CN108192969B - Marker for assisting epilepsy diagnosis and detection kit thereof - Google Patents

Abstract

The invention discloses a marker for assisting epilepsy diagnosis and a detection kit thereof, and relates to the field of epilepsy diagnosis. The research of the invention discovers that the FASN gene of a member of a patient with epilepsy in a pedigree of epilepsy has mutation c.G2998A on the FASN gene of the member with epilepsy, and the mutation of the gene causes the 1000 th amino acid of the corresponding FASN protein to be changed from asparagine (D) to asparagine (N) to be missense mutation. The nucleic acid molecule containing the c.G2998A mutation or the protein containing the p.D1000N mutation can be used as a biomarker for diagnosing epilepsy, and a quick and reliable detection auxiliary marker is provided for diagnosing epilepsy on a molecular level.

Description

Marker for assisting epilepsy diagnosis and detection kit thereof

Technical Field

The invention relates to the field of epilepsy diagnosis, in particular to a marker for assisting epilepsy diagnosis and a detection kit thereof.

Background

Epilepsy is a chronic recurrent transient brain dysfunction syndrome. Is characterized by recurrent epileptic seizures caused by highly synchronized abnormal firing of brain neurons. Epilepsy is one of the common diseases of the nervous system, and the prevalence rate is second to stroke. The incidence of epilepsy is age-related. Generally, the prevalence rate is highest within 1 year of age, and gradually decreases after 1-10 years of age. The ratio of male to female of epileptic patients in China is (1.15-1.7) to 1.

The etiology of epilepsy is extremely complex, and can be divided into three major categories, and there are various factors affecting the onset of epilepsy:

1. idiopathic epilepsy

The suspected hereditary tendency has no other obvious causes, the disease often starts in a specific age group, and the diagnosis is more definite due to characteristic clinical and electroencephalogram manifestations.

2. Symptomatic epilepsy

Central nervous system disorders affect structure or function, such as chromosomal abnormalities, focal or diffuse brain diseases, and certain systemic diseases.

(1) The local or diffuse brain diseases (congenital abnormal embryo development) include cerebral punch through deformity, microcephaly, congenital hydrocephalus corpus callosum deficiency, cerebral cortical hypoplasia, perinatal fetal brain injury and the like caused by various reasons; ② acquired brain injuries such as brain trauma, after craniocerebral surgery, after stroke, after intracranial infection, acute alcoholism; ③ the incidence rate of the newborn epilepsy caused by birth injury is about 1 percent, the birth injury is combined with cerebral hemorrhage or cerebral anoxia damage during the delivery, the newborn is combined with cerebral congenital development deformity or birth injury, and the incidence rate of the epilepsy is up to 25 percent; infection includes central nervous system bacteria, virus, fungus, parasite, spirochete infection, AIDS nervous system complication, etc.; cerebrovascular diseases such as cerebral arteriovenous malformation, cerebral infarction, cerebral hemorrhage, etc.; sixthly, intracranial primary tumors such as glioma, meningioma and the like; seventhly, hereditary metabolic diseases such as tuberous sclerosis, brain-surface angioma, phenylketonuria and the like; about 1/3 patients with nervous system degenerative diseases such as Alzheimer's disease and Pick's disease have combined epileptic seizures.

(2) Systemic diseases including hypoxic encephalopathy, such as cardiac arrest, CO poisoning asphyxia, anesthesia accident, respiratory failure, etc. may cause myoclonic attack or systemic grand attack; ② metabolic encephalopathy such as hypoglycemia, other metabolic and endocrine disorders such as hyperglycemia, hypocalcemia, hyponatremia, uremia, hepatic encephalopathy, thyrotoxicemia and the like can cause epileptic seizure; ③ cardiovascular diseases such as sudden cardiac arrest, hypertensive encephalopathy, etc.; fourthly, febrile convulsion and febrile attack; eclampsia; sixthly, poisoning caused by drugs such as alcohol, isoniazid, carbazolyl and the like and heavy metal poisoning caused by lead, thallium and the like.

3. Implicit epilepsy

More often, the clinical manifestations suggest symptomatic epilepsy, but no clear etiology is found, and the disease can be initiated in a special age group without specific clinical and electroencephalogram manifestations.

The clinical manifestations of epilepsy are as follows:

1. general tonic-clonic attack (grand attack)

Refers to the onset of muscle twitching and loss of consciousness throughout the body. It is common to produce wound, brain trauma, brain tumor, etc. Tonic-clonic seizures can occur at any age and are the most common type of seizure in a variety of epilepsies. The typical attack can be divided into three clinical stages, namely a strong and straight stage, a clonic stage and a recovery stage. Electroencephalography during an attack is typical of explosive multi-spike and spine-slow wave syndromes, each of which may be accompanied by a muscle beat.

2. Simple partial attack

It refers to the symptoms corresponding to the function of the part caused by abnormal discharge of the local cortex of the brain, and consciousness always exists during the attack, including motor, sensory, autonomic nerve, mental symptoms and physical signs. The method is divided into four groups: those with motor symptoms; ② those with somatic or special sensory symptoms; ③ those accompanied with autonomic nervous symptoms and physical signs; and those with mental symptoms.

3. Complicated part of attack

Habitually, it is also called psychomotor attack, accompanied by disturbance of consciousness. Aura usually occurs before or about the loss of consciousness, and after onset, details of the onset cannot or cannot be partly recalled. 4. Absence episode (small episode)

It typically manifests as a disturbance of consciousness without aura or post-attack symptoms.

5. Status of epilepsy persistence

Refers to a single seizure that is more than 5 minutes, or a short period of frequent seizures, such that the patient has not yet fully recovered from the previous seizure but has another seizure. Status epilepticus is an acute condition requiring rescue.

The treatment of epilepsy can be divided into five aspects of seizure control, etiological treatment, surgical treatment, general hygiene and prevention. The most important of them is the control of the attack, which is currently dominated by drug therapy.

Clinically, antiepileptic drugs are selected according to the type of epileptic seizure, and once a drug and a dosage which can completely control the seizure are found, the drugs and the dosage should be applied uninterruptedly. Generally, after the onset is completely controlled, if the patient does not have adverse reaction and then continues to take the medicine for 3-5 years, the patient should be gradually stopped taking the medicine. At present, single-drug therapy is advocated, and after the single-drug therapy fails, the 2 nd drug can be added. For example, for those who have failed to control the absence or myoclonus, ethosuximide and sodium valproate can be used together, or benzodiazepines can be added. The patients with various attack types can be combined reasonably according to the attack types, but the drug is preferably not more than 3 drugs.

