CN113151445B - Mutation site of ATRX gene related to mental retardation diseases and detection kit - Google Patents
Mutation site of ATRX gene related to mental retardation diseases and detection kit Download PDFInfo
- Publication number
- CN113151445B CN113151445B CN202110437546.3A CN202110437546A CN113151445B CN 113151445 B CN113151445 B CN 113151445B CN 202110437546 A CN202110437546 A CN 202110437546A CN 113151445 B CN113151445 B CN 113151445B
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- mutation
- nucleotide sequence
- atrx gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a mutation site of an ATRX gene related to intellectual impairment diseases, wherein the mutation site is positioned in a No. 24 intron of the ATRX gene, and mutation information of the mutation site is as follows: c.5786+4(IVS24) A > G (NM-000489.6); meanwhile, the invention also provides a DNA detection kit and an mRNA detection kit for auxiliary diagnosis of intellectual impairment diseases, wherein the DNA detection kit is used for detecting the mutation sites, the mRNA detection kit is used for detecting mRNA transcribed by the mutated ATRX gene, and the mutation sites and the mRNA transcribed by the ATRX gene in the first aspect can be directly detected through first-generation sequencing, so that the pathogenicity of the mutation is determined, the pathogenesis of intellectual impairment caused by the mutation is disclosed, and the kit can also be used for accurately diagnosing ATRX gene-related intellectual impairment diseases.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a mutation site of an ATRX gene related to intellectual disturbance diseases and a detection kit.
Background
Intellectual Disability (ID) disease refers to a patient who has significant deficits in cognitive function and social adaptation before 18 years of age, manifested by intellectual IQ values less than 70. ID patients have a wide variety of clinical phenotypes, both manifested as intellectual disability and possibly associated with congenital malformations or other neurological abnormalities such as Autism Spectrum Disorders (ASD), epilepsy, and the like. The incidence of ID is about 1-3% worldwide. According to related research reports, the lifetime medical cost of a patient with mental retardation can reach $ 100 ten thousand. ID is largely divided into genetic and non-genetic factors, with genetic factors accounting for about 2/3 ID etiology, and it can be seen that the clinical phenotype of ID is complex and there is significant genetic heterogeneity. Therefore, if the disease can be diagnosed accurately as early as possible and the treatment and rehabilitation intervention can be carried out in time, the occurrence of intellectual disability can be reduced as much as possible.
The existing research has found more than 700 ID related genes, including ATRX gene, but at present, the number of reports of ID patients about ATRX gene mutation is still relatively small, mainly exon mutation, and there is no report related to ATRX gene intron mutation.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides a mutation site of ATRX gene related to the intellectual disturbance disease and a detection kit, which are beneficial to promoting the development of molecular diagnosis of the disease.
In a first aspect, the following technical solutions are provided, including a mutation site of a mutant ATRX gene, where the mutation site of the ATRX gene causes intellectual impairment diseases, the mutation site is located in intron 24 of the ATRX gene, and mutation information of the mutation site is: c.5786+4(IVS24) A > G (NM-000489.6).
In other optimized technical schemes, the genome nucleotide sequence of the mutation site is shown as SEQ ID NO. 1.
In a second aspect, there is provided a DNA test kit for use in the aided diagnosis of a intellectual impairment disorder, said DNA test kit being for use in detecting a mutation site according to any one of the embodiments of the first aspect above.
In other optimized technical schemes, the DNA detection kit comprises an amplification primer of the mutation site, the amplification primer of the mutation site comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
In a third aspect, there is provided an mRNA detection kit for use in aiding diagnosis of intellectual impairment disorders, the mRNA detection kit being for detecting mRNA transcribed by the ATRX gene described in any one of the above aspects.
In other optimized technical schemes, the mRNA detection kit comprises amplification primers of exons of the mutated ATRX gene, the exons comprise Exon 23-25, and the amplification primers of Exon 23-25 comprise an upstream primer and a downstream primer.
In other preferred embodiments, the mRNA detection kit is used to detect the absence of Exon 24.
In other preferred embodiments, the mRNA detection kit is used to detect whether Exon24 is globally absent.
In other optimized technical schemes, the nucleotide sequence of the upstream primer of Exon 23-25 is shown as SEQ ID NO. 18, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 19.
In other optimized technical schemes, the exons further comprise Exon 1-22 and Exon 26-35, amplification primers of the Exon 1-22 and the Exon 26-35 comprise an upstream primer and a downstream primer,
the nucleotide sequence of the upstream primer of Exon 1-5 is shown as SEQ ID NO. 4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 5;
the nucleotide sequence of the upstream primer of Exon 6-8 is shown as SEQ ID NO. 6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 7;
the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 8, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 9; or the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 26, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 27; or the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 28, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 29; or the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 30, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 31; or the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 32, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 33; or the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 34, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 35; or the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 36, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 37;
the nucleotide sequence of the upstream primer of Exon 10-12 is shown as SEQ ID NO. 10, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 11;
the nucleotide sequence of the upstream primer of Exon 13-15 is shown as SEQ ID NO. 12, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 13;
the nucleotide sequence of the upstream primer of Exon 16-18 is shown as SEQ ID NO. 14, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 15;
the nucleotide sequence of the upstream primer of Exon 19-22 is shown as SEQ ID NO. 16, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 17;
the nucleotide sequence of the upstream primer of Exon 26-29 is shown as SEQ ID NO. 20, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 21;
the nucleotide sequence of the upstream primer of Exon 30-33 is shown as SEQ ID NO. 22, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 23;
the nucleotide sequence of the upstream primer of Exon 34-35 is shown as SEQ ID NO. 24, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 25.
