CN113652474B - Detection method for copy number variation of exon of DMD gene and application thereof - Google Patents

Detection method for copy number variation of exon of DMD gene and application thereof Download PDF

Info

Publication number
CN113652474B
CN113652474B CN202110987966.9A CN202110987966A CN113652474B CN 113652474 B CN113652474 B CN 113652474B CN 202110987966 A CN202110987966 A CN 202110987966A CN 113652474 B CN113652474 B CN 113652474B
Authority
CN
China
Prior art keywords
seq
dmd
gene
primer
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110987966.9A
Other languages
Chinese (zh)
Other versions
CN113652474A (en
Inventor
郭亦亦
邱一帆
钟丽霞
李淑如
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shengya Biotechnology Xiamen Co ltd
Original Assignee
Shengya Biotechnology Xiamen Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shengya Biotechnology Xiamen Co ltd filed Critical Shengya Biotechnology Xiamen Co ltd
Priority to CN202110987966.9A priority Critical patent/CN113652474B/en
Publication of CN113652474A publication Critical patent/CN113652474A/en
Application granted granted Critical
Publication of CN113652474B publication Critical patent/CN113652474B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a detection method of copy number variation of a DMD gene exon and application thereof; belongs to the technical field of molecular biology. The 79 exons of the DMD gene are amplified in the PCR reaction liquid, meanwhile, one or more than two groups of reference genes are used for monitoring the PCR reaction efficiency, the PCR products are analyzed through capillary electrophoresis, the DMD female control with the DMD gene of 2 copies is used for calculation, the relative quantitative detection is carried out on the copy numbers of the 79 exons of the DMD gene, the DMD genes with the copy numbers of 0, 1, 2 and 3 copies are calculated, the normal copy numbers, the deletion mutation and the repetition mutation of the exons of the DMD gene are distinguished, and small deletion and mutation can be prompted. The result can be obtained within 4 hours from the DNA sample, the copy number of the exon of the DMD gene can be detected by only one PCR experiment, the detection technical flow is simple, and the standardization is easy to realize.