Administration is preferably started with a small dose and then gradually increased to a minimum effective dose that will control the onset of the attack and not produce a toxic response. The principle of adding new drugs first and then decreasing old ones should be adopted for changing the drugs. The medicine can not be stopped suddenly.

Some epileptic patients with organic encephalopathy may need to take medicine for life; people advocate that patients with disease age over 30 years need to take the medicine carefully, and the relapse rate is high after the medicine is stopped, so the patients need to take the medicine for a long time or for life. However, the attack is still difficult to control in 10-15% of patients and surgical treatment can be adopted.

In terms of prevention:

1. the occurrence of epilepsy is prevented, family investigation is conducted in detail, whether epileptic seizures and seizure characteristics exist in parents and relatives of a patient are known, and prenatal diagnosis or screening examination in the neonatal period is conducted on some serious hereditary diseases which can cause mental retardation and epilepsy to decide to terminate pregnancy or treat early. The parturition accident is prevented, the birth injury of the newborn is one of important reasons of the epilepsia, and the avoidance of the birth injury has important significance for preventing the epilepsia.

2. Timely diagnosis and early treatment are needed for epileptics, the earlier the treatment is, the smaller the brain injury is, the less the relapse is, and the better the prognosis is. The method can remove or relieve the primary diseases causing epilepsy, such as intracranial space occupying diseases, metabolic disorder, infection and the like, and has important significance for repeated attack cases.

3. Epilepsy is a chronic disease, which can last for years, even decades, and thus can cause serious adverse effects on the body, spirit, marital and socioeconomic status of patients. The unfortunate and frustrated aspects of family relations, school education, employment and the like of patients, the limitation on cultural activities and the like can cause the patients to have a stigma and pessimistic mind, so that the physical and mental development of the patients is seriously affected, and the understanding and the support of epileptic patients are required by various social communities.

Early diagnosis and early treatment are effective methods for preventing and treating epilepsy, but markers related to epilepsy diagnosis are lacked at present.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a biomarker for assisting epilepsy diagnosis, which can be used for assisting epilepsy diagnosis and provides a new idea for epilepsy diagnosis.

It is another object of the present invention to provide the use of the above biomarkers.

The invention also aims to provide a kit for assisting epilepsy diagnosis.

The invention also aims to provide a gene chip for assisting epilepsy diagnosis.

The invention is realized by the following steps:

in a first aspect, the present invention provides a biomarker for aiding diagnosis of epilepsy, which is a nucleic acid molecule having the mutation c.g2998a relative to the coding sequence of normal FASN.

The enzyme encoded by the FASN gene is a multifunctional protein whose main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, which ultimately produces long-chain saturated fatty acids in the presence of NADPH. In some cancer cell lines, the N-terminus of the protein binds to the C-terminus of estrogen receptor- α (ER- α).

Further, in some embodiments of the present invention, the base sequence of the marker is shown in SEQ ID NO. 1.

The research of the invention finds that the FASN of the members of a patient with epilepsy family has mutation c.G2998A through the detection and sequencing of FASN of the members in the family, and the gene mutation causes the 1000 th amino acid of the corresponding FASN protein to be changed from asparagine (D) to asparagine (N) to be missense mutation. This variation does not belong to polymorphic sites and occurs very infrequently in the human population. No report is found in the database of HGMD professional edition. Through family verification analysis, the site of father (member No.2 in FIG. 1) of the examinee (member No. 3 in FIG. 1) has no variation, and the site of mother (member No.1 in FIG. 1) of the examinee has heterozygous variation.

Therefore, the nucleic acid molecule containing the c.G2998A mutation, namely the nucleic acid fragment containing the c.G2998A mutation relative to the coding sequence of normal FASN, or the protein containing the p.D1000N mutation can be used as a biomarker for epilepsy diagnosis, and provides a quick and reliable detection auxiliary marker for the epilepsy diagnosis on a molecular level.

In a second aspect, the present invention provides a biomarker for aiding diagnosis of epilepsy, which is a protein or polypeptide having a mutation p.d1000n relative to a normal FASN protein.

Further, in some embodiments of the invention, the amino acid sequence of the marker is as shown in SEQ ID No. 2.

In another aspect, the invention provides a primer or probe for detecting the marker of the first aspect, or an antibody against the biomarker of the second aspect, for use in preparing an epilepsy-assisted diagnosis kit, an epilepsy prenatal diagnosis kit, or a neonatal epilepsy screening kit.

Based on the research results of the present invention, those skilled in the art should easily use primers or probes for detecting the FASN mutant gene containing the c.g2998a mutation, and antibodies for detecting the FASN mutant protein containing the p.d1000n mutation in the fields of preparing epilepsy auxiliary diagnostic kits, epilepsy prenatal diagnostic kits, and neonatal epilepsy screening kits.

Or the probe for detecting the FASN mutant gene containing the c.G2998A mutation is used for preparing a gene chip for assisting epilepsy diagnosis.

Further, in some embodiments of the invention, the probe is a relative to the base at position 2998 of the coding sequence of normal FASN.

In another aspect, the present invention provides a kit for assisting diagnosis of epilepsy, comprising a primer or a probe for detecting the biomarker according to the first aspect;

or the kit contains an antibody that detects a biomarker according to the second aspect.

In another aspect, the present invention provides a gene chip for assisting epilepsy diagnosis, which comprises a probe for specifically binding to a target fragment having a mutation c.G2998A relative to the coding sequence of normal FASN.

The region of the probe that specifically binds to the target fragment encompasses the following positions: 2998 relative to normal FASN.

Further, in some embodiments of the invention, the probe is a relative to the base at position 2998 of the normal FASN coding sequence.

Further, in some embodiments of the invention, the target fragment is the coding sequence of FASN from the subject to be tested.

Further, in some embodiments of the invention, the subject is a human.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a genetic pedigree map of the pedigree of an epileptic patient of a subject in example 1 of the present invention;

FIG. 2-A is a drawing showing the result of FASN sequencing of member No. 3 in the genetic pedigree map in example 1 of the present invention;

FIG. 2-B is a drawing showing the result of FASN sequencing of Member No.1 in the genealogical map in example 1 of the present invention;

FIG. 2-C is a drawing showing the result of FASN sequencing of Member number 2 in the genealogical map in example 1 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

1 FASN mutation detection in epileptic families

1.1 object: the genetic map of the family is shown in figure 1, and detection objects comprise 2 epileptics (member 13 in the figure) and 1 normal family member (member 2 in the figure); no.1, No. 3: comprehensive tonic-clonic attacks; no. 2: the disease is not present. All family members, number 1-3, were subjected to detailed physical examination and each collected a blood sample after signing an informed consent.

