<210> 104

<211> 44

<212> DNA

<213> SEQ ID NO. 104

<400> 104

agcgagacgc taccatggct atccattcac catctgttcc acca 44

<210> 105

<211> 40

<212> DNA

<213> SEQ ID NO. 105

<400> 105

gacgcacgct cctgcacagg ctggtgatag aggcttgtct 40

<210> 106

<211> 41

<212> DNA

<213> SEQ ID NO. 106

<400> 106

agacgctacc atggctatac aaagtctgca tccaggaaca t 41

<210> 107

<211> 39

<212> DNA

<213> SEQ ID NO. 107

<400> 107

acgcacgctc ctgcacagtc tctgcaagag caacaaagt 39

<210> 108

<211> 42

<212> DNA

<213> SEQ ID NO. 108

<400> 108

cgagacgcta ccatggctat ctaacgatac actgtaaact gt 42

<210> 109

<211> 42

<212> DNA

<213> SEQ ID NO. 109

<400> 109

tcgacgcacg ctcctgcaca gagaagataa agaatgaagc ag 42

<210> 110

<211> 42

<212> DNA

<213> SEQ ID NO. 110

<400> 110

agacgctacc atggctatat taggaaatct tagttaagta cg 42

<210> 111

<211> 39

<212> DNA

<213> SEQ ID NO. 111

<400> 111

acgcacgctc ctgcacagca tgctattaag agagcattc 39

<210> 112

<211> 40

<212> DNA

<213> SEQ ID NO. 112

<400> 112

agacgctacc atggctatca ctggtagttg gtggttagag 40

<210> 113

<211> 40

<212> DNA

<213> SEQ ID NO. 113

<400> 113

gacgcacgct cctgcacaga tgagctaatc aatgaggaac 40

<210> 114

<211> 40

<212> DNA

<213> SEQ ID NO. 114

<400> 114

agacgctacc atggctatga gaggcctgta tctgctatac 40

<210> 115

<211> 42

<212> DNA

<213> SEQ ID NO. 115

<400> 115

cgacgcacgc tcctgcacag aggtgatcca cctgcctcga cc 42

<210> 116

<211> 43

<212> DNA

<213> SEQ ID NO. 116

<400> 116

cgagacgcta ccatggctat catatacctg tgcaacatca atc 43

<210> 117

<211> 42

<212> DNA

<213> SEQ ID NO. 117

<400> 117

tcgacgcacg ctcctgcaca gtaactctac tgattatcat gt 42

<210> 118

<211> 42

<212> DNA

<213> SEQ ID NO. 118

<400> 118

agacgctacc atggctatgt ctcagcatgc acacaccttt gc 42

<210> 119

<211> 40

<212> DNA

<213> SEQ ID NO. 119

<400> 119

acgcacgctc ctgcacagta cttgaaggtc aatgctctcc 40

<210> 120

<211> 41

<212> DNA

<213> SEQ ID NO. 120

<400> 120

agacgctacc atggctatag tttatcttcc accaacgtct c 41

<210> 121

<211> 43

<212> DNA

<213> SEQ ID NO. 121

<400> 121

tcgacgcacg ctcctgcaca gtcgctcact tgctcactcg ctc 43

<210> 122

<211> 37

<212> DNA

<213> SEQ ID NO. 122

<400> 122

agacgctacc atggctattc gatggttgag ctctgag 37

<210> 123

<211> 42

<212> DNA

<213> SEQ ID NO. 123

<400> 123

gacgcacgct cctgcacaga gaaaggctat gagcacagta tc 42

<210> 124

<211> 41

<212> DNA

<213> SEQ ID NO. 124

<400> 124

gagacgctac catggctatg ttttgtctgt aacagctgct g 41

<210> 125

<211> 39

<212> DNA

<213> SEQ ID NO. 125

<400> 125

acgcacgctc ctgcacagta ttgagcgagg atgacagtc 39

<210> 126

<211> 40

<212> DNA

<213> SEQ ID NO. 126

<400> 126

agacgctacc atggctatag ttgagtcttc gaaactgagc 40

<210> 127

<211> 42

<212> DNA

<213> SEQ ID NO. 127

<400> 127

tcgacgcacg ctcctgcaca ggatagtcta caacaaagct ca 42

<210> 128

<211> 41