The beneficial effects of the invention are:
in the first aspect, in the technical scheme of the invention, a new mutation site c.5786+4(IVS24) A > G (NM-000489.6) in the ATRX gene is found for the first time, and the mutation site is located in the No. 24 intron of the ATRX gene, so that the pathogenic mutation spectrum of the ATRX gene is enriched.
In the second and third aspects, the detection kit provided by the invention can be used for directly detecting the mutation site in the first aspect and mRNA obtained by transcription of the ATRX gene through one-generation sequencing, and can be used for accurately diagnosing ATRX gene-related dysnoesia diseases; compared with the existing detection technology, the method reduces complicated procedures, can skip high-throughput screening, and directly performs sequencing on the full length of the target gene exon, thereby clearly knowing the ATRX gene mutation and mRNA transcription conditions.
Drawings
In order to more clearly illustrate the technical solution of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. The drawings in the following description are only some of the embodiments described in the present invention, and it is obvious to those skilled in the art that other drawings can be obtained based on these drawings without inventive efforts.
FIG. 1 is a schematic diagram showing the presence of c.5786+4(IVS24) A > G hemizygous mutation in ATRX gene of infant patient in example 1;
FIG. 2 is a schematic diagram of the heterozygous mutation of mother into carrier c.5786+4(IVS24) A > G in example 1;
FIG. 3 is a schematic diagram showing example 1 in which the father is a wild type;
FIG. 4 is a schematic diagram showing comparison of Exon7 fragments in the RNA standard sequence transcribed from ATRX gene and proband sequence in example 2;
FIG. 5 is a schematic diagram showing the comparison of Exon9 fragments in the RNA standard sequence transcribed from ATRX gene and proband sequence in example 2;
FIG. 6 is a schematic diagram showing the comparison of Exon24 fragments in the RNA standard sequence transcribed from ATRX gene and proband sequence in example 2.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
First, a reagent, an instrument, analysis software, and the like used in the following examples will be explained.
1. The sources of reagents used in the examples of the invention are as follows:
KAPA2G Rob μ st HotStart PCR Kit available from KAPA BIOSYSTEMS (cat # KK 551707961073001);
the DNA/RNA co-extraction kit box (cat No. DP422), the RNAlock blood RNA stabilizer (cat No. DP440), the high-efficiency blood total RNA extraction kit (cat No. DP443) and the DL2000DNA Marker are all purchased from Tiangen Biochemical technology (Beijing) Ltd;
the Thermo Scientific RevertAId first strand cDNA Synthesis kit (cat. K1622) was purchased from Thermo Fisher;
TaKaRa Taq (TM) (R001A) PCR solution-related reagents were purchased from Takara;
SAP (1U/. mu.l, cat # 70092Y), ExoI (10U/. mu.l, cat # 70073Z) were purchased from USB;
BigDye 3.1 (cat # 4337455, ThermoFisher Scientific), Hi-Di Formamide (cat # 4404307, ABI); RNase remover and DNase aqueous solution (cat. 10977015) were purchased from ThermoFisher Scientific.
2. The instruments used in the examples of the present invention were: hema-9600 gene amplification instrument, ABI 3730XL gene sequencer.
3. The analysis software used in the examples of the present invention was Chromas software.
4. The amplification primers used in the examples of the present invention were synthesized by Biotechnology engineering (Shanghai) Inc.
5. Other experimental articles: agarose Regular, Tris-Acetate-EDTA Buffer (TAE)50 × Powder (pH8.3), 6 × Loading Buffer, Nucleic Acid Gel Stain, 200 μ L EP tube (RNase-free), microwave oven, Erlenmeyer flask, glass bottle, measuring cylinder, weighing scale, pipette gun, Gel imaging system.
Example 1:
firstly, obtaining a sample;
1 infant patient, male patient, 3 years old, was clinically manifested as hypokinesia, language retardation, severe mental retardation, and facial abnormality. The genetic metabolism, the skull MRI, the electroencephalogram and the nail function are not abnormal, and the anemia is not seen. The sick children are slow in sound following and vision following, smiling in a teasing way, unconscious in a sounding way, poor in consciousness of actively grabbing objects by two hands, stable in vertical head, incapable of actively turning over, poor in load bearing of two lower limbs, incapable of standing and walking, level 4 in muscle strength, low in muscle tension and abnormal in gastrointestinal tract function. And (3) suspicion and diagnosis: cerebral palsy.
All family members participating in the study of the present invention signed informed consent to obtain peripheral blood of the patients and related families.
Secondly, sequencing a whole genome;
the implementation adopts a whole genome sequencing technology, comprises the processes of peripheral blood sample collection, whole genome DNA extraction, DNA fragmentation, library construction and sequencing, sequencing result analysis and the like, and the whole genome sequencing is carried out on the core family of the patient with mental retardation, and the combination of bioinformatics analysis finds that the ATRX gene of the patient with mental retardation has hemizygous mutation c.5786+4(IVS24) A > G (NM _000489.6), wherein c represents a coding region, namely the sequence of an exon, and c.5786 represents the 5786 th site of the sequence of the exon region; organisms generally alternate from exon to intron, and therefore, the +4 case here indicates that the fourth base of the 24 th intron, which is arranged in sequence after the exon 5786, is changed.
The genome nucleotide sequence of the mutation site is shown as SEQ ID NO. 1.