1.2 sequencing:

the collected blood samples are sent to Beijing Makino gene science and technology Limited company for sequencing to carry out epileptic gene mutation screening and verification, and the relationship between clinical phenotype and genotype is analyzed, and the results are as follows:

the determined sequences were aligned with the normal FASN standard sequence (https:// www.ncbi.nlm.nih.gov/nuccore/NM-004104.4), and the sequencing results are shown in FIG. 2-A, with 1 heterozygous mutation in the proband, member number 4 FASN: c.2998G > A (nucleotide 2998 of the coding region is mutated from guanine to thymine), the amino acid is changed from p.D1000N (the 1000 th amino acid is mutated from aspartic acid (D) to asparagine (N)), and the missense mutation is obtained. This variation does not belong to polymorphic sites and occurs very infrequently in the human population. No report is found in the database of HGMD professional edition. Through family verification and analysis, the data is not reported in the HGMD professional version database. Through family verification analysis, the site of father (member No.2 in FIG. 1) of the examinee (member No. 3 in FIG. 1) has no variation, and the site of mother (member No.1 in FIG. 1) of the examinee has heterozygous variation. In FIGS. 2A-C, arrows indicate the sequencing results at 2998 site of FASN, the sequencing results of members No.1 and 3 at this site are both heterozygous mutations (the genotype is GT type), and the sequencing results of member No.2 at this site are no mutations (the genotype is GG type).

c.2998G > A variation information is as follows:

DNA variation information: (the clinical significance is not clear and is for reference)

In conclusion, it can be seen that the 2998 site mutation G > a of the FASN gene is related to epileptogenesis, and this site can be used as a target for auxiliary diagnosis of epileptic diseases, and both the nucleic acid fragment containing this mutation c.g2998a and the corresponding FASN protein having the mutation p.d1000n can be used as biomarkers for auxiliary diagnosis of epileptic diseases. Accordingly, probes, primers or other reagents for detecting a nucleic acid fragment containing the mutation c.G2998A, antibodies for detecting FASN protein containing the mutation p.D1000N, and the like can be used for preparing a preparation kit for assisting the diagnosis of epileptic diseases.

Example 2

This example provides a kit for detecting a mutation at position 2998 of FASN, comprising: primers used to detect whether the mutation at the FASN2998 site G2998A occurred, forward primer: AAGCTGCATGCCTAGCTGTG, reverse primer: GAACGGCAACCTGGTAGTGAG, respectively; and PCR amplification reagents: 10 Xbuffer (15 mM Mg)²⁺) dNTP (2.5Mm), high fidelity DNA polymerase pfu DNA polymerase (5U/. mu.l) and ddH₂O。

The method for detecting whether the position 2998 of FASN generates the mutation G > A by using the kit mainly comprises the following steps:

(1) the sample DNA was extracted and used as a template to perform PCR reaction using the PCR reaction kit.

(2) And (3) detecting a multiplex PCR product: and (3) carrying out electrophoresis on the PCR amplification product by using agarose gel to detect whether the PCR amplification is successful or not, wherein the amplification length is 385 bp.

(3) And (3) directly sequencing the PCR product, and comparing the sequencing result with the normal FASN sequence to judge whether the 2998 th site of the FASN gene of the sample to be detected has mutation G > A.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Chongqing medical university affiliated first hospital

<120> marker for assisting epilepsy diagnosis and detection kit thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 7536