Description

Detection method for copy number variation of exon of DMD gene and application thereof
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a detection method for copy number variation of a DMD gene exon and application thereof.
Background
Progressive muscular dystrophy (Progressive muscular dystrophy) is a group of heterogeneous gene-deficient diseases that are characterized by progressive atrophy of skeletal muscle as the primary clinical manifestation. Can be accompanied by involvement of the central nervous system, heart, bones, respiration, and gastrointestinal tract. The time, rate of progression, extent of involvement, and severity vary widely from type to type. Dunaliella muscular dystrophy (Duchenne muscular dystrophy, DMD), the most common progressive muscular dystrophy, with a neonatal male infant incidence of 1/3500; the incidence of Betty muscular dystrophy (Becker muscular dystrophy, BMD) is 1/30000 for neonatal men.
The pathogenic gene of DMD/BMD is DMD gene, which is located in Xp21.2, and the coded protein is called Dystrophin (Dystrophin) and distributed on the cell membrane of skeletal muscle and cardiac muscle, and acts as a scaffold to protect muscle cell membrane from injury during muscle contraction. Due to the defect of DMD gene, the dystrophin on muscle cell membrane has abnormal function, the muscle cells are damaged, progressive necrosis, atrophy and the like, and symptoms and signs of muscle weakness are clinically shown. Duchenne Muscular Dystrophy (DMD) usually develops in the age of 2 to 5 years, manifests as mild retardation of motor development, progressive atrophy of skeletal muscles, affecting limb motor function, progressive gait abnormalities, limited upper limb movement, and a natural course of disease usually loses walking ability around 10 years. After that, scoliosis, joint contracture, respiratory muscle weakness and dilated cardiomyopathy appear, and the patient dies about 20 years old due to respiratory failure and cardiac failure. The physical examination can show that the double gastrocnemius muscle is pseudohypertrophic, and the double forearm and the lingual muscle are pseudohypertrophic, the Gower's sign is positive, the lumbar vertebra is anterior, and about 1/3 of the children suffering from mental retardation. The behcet muscular dystrophy (Becker muscular dystrophy, BMD) has late onset, mild symptoms and slow progress, and usually lives in a wheelchair after 16 years of age, with a lifetime of 40-50 years. The disease is obviously lighter than Du's muscular dystrophy because the function of DMD gene is not completely lost. Can be used for young and even adult, and part of patients do not influence the survival period. The pseudohypertrophic sign is obvious, and when the limb weakness of part of patients is still light, obvious dilated cardiomyopathy appears first.
The DMD gene is one of the largest genes of human beings, is located at Xp21 and spans 2.5Mb on the genome, and comprises 79 exons, 78 introns and 8 promoters, and the mRNA sequence is 1.4Kb in full length and is mainly expressed in skeletal muscle and cardiac muscle and is expressed in brain tissue in a small amount. DMD gene mutations are diverse in form, with about 60-70% of DMD/BMD patients being pathogenic due to deletion mutations of one or more exons of the DMD gene, about 5-10% being repeat mutations, the remainder being minor mutations (including substitution of bases, small deletions or insertions, intronic mutations, chromosomal rearrangements, etc.). Unlike deletion or repeat mutations, the minor mutations have no distinct distribution hot spots and are randomly distributed throughout the gene. Among the pathogenic variations of the DMD gene, the deletion or repeat mutation of the copy number variation, 80%, is the major mutation type of DMD/BMD.
The most internationally accepted product of DMD/BMD is the MRC-Holland company multiplex ligation probe amplification (Multiple Ligation-dependent ProbeAmplification, MLPA) detection technology. The method can rapidly and simultaneously identify deletion, insertion and copy number of tens of genes, is widely applied to 900 laboratories worldwide, and has thousands of papers published by using the technology. Detecting the fragment lengths of 79 exons of the DMD gene and the reference gene in a DMD gene detection probe set containing P034 and P035, distinguishing the fragment lengths of different sizes by capillary analysis, calculating the abundance ratio of the PCR product of the exons of the DMD represented by the amplified product fragment and the PCR product of the reference gene, judging whether each exon of the DMD gene is deleted or duplicated, and carrying out semi-quantitative analysis on the copy number of the exons of the DMD gene. However, the detection method is complicated, 79 exons need to be hybridized with target sequence DNA in two tubes, connected and amplified by PCR, and then two-hole capillary analysis is carried out, so that the result can be obtained in two days.
In view of the above, there is a need for an improved method for detecting 79 exon copy number variations of DMD gene in a human subject in an accurate, specific and faster manner, and for confirming deletion and repeated mutation of large fragments, thereby determining whether the human subject is a duchenne/bellevil patient, carrier or normal.
Disclosure of Invention
The invention aims to provide a detection method for copy number variation of the exon of the DMD gene and application thereof aiming at the problems.
In order to achieve the aim of the invention, the invention adopts the following technical scheme:
a PCR amplification reaction detection method for the copy number of the exon of the DMD gene comprises the following steps: performing PCR amplification reaction, and amplifying 79 exons of the DMD gene, internal reference genes and SRY genes; wherein the primers for amplifying 79 exons of the DMD gene and the reference gene comprise at least two different primers; the first primer binds 79 exons of the DMD gene with the upstream region of the reference gene, while the 5' end of the first primer contains a non-humanized genomic sequence primer SEQ ID NO.1 containing all or part; the second primer binds 79 exons of the DMD gene with the downstream region of the reference gene, while the 5' end of the second primer comprises all or part of the non-humanized genomic sequence primer SEQ ID NO.2; wherein the primers used to amplify the SRY gene comprise at least two different primers, a first primer that binds to an upstream region of the SRY gene and a second primer that binds to a downstream region of the SRY gene.
In the above detection method, the reference gene is one or more selected from GAPDH, ACTB, HBB, CFTR, HPRT, RPP and RPP 40.
The primers used for amplifying 79 exons of DMD gene in the above detection method comprise sequences shown as SEQ ID NO. 3-160.
The primers used in the above detection method for amplifying the SRY gene comprise sequences shown as SEQ ID NO. 161-162.
In the detection method, in the PCR amplification reaction, the primer at least contains more than one fluorescent group; the fluorescent group is selected from any one of FAM, VIC, HEX, JOE, TMR, NED, PET, ROX.
A DMD gene copy number assay kit comprising the following components: DMD reaction solution, DMD primer mixed solution, DNA polymerase, DMD female control, DMD male control, DMD blank control;
the DMD primer mixture comprises the primers for amplifying 79 exons of the DMD gene and the internal reference gene and the primers for amplifying the SRY gene.
Further, the DMD primer mixture comprises primers SEQ ID NO.1/2SEQ ID NO.3-160, SEQ ID NO.161/162, ACTB upstream/downstream primer and HBB upstream/downstream primer.
Further, the DMD primer mixture solution includes: DMD primer mix 1: primers SEQ ID NO.1-84, SEQ ID NO.161/162, ACTB upstream/downstream primer and HBB upstream/downstream primer; DMD primer mix 2: primers SEQ ID NO.1/2, SEQ ID NO.85-160, ACTB upstream/downstream primer and HBB upstream/downstream primer.
The DMD reaction liquid comprises: 10 XTaq Buffer with a final concentration of 1.5X; 25mM MgCl2 at a final concentration of 0.5 mM; dATP/dTTP/dGTP/dCTP at a final concentration of 0.5 mM; a final concentration of 2.0M enhancer; the enhancer comprises one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.
The application method of the detection kit in detecting the copy number variation of the exon of the DMD gene comprises the following steps:
(1) Processing the sample;
(2) Preparing an amplification reagent;
(3) PCR amplification and analysis by a capillary electrophoresis apparatus; carrying out PCR amplification reaction on a DNA sample to be detected to generate a PCR product, and carrying out analysis on the fragment size and the abundance by using a capillary electrophoresis apparatus;
(4) Detecting peak ratio calculation: after the reaction procedure is finished, analyzing the fragment size of the PCR amplified product; the detection peak areas of 79 exons of the DMD gene and the two internal reference genes of the sample to be detected and the DMD female control are respectively divided by the total area of the internal reference genes, and then the value corresponding to each position of the DMD female control is divided by the sample to be detected, so that the detection peak ratio of each position is obtained;