Thirdly, carrying out Sanger sequencing verification;
based on the results of the second step, the ATRX gene c.5786+4(IVS24) a > G hemizygous mutation was verified using traditional PCR based Sanger sequencing analysis. The specific implementation is as follows:
(1) design of PCR primers
The specific amplification primer is designed by adopting Oligo7 software, and comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3, and the primers are synthesized by the company Limited in the Biotechnology engineering (Shanghai).
(2) PCR reaction
Using DNA as template, the KAPA2G Rob μ st HotStart PCR Kit was used to perform PCR amplification on the experimental samples. The PCR reaction system is 25 μ L, which comprises: mu.L of 5X KAPA2G Buffer A/5X KAPA2G Buffer B/5X KAPA2G GC Buffer, 5. mu.L of 5X KAPA Enhancer 1, 0.5. mu.L of 10mM KAPA dNTP Mix, 1.25. mu.L of PCR amplification primer, 0.1. mu.L of 5U/. mu.L KAPA2G Robust HotStar DNA Polymerase, DNA template added as required, and PCR-grade water to make up to 25. mu.L.
Touchdown PCR amplification was performed using a Hema gene amplification instrument 9600, and the PCR reaction conditions were as follows:
pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 15s, extension at 72 ℃ for 15-60s/kb, and cycle times of 30-40; finally, final extension at 72 ℃ was 1 min/kb.
(3) PCR product purification
The PCR purification system is 20 μ L, which comprises: PCR product 8. mu.L, 1U/. mu.L LSAP enzyme 1. mu.L, 10U/. mu.L ExoI enzyme 1. mu.L, RNase and DNase removed water 10. mu.L.
(4) Sanger sequencing reaction
The DNA sequencing reaction system is 10 mu L, comprises 4 mu L of BigDye, 2 mu L of 3.2pMol/L sequencing primer and 5-20 ng of purified PCR product, and the RNase and DNase water are used for supplementing to 10 mu L.
The reaction conditions are as follows: the reaction is carried out for 28 cycles of reaction at 96 ℃ for 10s, 50 ℃ for 5s and 60 ℃ for 4 min.
The PCR was cycled off and cooled to 4 deg.C, removed and immediately centrifuged for a short period of time.
After the sequencing reaction is finished, 2.5 mu L of 0.125M EDTA solution is added into the reaction product, then 30 mu L of absolute ethyl alcohol is added, and the mixture is reversed and mixed evenly and placed at room temperature for 15 min. After centrifugation at 12000g for 10min, the supernatant was removed. Adding 60 μ L ethanol solution with volume percentage concentration of 70%, centrifuging at 4 deg.C and 12000g for 15min, removing supernatant, repeating once, and dissolving precipitate in 10 μ L Hi-Di formamide after ethanol is completely volatilized.
After denaturation at 95 ℃ for 4min, sequencing analysis was performed using ABI 3130XL sequencer.
(5) Analysis of sequencing results
Sequencing results ab1 files can be opened with Chromas software and aligned to the ATRX gene reference sequence.
(6) Results of the experiment
The whole genome sequencing is consistent with the Sanger sequencing verification result, and the fact that c.5786+4(IVS24) A > G hemizygous mutation exists in the ATRX gene of the child is proved, as shown in the attached figure 1, and the nucleotide sequence of the genome after mutation is shown in SEQ ID No. 1; the mother is carrier c.5786+4(IVS24) A > G heterozygous mutation as shown in figure 2, and the father is wild type as shown in figure 3.
Example 2
This embodiment provides a DNA detection kit and an mRNA detection kit for the auxiliary diagnosis of intellectual impairment disorders.
The DNA detection kit comprises an amplification primer of the ATRX gene mutation site in the embodiment 1, wherein the amplification primer of the mutation site comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3, and the primers are synthesized by the company Limited in the biological engineering (Shanghai).
The DNA detection kit also comprises a PCR reagent, a PCR product purification reagent and a Sanger sequencing reagent.
Wherein, the PCR reagent is KAPA2G Rob mu st HotStart PCR Kit, which comprises: 5X KAPA2G Buffer A/5X KAPA2G Buffer B/5X KAPA2G GC Buffer, 5X KAPA Enhancer 1, 10mM KAPA dNTP Mix, 5U/. mu.L KAPA2G Robust HotStar DNA Polymerase, PCR-grade water. The working concentration of each component in the PCR system is as follows: 1X KAPA2G Buffer A/1X KAPA2G Buffer B/1X KAPA2G GC Buffer, 1X KAPA Enhancer 1, 0.2mM KAPA dNTP Mix, 0.5. mu.M each of upstream and downstream primers for PCR amplification, 0.5U/. mu.L KAPA2G Robust HotStar DNA Polymerase, and DNA template can be added as required.
The PCR product purification reagent comprises: 1U/. mu.L SAP enzyme, 10U/. mu.L ExoI enzyme, RNase and DNase water. The working concentration of each component in the PCR product purification system is as follows: 0.05U/. mu.L SAP enzyme, 0.5U/. mu.L ExoI enzyme; the volume ratio of the PCR product to the PCR purification system was 2: 5.
Sanger sequencing reagents include: BigDye 3.1 mixed solution, 0.125M EDTA solution, absolute ethyl alcohol, 75 percent by volume of ethyl alcohol solution, RNase and DNase water and Hi-Di formamide solution. The working concentration of each component in the Sanger sequencing system is as follows: BigDye mixed solution is 1x, the concentration of sequencing primer is 0.64pMol/L, and the concentration of sample is 0.5-2 ng/mu L.