<212> DNA

<213> Artificial sequence

<400> 1

atggaggagg tggtgattgc cggcatgtcc gggaagctgc cagagtcgga gaacttgcag 60

gagttctggg acaacctcat cggcggtgtg gacatggtca cggacgatga ccgtcgctgg 120

aaggcggggc tctacggcct gccccggcgg tccggcaagc tgaaggacct gtctaggttt 180

gatgcctcct tcttcggagt ccaccccaag caggcacaca cgatggaccc tcagctgcgg 240

ctgctgctgg aagtcaccta tgaagccatc gtggacggag gcatcaaccc agattcactc 300

cgaggaacac acactggcgt ctgggtgggc gtgagcggct ctgagacctc ggaggccctg 360

agccgagacc ccgagacact cgtgggctac agcatggtgg gctgccagcg agcgatgatg 420

gccaaccggc tctccttctt cttcgacttc agagggccca gcatcgcact ggacacagcc 480

tgctcctcca gcctgatggc cctgcagaac gcctaccagg ccatccacag cgggcagtgc 540

cctgccgcca tcgtgggggg catcaatgtc ctgctgaagc ccaacacctc cgtgcagttc 600

ttgaggctgg ggatgctcag ccccgagggc acctgcaagg ccttcgacac agcggggaat 660

gggtactgcc gctcggaggg tgtggtggcc gtcctgctga ccaagaagtc cctggcccgg 720

cgggtgtacg ccaccatcct gaacgccggc accaatacag atggcttcaa ggagcaaggc 780

gtgaccttcc cctcagggga tatccaggag cagctcatcc gctcgttgta ccagtcggcc 840

ggagtggccc ctgagtcatt tgaatacatc gaagcccacg gcacaggcac caaggtgggc 900

gacccccagg agctgaatgg catcacccga gccctgtgcg ccacccgcca ggagccgctg 960

ctcatcggct ccaccaagtc caacatgggg cacccggagc cagcctcggg gctggcagcc 1020

ctggccaagg tgctgctgtc cctggagcac gggctctggg cccccaacct gcacttccat 1080

agccccaacc ctgagatccc agcgctgttg gatgggcggc tgcaggtggt ggaccagccc 1140

ctgcccgtcc gtggcggcaa cgtgggcatc aactcctttg gcttcggggg ctccaacgtg 1200

cacatcatcc tgaggcccaa cacgcagccg ccccccgcac ccgccccaca tgccaccctg 1260

ccccgtctgc tgcgggccag cggacgcacc cctgaggccg tgcagaagct gctggagcag 1320

ggcctccggc acagccagga cctggctttc ctgagcatgc tgaacgacat cgcggctgtc 1380

cccgccaccg ccatgccctt ccgtggctac gctgtgctgg gtggtgagcg cggtggccca 1440

gaggtgcagc aggtgcccgc tggcgagcgc ccgctctggt tcatctgctc tgggatgggc 1500

acacagtggc gcgggatggg gctgagcctc atgcgcctgg accgcttccg agattccatc 1560

ctacgctccg atgaggctgt gaagccattc ggcctgaagg tgtcacagct gctgctgagc 1620

acagacgaga gcacctttga tgacatcgtc cattcgtttg tgagcctgac tgccatccag 1680

ataggcctca tagacctgct gagctgcatg gggctgaggc cagatggcat cgtcggccac 1740

tccctggggg aggtggcctg tggctacgcc gacggctgcc tgtcccagga ggaggccgtc 1800

ctcgctgcct actggagggg acagtgcatc aaagaagccc atctcccgcc gggcgccatg 1860

gcagccgtgg gcttgtcctg ggaggagtgt aaacagcgct gccccccggg cgtggtgccc 1920

gcctgccaca actccaagga cacagtcacc atctcgggac ctcaggcccc ggtgtttgag 1980

ttcgtggagc agctgaggaa ggagggtgtg tttgccaagg aggtgcggac cggcggtatg 2040

gccttccact cctacttcat ggaggccatc gcacccccac tgctgcagga gctcaagaag 2100

gtgatccggg agccgaagcc acgttcagcc cgctggctca gcacctctat ccccgaggcc 2160

cagtggcaca gcagcctggc acgcacgtcc tccgccgagt acaatgtcaa caacctggtg 2220

agccctgtgc tgttccagga ggccctgtgg cacgtgcctg agcacgcggt ggtgctggag 2280

atcgcgcccc acgccctgct gcaggctgtc ctgaagcgtg gcctgaagcc gagctgcacc 2340

atcatccccc tgatgaagaa ggatcacagg gacaacctgg agttcttcct ggccggcatc 2400

ggcaggctgc acctctcagg catcgacgcc aaccccaatg ccttgttccc acctgtggag 2460

ttcccagctc cccgaggaac tcccctcatc tccccactca tcaagtggga ccacagcctg 2520

gcctgggacg tgccggccgc cgaggacttc cccaacggtt caggttcccc ctcagccgcc 2580

atctacaaca tcgacaccag ctccgagtct cctgaccact acctggtgga ccacaccctc 2640

gacggtcgcg tcctcttccc cgccactggc tacctgagca tagtgtggaa gacgctggcc 2700

cgcgccctgg gcctgggcgt cgagcagctg cctgtggtgt ttgaggatgt ggtgctgcac 2760

caggccacca tcctgcccaa gactgggaca gtgtccctgg aggtacggct cctggaggcc 2820

tcccgtgcct tcgaggtgtc agagaacggc aacctggtag tgagtgggaa ggtgtaccag 2880

tgggatgacc ctgaccccag gctcttcgac cacccggaaa gccccacccc caaccccacg 2940

gagcccctct tcctggccca ggctgaagtt tacaaggagc tgcgtctgcg tggctacaac 3000

tacggccctc atttccaggg catcctggag gccagcctgg aaggtgactc ggggaggctg 3060

ctgtggaagg ataactgggt gagcttcatg gacaccatgc tgcagatgtc catcctgggc 3120

tcggccaagc acggcctgta cctgcccacc cgtgtcaccg ccatccacat cgaccctgcc 3180

acccacaggc agaagctgta cacactgcag gacaaggccc aagtggctga cgtggtggtg 3240

agcaggtggc tgagggtcac agtggccgga ggcgtccaca tctccgggct ccacactgag 3300

tcggccccgc ggcggcagca ggagcagcag gtgcccatcc tggagaagtt ttgcttcact 3360

ccccacacgg aggaggggtg cctgtctgag cgcgctgccc tgcaggagga gctgcaactg 3420

tgcaaggggc tggtgcaggc actgcagacc aaggtgaccc agcaggggct gaagatggtg 3480

gtgcccggac tggatggggc ccagatcccc cgggacccct cacagcagga actgccccgg 3540

ctgttgtcgg ctgcctgcag gcttcagctc aacgggaacc tgcagctgga gctggcgcag 3600

gtgctggccc aggagaggcc caagctgcca gaggaccctc tgctcagcgg cctcctggac 3660

tccccggcac tcaaggcctg cctggacact gccgtggaga acatgcccag cctgaagatg 3720

aaggtggtgg aggtgctggc tggccacggt cacctgtatt cccgcatccc aggcctgctc 3780