<212> DNA

<213> SEQ ID NO. 128

<400> 128

cgagacgcta ccatggctat gagagcttcc tgtagcttca c 41

<210> 129

<211> 43

<212> DNA

<213> SEQ ID NO. 129

<400> 129

tcgacgcacg ctcctgcaca gcaggaactc caggatggca ttg 43

<210> 130

<211> 39

<212> DNA

<213> SEQ ID NO. 130

<400> 130

agacgctacc atggctatct gtctgacagc tgtttgcag 39

<210> 131

<211> 39

<212> DNA

<213> SEQ ID NO. 131

<400> 131

acgcacgctc ctgcacagca gtcaatcagc tctgtgctc 39

<210> 132

<211> 41

<212> DNA

<213> SEQ ID NO. 132

<400> 132

agacgctacc atggctatac tggagatttg tctgcttgag c 41

<210> 133

<211> 46

<212> DNA

<213> SEQ ID NO. 133

<400> 133

tcgacgcacg ctcctgcaca ggatctgcaa tacatgtgga gtctcc 46

<210> 134

<211> 42

<212> DNA

<213> SEQ ID NO. 134

<400> 134

agacgctacc atggctatca tccggttgtt tagcttgaac tg 42

<210> 135

<211> 39

<212> DNA

<213> SEQ ID NO. 135

<400> 135

acgcacgctc ctgcacagag actgttactc tggtgacac 39

<210> 136

<211> 38

<212> DNA

<213> SEQ ID NO. 136

<400> 136

agacgctacc atggctattg aaatctgcca gagcaggt 38

<210> 137

<211> 43

<212> DNA

<213> SEQ ID NO. 137

<400> 137

tcgacgcacg ctcctgcaca gccaatgtcc tacaggatgc tac 43

<210> 138

<211> 39

<212> DNA

<213> SEQ ID NO. 138

<400> 138

agacgctacc atggctattg tccctggctt gtcagttac 39

<210> 139

<211> 42

<212> DNA

<213> SEQ ID NO. 139

<400> 139

tcgacgcacg ctcctgcaca gaacatatgg ctaaacactg cc 42

<210> 140

<211> 43

<212> DNA

<213> SEQ ID NO. 140

<400> 140

cgagacgcta ccatggctat gtcctaccct atgtacatcg ttc 43

<210> 141

<211> 43

<212> DNA

<213> SEQ ID NO. 141

<400> 141

tcgacgcacg ctcctgcaca gtactaattg aagcagtagt tca 43

<210> 142

<211> 40

<212> DNA

<213> SEQ ID NO. 142

<400> 142

agacgctacc atggctatgc agctgcctga ctcggtcctc 40

<210> 143

<211> 42

<212> DNA

<213> SEQ ID NO. 143

<400> 143

acgcacgctc ctgcacagcc tgtttgcgat gaatttgacc tc 42

<210> 144

<211> 38

<212> DNA

<213> SEQ ID NO. 144

<400> 144

gagacgctac catggctatt tacttgatat agtagggc 38

<210> 145

<211> 43

<212> DNA

<213> SEQ ID NO. 145

<400> 145

cgcacgctcc tgcacagatc ataactgaag tgcgatcgat ttg 43

<210> 146

<211> 41

<212> DNA

<213> SEQ ID NO. 146

<400> 146

agacgctacc atggctatct aaagactggt agagctctgt c 41

<210> 147

<211> 42

<212> DNA

<213> SEQ ID NO. 147

<400> 147

tcgacgcacg ctcctgcaca gttcagatcc tgaatactga tc 42

<210> 148

<211> 45

<212> DNA

<213> SEQ ID NO. 148

<400> 148

cgagacgcta ccatggctat agccagttca gacacatatc cacgc 45

<210> 149

<211> 42

<212> DNA

<213> SEQ ID NO. 149

<400> 149

tcgacgcacg ctcctgcaca gcaagcaagt ggcaagttca ac 42

<210> 150

<211> 41

<212> DNA

<213> SEQ ID NO. 150

<400> 150

cgagacgcta ccatggctat acctactgcc tactgaagag c 41

<210> 151

<211> 43

<212> DNA

<213> SEQ ID NO. 151

<400> 151

tcgacgcacg ctcctgcaca gagtagtaat gattctcaag atc 43

<210> 152

<211> 39