The mRNA detection kit comprises amplification primers of each Exon of the mutant ATRX gene in the embodiment 1, including Exon 1-35, wherein the amplification primers of the Exon 1-35 comprise an upstream primer and a downstream primer, wherein in the embodiment:
the nucleotide sequence of the upstream primer of Exon 1-5 is shown as SEQ ID NO. 4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 5;
the nucleotide sequence of the upstream primer of Exon 6-8 is shown as SEQ ID NO. 6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 7;
the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 8, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 9;
the nucleotide sequence of the upstream primer of Exon 10-12 is shown as SEQ ID NO. 10, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 11;
the nucleotide sequence of the upstream primer of Exon 13-15 is shown as SEQ ID NO. 12, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 13;
the nucleotide sequence of the upstream primer of Exon 16-18 is shown as SEQ ID NO. 14, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 15;
the nucleotide sequence of the upstream primer of Exon 19-22 is shown as SEQ ID NO. 16, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 17;
the nucleotide sequence of the upstream primer of Exon 23-25 is shown as SEQ ID NO. 18, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 19;
the nucleotide sequence of the upstream primer of Exon 26-29 is shown as SEQ ID NO. 20, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 21;
the nucleotide sequence of the upstream primer of Exon 30-33 is shown as SEQ ID NO. 22, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 23;
the nucleotide sequence of the upstream primer of Exon 34-35 is shown as SEQ ID NO. 24, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 25.
In other preferred embodiments, the amplification primers of Exon9 can be replaced by any of the following methods:
the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 26, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 27; or the like, or, alternatively,
the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 28, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 29; or the like, or a combination thereof,
the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 30, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 31; or the like, or, alternatively,
the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 32, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 33; or the like, or a combination thereof,
the nucleotide sequence of the upstream primer of the Exon9 is shown as SEQ ID NO. 34, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 35; or the like, or, alternatively,
the nucleotide sequence of the upstream primer of Exon9 is shown as SEQ ID NO. 36, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 37.
Next, the process of detecting the mRNA sequence of the ATRX gene will be described.
Preparation work: preparing agarose gel;
1) 2 1L glass bottles, 100mL triangular bottles, 100mL glass measuring cylinders and 1L glass measuring cylinders are cleaned and dried for standby.
1)50 × TAE mother liquor: pouring Tris-Acetate-EDTA Buffer (TAE)50 × Powder dry Powder into 1L glass
Adding 1L of ultrapure water into the bottle, and marking after uniformly mixing.
2)1 XTAE solution: 20mL of 50 XTAE mother liquor is weighed into a 1L glass measuring cylinder, the volume is fixed to 1L by ultrapure water, the solution is poured into a new 1L glass bottle, and the marking is done after the solution is mixed uniformly.
3) Add 0.5. mu.L of Nucleic Acid Gel Stain 6 XLoading Buffer, vortex and mix well, and mark well.
4) Preparing glue: after the rubber plate is well balanced and the comb is inserted, 0.8g of Agarose Regular is weighed into a triangular flask, 80mL of 1 XTAE solution is added, and the mixture is poured into the rubber plate after being heated by a microwave oven and completely dissolved.
Part of the formal experiment:
firstly, adding RNAlock blood RNA stabilizer (cargo number DP440, Tiangen Biochemical technology (Beijing) Co., Ltd.) in advance into EDTA anticoagulated blood sample and normal control anticoagulated blood sample;
secondly, respectively extracting RNA of the experimental sample and the normal control sample by adopting a high-efficiency blood total RNA extraction kit (Cat No. DP443, Tiangen Biochemical technology (Beijing) Co., Ltd.), wherein the specific method comprises the following steps:
1) dilution of erythrocyte lysate: an appropriate volume of 10X erythrocyte lysate H (for example, 140. mu.L of 10X erythrocyte lysate H when the volume of the blood sample to be treated is 200. mu.L) is selected according to the volume of the treated blood sample, and the selected volume is diluted to 1X erythrocyte lysate H with RNase-Free ddH 2O.
2) To 1 volume of human whole blood was added 5 volumes of 1x erythrocyte lysate H (prepared from a suitable clean tube).
Note that: for optimal mixing, the volume of the mixture of blood and 1x erythrocyte lysate H should not exceed 3/4 of the tube volume. If the white blood cell content of the blood is high, the volume of the blood used can be proportionally reduced, and the volume of the 1 × erythrocyte lysate H used in step 6 can be adjusted accordingly.
3) Incubate on ice for 10-15min, vortex and mix well for 2 times during incubation.
Note that: the solution will become translucent during incubation, indicating red blood cell lysis. The incubation time can be extended to 20min if necessary.
4) The supernatant was completely removed by centrifugation at 2,100rpm (. about.400 Xg) at 4 ℃ for 10 min.
Note that: the leukocytes may form globules after centrifugation, ensuring complete removal of the supernatant, and the presence of traces of erythrocytes, which appear red in the leukocyte globules, disappear in the subsequent rinsing step.
5) To the leukocyte pellet, 1 Xerythrocyte lysate H (1 Xerythrocyte lysate H was added in a volume 2 times the amount of whole blood used in step 1) was added, and the cells were resuspended.
6) The supernatant was completely removed by centrifugation at 2,100rpm (. about.400 Xg) at 4 ℃ for 10 min.
Note that: incomplete removal of the supernatant will affect cleavage and subsequent binding of the RNA to the membrane, resulting in a decrease in the final RNA yield.
7) Lysis buffer RLH (beta-mercaptoethanol added before use) was added to the leukocyte pellet, in the amounts specified in the table below, either vortexed or mixed using a pipette.
Note: if the blood is not whole blood of a healthy person, the volume of lysis buffer RLH is determined according to the number of white blood cells in the blood, and the cells are completely lysed and the clumped cell pellet disappears.