agcccccatc ccctgctgca gctgagctac acggccaccg accgccaccc ccaggccctg 3840

gaggctgccc aggccgagct gcagcagcac gacgttgccc agggccagtg ggatcccgca 3900

gaccctgccc ccagcgccct gggcagcgcc gacctcctgg tgtgcaactg tgctgtggct 3960

gccctcgggg acccggcctc agctctcagc aacatggtgg ctgccctgag agaagggggc 4020

tttctgctcc tgcacacact gctccggggg caccccctcg gggacatcgt ggccttcctc 4080

acctccactg agccgcagta tggccagggc atcctgagcc aggacgcgtg ggagagcctc 4140

ttctccaggg tgtcgctgcg cctggtgggc ctgaagaagt ccttctacgg ctccacgctc 4200

ttcctgtgcc gccggcccac cccgcaggac agccccatct tcctgccggt ggacgatacc 4260

agcttccgct gggtggagtc tctgaagggc atcctggctg acgaagactc ttcccggcct 4320

gtgtggctga aggccatcaa ctgtgccacc tcgggcgtgg tgggcttggt gaactgtctc 4380

cgccgagagc ccggcgggaa ccgcctccgg tgtgtgctgc tctccaacct cagcagcacc 4440

tcccacgtcc cggaggtgga cccgggctcc gcagaactgc agaaggtgtt gcagggagac 4500

ctggtgatga acgtctaccg cgacggggcc tggggggctt tccgccactt cctgctggag 4560

gaggacaagc ctgaggagcc gacggcacat gcctttgtga gcaccctcac ccggggggac 4620

ctgtcctcca tccgctgggt ctgctcctcg ctgcgccatg cccagcccac ctgccctggc 4680

gcccagctct gcacggtcta ctacgcctcc ctcaacttcc gcgacatcat gctggccact 4740

ggcaagctgt cccctgatgc catcccaggg aagtggacct cccaggacag cctgctaggt 4800

atggagttct cgggccgaga cgccagcggc aagcgtgtga tgggactggt gcctgccaag 4860

ggcctggcca cctctgtcct gctgtcaccg gacttcctct gggatgtgcc ttccaactgg 4920

acgctggagg aggcggcctc ggtgcctgtc gtctacagca cggcctacta cgcgctggtg 4980

gtgcgtgggc gggtgcgccc cggggagacg ctgctcatcc actcgggctc gggcggcgtg 5040

ggccaggccg ccatcgccat cgccctcagt ctgggctgcc gcgtcttcac caccgtgggg 5100

tcggctgaga agcgggcgta cctccaggcc aggttccccc agctcgacag caccagcttc 5160

gccaactccc gggacacatc cttcgagcag catgtgctgt ggcacacggg cgggaagggc 5220

gttgacctgg tcttgaactc cttggcggaa gagaagctgc aggccagcgt gaggtgcttg 5280

gctacgcacg gtcgcttcct ggaaattggc aaattcgacc tttctcagaa ccacccgctc 5340

ggcatggcta tcttcctgaa gaacgtgaca ttccacgggg tcctactgga tgcgttcttc 5400

aacgagagca gtgctgactg gcgggaggtg tgggcgcttg tgcaggccgg catccgggat 5460

ggggtggtac ggcccctcaa gtgcacggtg ttccatgggg cccaggtgga ggacgccttc 5520

cgctacatgg cccaagggaa gcacattggc aaagtcgtcg tgcaggtgct tgcggaggag 5580

ccggaggcag tgctgaaggg ggccaaaccc aagctgatgt cggccatctc caagaccttc 5640

tgcccggccc acaagagcta catcatcgct ggtggtctgg gtggcttcgg cctggagttg 5700

gcgcagtggc tgatacagcg tggggtgcag aagctcgtgt tgacttctcg ctccgggatc 5760

cggacaggct accaggccaa gcaggtccgc cggtggaggc gccagggcgt acaggtgcag 5820

gtgtccacca gcaacatcag ctcactggag ggggcccggg gcctcattgc cgaggcggcg 5880

cagcttgggc ccgtgggcgg cgtcttcaac ctggccgtgg tcttgagaga tggcttgctg 5940

gagaaccaga ccccagagtt cttccaggac gtctgcaagc ccaagtacag cggcaccctg 6000

aacctggaca gggtgacccg agaggcgtgc cctgagctgg actactttgt ggtcttctcc 6060

tctgtgagct gcgggcgtgg caatgcggga cagagcaact acggctttgc caattccgcc 6120

atggagcgta tctgtgagaa acgccggcac gaaggcctcc caggcctggc cgtgcagtgg 6180

ggcgccatcg gcgacgtggg cattttggtg gagacgatga gcaccaacga cacgatcgtc 6240

agtggcacgc tgccccagcg catggcgtcc tgcctggagg tgctggacct cttcctgaac 6300

cagccccaca tggtcctgag cagctttgtg ctggctgaga aggctgcggc ctatagggac 6360

agggacagcc agcgggacct ggtggaggcc gtggcacaca tcctgggcat ccgcgacttg 6420

gctgctgtca acctggacag ctcactggcg gacctgggcc tggactcgct catgagcgtg 6480

gaggtgcgcc agacgctgga gcgtgagctc aacctggtgc tgtccgtgcg cgaggtgcgg 6540

caactcacgc tccggaaact gcaggagctg tcctcaaagg cggatgaggc cagcgagctg 6600

gcatgcccca cgcccaagga ggatggtctg gcccagcagc agactcagct gaacctgcgc 6660

tccctgctgg tgaacccgga gggccccacc ctgatgcggc tcaactccgt gcagagctcg 6720

gagcggcccc tgttcctggt gcacccaatc gagggctcca ccaccgtgtt ccacagcctg 6780

gcctcccggc tcagcatccc cacctatggc ctgcagtgca cccgagctgc gccccttgac 6840

agcatccaca gcctggctgc ctactacatc gactgcatca ggcaggtgca gcccgagggc 6900

ccctaccgcg tggccggcta ctcctacggg gcctgcgtgg cctttgaaat gtgctcccag 6960

ctgcaggccc agcagagccc agcccccacc cacaacagcc tcttcctgtt cgacggctcg 7020

cccacctacg tactggccta cacccagagc taccgggcaa agctgacccc aggctgtgag 7080

gctgaggctg agacggaggc catatgcttc ttcgtgcagc agttcacgga catggagcac 7140

aacagggtgc tggaggcgct gctgccgctg aagggcctag aggagcgtgt ggcagccgcc 7200

gtggacctga tcatcaagag ccaccagggc ctggaccgcc aggagctgag ctttgcggcc 7260

cggtccttct actacaagct gcgtgccgct gagcagtaca cacccaaggc caagtaccat 7320

ggcaacgtga tgctactgcg cgccaagacg ggtggcgcct acggcgagga cctgggcgcg 7380

gactacaacc tctcccaggt atgcgacggg aaagtatccg tccacgtcat cgagggtgac 7440

caccgcacgc tgctggaggg cagcggcctg gagtccatca tcagcatcat ccacagctcc 7500

ctggctgagc cacgcgtgag cgtgcgggag ggctag 7536