(5) Interpretation of the results:
(a) The detection front ratio of the reference gene falls between 1.80 and 2.38;
DMD gene 79 exons detection peak ratio: the detection peak ratio is less than 0.25, and the copy number is 0; the detection peak ratio is 0.25 and less than or equal to R <1.45, and the copy number is 1; the detection peak ratio is 1.45 and is less than or equal to R <2.53, and the copy number is 2; the detection peak ratio is 2.53 and is less than or equal to R <3.80, and the copy number is 3;
(b) And (3) detection type interpretation:
if the SRY wave front exists, judging the type according to a male sample: DMD exon gene copy number 0, male samples were hemizygous deletions; DMD exon gene copy number 1, male samples were normal; DMD exon gene copy number 2, male samples were semi-synthetic repeats;
if the SRY wave front is not found, judging the type according to the female sample: DMD exon gene copy number 1, female sample heterozygous deletion; DMD exon gene copy number 2, female sample is normal; DMD exon gene copy number 3, female samples were heterozygous repeat.
The detection kit is applied to DMD gene detection.
TABLE 1 amplification composition information
Wherein the single line drawn part is a non-humanized genome
The primer sequences SEQ ID NO.1 and SEQ ID NO.2 are as follows:
SEQ ID NO.1：TCGACGCACGCTCCTGCACAG；
SEQ ID NO.2：AGCGAGACGCTACCATGGCTAT；
the invention has the beneficial effects that:
(1) In terms of detection time, the whole process comprises fluorescent PCR amplification and capillary electrophoresis fragment analysis, and results can be obtained within 4 hours. The invention greatly shortens the detection time, has simple detection technical flow and is easy to realize standardization.
(2) In terms of reagent performance, the following more superior performance can be achieved through the design of special primers and a PCR reaction system:
a, more comprehensive specification design: and (3) carrying out PCR reaction once, carrying out capillary electrophoresis analysis by matching with a hole, detecting the copy number of the exon 1-79 of the DMD gene, carrying out identification type by matching with the SRY gene of the male sex determining gene, distinguishing the normal copy number of the exon of the DMD gene, the deletion mutation and the repeated mutation, prompting small deletion and mutation, and realizing the distinction of normal people, carriers and patients of the DMD.
B, more sensitive detection result: sample concentrations as low as 15ng/ul still allow accurate interpretation of copy number of the exons of the DMD gene.
Combining two-stage amplification reaction designs, increasing amplification consistency and providing more accurate detection results: the non-humanized genome sequence is designed at the 5-end of the upstream and downstream primers of 79 exons of the DMD gene and the internal reference gene, and comprises two-stage PCR amplification reaction. First stage amplification: the first primer and the second primer amplify amplification products of 79 exons of DMD gene and internal reference gene with 5 'end containing all or part of non-human genome sequence SEQ ID NO.1 and 3' end containing all or part of non-human genome sequence SEQ ID NO.2; second stage amplification: the amplification products of 79 exons of the DMD gene and an internal reference gene, the 5 'end of which contains all or part of the non-human genome sequence SEQ ID NO.1 and the 3' end of which contains all or part of the non-human genome sequence SEQ ID NO.2, are amplified in the first stage as templates, and the second amplification is carried out by using EQ ID NOs 1 and SEQ ID NO. 2. The special multiplex primer design is matched with the non-humanized genome sequence, so that the problem of amplification consistency of a multiplex PCR quantitative system is solved, and the accuracy of relative quantification of the copy number is improved. Meanwhile, the PCR reaction system adopts double-gene internal control, and the ratio is calculated by contrast with the DMD normal female, so that the efficiency of the PCR amplification reaction can be effectively monitored.
(3) The small deletion and insertion mutation of the DMD gene suggests that the design of the primer covers the exon region of the DMD gene from 1 to 79, and when an amplification product which does not conform to the expected fragment size appears through capillary electrophoresis fragment analysis, the rare gene mutation or gene polymorphism (polymorphism) which indicates the deletion or insertion appears in the amplification region of the primer, and the sequence confirmation of the deletion or insertion can be further carried out by matching with the first-generation sequencing.
(4) Drug guidelines for the treatment of Du's Muscular Dystrophy (DMD) by Sarepta company, first drug Exondys 51, day 9, 2016, U.S. Food and Drug Administration (FDA) TM Is applied to the market. Exondys 51 TM Suitable for identifying DMD patients carrying the jump mutation of exon 51 of DMD gene, accounting for about 13% of all DMD patients, and another drug, vyondys 53 TM Preferential approval also in the FDA, vyondys 53 TM Is suitable for confirming the 53 rd exon skipping mutation carrying DMD geneApproximately 8% of all DMD patients, these drugs need to be tailored to the specific exon deletion mutation type in order to select the appropriate therapeutic agent. Therefore, the detection of the invention can be used as a medicine administration guide.
Description of the drawings:
fig. 1 is a diagram of electrophoresis results of normal male individuals with DMD, which shows the analysis results of DNA samples extracted from normal male individuals according to example 4 of the present disclosure. The analysis result shows that the detection front of SRY is provided, the copy number of the exon of the DMD gene is 1 copy, and the detection result is normal.
Fig. 2 is a graph of DMD female normal individual results showing the results of analysis of DNA samples extracted from female normal individuals according to example 4 of the present disclosure. The analysis result shows that the SRY detection front is not generated, the copy number of the exon of the DMD gene is 2 copies, and the detection result is normal.
FIG. 3 is a carrier of heterozygous deletion mutations of exons 45-47 of the DMD gene, showing the results of analysis of DNA samples extracted from normal Du/Behcet muscular dystrophy carriers according to example 4 of the present disclosure. The analysis result shows that no SRY detection front exists, the copy number of the exons 45-47 of the DMD gene is 1 copy, the rest exons are 2 copies, and the detection result is that the exons 45-47 are heterozygous and deleted.
FIG. 4 is a patient with a D gene with exon 45-50 hemizygous deletion mutation, showing the results of analysis of DNA samples extracted from normal Du/Behcet muscular dystrophy patients according to example 4 of the present disclosure. The analysis result shows that no SRY detection front exists, the copy number of the 45-50 exons of the DMD gene is 0 copy, the rest exons are 1 copy, and the detection result is 45-50 exons semi-synthetic deletion.
FIG. 5 is a patient with half-and-repeat mutation of exon 2 of the DMD gene, showing the results of analysis of DNA samples extracted from normal Du/Behcet muscular dystrophy patients according to example 4 of the present disclosure. The analysis result shows that no SRY detection front exists, the copy number of the exon 2 of the DMD gene is 2 copies, the rest exons are 1 copy, and the detection result is the exon 2 semi-synthetic repetition.
The specific embodiment is as follows:
example 1 primer design
According to NCBI database, 79 exons of DMD gene, SRY, ACTB and HBB genes are searched, and specific primers are designed. Wherein the SRY gene is taken as a male and female sample for interpretation, and two internal reference genes (ACTB and HBB) are used for monitoring the PCR efficiency.
Preparing DMD reaction liquid and DMD primer mixed liquid
TABLE 2 formulation of DMD reaction liquid components
Component (A) Final concentration per reaction
10X Taq Buffer(Thermo) 1.5X
25mM MgCl 2 0.5mM
dATP/dTTP/dGTP/dCTP 0.5mM each
Betaine (betaine) 2.0M
TABLE 3 preparation of DMD primer mixture 1 Components Table
The 5' ends of SEQ ID No.1 and SEQ ID No.161 in Table 3 are modified with FAM fluorophores.
TABLE 4 preparation of DMD primer mixture 2 Components Table
Primer name Final concentration (μM) Primer name Final concentration (μM) Primer name Final concentration (μM)
SEQ ID NO.1 3.00 SEQ ID NO.111 0.57 SEQ ID NO.139 0.50
SEQ ID NO.2 3.00 SEQ ID NO.112 0.57 SEQ ID NO.140 0.50
SEQ ID NO.85 0.47 SEQ ID NO.113 0.53 SEQ ID NO.141 0.57
SEQ ID NO.86 0.47 SEQ ID NO.114 0.53 SEQ ID NO.142 0.57
SEQ ID NO.87 0.33 SEQ ID NO.115 0.47 SEQ ID NO.143 0.47
SEQ ID NO.88 0.33 SEQ ID NO.116 0.47 SEQ ID NO.144 0.47
SEQ ID NO.89 0.40 SEQ ID NO.117 0.53 SEQ ID NO.145 0.40
SEQ ID NO.90 0.40 SEQ ID NO.118 0.53 SEQ ID NO.146 0.40
SEQ ID NO.91 0.43 SEQ ID NO.119 0.60 SEQ ID NO.147 0.30
SEQ ID NO.92 0.43 SEQ ID NO.120 0.60 SEQ ID NO.148 0.30
SEQ ID NO.93 0.57 SEQ ID NO.121 0.73 SEQ ID NO.149 0.60
SEQ ID NO.94 0.57 SEQ ID NO.122 0.73 SEQ ID NO.150 0.60
SEQ ID NO.95 0.67 SEQ ID NO.123 0.40 SEQ ID NO.151 0.27