Lysate RLH (. mu.L) number of leukocytes in healthy human Whole blood (mL)
350 to 0.5 to 2X 106
6000.5-1.52X 106 to 1X 107
8) The solution was transferred to the filtration column CS (the filtration column CS was placed in the collection tube), centrifuged at 12,000rpm (. about.13,400 Xg) for 2min, the filtration column CS was discarded, and the filtrate was collected.
Note that: in order to avoid the formation of aerosol, please adjust the pipettor to more than or equal to 750 μ l to ensure that all the solution is transferred to the filter column at one time, if too many cells will cause the phenomenon of viscous lysate, resulting in the situation of difficult suction.
9) To the filtrate, 70% ethanol (usually 350 or 600. mu.L) was added in an amount of 1 volume, mixed (precipitation may occur at this time), and the resulting solution was transferred together with the precipitate to an adsorption column CR4 (adsorption column CR4 was put into a collection tube), centrifuged at 12,000rpm (. about.13,400 Xg) for 30-60sec, the waste liquid in the collection tube was discarded, and the adsorption column CR4 was returned to the collection tube.
Note that: for 70% ethanol, use RNase-Free ddH2O, if the volume of the filtrate is lost, reduce the ethanol dosage by 70%. The solution and precipitate were transferred to adsorption column CR4, where the volume was larger than the capacity of the adsorption column, and this was done in two steps.
10) If DNase I digestion is not performed, 700. mu.L of deproteinizing solution RW1H (previously examined whether ethanol was added or not) may be directly added to the adsorption column CR4, centrifuged at 12,000rpm (13,400 Xg) for 30-60sec, and the waste liquid in the collection tube may be discarded to directly perform step 14. DNase I digestion: 350 μ L of deproteinized solution RW1H was added to adsorption column CR4, centrifuged at 12,000rpm (. about.13,400 Xg) for 30-60s, the waste liquid in the collection tube was discarded, and adsorption column CR4 was returned to the collection tube.
11) Preparing DNase I working solution: 10 μ L of DNase I stock solution was put into a new RNase-Free centrifuge tube, 70 μ L of RDD solution was added, and gently mixed.
12) 80. mu.L of DNase I working solution was added to the center of the adsorption column CR4, and the mixture was left at room temperature for 15 min.
13) 350 μ L of deproteinizing solution RW1H was added to the adsorption column CR4, centrifuged at 12,000rpm (. about.13,400 Xg) for 30-60s, the waste liquid in the collection tube was decanted, and the adsorption column CR4 was returned to the collection tube.
14) Adding 500 μ L of rinsing solution RW (whether ethanol is added before use) into adsorption column CR4, standing at room temperature for 2min, centrifuging at 12,000rpm (13,400 Xg) for 30-60s, discarding the waste liquid in the collection tube, and returning adsorption column CR4 to the collection tube.
15) Step 14 is repeated.
16) Centrifuge at 12,000rpm (. about.13,400 Xg) for 2min and discard the waste. The adsorption column CR4 was left at room temperature for several min to thoroughly dry the residual rinse solution from the adsorption material.
Note that: after centrifugation, the adsorption column CR4 was left at room temperature for a while to allow it to dry thoroughly. If the rinsing liquid remains, the subsequent experiments such as reverse transcription, fluorescence quantification and the like can be influenced.
17) The adsorption column CR4 was transferred to a new RNase-Free centrifuge tube, 30-50. mu.L RNase-Free ddH2O was added and left at room temperature for 2min, and centrifuged at 12,000rpm (. about.13,400 Xg) for 2min to obtain an RNA solution.
Note that: the volume of elution buffer should not be less than 30. mu.L, and too small a volume affects the recovery efficiency. The RNA solution was stored at-70 ℃.
Thirdly, reverse transcribing the RNA into cDNA by the following operation method:
1) add 0.1 ng-5. mu.g of RNA and 1. mu.L of oligo (dT) prime to ice-cooled sterile nuclease-free centrifuge tubes, made up to 12. mu.L with nuclease-free water. Gently mixed, briefly centrifuged, and incubated at 65 ℃ for 5min, stored and in ice.
2) mu.L of 5X Reaction Buffer, 1. mu.L of RiboLock RNase Inhibitor (20U/. mu.L), 2. mu.L of 10mM dNTP Mix, and 1. mu.L of RevertAid M-MuLV RT (200U/. mu.L) were added in this order to a total volume of 20. mu.L.
3) Mix gently and centrifuge briefly. After incubation at 42 ℃ for 60min, the reaction was terminated by heating at 70 ℃ for 5min to obtain cDNA product.
Fourthly, designing a target gene primer;
primers specific to each of the above exons of ATRX gene were designed using Oligo7 software and synthesized by Biotechnology, Inc. (Shanghai).
Fifthly, amplifying target genes;
using cDNA as template, KAPA2G Rob μ st HotStart PCR Kit was used to perform PCR amplification of the designated target region of the experimental sample and the normal human control sample, respectively. The PCR reaction system is 25 μ L, which comprises: 5 μ L5X KAPA2G Buffer A/5X KAPA2G Buffer B/5X KAPA2G GC Buffer, 5 μ L5X KAPA Enhancer 1, 0.5 μ L10 mM KAPA dNTP Mix, PCR amplification primer 1.25 μ L, 0.1 μ L5U/μ L KAPA2G Robust HotStar DNA Polymerase, adding DNA template as required, PCR-grade water to make up to 25 μ L.
Touchdown PCR amplification was performed using a Hema gene amplification instrument 9600, and the PCR reaction conditions were as follows:
pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 15s, extension at 72 ℃ for 15-60s/kb, and cycle times of 30-40; finally, final extension at 72 ℃ was 1 min/kb.