<210> 2

<211> 2511

<212> PRT

<213> Artificial sequence

<400> 2

Met Glu Glu Val Val Ile Ala Gly Met Ser Gly Lys Leu Pro Glu Ser

1 5 10 15

Glu Asn Leu Gln Glu Phe Trp Asp Asn Leu Ile Gly Gly Val Asp Met

20 25 30

Val Thr Asp Asp Asp Arg Arg Trp Lys Ala Gly Leu Tyr Gly Leu Pro

35 40 45

Arg Arg Ser Gly Lys Leu Lys Asp Leu Ser Arg Phe Asp Ala Ser Phe

50 55 60

Phe Gly Val His Pro Lys Gln Ala His Thr Met Asp Pro Gln Leu Arg

65 70 75 80

Leu Leu Leu Glu Val Thr Tyr Glu Ala Ile Val Asp Gly Gly Ile Asn

85 90 95

Pro Asp Ser Leu Arg Gly Thr His Thr Gly Val Trp Val Gly Val Ser

100 105 110

Gly Ser Glu Thr Ser Glu Ala Leu Ser Arg Asp Pro Glu Thr Leu Val

115 120 125

Gly Tyr Ser Met Val Gly Cys Gln Arg Ala Met Met Ala Asn Arg Leu

130 135 140

Ser Phe Phe Phe Asp Phe Arg Gly Pro Ser Ile Ala Leu Asp Thr Ala

145 150 155 160

Cys Ser Ser Ser Leu Met Ala Leu Gln Asn Ala Tyr Gln Ala Ile His

165 170 175

Ser Gly Gln Cys Pro Ala Ala Ile Val Gly Gly Ile Asn Val Leu Leu

180 185 190

Lys Pro Asn Thr Ser Val Gln Phe Leu Arg Leu Gly Met Leu Ser Pro

195 200 205

Glu Gly Thr Cys Lys Ala Phe Asp Thr Ala Gly Asn Gly Tyr Cys Arg

210 215 220

Ser Glu Gly Val Val Ala Val Leu Leu Thr Lys Lys Ser Leu Ala Arg

225 230 235 240

Arg Val Tyr Ala Thr Ile Leu Asn Ala Gly Thr Asn Thr Asp Gly Phe

245 250 255

Lys Glu Gln Gly Val Thr Phe Pro Ser Gly Asp Ile Gln Glu Gln Leu

260 265 270

Ile Arg Ser Leu Tyr Gln Ser Ala Gly Val Ala Pro Glu Ser Phe Glu

275 280 285

Tyr Ile Glu Ala His Gly Thr Gly Thr Lys Val Gly Asp Pro Gln Glu

290 295 300

Leu Asn Gly Ile Thr Arg Ala Leu Cys Ala Thr Arg Gln Glu Pro Leu

305 310 315 320

Leu Ile Gly Ser Thr Lys Ser Asn Met Gly His Pro Glu Pro Ala Ser

325 330 335

Gly Leu Ala Ala Leu Ala Lys Val Leu Leu Ser Leu Glu His Gly Leu

340 345 350

Trp Ala Pro Asn Leu His Phe His Ser Pro Asn Pro Glu Ile Pro Ala

355 360 365

Leu Leu Asp Gly Arg Leu Gln Val Val Asp Gln Pro Leu Pro Val Arg

370 375 380

Gly Gly Asn Val Gly Ile Asn Ser Phe Gly Phe Gly Gly Ser Asn Val

385 390 395 400

His Ile Ile Leu Arg Pro Asn Thr Gln Pro Pro Pro Ala Pro Ala Pro

405 410 415

His Ala Thr Leu Pro Arg Leu Leu Arg Ala Ser Gly Arg Thr Pro Glu

420 425 430

Ala Val Gln Lys Leu Leu Glu Gln Gly Leu Arg His Ser Gln Asp Leu

435 440 445

Ala Phe Leu Ser Met Leu Asn Asp Ile Ala Ala Val Pro Ala Thr Ala

450 455 460

Met Pro Phe Arg Gly Tyr Ala Val Leu Gly Gly Glu Arg Gly Gly Pro

465 470 475 480

Glu Val Gln Gln Val Pro Ala Gly Glu Arg Pro Leu Trp Phe Ile Cys

485 490 495

Ser Gly Met Gly Thr Gln Trp Arg Gly Met Gly Leu Ser Leu Met Arg

500 505 510

Leu Asp Arg Phe Arg Asp Ser Ile Leu Arg Ser Asp Glu Ala Val Lys

515 520 525

Pro Phe Gly Leu Lys Val Ser Gln Leu Leu Leu Ser Thr Asp Glu Ser

530 535 540

Thr Phe Asp Asp Ile Val His Ser Phe Val Ser Leu Thr Ala Ile Gln

545 550 555 560

Ile Gly Leu Ile Asp Leu Leu Ser Cys Met Gly Leu Arg Pro Asp Gly

565 570 575

Ile Val Gly His Ser Leu Gly Glu Val Ala Cys Gly Tyr Ala Asp Gly

580 585 590

Cys Leu Ser Gln Glu Glu Ala Val Leu Ala Ala Tyr Trp Arg Gly Gln

595 600 605

Cys Ile Lys Glu Ala His Leu Pro Pro Gly Ala Met Ala Ala Val Gly

610 615 620

Leu Ser Trp Glu Glu Cys Lys Gln Arg Cys Pro Pro Gly Val Val Pro

625 630 635 640

Ala Cys His Asn Ser Lys Asp Thr Val Thr Ile Ser Gly Pro Gln Ala

645 650 655

Pro Val Phe Glu Phe Val Glu Gln Leu Arg Lys Glu Gly Val Phe Ala

660 665 670

Lys Glu Val Arg Thr Gly Gly Met Ala Phe His Ser Tyr Phe Met Glu

675 680 685

Ala Ile Ala Pro Pro Leu Leu Gln Glu Leu Lys Lys Val Ile Arg Glu

690 695 700

Pro Lys Pro Arg Ser Ala Arg Trp Leu Ser Thr Ser Ile Pro Glu Ala

705 710 715 720

Gln Trp His Ser Ser Leu Ala Arg Thr Ser Ser Ala Glu Tyr Asn Val

725 730 735

Asn Asn Leu Val Ser Pro Val Leu Phe Gln Glu Ala Leu Trp His Val

740 745 750

Pro Glu His Ala Val Val Leu Glu Ile Ala Pro His Ala Leu Leu Gln

755 760 765

Ala Val Leu Lys Arg Gly Leu Lys Pro Ser Cys Thr Ile Ile Pro Leu

770 775 780

Met Lys Lys Asp His Arg Asp Asn Leu Glu Phe Phe Leu Ala Gly Ile

785 790 795 800

Gly Arg Leu His Leu Ser Gly Ile Asp Ala Asn Pro Asn Ala Leu Phe

805 810 815

Pro Pro Val Glu Phe Pro Ala Pro Arg Gly Thr Pro Leu Ile Ser Pro

820 825 830

Leu Ile Lys Trp Asp His Ser Leu Ala Trp Asp Val Pro Ala Ala Glu

835 840 845

Asp Phe Pro Asn Gly Ser Gly Ser Pro Ser Ala Ala Ile Tyr Asn Ile

850 855 860

Asp Thr Ser Ser Glu Ser Pro Asp His Tyr Leu Val Asp His Thr Leu

865 870 875 880

Asp Gly Arg Val Leu Phe Pro Ala Thr Gly Tyr Leu Ser Ile Val Trp

885 890 895

Lys Thr Leu Ala Arg Ala Leu Gly Leu Gly Val Glu Gln Leu Pro Val