SEQ ID NO.96 0.67 SEQ ID NO.124 0.40 SEQ ID NO.152 0.27
SEQ ID NO.97 0.53 SEQ ID NO.125 0.37 SEQ ID NO.153 0.40
SEQ ID NO.98 0.53 SEQ ID NO.126 0.37 SEQ ID NO.154 0.40
SEQ ID NO.99 0.47 SEQ ID NO.127 0.50 SEQ ID NO.155 0.67
SEQ ID NO.100 0.47 SEQ ID NO.128 0.50 SEQ ID NO.156 0.67
SEQ ID NO.101 0.50 SEQ ID NO.129 0.47 SEQ ID NO.157 0.63
SEQ ID NO.102 0.50 SEQ ID NO.130 0.47 SEQ ID NO.158 0.63
SEQ ID NO.103 0.53 SEQ ID NO.131 0.47 SEQ ID NO.159 0.33
SEQ ID NO.104 0.53 SEQ ID NO.132 0.47 SEQ ID NO.160 0.33
SEQ ID NO.105 0.47 SEQ ID NO.133 0.57 ACTB upstream primer 0.48
SEQ ID NO.106 0.47 SEQ ID NO.134 0.57 ACTB downstream primer 0.48
SEQ ID NO.107 0.47 SEQ ID NO.135 0.37 HBB upstream primer 0.37
SEQ ID NO.108 0.47 SEQ ID NO.136 0.37 HBB downstream primer 0.37
SEQ ID NO.109 0.43 SEQ ID NO.137 0.40
SEQ ID NO.110 0.43 SEQ ID NO.138 0.40
The NED fluorophore was modified at the 5' end of SEQ ID NO.1 in Table 4.
In the above DMD primer mix 1 and 2, the following are mentioned:
ACTB upstream primer sequence:
TGACCGTCTGCGCCTCGTTCCATGTACGTTGCTATCCAGGC，
ACTB downstream primer sequence:
TCGACGCACGCTCCTGCTACAGCTCATTGCCAATGGTGATGAC，
HBB upstream primer sequence:
TGACCGTCTGCGCCTCGTTCACACAACTGTGTTCACTAGC，
HBB downstream primer sequence:
TCGACGCACGCTCCTGCTACATGGTCTCCTTAAACCTGTCTTG。
the remaining primer sequences are shown in Table 1.
Example 2 PCR amplification and result analysis
1. Sample processing: the nucleic acid extraction instrument (MagCore) and the nucleic acid extraction kit (MagCore Genomic DNA WholeBlood Kit) are used for extracting human genome DNA for subsequent PCR reaction, the DNA concentration is 2.5 ng/uL-60ng/uL, and the OD is high 260 nm/OD 280 The ratio of nm is between 1.6 and 2.0.
2. Preparing an amplification reagent:
(1) Taking out the DMD reaction liquid, the DMD primer mixed liquid 1 and the DMD primer mixed liquid 2 from the kit, thawing at room temperature, mixing uniformly upside down, and then briefly centrifuging by using a micro-centrifuge to enable all the liquid to be settled at the bottom of the tube.
(2) Preparing an amplification reagent: preparation of amplification reagents according to Table 5 below
TABLE 5 amplification reagent formulation table
Amplification reagent 1 Amplification reagent 2 Per reaction volume
DMD reaction liquid DMD reaction liquid 14.5μL
DMD primer mixture 1 DMD primer mixture 2 3μL
DNA polymerase DNA polymerase 0.5μL
Total volume of Total volume of 18μL
In order to reduce the liquid separation error, it is proposed to separately take (n+1) parts of the reaction solution and the mixed enzyme according to the number of samples (n) at the time of preparing the amplification reagent. n=number of samples to be tested+dmd blank 1 part+dmd female 1 part.
(3) 18 mu L of the prepared amplification reagents are respectively added into the PCR reaction tube, and the mixture is transferred to a sample treatment area for sample addition.
3. Sample adding: 2 mu L of genome DNA of a sample to be detected, DMD female control and DMD blank control are respectively added into corresponding PCR reaction tubes containing 18 mu L of amplification reagent, and after the PCR reaction tubes are covered, the PCR reaction tubes are short
And (5) temporarily centrifuging.
4. PCR amplification and capillary electrophoresis analysis:
(1) The PCR reaction tube was placed in a PCR apparatus to set the reaction program (95 ℃ C./5 min;95 ℃ C./30 s,57 ℃ C./30 s,72 ℃ C./1 min,25cycles;72 ℃ C./30 min;4 ℃ C./O/N), and the reaction volume was set: 20. Mu.L;
(2) Capillary electrophoresis analysis of PCR amplification products: detection was performed using an ABI3130, ABI3730, ABI3500Dx, or ABI SeqStudio GeneticAnalyzer capillary gene analyzer, 1. Mu.L of amplification product 1, 1. Mu.L of amplification product 2, 10. Mu.L 1%GeneScan 500LIZ Size Standard (prepared by 10. Mu.L of GeneScan 500LIZ Size Standard plus 990. Mu.LHi-Di Formamide, 1vol%GeneScan 500LIZ Size Standard) were denatured at 95℃for 3 minutes, immediately frozen for 2 minutes, and detected on a machine.
5. Software analysis:
after the reaction procedure is finished, fragment Size Analysis is carried out on the PCR amplified product by using GeneMapper software, analysis methods, panel and Size Standard files required by Analysis can be downloaded from a website, and specific information of data import, analysis parameter setting and result Analysis is shown in GeneMapper user manual.
6. Detecting peak ratio calculation: the detection peak area of 79 exons of the DMD gene and the two reference genes of the sample to be detected and the DMD female control are divided by the sum of the areas of the reference genes respectively, and then the value corresponding to each position of the DMD female control is divided by the sample to be detected, so that the detection peak ratio (R) of each position is obtained.
7. Interpretation of the results:
(1) The peak ratio (R) of the internal reference gene is between 1.80 and 2.40, and the copy number judgment is carried out according to the following table
Copy number interpretation Detection peak ratio (R) range
0 R≤0.25
1 0.25≤R<1.45
2 1.45≤R<2.53
3 2.53≤R<3.80
(2) If the detection peak ratio falls outside the range of the detection peak ratio, re-detection is needed, and the detection result is interpreted according to the table.
(3) Judging the detection type according to the following table, and judging the type according to a male sample if the detection type has an SRY wave front; if there is no SRY wave front, the pattern is interpreted according to the female sample.
(4) If rare gene mutation or gene polymorphism (polymorphism) of deletion or insertion occurs in the amplified region of the primer, the calculation of the detection peak ratio can be incorporated to carry out copy number interpretation, and further mutation or gene polymorphism information should be confirmed by adopting sequencing or other detection methods in combination with clinical symptoms.
Example 3 reagent Performance verification
1. Assessment of diagnostic accuracy of the inventive reagents
9 accurate references are detected, the concentrations of the samples are respectively detected, medium and low, the concentrations of the samples are respectively 60ng/uL, 25ng/uL and 15ng/uL, three repeated tests are carried out on the concentrations, three batches of reagents are detected, and the copy number of the exon of the DMD gene meets the requirement.
TABLE 6 accuracy reference type of exon mutations in DMD gene
2. Specific reference compliance rate
4 missing references are detected, the concentrations of the samples are respectively detected, medium and low, the concentrations of the samples are respectively 60ng/uL, 25ng/uL and 15ng/uL, three repeated tests are carried out on the concentrations, three batches of reagents are detected, and the specific coincidence rate of the detection results is 100%.
TABLE 7 specific reference DMD Gene exon mutant types
3. Repeatability of
And detecting 2 parts of repetitive reference substances, carrying out repeated detection for ten times on each concentration, detecting three batches of reagents, judging the copy number correctly, and conforming to detection results.
TABLE 8 repetitive reference type of exon mutation of DMD Gene
4. Detection limit
13 detection limit references are detected, the concentrations of the samples are respectively diluted to 20 ng/mu L and 15 ng/mu L, 20 repeated tests are respectively carried out, three batches of reagents are detected, and the repetition numbers of detection results meet the requirements.
TABLE 9 detection limit reference DMD Gene exon mutation types
5. National reference detection
A set of 46 national references are detected, the deletion and repeated mutation results in the detection range of the reagent are met, the detection results are shown in Table 10, and the detection results meet the requirements of the types of the national references.
Table 10
Example 4
1. 150 EDTA anticoagulated whole blood samples were collected and developed using MRC-Holland, netherlandsProbemix P034 and +.>Probemix P035 was used as a reference method to verify consistency between results.
2. Collecting EDTA anticoagulated whole blood sample, extracting human genome DNA by using a nucleic acid extractor (MagCore) and a nucleic acid extraction kit (MagCore Genomic DNA WholeBlood Kit), detecting the concentration and purity of the DNA by using a micro spectroluminometer, wherein 150 samples have the concentration of 15ng/uL-60ng/uL and OD 260nm /OD 280nm The ratio of (2) is between 1.6 and 2.0.
3. DNA was sampled and reacted by a PCR instrument according to the procedure of example 2,
4. the results were analyzed according to the procedure of example 2, and the results in the following tables were all in accordance with the DMD exon copy number requirements, wherein 51 samples were tested for DMD patients, 22 samples were tested for DMD carriers, 77 samples were tested for DMD normal individuals, and 150 samples were tested in total (Table 11).
Table 11 test results for 150 samples
* MLPA: multiplex ligation probe amplification as a positive control group of the present disclosure.