Sixthly, electrophoresis is carried out;
and (3) putting the prepared agarose gel into an electrophoresis apparatus, sucking 2 mu L of PCR reaction solution obtained in the step (5), uniformly mixing with 3 mu L of 6 × Loading Buffer, and then dotting into a hole, and finally dotting a Marker. 120V, 20 min.
Seventhly, glue is checked;
and (3) putting the run gel into a gel imaging system, opening ultraviolet, observing the gel, and generating a specific amplification product.
Eighth, carrying out Sanger sequencing reaction;
sanger sequencing was performed by Biotechnology engineering (Shanghai) Inc.
Ninth, analyzing the sequencing result;
sequencing result ab1 files can be opened with Chromas software and aligned with the ATRX gene reference sequence.
The mRNA sequencing results and alignment for ATRX were as follows:
the inventors found that there was an Exon7 deletion (AGA) in mRNA of the ATRX gene in both normal humans and patients as shown in fig. 4;
exon9 deletion (ATTAAATCAAAAACTACAGCTAAAGTAACAAAAGAATTATATGTTAAACTCACTCCTGTTTCCCTTTCTAATTCCCCAATTAAAGGT), fig. 5;
however, the entire Exon of Exon24 was deleted only in the mRNA of ATRX gene in the infant patient, as shown in fig. 6.
In this example, the entire exon24 is deleted under the precondition that only the base of ATRX gene on intron 24 is changed, i.e., when DNA is transcribed into mRNA, it is seen that the mutation of intron causes the abnormal transcription of exon, thereby causing mental retardation.
There are three diseases caused by ATRX gene mutation, which are mental retardation-low tension face-beauty syndrome, X-linkage, type 1 (MRXHF1), alpha thalassemia with myelodysplastic syndrome, and alpha thalassemia with mental retardation syndrome. The disease caused by the mutation of the ATRX gene in this patient is, according to clinical phenotype, intellectual impairment-hypo-tension face-beauty syndrome, X-linked, type 1 (MRXHF 1); the clinical phenotypes of MRXHF1 include progressive intellectual disability, low infant muscle tone, abnormal facial appearance, cryptorchidism, hypoplasia of scrotum, hypospadias, congenital oligopeptides, vesicoureteral reflux, renal hypoplasia, hypogonadism, paroxysmal explosive laughing sounds, hyperactivity, brachydactyla syndrome, tapered fingers, fine fingers, seizures, hyperreflexia, supine toe valgus, vomiting, constipation, gastroesophageal reflux, salivation, scoliosis, genu valgus, short stature, depressed nose bridge, hypoplasia in humans, high lower limb muscle tone, and small ear deformity.
In this example, the infant does not yet exhibit the full phenotype of the disease due to the heterogeneity of disease inheritance.
Compared with the normal control, the detection result of the mRNA of the infant shows that the ATRX gene c.5786+4(IVS24) A > G hemizygous mutation of the infant forms abnormal mRNA, further influences protein translation, generates abnormal protein and cannot play the normal function of the ATRX protein. The ATRX protein is one of yeast switch in type/sucrose non-fermentation (SWI/SNF) family members, and plays an important role in the processes of gene expression, DNA repair, replication, recombination, maintenance of telomere integrity and the like as an ATP-dependent chromatin remodeling factor. Thus, the mutation can cause mitotic defect of neural precursor cell, influence accuracy of chromosome separation, cause apoptosis increase, reduce neuron number of brain tissue (cerebral cortex, hippocampus, etc.) and reduce forebrain volume, and influence development of intelligence.
In conclusion, the invention discovers a hemizygous fragment c.5786+4(IVS24) A > G (NM-000489.6) of the ATRX gene and abnormal mRNA expression generated by the mutation for the first time, defines the pathogenicity of the mutation, discloses a pathogenesis of intellectual disability caused by the mutation, enriches a pathogenic mutation spectrum of the ATRX gene, defines the correlation between genotype and phenotype, and can be used for clinical diagnosis and basic research. Meanwhile, a kit for directly detecting the mutation site and ATRX gene mRNA is designed, and can be used for auxiliary detection and molecular diagnosis of ATRX gene-related intellectual impairment diseases.
Specifically, the detection kit provided in this embodiment can directly perform sequencing by one generation, reduce tedious procedures, skip high-throughput screening, directly sequence the full-length exon of the target gene, and clearly know the exon status. The provided primer design and PCR amplification and first-generation sequencing are used for detecting the mutation of the gene exon, the operation is simple, the technology is mature, the cost is extremely low, the kit is not influenced by the mutation size (20bp), the homozygous deletion of the exon and the deletion insertion of large fragments can be detected, the kit is wide in practical range, and the detected DNA can be extracted from fresh tissues, peripheral blood and paraffin section samples.
Example 3
This example provides an mRNA transcribed from the mutated ATRX gene of example 1, with the deletion of Exon7, Exon9, and Exon24 as mentioned above in example 2;
among these, Exon7 deletion (AGA);
exon9 deletion
(ATTAAATCAAAAACTACAGCTAAAGTAACAAAAGAATTATATGTTAAACTCACTCCTGTTTCCCTTTCTAATTCCCCAATTAAAGGT)；
Exon24 was deleted in its entirety.
Experiments prove that the mutation of an intron of the ATRX gene generates abnormal mRNA, the pathogenicity of the mutation is determined, and the pathogenesis of the intellectual disability caused by the mutation is disclosed.