900 905 910

Val Phe Glu Asp Val Val Leu His Gln Ala Thr Ile Leu Pro Lys Thr

915 920 925

Gly Thr Val Ser Leu Glu Val Arg Leu Leu Glu Ala Ser Arg Ala Phe

930 935 940

Glu Val Ser Glu Asn Gly Asn Leu Val Val Ser Gly Lys Val Tyr Gln

945 950 955 960

Trp Asp Asp Pro Asp Pro Arg Leu Phe Asp His Pro Glu Ser Pro Thr

965 970 975

Pro Asn Pro Thr Glu Pro Leu Phe Leu Ala Gln Ala Glu Val Tyr Lys

980 985 990

Glu Leu Arg Leu Arg Gly Tyr Asn Tyr Gly Pro His Phe Gln Gly Ile

995 1000 1005

Leu Glu Ala Ser Leu Glu Gly Asp Ser Gly Arg Leu Leu Trp Lys

1010 1015 1020

Asp Asn Trp Val Ser Phe Met Asp Thr Met Leu Gln Met Ser Ile

1025 1030 1035

Leu Gly Ser Ala Lys His Gly Leu Tyr Leu Pro Thr Arg Val Thr

1040 1045 1050

Ala Ile His Ile Asp Pro Ala Thr His Arg Gln Lys Leu Tyr Thr

1055 1060 1065

Leu Gln Asp Lys Ala Gln Val Ala Asp Val Val Val Ser Arg Trp

1070 1075 1080

Leu Arg Val Thr Val Ala Gly Gly Val His Ile Ser Gly Leu His

1085 1090 1095

Thr Glu Ser Ala Pro Arg Arg Gln Gln Glu Gln Gln Val Pro Ile

1100 1105 1110

Leu Glu Lys Phe Cys Phe Thr Pro His Thr Glu Glu Gly Cys Leu

1115 1120 1125

Ser Glu Arg Ala Ala Leu Gln Glu Glu Leu Gln Leu Cys Lys Gly

1130 1135 1140

Leu Val Gln Ala Leu Gln Thr Lys Val Thr Gln Gln Gly Leu Lys

1145 1150 1155

Met Val Val Pro Gly Leu Asp Gly Ala Gln Ile Pro Arg Asp Pro

1160 1165 1170

Ser Gln Gln Glu Leu Pro Arg Leu Leu Ser Ala Ala Cys Arg Leu

1175 1180 1185

Gln Leu Asn Gly Asn Leu Gln Leu Glu Leu Ala Gln Val Leu Ala

1190 1195 1200

Gln Glu Arg Pro Lys Leu Pro Glu Asp Pro Leu Leu Ser Gly Leu

1205 1210 1215

Leu Asp Ser Pro Ala Leu Lys Ala Cys Leu Asp Thr Ala Val Glu

1220 1225 1230

Asn Met Pro Ser Leu Lys Met Lys Val Val Glu Val Leu Ala Gly

1235 1240 1245

His Gly His Leu Tyr Ser Arg Ile Pro Gly Leu Leu Ser Pro His

1250 1255 1260

Pro Leu Leu Gln Leu Ser Tyr Thr Ala Thr Asp Arg His Pro Gln

1265 1270 1275

Ala Leu Glu Ala Ala Gln Ala Glu Leu Gln Gln His Asp Val Ala

1280 1285 1290

Gln Gly Gln Trp Asp Pro Ala Asp Pro Ala Pro Ser Ala Leu Gly

1295 1300 1305

Ser Ala Asp Leu Leu Val Cys Asn Cys Ala Val Ala Ala Leu Gly

1310 1315 1320

Asp Pro Ala Ser Ala Leu Ser Asn Met Val Ala Ala Leu Arg Glu

1325 1330 1335

Gly Gly Phe Leu Leu Leu His Thr Leu Leu Arg Gly His Pro Leu

1340 1345 1350

Gly Asp Ile Val Ala Phe Leu Thr Ser Thr Glu Pro Gln Tyr Gly

1355 1360 1365

Gln Gly Ile Leu Ser Gln Asp Ala Trp Glu Ser Leu Phe Ser Arg

1370 1375 1380

Val Ser Leu Arg Leu Val Gly Leu Lys Lys Ser Phe Tyr Gly Ser

1385 1390 1395

Thr Leu Phe Leu Cys Arg Arg Pro Thr Pro Gln Asp Ser Pro Ile

1400 1405 1410

Phe Leu Pro Val Asp Asp Thr Ser Phe Arg Trp Val Glu Ser Leu

1415 1420 1425

Lys Gly Ile Leu Ala Asp Glu Asp Ser Ser Arg Pro Val Trp Leu

1430 1435 1440

Lys Ala Ile Asn Cys Ala Thr Ser Gly Val Val Gly Leu Val Asn

1445 1450 1455

Cys Leu Arg Arg Glu Pro Gly Gly Asn Arg Leu Arg Cys Val Leu

1460 1465 1470

Leu Ser Asn Leu Ser Ser Thr Ser His Val Pro Glu Val Asp Pro

1475 1480 1485

Gly Ser Ala Glu Leu Gln Lys Val Leu Gln Gly Asp Leu Val Met

1490 1495 1500

Asn Val Tyr Arg Asp Gly Ala Trp Gly Ala Phe Arg His Phe Leu

1505 1510 1515

Leu Glu Glu Asp Lys Pro Glu Glu Pro Thr Ala His Ala Phe Val

1520 1525 1530

Ser Thr Leu Thr Arg Gly Asp Leu Ser Ser Ile Arg Trp Val Cys

1535 1540 1545

Ser Ser Leu Arg His Ala Gln Pro Thr Cys Pro Gly Ala Gln Leu

1550 1555 1560

Cys Thr Val Tyr Tyr Ala Ser Leu Asn Phe Arg Asp Ile Met Leu

1565 1570 1575

Ala Thr Gly Lys Leu Ser Pro Asp Ala Ile Pro Gly Lys Trp Thr

1580 1585 1590

Ser Gln Asp Ser Leu Leu Gly Met Glu Phe Ser Gly Arg Asp Ala

1595 1600 1605

Ser Gly Lys Arg Val Met Gly Leu Val Pro Ala Lys Gly Leu Ala

1610 1615 1620

Thr Ser Val Leu Leu Ser Pro Asp Phe Leu Trp Asp Val Pro Ser

1625 1630 1635

Asn Trp Thr Leu Glu Glu Ala Ala Ser Val Pro Val Val Tyr Ser

1640 1645 1650

Thr Ala Tyr Tyr Ala Leu Val Val Arg Gly Arg Val Arg Pro Gly

1655 1660 1665

Glu Thr Leu Leu Ile His Ser Gly Ser Gly Gly Val Gly Gln Ala

1670 1675 1680

Ala Ile Ala Ile Ala Leu Ser Leu Gly Cys Arg Val Phe Thr Thr

1685 1690 1695

Val Gly Ser Ala Glu Lys Arg Ala Tyr Leu Gln Ala Arg Phe Pro

1700 1705 1710

Gln Leu Asp Ser Thr Ser Phe Ala Asn Ser Arg Asp Thr Ser Phe

1715 1720 1725

Glu Gln His Val Leu Trp His Thr Gly Gly Lys Gly Val Asp Leu

1730 1735 1740

Val Leu Asn Ser Leu Ala Glu Glu Lys Leu Gln Ala Ser Val Arg

1745 1750 1755

Cys Leu Ala Thr His Gly Arg Phe Leu Glu Ile Gly Lys Phe Asp

1760 1765 1770

Leu Ser Gln Asn His Pro Leu Gly Met Ala Ile Phe Leu Lys Asn

1775 1780 1785