Based on the results of Table 10 and FIGS. 1 through 4, the present invention can accurately determine the copy number of the exon of the DMD gene in human individuals to identify Du/Behcet muscular dystrophy patients, du/Behcet muscular dystrophy carriers and normal individuals, it should be understood that the foregoing description of the embodiments is given by way of example only and that various modifications can be made by those skilled in the art. The above specification, examples and experimental results provide a complete description of the structure and use of exemplary embodiments of the invention. Although various embodiments of the present invention have been disclosed in the foregoing description, it should be understood that these embodiments are not limited to the details of the invention, and that various changes and modifications can be made by one skilled in the art without departing from the spirit and principles of the invention, therefore, all such equivalent changes and modifications as fall within the spirit and scope of the invention are intended to be covered by the appended claims.
SEQUENCE LISTING
<110> Shengya Biotechnology (Xiamen) Co., ltd
<120> method for detecting copy number variation of exon in DMD gene and application thereof
<130> 166
<160> 166
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> SEQ ID NO. 1
<400> 1
tcgacgcacg ctcctgcaca g 21
<210> 2
<211> 22
<212> DNA
<213> SEQ ID NO. 2
<400> 2
agcgagacgc taccatggct at 22
<210> 3
<211> 39
<212> DNA
<213> SEQ ID NO. 3
<400> 3
gacgcacgct cctgcacaga gaatcctggc atcagttac 39
<210> 4
<211> 44
<212> DNA
<213> SEQ ID NO. 4
<400> 4
cgagacgcta ccatggctat gaaaagtgta tatcaaggca gcga 44
<210> 5
<211> 42
<212> DNA
<213> SEQ ID NO. 5
<400> 5
tcgacgcacg ctcctgcaca gagatgaaag agaagatgtt ca 42
<210> 6
<211> 41
<212> DNA
<213> SEQ ID NO. 6
<400> 6
cgagacgcta ccatggctat cacaacttag atcttaaaag t 41
<210> 7
<211> 43
<212> DNA
<213> SEQ ID NO. 7
<400> 7
tcgacgcacg ctcctgcaca gaggatccac aagagttcat gcc 43
<210> 8
<211> 41
<212> DNA
<213> SEQ ID NO. 8
<400> 8
cgagacgcta ccatggctat agggtactac ttacattatt g 41
<210> 9
<211> 44
<212> DNA
<213> SEQ ID NO. 9
<400> 9
tcgacgcacg ctcctgcaca gtcatggctg gattgcaaca aacc 44
<210> 10
<211> 42
<212> DNA
<213> SEQ ID NO. 10
<400> 10
cgagacgcta ccatggctat cttacctatg actatggatg ag 42
<210> 11
<211> 43
<212> DNA
<213> SEQ ID NO. 11
<400> 11
tcgacgcacg ctcctgcaca gtgtagtgtt aatgtgctta cag 43
<210> 12
<211> 43
<212> DNA
<213> SEQ ID NO. 12
<400> 12
cgagacgcta ccatggctat acctgttgag aatagtgcat ttg 43
<210> 13
<211> 41
<212> DNA
<213> SEQ ID NO. 13
<400> 13
gacgcacgct cctgctacag gaagctcctg aagacaagtc a 41
<210> 14
<211> 41
<212> DNA
<213> SEQ ID NO. 14
<400> 14
cgagacgcta ccatggctat tgcttgcaat gtgtcctcag c 41
<210> 15
<211> 42
<212> DNA
<213> SEQ ID NO. 15
<400> 15
tcgacgcacg ctcctgcaca gtacttacat ccttctcaat gt 42
<210> 16
<211> 42
<212> DNA
<213> SEQ ID NO. 16
<400> 16
cgagacgcta ccatggctat gttgtacttg gcgttttagg tc 42
<210> 17
<211> 42
<212> DNA
<213> SEQ ID NO. 17
<400> 17
tcgacgcacg ctcctgcaca gtgtctcttc tccaggtatt gg 42
<210> 18
<211> 44
<212> DNA
<213> SEQ ID NO. 18
<400> 18
agcgagacgc taccatggct atctgttctt cagtaagacg ttgc 44
<210> 19
<211> 42
<212> DNA
<213> SEQ ID NO. 19
<400> 19
tcgacgcacg ctcctgcaca ggattactcg ctcagaagct gt 42
<210> 20
<211> 42
<212> DNA
<213> SEQ ID NO. 20
<400> 20
gagacgctac catggctatt agtcagtcac agaagaatcc ag 42
<210> 21
<211> 42
<212> DNA
<213> SEQ ID NO. 21
<400> 21
tcgacgcacg ctcctgcaca gcaagcctca gaacaactga ac 42
<210> 22
<211> 44
<212> DNA
<213> SEQ ID NO. 22
<400> 22
agcgagacgc taccatggct atagcagtag ttgtcatctg ctcc 44
<210> 23
<211> 40
<212> DNA
<213> SEQ ID NO. 23
<400> 23
acgcacgctc ctgcacaggc caccaatgcg ctatcaggag 40
<210> 24
<211> 41
<212> DNA
<213> SEQ ID NO. 24
<400> 24
gagacgctac catggctatt gtgaatgctt gataagcgtg c 41
<210> 25
<211> 42
<212> DNA
<213> SEQ ID NO. 25
<400> 25
tcgacgcacg ctcctgcaca gtctcgtttc agaatcacat ac 42
<210> 26
<211> 41
<212> DNA
<213> SEQ ID NO. 26
<400> 26
gagacgctac catggctatc tgaatcccca agggcaggcc a 41
<210> 27
<211> 37
<212> DNA
<213> SEQ ID NO. 27
<400> 27
cgcacgctcc tgcacaggat ctatcagaga tgcacga 37
<210> 28
<211> 42
<212> DNA
<213> SEQ ID NO. 28
<400> 28
agacgctacc atggctatct gctttctgta attcatctgg ag 42
<210> 29
<211> 39
<212> DNA
<213> SEQ ID NO. 29
<400> 29
acgcacgctc ctgcacagca tgttggcatg agttattgt 39
<210> 30
<211> 40
<212> DNA
<213> SEQ ID NO. 30
<400> 30
agacgctacc atggctatca gtgctgagtg ataacatagt 40
<210> 31
<211> 40
<212> DNA
<213> SEQ ID NO. 31
<400> 31
tcgacgcacg ctcctgcaca gtgttcagca ggattacaga 40
<210> 32
<211> 43
<212> DNA
<213> SEQ ID NO. 32
<400> 32
agcgagacgc taccatggct atctgaggca tttgagctgc gtc 43
<210> 33
<211> 42
<212> DNA
<213> SEQ ID NO. 33
<400> 33
tcgacgcacg ctcctgcaca gtacaagatg tctccatgaa gt 42
<210> 34
<211> 39
<212> DNA
<213> SEQ ID NO. 34
<400> 34
agacgctacc atggctattc caatgcaggc aagtgcatc 39
<210> 35
<211> 43
<212> DNA
<213> SEQ ID NO. 35
<400> 35
tcgacgcacg ctcctgcaca gcgatgtcat ctgccctaga cag 43
<210> 36
<211> 39
<212> DNA
<213> SEQ ID NO. 36
<400> 36
agacgctacc atggctattc catatctgta gctgccagc 39
<210> 37
<211> 39
<212> DNA
<213> SEQ ID NO. 37
<400> 37
acgcacgctc ctgcacagat accagaaaca catggaaac 39
<210> 38
<211> 39
<212> DNA
<213> SEQ ID NO. 38
<400> 38
agacgctacc atggctattg ctaccttaag cacgtcttc 39
<210> 39
<211> 44
<212> DNA
<213> SEQ ID NO. 39
<400> 39
gacgcacgct cctgcacagt gattagttta gcaacaggag gttg 44
<210> 40
<211> 43
<212> DNA
<213> SEQ ID NO. 40
<400> 40
cgagacgcta ccatggctat accatatctt tattgaagtc ttc 43
<210> 41
<211> 43
<212> DNA
<213> SEQ ID NO. 41
<400> 41
tcgacgcacg ctcctgcaca gcttagcttc ctatacatgg gtc 43
<210> 42
<211> 41
<212> DNA
<213> SEQ ID NO. 42
<400> 42
gagacgctac catggctatc aatgtcatcc aagcatttca g 41
<210> 43
<211> 42
<212> DNA
<213> SEQ ID NO. 43
<400> 43
tcgacgcacg ctcctgcaca gcgtgaagaa acgatgatgg tg 42
<210> 44
<211> 41
<212> DNA
<213> SEQ ID NO. 44
<400> 44
agacgctacc atggctatgt gaaagtcaaa atgccatcat g 41
<210> 45
<211> 40
<212> DNA
<213> SEQ ID NO. 45
<400> 45
gacgcacgct cctgcacagc tgcaggcgat ttgacagatc 40
<210> 46
<211> 41
<212> DNA
<213> SEQ ID NO. 46
<400> 46
gagacgctac catggctatt cttcagcaca tctggactct t 41
<210> 47
<211> 42
<212> DNA
<213> SEQ ID NO. 47
<400> 47
tcgacgcacg ctcctgcaca gctttctcca ggctagaaga ac 42
<210> 48
<211> 39
<212> DNA
<213> SEQ ID NO. 48
<400> 48
agacgctacc atggctatat taccttgact tgctcaagc 39
<210> 49
<211> 44
<212> DNA
<213> SEQ ID NO. 49
<400> 49
cgacgcacgc tcctgcacag caggtttcca gagctttacc tgag 44
<210> 50
<211> 41
<212> DNA
<213> SEQ ID NO. 50
<400> 50
gagacgctac catggctatt aggcacaggg accactgcaa t 41
<210> 51
<211> 40
<212> DNA
<213> SEQ ID NO. 51
<400> 51
gacgcacgct cctgcacaga tctgagctct gagtggaagg 40
<210> 52
<211> 41
<212> DNA
<213> SEQ ID NO. 52
<400> 52
gagacgctac catggctatt agctagagcc aaagagaatg g 41
<210> 53
<211> 44
<212> DNA
<213> SEQ ID NO. 53
<400> 53
tcgacgcacg ctcctgcaca gtccgaggta ctccggaatg tctc 44
<210> 54
<211> 44
<212> DNA
<213> SEQ ID NO. 54
<400> 54
agcgagacgc taccatggct atcttcgatc cgtaatgatt gttc 44
<210> 55
<211> 42
<212> DNA
<213> SEQ ID NO. 55
<400> 55
tcgacgcacg ctcctgcaca gatgaagtac aagaacacct tc 42
<210> 56
<211> 39
<212> DNA
<213> SEQ ID NO. 56
<400> 56
agacgctacc atggctattt gcatctactg tatagggac 39
<210> 57
<211> 39
<212> DNA
<213> SEQ ID NO. 57
<400> 57
gcacgctcct gcacagccag tggcagacaa atgtagatg 39
<210> 58
<211> 40
<212> DNA
<213> SEQ ID NO. 58
<400> 58
gagacgctac catggctatg cattgatatt ctctgttatc 40
<210> 59
<211> 42
<212> DNA
<213> SEQ ID NO. 59
<400> 59
cgacgcacgc tcctgcacag gatgtttatc acaacctgga tg 42
<210> 60
<211> 39
<212> DNA
<213> SEQ ID NO. 60
<400> 60
gagacgctac catggctatt atccaaacgt ctttgtaac 39
<210> 61
<211> 41
<212> DNA
<213> SEQ ID NO. 61
<400> 61
gacgcacgct cctgcacagc gctttcctca ttaacagata g 41
<210> 62
<211> 40
<212> DNA
<213> SEQ ID NO. 62
<400> 62
agacgctacc atggctatgg atgggctgct ccgtcaccac 40
<210> 63
<211> 40
<212> DNA
<213> SEQ ID NO. 63
<400> 63
gacgcacgct cctgcacagc agtaggttac cctcttgttc 40
<210> 64
<211> 39
<212> DNA
<213> SEQ ID NO. 64
<400> 64
agacgctacc atggctatgg ctgccaggat cccttgatc 39
<210> 65
<211> 44
<212> DNA
<213> SEQ ID NO. 65
<400> 65
tcgacgcacg ctcctgcaca gccgtagcat agagcaaaca ttac 44
<210> 66
<211> 45
<212> DNA
<213> SEQ ID NO. 66
<400> 66
agacgctacc atggctatcc tatcctcaca aatattacca tgaac 45
<210> 67
<211> 44
<212> DNA
<213> SEQ ID NO. 67
<400> 67
acgcacgctc ctgcacagct ataccacttt agtcttcaca gaac 44
<210> 68
<211> 41
<212> DNA
<213> SEQ ID NO. 68
<400> 68
cgagacgcta ccatggctat acagcaaagg gccttctgca g 41
<210> 69
<211> 47
<212> DNA
<213> SEQ ID NO. 69
<400> 69
tcgacgcacg ctcctgcaca gtcacacatc attgagcact ttactcc 47
<210> 70
<211> 40
<212> DNA
<213> SEQ ID NO. 70
<400> 70
gagacgctac catggctatt tacatctgta cttgtcttcc 40
<210> 71
<211> 40
<212> DNA
<213> SEQ ID NO. 71
<400> 71
cgacgcacgc tcctgcacag tgatatacac ctcctttgcc 40
<210> 72
<211> 43
<212> DNA
<213> SEQ ID NO. 72
<400> 72
agcgagacgc taccatggct attcctaata cctgaatcca atg 43
<210> 73
<211> 44
<212> DNA
<213> SEQ ID NO. 73
<400> 73
tcgacgcacg ctcctgcaca gcaaattaga acgtggtaga aggt 44
<210> 74
<211> 41
<212> DNA
<213> SEQ ID NO. 74
<400> 74
gagacgctac catggctatc tgcagtattg tacaaaactg a 41
<210> 75
<211> 43
<212> DNA
<213> SEQ ID NO. 75
<400> 75
tcgacgcacg ctcctgcaca gtagactaca tcaggagaag atg 43
<210> 76
<211> 40
<212> DNA
<213> SEQ ID NO. 76
<400> 76
gagacgctac catggctatg tgttctgctt ttgctactac 40
<210> 77
<211> 41
<212> DNA
<213> SEQ ID NO. 77
<400> 77
gacgcacgct cctgcacaga atggcgcagg tgtaaactat t 41
<210> 78
<211> 42
<212> DNA
<213> SEQ ID NO. 78
<400> 78
agacgctacc atggctattg cgtgaatgag tatcatcgtg tg 42
<210> 79
<211> 40
<212> DNA
<213> SEQ ID NO. 79
<400> 79
gacgcacgct cctgcacagt ccagcattac tgccaaagtt 40
<210> 80
<211> 42