Next, the nucleotide sequences of the amplification primers and the lengths of the amplification products obtained in examples 1 to 3 are shown in the following table:
finally, it should be noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, while the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.
Sequence listing
<110> Yiwu city health care hospital for women and children
<120> mutation site of intellectual impairment related mutant ATRX gene and detection kit
<160> 37
<170> PatentIn version 3.5
<210> 1
<211> 51
<212> DNA
<213> Homo sapiens
<221> MISC_FEATURE
<222> (1)..(51)
<400> 1
agctccgatg attatacaaa gtagatcgaa tactttttcg tgccatcctg t 51
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 2
tcttgcctcc aaaacacgaa 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 3
acctcagcat cagcatctgt 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 4
tttgagctgt ggggaggttc 20
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 5
tctgcttcta aattcaggcc c 21
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 6
agagccagtg ctgaatgaag a 21
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 7
ccaacaaagg ctctgggtga 20
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 8
agccgtgact cagatggaat g 21
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 9
tccaatgcaa gatgagcctt c 21
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 10
gtgagggaag cagcgatgaa 20
<210> 11
<211> 29
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(29)
<400> 11
gccgctgttc atcttcgga 19
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 12
tgcggcacaa attgactgtg 20
<210> 13
<211> 24
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(24)
<400> 13
cctgcactaa aggttctttg gttt 24
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 14
agtctcctgg aaaaggcaga a 21
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 15
caccatcttc ttgccacctc t 21
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 16
atgtgggatt gctgctgtga 20
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 17
tttgcacctg cctttcctct 20
<210> 18
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 18
ttcaaaatgg tcagtgtgca g 21
<210> 19
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 19
ttcaaaatgg tcagtgtgca g 21
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 20
gctcaagtgg aagtggcagt 20
<210> 21
<211> 23
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(23)
<400> 21
gggtcatct aataagtctg gct 23
<210> 22
<211> 24
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(24)
<400> 22
aatccatctt atgacatcca gagt 24
<210> 23
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 23
taacatcaag ctcctggctg g 21
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 24
agggactgac catgcgtttc 20
<210> 25
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 25
tggcatttaa ggggaccaaa c 21
<210> 26
<211> 24
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(24)
<400> 26
gcccaaagag atgattaaga aggc 24
<210> 27
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 27
tgctgccatc cccttgatga 20
<210> 28
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 28
agtgagcaca tgcatcagaa 20
<210> 29
<211> 23
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(23)
<400> 29
agcactgtca gaagaattac gct 23
<210> 30
<211> 21
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(21)
<400> 30
tggacttgga caggaaaaca g 21
<210> 31
<211> 22
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(22)
<400> 31
tcagactggg tttgtcgttt ct 22
<210> 32
<211> 20
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(20)
<400> 32
ttaaagactc aggcggggaa 20
<210> 33
<211> 22
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(22)
<400> 33
acaaatttct tctcgctcag gt 22
<210> 34
<211> 22
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(22)
<400> 34
agaaagacca gagcgatgaa ac 22
<210> 35
<211> 22
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(22)
<400> 35
cagaactttc ctcagcatca ga 22
<210> 36
<211> 25
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(25)
<400> 36
aagagacaag attgttcatc atctg 25
<210> 37
<211> 23
<212> DNA
<213> Artificial sequence
<221> MISC_FEATURE
<222> (1)..(23)
<400> 37
aaaagcatct tcttggcaat tct 23
Claims (5)
1. The application of the primer for detecting the ATRX gene mutation site in preparing the DNA detection kit for assisting the diagnosis of the intellectual disability diseases is characterized in that:
the mutation site of the ATRX gene is positioned in the No. 24 intron of the ATRX gene, and the mutation information of the mutation site is as follows: c, 5786+4(IVS24) A > G, the site reference sequence is NM-000489.6, and the primer for detecting the mutation site of the ATRX gene comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
2. Use of the primer for detecting the mutation site of ATRX gene according to claim 1 for the preparation of DNA assay kit for the auxiliary diagnosis of intellectual impairment disorders, wherein: the genome nucleotide sequence of the mutation site is shown as SEQ ID NO. 1.
3. The application of the primer for detecting the ATRX gene mutation site in preparing the mRNA detection kit for assisting the diagnosis of the intellectual disturbance disease is characterized in that:
the mutation information of the ATRX gene mutation site is as defined in claim 1 or 2, a primer for detecting the ATRX gene mutation site is an amplification primer of an Exon of the ATRX gene, the Exon comprises Exon 23-25, and the amplification primers of the Exon 23-25 comprise an upstream primer and a downstream primer.
4. Use of the primers for detecting the mutated site of ATRX gene according to claim 3 for the preparation of an mRNA assay kit for the auxiliary diagnosis of intellectual impairment disorders, characterized in that:
the mRNA detection kit is used for detecting whether Exon24 is deleted or not.