Val Thr Phe His Gly Val Leu Leu Asp Ala Phe Phe Asn Glu Ser

1790 1795 1800

Ser Ala Asp Trp Arg Glu Val Trp Ala Leu Val Gln Ala Gly Ile

1805 1810 1815

Arg Asp Gly Val Val Arg Pro Leu Lys Cys Thr Val Phe His Gly

1820 1825 1830

Ala Gln Val Glu Asp Ala Phe Arg Tyr Met Ala Gln Gly Lys His

1835 1840 1845

Ile Gly Lys Val Val Val Gln Val Leu Ala Glu Glu Pro Glu Ala

1850 1855 1860

Val Leu Lys Gly Ala Lys Pro Lys Leu Met Ser Ala Ile Ser Lys

1865 1870 1875

Thr Phe Cys Pro Ala His Lys Ser Tyr Ile Ile Ala Gly Gly Leu

1880 1885 1890

Gly Gly Phe Gly Leu Glu Leu Ala Gln Trp Leu Ile Gln Arg Gly

1895 1900 1905

Val Gln Lys Leu Val Leu Thr Ser Arg Ser Gly Ile Arg Thr Gly

1910 1915 1920

Tyr Gln Ala Lys Gln Val Arg Arg Trp Arg Arg Gln Gly Val Gln

1925 1930 1935

Val Gln Val Ser Thr Ser Asn Ile Ser Ser Leu Glu Gly Ala Arg

1940 1945 1950

Gly Leu Ile Ala Glu Ala Ala Gln Leu Gly Pro Val Gly Gly Val

1955 1960 1965

Phe Asn Leu Ala Val Val Leu Arg Asp Gly Leu Leu Glu Asn Gln

1970 1975 1980

Thr Pro Glu Phe Phe Gln Asp Val Cys Lys Pro Lys Tyr Ser Gly

1985 1990 1995

Thr Leu Asn Leu Asp Arg Val Thr Arg Glu Ala Cys Pro Glu Leu

2000 2005 2010

Asp Tyr Phe Val Val Phe Ser Ser Val Ser Cys Gly Arg Gly Asn

2015 2020 2025

Ala Gly Gln Ser Asn Tyr Gly Phe Ala Asn Ser Ala Met Glu Arg

2030 2035 2040

Ile Cys Glu Lys Arg Arg His Glu Gly Leu Pro Gly Leu Ala Val

2045 2050 2055

Gln Trp Gly Ala Ile Gly Asp Val Gly Ile Leu Val Glu Thr Met

2060 2065 2070

Ser Thr Asn Asp Thr Ile Val Ser Gly Thr Leu Pro Gln Arg Met

2075 2080 2085

Ala Ser Cys Leu Glu Val Leu Asp Leu Phe Leu Asn Gln Pro His

2090 2095 2100

Met Val Leu Ser Ser Phe Val Leu Ala Glu Lys Ala Ala Ala Tyr

2105 2110 2115

Arg Asp Arg Asp Ser Gln Arg Asp Leu Val Glu Ala Val Ala His

2120 2125 2130

Ile Leu Gly Ile Arg Asp Leu Ala Ala Val Asn Leu Asp Ser Ser

2135 2140 2145

Leu Ala Asp Leu Gly Leu Asp Ser Leu Met Ser Val Glu Val Arg

2150 2155 2160

Gln Thr Leu Glu Arg Glu Leu Asn Leu Val Leu Ser Val Arg Glu

2165 2170 2175

Val Arg Gln Leu Thr Leu Arg Lys Leu Gln Glu Leu Ser Ser Lys

2180 2185 2190

Ala Asp Glu Ala Ser Glu Leu Ala Cys Pro Thr Pro Lys Glu Asp

2195 2200 2205

Gly Leu Ala Gln Gln Gln Thr Gln Leu Asn Leu Arg Ser Leu Leu

2210 2215 2220

Val Asn Pro Glu Gly Pro Thr Leu Met Arg Leu Asn Ser Val Gln

2225 2230 2235

Ser Ser Glu Arg Pro Leu Phe Leu Val His Pro Ile Glu Gly Ser

2240 2245 2250

Thr Thr Val Phe His Ser Leu Ala Ser Arg Leu Ser Ile Pro Thr

2255 2260 2265

Tyr Gly Leu Gln Cys Thr Arg Ala Ala Pro Leu Asp Ser Ile His

2270 2275 2280

Ser Leu Ala Ala Tyr Tyr Ile Asp Cys Ile Arg Gln Val Gln Pro

2285 2290 2295

Glu Gly Pro Tyr Arg Val Ala Gly Tyr Ser Tyr Gly Ala Cys Val

2300 2305 2310

Ala Phe Glu Met Cys Ser Gln Leu Gln Ala Gln Gln Ser Pro Ala

2315 2320 2325

Pro Thr His Asn Ser Leu Phe Leu Phe Asp Gly Ser Pro Thr Tyr

2330 2335 2340

Val Leu Ala Tyr Thr Gln Ser Tyr Arg Ala Lys Leu Thr Pro Gly

2345 2350 2355

Cys Glu Ala Glu Ala Glu Thr Glu Ala Ile Cys Phe Phe Val Gln

2360 2365 2370

Gln Phe Thr Asp Met Glu His Asn Arg Val Leu Glu Ala Leu Leu

2375 2380 2385

Pro Leu Lys Gly Leu Glu Glu Arg Val Ala Ala Ala Val Asp Leu

2390 2395 2400

Ile Ile Lys Ser His Gln Gly Leu Asp Arg Gln Glu Leu Ser Phe

2405 2410 2415

Ala Ala Arg Ser Phe Tyr Tyr Lys Leu Arg Ala Ala Glu Gln Tyr

2420 2425 2430

Thr Pro Lys Ala Lys Tyr His Gly Asn Val Met Leu Leu Arg Ala

2435 2440 2445

Lys Thr Gly Gly Ala Tyr Gly Glu Asp Leu Gly Ala Asp Tyr Asn

2450 2455 2460

Leu Ser Gln Val Cys Asp Gly Lys Val Ser Val His Val Ile Glu

2465 2470 2475

Gly Asp His Arg Thr Leu Leu Glu Gly Ser Gly Leu Glu Ser Ile

2480 2485 2490

Ile Ser Ile Ile His Ser Ser Leu Ala Glu Pro Arg Val Ser Val

2495 2500 2505

Arg Glu Gly

2510

Claims (2)

1. Application of primer or probe for detecting biomarker in preparation of epilepsy auxiliary diagnosis kit, epilepsy prenatal diagnosis kit or neonatal epilepsy screening kit, and is characterized in that the biomarker is nucleic acid molecule which is relatively normalFASNHas the mutation c.G2998A, and the coding sequence of (A) is normalFASNThe number of the transcript of (1) is NM-004104, and the base sequence of the marker is shown as SEQ ID NO. 1; or the marker is protein which has mutation p.D1000N relative to normal FASN protein, the amino acid sequence of the marker is shown in SEQ ID NO.2, and the normal FASN protein is formed by the normal FASN proteinFASNAnd (5) encoding.

2. The use of claim 1, wherein the probe is relative to the normalFASNThe base at position 2998 of the coding sequence of (1) is A.

Images