<212> DNA
<213> SEQ ID NO. 80
<400> 80
cgagacgcta ccatggctat gtcattggta tgcagagtgc at 42
<210> 81
<211> 44
<212> DNA
<213> SEQ ID NO. 81
<400> 81
tcgacgcacg ctcctgcaca gtaatgtaat gatgtatagt ctca 44
<210> 82
<211> 38
<212> DNA
<213> SEQ ID NO. 82
<400> 82
acgctaccat ggctatcgga gcagcatagg ctgactgc 38
<210> 83
<211> 46
<212> DNA
<213> SEQ ID NO. 83
<400> 83
cgacgcacgc tcctgcacag tgacgtcttc tggatcatgt tatctg 46
<210> 84
<211> 40
<212> DNA
<213> SEQ ID NO. 84
<400> 84
agacgctacc atggctattc tcactaacct ctctcattgg 40
<210> 85
<211> 42
<212> DNA
<213> SEQ ID NO. 85
<400> 85
gacgcacgct cctgcacagt cttcggcaga ttaattatgc ac 42
<210> 86
<211> 44
<212> DNA
<213> SEQ ID NO. 86
<400> 86
agcgagacgc taccatggct atctgtcagg ccttcgagga ggtc 44
<210> 87
<211> 41
<212> DNA
<213> SEQ ID NO. 87
<400> 87
acgcacgctc ctgcacagca actaggcatt tggtctctta c 41
<210> 88
<211> 40
<212> DNA
<213> SEQ ID NO. 88
<400> 88
gagacgctac catggctatt catcaggatt cttacctgcc 40
<210> 89
<211> 45
<212> DNA
<213> SEQ ID NO. 89
<400> 89
tcgacgcacg ctcctgcaca ggcatggaag taaatctcat ggaac 45
<210> 90
<211> 39
<212> DNA
<213> SEQ ID NO. 90
<400> 90
agacgctacc atggctatat gttccagtcg ttgtgtggc 39
<210> 91
<211> 42
<212> DNA
<213> SEQ ID NO. 91
<400> 91
tcgacgcacg ctcctgcaca gctaccatgt tggaaagtag tc 42
<210> 92
<211> 40
<212> DNA
<213> SEQ ID NO. 92
<400> 92
agacgctacc atggctattc cgtgtagggt cagaggtggt 40
<210> 93
<211> 41
<212> DNA
<213> SEQ ID NO. 93
<400> 93
cgacgcacgc tcctgcacag accgatttac ctagagttct a 41
<210> 94
<211> 39
<212> DNA
<213> SEQ ID NO. 94
<400> 94
agacgctacc atggctatca gcttacttcc caattgtag 39
<210> 95
<211> 43
<212> DNA
<213> SEQ ID NO. 95
<400> 95
tcgacgcacg ctcctgcaca ggtgcttcaa gaagatctag aac 43
<210> 96
<211> 38
<212> DNA
<213> SEQ ID NO. 96
<400> 96
agacgctacc atggctatgt atcagaatta tggaattc 38
<210> 97
<211> 41
<212> DNA
<213> SEQ ID NO. 97
<400> 97
acgcacgctc ctgcacagtg tgtcatgtgt gagaaactag c 41
<210> 98
<211> 41
<212> DNA
<213> SEQ ID NO. 98
<400> 98
agacgctacc atggctatgt tgtgtgaatc ttgttcactg c 41
<210> 99
<211> 41
<212> DNA
<213> SEQ ID NO. 99
<400> 99
acgcacgctc ctgcacagag attgaactat agtggtgtat g 41
<210> 100
<211> 41
<212> DNA
<213> SEQ ID NO. 100
<400> 100
acgctaccat ggctattaac ctgtgctgta ctcttttcaa g 41
<210> 101
<211> 39
<212> DNA
<213> SEQ ID NO. 101
<400> 101
gacgcacgct cctgcacagt gatctgaagg tcaatctac 39
<210> 102
<211> 41
<212> DNA
<213> SEQ ID NO. 102
<400> 102
agacgctacc atggctatca gtaatctgcc tcttcttttg g 41
<210> 103
<211> 42
<212> DNA
<213> SEQ ID NO. 103
<400> 103
tcgacgcacg ctcctgcaca gagattcacg tgataagctg ac 42
<210> 104
<211> 44
<212> DNA
<213> SEQ ID NO. 104
<400> 104
agcgagacgc taccatggct atccattcac catctgttcc acca 44
<210> 105
<211> 40
<212> DNA
<213> SEQ ID NO. 105
<400> 105
gacgcacgct cctgcacagg ctggtgatag aggcttgtct 40
<210> 106
<211> 41
<212> DNA
<213> SEQ ID NO. 106
<400> 106
agacgctacc atggctatac aaagtctgca tccaggaaca t 41
<210> 107
<211> 39
<212> DNA
<213> SEQ ID NO. 107
<400> 107
acgcacgctc ctgcacagtc tctgcaagag caacaaagt 39
<210> 108
<211> 42
<212> DNA
<213> SEQ ID NO. 108
<400> 108
cgagacgcta ccatggctat ctaacgatac actgtaaact gt 42
<210> 109
<211> 42
<212> DNA
<213> SEQ ID NO. 109
<400> 109
tcgacgcacg ctcctgcaca gagaagataa agaatgaagc ag 42
<210> 110
<211> 42
<212> DNA
<213> SEQ ID NO. 110
<400> 110
agacgctacc atggctatat taggaaatct tagttaagta cg 42
<210> 111
<211> 39
<212> DNA
<213> SEQ ID NO. 111
<400> 111
acgcacgctc ctgcacagca tgctattaag agagcattc 39
<210> 112
<211> 40
<212> DNA
<213> SEQ ID NO. 112
<400> 112
agacgctacc atggctatca ctggtagttg gtggttagag 40
<210> 113
<211> 40
<212> DNA
<213> SEQ ID NO. 113
<400> 113
gacgcacgct cctgcacaga tgagctaatc aatgaggaac 40
<210> 114
<211> 40
<212> DNA
<213> SEQ ID NO. 114
<400> 114
agacgctacc atggctatga gaggcctgta tctgctatac 40
<210> 115
<211> 42
<212> DNA
<213> SEQ ID NO. 115
<400> 115
cgacgcacgc tcctgcacag aggtgatcca cctgcctcga cc 42
<210> 116
<211> 43
<212> DNA
<213> SEQ ID NO. 116
<400> 116
cgagacgcta ccatggctat catatacctg tgcaacatca atc 43
<210> 117
<211> 42
<212> DNA
<213> SEQ ID NO. 117
<400> 117
tcgacgcacg ctcctgcaca gtaactctac tgattatcat gt 42
<210> 118
<211> 42
<212> DNA
<213> SEQ ID NO. 118
<400> 118
agacgctacc atggctatgt ctcagcatgc acacaccttt gc 42
<210> 119
<211> 40
<212> DNA
<213> SEQ ID NO. 119
<400> 119
acgcacgctc ctgcacagta cttgaaggtc aatgctctcc 40
<210> 120
<211> 41
<212> DNA
<213> SEQ ID NO. 120
<400> 120
agacgctacc atggctatag tttatcttcc accaacgtct c 41
<210> 121
<211> 43
<212> DNA
<213> SEQ ID NO. 121
<400> 121
tcgacgcacg ctcctgcaca gtcgctcact tgctcactcg ctc 43
<210> 122
<211> 37
<212> DNA
<213> SEQ ID NO. 122
<400> 122
agacgctacc atggctattc gatggttgag ctctgag 37
<210> 123
<211> 42
<212> DNA
<213> SEQ ID NO. 123
<400> 123
gacgcacgct cctgcacaga gaaaggctat gagcacagta tc 42
<210> 124
<211> 41
<212> DNA
<213> SEQ ID NO. 124
<400> 124
gagacgctac catggctatg ttttgtctgt aacagctgct g 41
<210> 125
<211> 39
<212> DNA
<213> SEQ ID NO. 125
<400> 125
acgcacgctc ctgcacagta ttgagcgagg atgacagtc 39
<210> 126
<211> 40
<212> DNA
<213> SEQ ID NO. 126
<400> 126
agacgctacc atggctatag ttgagtcttc gaaactgagc 40
<210> 127
<211> 42
<212> DNA
<213> SEQ ID NO. 127
<400> 127
tcgacgcacg ctcctgcaca ggatagtcta caacaaagct ca 42
<210> 128
<211> 41
<212> DNA
<213> SEQ ID NO. 128
<400> 128
cgagacgcta ccatggctat gagagcttcc tgtagcttca c 41
<210> 129
<211> 43
<212> DNA
<213> SEQ ID NO. 129
<400> 129
tcgacgcacg ctcctgcaca gcaggaactc caggatggca ttg 43
<210> 130
<211> 39
<212> DNA
<213> SEQ ID NO. 130
<400> 130
agacgctacc atggctatct gtctgacagc tgtttgcag 39
<210> 131
<211> 39
<212> DNA
<213> SEQ ID NO. 131
<400> 131
acgcacgctc ctgcacagca gtcaatcagc tctgtgctc 39
<210> 132
<211> 41
<212> DNA
<213> SEQ ID NO. 132
<400> 132
agacgctacc atggctatac tggagatttg tctgcttgag c 41
<210> 133
<211> 46
<212> DNA
<213> SEQ ID NO. 133
<400> 133
tcgacgcacg ctcctgcaca ggatctgcaa tacatgtgga gtctcc 46
<210> 134
<211> 42
<212> DNA
<213> SEQ ID NO. 134
<400> 134
agacgctacc atggctatca tccggttgtt tagcttgaac tg 42
<210> 135
<211> 39
<212> DNA
<213> SEQ ID NO. 135
<400> 135
acgcacgctc ctgcacagag actgttactc tggtgacac 39
<210> 136
<211> 38
<212> DNA
<213> SEQ ID NO. 136
<400> 136
agacgctacc atggctattg aaatctgcca gagcaggt 38
<210> 137
<211> 43
<212> DNA
<213> SEQ ID NO. 137
<400> 137
tcgacgcacg ctcctgcaca gccaatgtcc tacaggatgc tac 43
<210> 138
<211> 39
<212> DNA
<213> SEQ ID NO. 138
<400> 138
agacgctacc atggctattg tccctggctt gtcagttac 39
<210> 139
<211> 42
<212> DNA
<213> SEQ ID NO. 139
<400> 139
tcgacgcacg ctcctgcaca gaacatatgg ctaaacactg cc 42
<210> 140
<211> 43
<212> DNA
<213> SEQ ID NO. 140
<400> 140
cgagacgcta ccatggctat gtcctaccct atgtacatcg ttc 43
<210> 141
<211> 43
<212> DNA
<213> SEQ ID NO. 141
<400> 141
tcgacgcacg ctcctgcaca gtactaattg aagcagtagt tca 43
<210> 142
<211> 40
<212> DNA
<213> SEQ ID NO. 142
<400> 142
agacgctacc atggctatgc agctgcctga ctcggtcctc 40
<210> 143
<211> 42
<212> DNA
<213> SEQ ID NO. 143
<400> 143
acgcacgctc ctgcacagcc tgtttgcgat gaatttgacc tc 42
<210> 144
<211> 38
<212> DNA
<213> SEQ ID NO. 144
<400> 144
gagacgctac catggctatt tacttgatat agtagggc 38
<210> 145
<211> 43
<212> DNA
<213> SEQ ID NO. 145
<400> 145
cgcacgctcc tgcacagatc ataactgaag tgcgatcgat ttg 43
<210> 146
<211> 41
<212> DNA
<213> SEQ ID NO. 146
<400> 146
agacgctacc atggctatct aaagactggt agagctctgt c 41
<210> 147
<211> 42
<212> DNA
<213> SEQ ID NO. 147
<400> 147
tcgacgcacg ctcctgcaca gttcagatcc tgaatactga tc 42
<210> 148
<211> 45
<212> DNA
<213> SEQ ID NO. 148
<400> 148
cgagacgcta ccatggctat agccagttca gacacatatc cacgc 45
<210> 149
<211> 42
<212> DNA
<213> SEQ ID NO. 149
<400> 149
tcgacgcacg ctcctgcaca gcaagcaagt ggcaagttca ac 42
<210> 150
<211> 41
<212> DNA
<213> SEQ ID NO. 150
<400> 150
cgagacgcta ccatggctat acctactgcc tactgaagag c 41
<210> 151
<211> 43
<212> DNA
<213> SEQ ID NO. 151
<400> 151
tcgacgcacg ctcctgcaca gagtagtaat gattctcaag atc 43
<210> 152
<211> 39
<212> DNA
<213> SEQ ID NO. 152
<400> 152
agacgctacc atggctatcc agaagttgat cagagtaac 39
<210> 153
<211> 42
<212> DNA
<213> SEQ ID NO. 153
<400> 153
cgcacgctcc tgcacagtga tagcatctct cctaatgaga gc 42
<210> 154
<211> 44
<212> DNA
<213> SEQ ID NO. 154
<400> 154
agacgctacc atggctatgc tataccaaga tcacgtttcc actc 44
<210> 155
<211> 43
<212> DNA
<213> SEQ ID NO. 155
<400> 155
tcgacgcacg ctcctgcaca ggagctcatt gctgaggcca agc 43
<210> 156
<211> 41
<212> DNA
<213> SEQ ID NO. 156
<400> 156
agacgctacc atggctatgt ggtcttccag gatttgcatc c 41
<210> 157
<211> 43
<212> DNA
<213> SEQ ID NO. 157
<400> 157
tcgacgcacg ctcctgcaca gttgcagtga gccaagatcg tgc 43
<210> 158
<211> 40
<212> DNA
<213> SEQ ID NO. 158
<400> 158
agacgctacc atggctatgg actgagaaga tcttcctcac 40
<210> 159
<211> 44
<212> DNA
<213> SEQ ID NO. 159
<400> 159
tcgacgcacg ctcctgcaca ggaaggtatt ctgaccttgt gaac 44
<210> 160
<211> 42
<212> DNA
<213> SEQ ID NO. 160
<400> 160
gagacgctac catggctatc agaagcccat gaactgtgtt tc 42
<210> 161
<211> 21
<212> DNA
<213> SEQ ID NO. 161
<400> 161
gaatattccc gctctccgga g 21
<210> 162
<211> 22
<212> DNA
<213> SEQ ID NO. 162
<400> 162
gctggtgctc cattcttgag tg 22
<210> 163
<211> 41
<212> DNA
<213> ACTB upstream primer sequence
<400> 163
tgaccgtctg cgcctcgttc catgtacgtt gctatccagg c 41
<210> 164
<211> 43
<212> DNA
<213> ACTB downstream primer sequence
<400> 164
tcgacgcacg ctcctgctac agctcattgc caatggtgat gac 43
<210> 165
<211> 40
<212> DNA
<213> HBB upstream primer sequence
<400> 165
tgaccgtctg cgcctcgttc acacaactgt gttcactagc 40
<210> 166
<211> 43
<212> DNA
<213> HBB downstream primer sequence
<400> 166
tcgacgcacg ctcctgctac atggtctcct taaacctgtc ttg 43