<212> DNA

<213> SEQ ID NO. 152

<400> 152

agacgctacc atggctatcc agaagttgat cagagtaac 39

<210> 153

<211> 42

<212> DNA

<213> SEQ ID NO. 153

<400> 153

cgcacgctcc tgcacagtga tagcatctct cctaatgaga gc 42

<210> 154

<211> 44

<212> DNA

<213> SEQ ID NO. 154

<400> 154

agacgctacc atggctatgc tataccaaga tcacgtttcc actc 44

<210> 155

<211> 43

<212> DNA

<213> SEQ ID NO. 155

<400> 155

tcgacgcacg ctcctgcaca ggagctcatt gctgaggcca agc 43

<210> 156

<211> 41

<212> DNA

<213> SEQ ID NO. 156

<400> 156

agacgctacc atggctatgt ggtcttccag gatttgcatc c 41

<210> 157

<211> 43

<212> DNA

<213> SEQ ID NO. 157

<400> 157

tcgacgcacg ctcctgcaca gttgcagtga gccaagatcg tgc 43

<210> 158

<211> 40

<212> DNA

<213> SEQ ID NO. 158

<400> 158

agacgctacc atggctatgg actgagaaga tcttcctcac 40

<210> 159

<211> 44

<212> DNA

<213> SEQ ID NO. 159

<400> 159

tcgacgcacg ctcctgcaca ggaaggtatt ctgaccttgt gaac 44

<210> 160

<211> 42

<212> DNA

<213> SEQ ID NO. 160

<400> 160

gagacgctac catggctatc agaagcccat gaactgtgtt tc 42

<210> 161

<211> 21

<212> DNA

<213> SEQ ID NO. 161

<400> 161

gaatattccc gctctccgga g 21

<210> 162

<211> 22

<212> DNA

<213> SEQ ID NO. 162

<400> 162

gctggtgctc cattcttgag tg 22

<210> 163

<211> 41

<212> DNA

<213> ACTB upstream primer sequences

<400> 163

tgaccgtctg cgcctcgttc catgtacgtt gctatccagg c 41

<210> 164

<211> 43

<212> DNA

<213> ACTB downstream primer sequences

<400> 164

tcgacgcacg ctcctgctac agctcattgc caatggtgat gac 43

<210> 165

<211> 40

<212> DNA

<213> HBB upstream primer sequence

<400> 165

tgaccgtctg cgcctcgttc acacaactgt gttcactagc 40

<210> 166

<211> 43

<212> DNA

<213> HBB downstream primer sequence

<400> 166

tcgacgcacg ctcctgctac atggtctcct taaacctgtc ttg 43

Claims (10)

1. A PCR amplification reaction detection method for DMD gene exon copy number is characterized in that: performing PCR amplification reaction, and simultaneously amplifying 79 exons, reference genes and SRY genes of the DMD gene; wherein the primers for amplifying 79 exons and reference genes of the DMD gene at least comprise two different primers; the first primer is bonded with 79 exons of the DMD gene and the upstream region of an internal reference gene, and the 5' end of the first primer contains a primer SEQ ID number 1 containing all or part of a non-human genome sequence; the second primer is bonded with 79 exons of the DMD gene and the downstream region of the reference gene, and the 5' end of the second primer contains all or part of non-human genome sequence primer SEQ ID number 2; wherein the primers used to amplify the SRY gene comprise at least two different primers, a first primer binding to the upstream region of the SRY gene and a second primer binding to the downstream region of the SRY gene.