5. Use of the primers for detecting the mutated site of ATRX gene according to claim 4 for the preparation of an mRNA assay kit for the auxiliary diagnosis of intellectual impairment disorders, characterized in that:
the mRNA detection kit is used for detecting whether the Exon24 is totally deleted.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110437546.3A CN113151445B (en) | 2021-04-22 | 2021-04-22 | Mutation site of ATRX gene related to mental retardation diseases and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110437546.3A CN113151445B (en) | 2021-04-22 | 2021-04-22 | Mutation site of ATRX gene related to mental retardation diseases and detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113151445A CN113151445A (en) | 2021-07-23 |
| CN113151445B true CN113151445B (en) | 2022-07-15 |
Family
ID=76869552
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110437546.3A Active CN113151445B (en) | 2021-04-22 | 2021-04-22 | Mutation site of ATRX gene related to mental retardation diseases and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113151445B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591957A (en) * | 2016-11-10 | 2017-04-26 | 复旦大学附属中山医院 | Construction method and application of gastrointestinal stromal tumor polygenic variation library |
| CN108998525A (en) * | 2018-07-27 | 2018-12-14 | 北京艾迪康医学检验实验室有限公司 | Detect primer, method and the kit of ATRX gene point mutation |
| CN112111577A (en) * | 2020-10-23 | 2020-12-22 | 北京诺禾致源科技股份有限公司 | ATRX and KDM5A mutation detection kit based on digital PCR technology, device and application |
-
2021
- 2021-04-22 CN CN202110437546.3A patent/CN113151445B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591957A (en) * | 2016-11-10 | 2017-04-26 | 复旦大学附属中山医院 | Construction method and application of gastrointestinal stromal tumor polygenic variation library |
| CN108998525A (en) * | 2018-07-27 | 2018-12-14 | 北京艾迪康医学检验实验室有限公司 | Detect primer, method and the kit of ATRX gene point mutation |
| CN112111577A (en) * | 2020-10-23 | 2020-12-22 | 北京诺禾致源科技股份有限公司 | ATRX and KDM5A mutation detection kit based on digital PCR technology, device and application |
Non-Patent Citations (7)
| Title |
|---|
| "Homo sapiens ATRX chromatin remodeler (ATRX), transcript variant 1, mRNA，NM_000489.6;佚名;《GenBank》;20210220;第1-13页 * |
| A novel exomal ATRX mutation with preferential transmission to offspring: A case report and review of the literature for transmission ratio distortion in ATRX families;Stabile M, Colavito D, Del Giudice E等;《Mol Med Rep》;20201009;第22卷(第6期);第4561-4566页 * |
| A novel missense mutation in ATRX uncovered in a Yemeni family leads to alpha-thalassemia/mental retardation syndrome without alpha-thalassemia;Hamzeh AR, Nair P, Mohamed M等;《Ir J Med Sci》;20160209;第186卷(第2期);第333-337页 * |
| ATRX/XNP基因研究进展;刘奇迹;《国外医学.遗传学分册》;20020228;第25卷(第1期);第19-24页 * |
| Homo sapiens chromosome X X-linked nuclear protein (ATRX) gene,complete cds，AH006694.3;佚名;《GenBank》;20161219;第1-9页 * |
| Mutations in the chromatin-associated protein ATRX;Gibbons RJ, Wada T, Fisher CA等;《Hum Mutat》;20080522;第29卷(第6期);第796-802页 * |
| 隐睾及隐睾合并其他泌尿生殖系统畸形的外显子测序分析;唐炳强，耿红全，林厚维等;《临床小儿外科杂志》;20200131;第19卷(第1期);第45-49页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113151445A (en) | 2021-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104120132B (en) | FBN1 gene mutation body and its application | |
| CN111909997B (en) | Application of miRNA marker in preparation of product for evaluating curative effect of olanzapine on schizophrenia treatment and kit | |
| CN106755395B (en) | Mutation site of XI type osteogenesis imperfecta pathogenic gene FKBP10 and application thereof | |
| Eisinger et al. | Medial prefrontal cortex: genes linked to bipolar disorder and schizophrenia have altered expression in the highly social maternal phenotype | |
| US20180291450A1 (en) | Method of identifying risk for autism | |
| CN114703278A (en) | Amyotrophic lateral sclerosis pathogenic gene, detection kit and primer group | |
| CN110551812A (en) | CRISPR-Cas system for diagnosing spinal muscular atrophy and application thereof | |
| CN113981071A (en) | CSF1R related gene mutation as marker for diagnosing CVM and application thereof | |
| CN112226440A (en) | Pathogenic mutation of hereditary primary infertility and detection reagent thereof | |
| CN113151445B (en) | Mutation site of ATRX gene related to mental retardation diseases and detection kit | |
| CN109355379B (en) | Kit for detecting autosomal dominant hereditary deafness family-induced deafness gene mutation | |
| US20110118125A1 (en) | Neonatal salivary genomics | |
| CN110878346B (en) | Gene mutant and application thereof | |
| CN115478101A (en) | Kit and method for detecting multiple gene site copy number variation of autism patient | |
| CN110628898A (en) | BAZ1B susceptibility SNP locus detection reagent and kit prepared by same | |
| JP2005511095A (en) | Bi-allelic marker of D-amino acid oxidase and use thereof | |
| JP2004275115A (en) | Mutation of scn2a gene in intractable childhood epilepsy accompanied by involution of critical mental faculty | |
| CN110511992B (en) | TARDBP mutant gene, detection primer and kit | |
| CN110452910B (en) | FUS mutant gene, detection primer and kit | |
| CN108018351A (en) | The relevant biomarker of metabolic disease and its application caused by a kind of high lipid food with intake | |
| CN116004788B (en) | Application of Angelman syndrome pathogenic gene UBE3A mutation site and diagnostic reagent thereof | |
| CN117535402B (en) | Application of FRMPD gene mutant as detection target, detection reagent with FRMPD gene mutant and detection kit | |
| CN115927354B (en) | SH3TC2 gene pathogenic mutant and application thereof in preparation of fibula muscular atrophy 4C type diagnostic kit | |
| CN110643700B (en) | Application of KFS related gene mutation in preparation of detection kit | |
| CN110628897B (en) | KFS pathogenic gene new mutation and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wu Ke Inventor after: Cong Yan Inventor before: Wu Ke Inventor before: Cong Yan |