Claims (6)

1. A PCR amplification reaction detection primer for detecting copy number of exon of DMD gene, which is characterized in that: the primer simultaneously amplifies 79 exons of the DMD gene, an internal reference gene and an SRY gene; wherein the primers for amplifying 79 exons of the DMD gene and the reference gene comprise at least two different primers; the first primer binds 79 exons of the DMD gene with the upstream region of the reference gene, while the 5' end of the first primer contains a non-humanized genomic sequence primer SEQ ID NO.1 containing all or part; the second primer binds 79 exons of the DMD gene with the downstream region of the reference gene, while the 5' end of the second primer comprises all or part of the non-humanized genomic sequence primer SEQ ID NO.2; wherein the primers used to amplify the SRY gene comprise at least two different primers, a first primer binding to an upstream region of the SRY gene and a second primer binding to a downstream region of the SRY gene;
the reference gene is selected from one or more of ACTB and HBB;
the primer for amplifying 79 exons of the DMD gene comprises a sequence shown as SEQ ID NO.3-160, the primer for amplifying the reference gene ACTB comprises a sequence shown as SEQ ID NO. 163-164, the primer for amplifying the reference gene HBB comprises a sequence shown as SEQ ID NO. 165-166, and the primer for amplifying the SRY gene comprises a sequence shown as SEQ ID NO. 161-162.
2. The detection primer according to claim 1, wherein: the primer at least comprises more than one fluorescent group; the fluorescent group is selected from any one of FAM, VIC, HEX, JOE, TMR, NED, PET, ROX.
3. The DMD gene copy number detection kit is characterized in that: the detection kit comprises the following components: DMD reaction solution, DMD primer mixed solution, DNA polymerase, DMD female control, DMD male control, DMD blank control; the DMD primer mixture comprises the primers for amplifying 79 exons of the DMD gene and the reference gene and the primers for amplifying the SRY gene according to claim 1.
4. A test kit according to claim 3, wherein: the DMD primer mixture comprises a DMD primer mixture 1 and a DMD primer mixture 2, wherein the DMD primer mixture 1 comprises detection primers SEQ ID NO.1-84 and SEQ ID NO. 161-166, and the DMD primer mixture 2 comprises detection primers SEQ ID NO. 1-2, SEQ ID NO.85-160 and SEQ ID NO. 163-166.
5. A test kit according to claim 3, wherein: the DMD reaction liquid comprises: 10 XTaq Buffer with a final concentration of 1.5X; 25mM MgCl with final concentration of 0.5mM 2 The method comprises the steps of carrying out a first treatment on the surface of the dATP/dTTP/dGTP/dCTP at a final concentration of 0.5 mM; a final concentration of 2.0M enhancer; the enhancer comprises one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol.
6. Use of the test kit according to claim 3 for the preparation of a product for DMD gene detection.
CN202110987966.9A 2021-08-26 2021-08-26 Detection method for copy number variation of exon of DMD gene and application thereof Active CN113652474B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110987966.9A CN113652474B (en) 2021-08-26 2021-08-26 Detection method for copy number variation of exon of DMD gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110987966.9A CN113652474B (en) 2021-08-26 2021-08-26 Detection method for copy number variation of exon of DMD gene and application thereof