2. The detection method according to claim 1, characterized in that: the reference gene is selected from one or more of GAPDH, ACTB, HBB, CFTR, HPRT, RPP30 or RPP 40.

3. The detection method according to claim 1, characterized in that: the primer for amplifying 79 exons of the DMD gene comprises a sequence shown as SEQ ID number 3-160; the primer for amplifying the SRY gene comprises a sequence shown as SEQ ID number 161/162.

4. The detection method according to claim 1, characterized in that: in the PCR amplification reaction, the primer at least comprises more than one fluorescent group; the fluorescent group is selected from any one of FAM, VIC, HEX, JOE, TMR, NED, PET and ROX.

5. A DMD gene copy number detection kit is characterized in that: the detection kit comprises the following components: DMD reaction liquid, DMD primer mixed liquid, DNA polymerase, DMD female control, DMD male control and DMD blank control; the DMD primer mixture comprises the primer for amplifying 79 exons and reference genes of the DMD gene and the primer for amplifying the SRY gene, which are disclosed in claim 1.

6. The detection kit according to claim 5, characterized in that: the DMD primer mixed solution comprises primers SEQ ID number 1/2, SEQ ID number 3-160, SEQ ID NO.161/162, ACTB upstream/downstream primer and HBB upstream/downstream primer.

7. The detection kit according to claim 5, characterized in that: the DMD primer mixed solution comprises:

DMD primer mixture 1: comprises detection primers SEQ ID number 1-84, SEQ ID NO.161/162, ACTB upstream/downstream primer and HBB upstream/downstream primer;

DMD primer mixture 2: comprises detection primers SEQ ID number 1/2, SEQ ID number 85-160, ACTB upstream/downstream primer and HBB upstream/downstream primer.

8. The detection kit according to claim 5, characterized in that: the DMD reaction liquid comprises: 10 Taq Buffer at a final concentration of 1.5X; 25mM MgCl at a final concentration of 0.5mM₂(ii) a dATP/dTTP/dGTP/dCTP at a final concentration of 0.5 mM; enhancer at a final concentration of 2.0M; the enhancer comprises one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.

9. The method of using the detection kit according to claim 5 for detecting the DMD gene exon copy number variation, comprising the steps of:

(1) processing a sample;

(2) preparing an amplification reagent;

(3) PCR amplification and analysis by a capillary electrophoresis apparatus; carrying out PCR amplification reaction on a DNA sample to be detected to generate a PCR product, and analyzing the size and abundance of the fragment by using a capillary electrophoresis apparatus;

(4) and (3) calculating a detection peak ratio: after the reaction program is finished, carrying out fragment size analysis on the PCR amplification product; dividing the detection peak area of 79 exons and two reference genes of the DMD gene of the sample to be detected and the DMD female control by the total area of the reference genes respectively, and dividing the value corresponding to each point of the DMD female control by the sample to be detected to obtain the detection peak ratio of each point;

(6) and (4) interpretation of results:

(a) the detection peak ratio R of the reference gene falls between 1.80 and 2.38;

detection peak ratio of 79 exons of DMD gene: detecting a peak ratio R <0.25 and copy number 0; the detection peak ratio is more than or equal to 0.25, R is less than 1.45, and the copy number is 1; detecting the peak ratio of 1.45-2.53, wherein R is less than or equal to 2.53, and the copy number is 2; detecting the peak ratio of 2.53-3.80, and copy number of 3;

(b) judging the detection type:

if SRY wave, judging the type according to the male sample: DMD exon gene copy number is 0, and a male sample is of a hemizygous deletion type; the copy number of the DMD exogene is 1, and a male sample is a normal type; DMD exon gene copy number is 2, and the male sample is a half-synthetic duplication type;

if there is no SRY wave, judging the type according to the female sample: DMD exon gene copy number is 1, and female samples are heterozygous deletion type; DMD exon gene copy number is 2, and the female sample is normal; DMD exon gene copy number 3, female samples were heterozygous replicates.

10. Use of the assay kit according to claim 5 for the detection of DMD gene.

Images