Publications (2)

Publication Number Publication Date
CN113652474A CN113652474A (en) 2021-11-16
CN113652474B true CN113652474B (en) 2023-09-01

Family

ID=78492948

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110987966.9A Active CN113652474B (en) 2021-08-26 2021-08-26 Detection method for copy number variation of exon of DMD gene and application thereof

Country Status (1)

Country Link
CN (1) CN113652474B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114717304A (en) * 2022-03-25 2022-07-08 郑州大学第一附属医院 Method for quantitatively detecting copy number of NR0B1 gene by fluorescence, kit and application

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104498614A (en) * 2014-12-31 2015-04-08 广州和泰科技有限公司 Probe and non-invasive kit for detecting pseudo-hypertrophic muscular dystrophy
CN110527720A (en) * 2019-08-29 2019-12-03 北京华瑞康源生物科技发展有限公司 A kind of amplification system and its kit copying number variation for detecting DMD gene extron
CN111218506A (en) * 2020-03-03 2020-06-02 胜亚生物科技(厦门)有限公司 Detection kit for copy numbers of SMN1 and SMN2 genes
CN112410410A (en) * 2020-05-12 2021-02-26 上海市儿童医院 Copy number variation detection kit for DMD and SMA based on MLPA-NGS technology and application thereof
CN112430645A (en) * 2020-12-09 2021-03-02 北京华瑞康源生物科技发展有限公司 Relative quantitative method and kit for detecting human DMD gene copy number by multiple real-time fluorescence PCR method

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015050581A1 (en) * 2013-04-19 2015-04-09 Cedars-Sinai Medical Center Phosphodiesterase 5a inhibitors for the treatment of muscular dystrophy
US20200327957A1 (en) * 2017-12-14 2020-10-15 Ancestry.Com Dna, Llc Detection of deletions and copy number variations in dna sequences

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104498614A (en) * 2014-12-31 2015-04-08 广州和泰科技有限公司 Probe and non-invasive kit for detecting pseudo-hypertrophic muscular dystrophy
CN110527720A (en) * 2019-08-29 2019-12-03 北京华瑞康源生物科技发展有限公司 A kind of amplification system and its kit copying number variation for detecting DMD gene extron
CN111218506A (en) * 2020-03-03 2020-06-02 胜亚生物科技(厦门)有限公司 Detection kit for copy numbers of SMN1 and SMN2 genes
CN112410410A (en) * 2020-05-12 2021-02-26 上海市儿童医院 Copy number variation detection kit for DMD and SMA based on MLPA-NGS technology and application thereof
CN112430645A (en) * 2020-12-09 2021-03-02 北京华瑞康源生物科技发展有限公司 Relative quantitative method and kit for detecting human DMD gene copy number by multiple real-time fluorescence PCR method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Xingjian Zhong等.DMD/BMD prenatal diagnosis and treatment expectation in a single centre in China for 15 years.BMC Med Genomics.2021,第14卷181. *

Also Published As

Publication number Publication date
CN113652474A (en) 2021-11-16

Similar Documents

Publication Publication Date Title
CN109207579B (en) Multiple detection kit for detecting malignant high fever susceptibility gene and application thereof
CN111073961A (en) High-throughput detection method for gene rare mutation
CN111304320A (en) Primer sequence and kit for detecting safe medication gene of children
CN108913757B (en) Primer group and detection kit for chromosome aneuploid number abnormality and application thereof
CN108070658B (en) Non-diagnostic method for detecting MSI
CN106367491A (en) Kit for detecting deafness susceptibility genes
CN116287192A (en) Kit for integrating SMN1 and SMN2 copy number, minor variation and family linkage analysis and application thereof
CN113025701B (en) Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene
CN111118138A (en) Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR
CN109694907B (en) Noninvasive prenatal screening trisomy syndrome kit and application thereof
CN112430645A (en) Relative quantitative method and kit for detecting human DMD gene copy number by multiple real-time fluorescence PCR method
CN113652474B (en) Detection method for copy number variation of exon of DMD gene and application thereof
CN109797203A (en) Helicobacter pylori detection architecture and detection kit and application
CN111893173A (en) Primer, method and kit for detecting PEAR1 SNP locus
CN109207600A (en) The method and system of affiliation between identification biological sample
CN112280849B (en) Composite amplification system and kit for anti-depression individualized medication genotyping detection
CN112553325B (en) Guiding method and kit for personalized medicine gene of sufentanil
CN101671736B (en) Gene detection kit used for detecting cell chimerism or individual recognition
CN111334568A (en) Multiple connection probe amplification probe combination and kit for screening congenital heart disease gene copy number variation and susceptible persons
CN116970722A (en) Method for simultaneously identifying helicobacter pylori infection and detecting drug-resistant gene mutation site, primer probe composition, application and kit
CN114717303B (en) Primer group, kit and application for detecting osteogenesis imperfecta related genes based on multiplex PCR and high throughput sequencing technology
CN108192969B (en) Marker for assisting epilepsy diagnosis and detection kit thereof
CN112501283A (en) Guiding method and kit for carbamazepine personalized medicine gene
CN113025702A (en) Early screening method and kit for ankylosing spondylitis susceptibility genes
CN113736876B (en) Kit for rapidly detecting chromosome number abnormality and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant