CN113981071A - CSF1R related gene mutation as marker for diagnosing CVM and application thereof - Google Patents

CSF1R related gene mutation as marker for diagnosing CVM and application thereof Download PDF

Info

Publication number
CN113981071A
CN113981071A CN202111395426.8A CN202111395426A CN113981071A CN 113981071 A CN113981071 A CN 113981071A CN 202111395426 A CN202111395426 A CN 202111395426A CN 113981071 A CN113981071 A CN 113981071A
Authority
CN
China
Prior art keywords
cvm
mutation
csf1r
gene
detection reagent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111395426.8A
Other languages
Chinese (zh)
Inventor
吴南
仉建国
吴志宏
刘博文
赵森
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Original Assignee
Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Peking Union Medical College Hospital Chinese Academy of Medical Sciences filed Critical Peking Union Medical College Hospital Chinese Academy of Medical Sciences
Publication of CN113981071A publication Critical patent/CN113981071A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7153—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for colony-stimulating factors [CSF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/40—Fish
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Endocrinology (AREA)
  • Diabetes (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention disclosesCSF1RThe invention relates to a relative gene mutation as a marker for diagnosing CVM and application thereof, and the invention firstly carries out exome sequencing and bioinformatics analysis on 538 CVM patientsCSF1RThe mutant sites c.2749-2758 delGACAGGAGAG and c.2797G are found on the gene>T, c.2906_2909dupATCA, which is tested by in vitro and in vivo functional experiments to verify that the mutation site is a pathogenic mutation of CVM, and detecting whether one or more of the above-mentioned mutations exist in the genomic DNA of a subjectThe mutation site can be used for assisting the rapid diagnosis of CVM, and the invention lays a foundation for controlling the incidence of CVM from etiology and realizing the early diagnosis and early intervention of CVM.

Description

CSF1RRelated gene mutation as marker for diagnosing CVM (CVM) and application thereof
Technical Field
The invention belongs to the technical field of medical detection, and particularly relates to a medical detection kitCSF1RRelated gene mutation is used as a marker for diagnosing CVM and application thereof.
Background
Congenital Vertebral Malformation (CVM) is a serious Congenital spinal dysplasia and one of the major diseases causing disability in adolescents. CVM is a group of diseases mainly characterized by abnormal vertebral body structure of the spine due to abnormal development of the body segment during the embryonic development process, and can be expressed as Congenital Scoliosis (CS), kyphosis and other spinal deformities, which further cause severe physical problems such as neck and back pain, impaired cardio-pulmonary function, reduced labor capacity, even disability and the like (Giampiro P F, Raggio C L, Blank R D, et al. Clinical, genetic and environmental concerns with genetic structural formulas [ J ] Molecular syndrome, 2013, 4(1-2): 94-105.). Epidemiological investigations have shown that the incidence of CVM in newborns is between 0.5 and 1%, but the actual incidence of CVM in newborns is higher because some patients have no obvious symptoms or few symptoms without finding them. Teratogenic factors mainly exist before the growth development peak, when a CVM patient enters the spine development peak, the deformity progresses rapidly, the patient often shows cervicodynia, thoracodorsal pain, limited cardiopulmonary function and reduced motor ability, and in addition, the somatic pain and the deformity easily cause serious psychological problems, the orthopedic operation is complex and high in cost, and great burden is brought to families and society.
The pathogenesis of CVM is not completely understood at present, CVM is attributed to paraaxial mesoderm, somite or mesoclavicular dysplasia at embryonic stage, and any effect on the development of paraaxial mesoderm, somite and mesoclavium during embryonic development may lead to CVM (McMaster M J. structural scientific used by a systemic failure of genetic segmentation with a connective bone marrow developmental complex [ J]Spine, 1998, 23(9): 998-. Therefore, CVM is generated as a result of the combined action of multiple factors, mainly by the combined action of genetic factors and environmental factors, and related researches report that CVM has genetic tendency, the genetic factors are considered to dominate the generation and development of CVM relative to the environmental factors, and the mutation or abnormal regulation of the somite formation related genes in the embryonic development period is considered to be an important mechanism for causing the CVM. With the rapid development of genomics and sequencing technologies, research reports have been reportedPAX1、TBX6、WNT3A、LMX1A、DLL3Polymorphisms and rare variations of the isogene are closely related to CVM; copy number variation in the regions of chromosomes 17p11.2, 16p11.2, 10q24.31, 21p11, 22q11.2 are closely related to CVM. With the ongoing and intensive research on CVM, more and more research results indicate that rare mutations may play a more important role in the development and progression of CVM in genetic diseases.
Currently, research on CVM-associated rare mutations is slow. The present invention addresses the above deficiencies, by exome sequencing and bioinformatics analysis of 538 CVM patients, the first time inCSF1RThe mutant sites c.2749-2758 delGACAGGAGAG and c.2797G are found on the gene>T, c.2906_2909dupATCA, the pathogenic mutation of CVM at the mutation site is verified by in vitro and in vivo functional experiments, therefore, the peripheral blood of a subject can be collected, genome DNA is extracted, and detection is carried outCSF1RWhether one or more mutation sites exist on the gene or not can be used for assisting the rapid diagnosis of CVM, and the invention lays a foundation for controlling the incidence of CVM and realizing the early diagnosis and early intervention of CVM from the etiology.
Disclosure of Invention
Aiming at the technical defects existing in the prior art, the invention aims to provideCSF1RRelated gene mutation as marker for diagnosing CVM (CVM) and application thereofCSF1RThe related gene mutations include c.2749-2758 delGACAGGAGAG, c.2797G>T, c.2906_2909dupATCA, and functional experiments in vitro and in vivo verify that the mutation site is a pathogenic mutation of CVM, and the pathogenic mutation can be used for early diagnosis of CVM.
The above object of the present invention is achieved by the following technical solutions:
in a first aspect of the invention, a genetic mutation is provided for diagnosing CVM.
Further, the gene mutation isCSF1RA mutation in a gene.
Further, the mutations are c.2749_2758delGACAGGAGAG, c.2797G > T, c.2906_2909 dupATCA.
As an alternative embodiment, the mutation is any one of c.2749-2758 delGACAGGAGAG, c.2797G > T, c.2906-2909 dupATCA.
As an alternative embodiment, the mutations are any two of c.2749_2758 delgacaggaag, c.2797g > T, c.2906_2909 dupATCA.
As an alternative embodiment, the mutations are three, c.2749-2758 delGACAGGAGAG, c.2797G > T, c.2906-2909 dupATCA.
In the invention said to be locatedCSF1RThe specific information of the mutation sites on the gene is as follows:
c.2749_2758 delgacaggag: NM _ 005211.3: c.2749_2758delgacaggag (p.asp917serfster32);
c.2797g > T specific information: NM _ 005211.3: c.2797g > T (p.gly933cys);
specific information of 2906_2909 dupATCA: c.2906_2909dupATCA (p.Phe971SerfsTer7).
In a second aspect of the invention, a detection reagent is provided.
Further, the detection reagent is a detection reagent for a gene mutation according to the first aspect of the present invention.
Further, the detection reagent comprises a specific amplification primer and/or a specific recognition probe of the gene mutation;
preferably, the gene mutation is c.2749_2758delGACAGGAGAG, c.2797G > T, c.2906_2909 dupATCA.
Furthermore, the sequences of the specific amplification primers of the gene mutation c.2749-2758 delGACAGGAGAG, c.2797G > T and c.2906-2909 dupATCA are respectively shown as SEQ ID NO.1-SEQ ID NO.2, SEQ ID NO.3-SEQ ID NO.4 and SEQ ID NO.5-SEQ ID NO. 6.
Further, the reagent also comprises dNTPs, Taq enzyme and Mg2+And PCR reaction buffer.
Certain methods known to those skilled in the art can be used to detect the gene mutation, including (but not limited to): DNA sequencing; primer extension assays, including cell mutation-specific nucleotide incorporation assays and cell mutation-specific primer extension assays (e.g., cell mutation-specific PCR, cell mutation-specific Ligation Chain Reaction (LCR), and nick-LCR); mutation-specific oligonucleotide hybridization assays (e.g., oligonucleotide ligation assays); a cleavage protection assay in which protection from a cleavage agent is used to detect mismatched bases in a nucleic acid duplex; analysis of the binding of the MutS protein; electrophoretic analysis comparing the molecular mobility of variant and wild-type nucleic acids; denaturing gradient gel electrophoresis (DGGE, as described, for example, in Myers et al (1985) Nature 313: 495); analysis of rnases cleavage at mismatched base pairs; analyzing chemical or enzymatic cleavage of heteroduplex DNA; mass spectrometry (e.g., MALDI-TOF-MS); genetic Bit Analysis (GBA); 5' nuclease assay (e.g.: TaqManTM) (ii) a Assays employing molecular beacons.
Further, the primer or probe of the present invention can be chemically synthesized using a solid phase support method of phosphoryl imine or other well-known methods. The nucleic acid sequence may also be modified using a number of means known in the art. Non-limiting examples of such modifications are methylation, capping, substitution with one or more analogs of a natural nucleotide, and modification between nucleotides, for example, modification of an uncharged linker (e.g., methyl phosphate, phosphotriester, phosphoimide, carbamate, etc.), or modification of a charged linker (e.g., phosphorothioate, phosphorodithioate, etc.).
A third aspect of the invention provides a diagnostic product for CVM.
Further, the diagnostic product comprises a detection reagent according to the second aspect of the invention;
preferably, the diagnostic product comprises a kit, a chip, a test strip.
Further, the kit may further comprise instructions or labels for use, positive controls, negative controls, buffers, adjuvants or solvents; the instructions or labels specify how the kit is to be used for detection and the use of the kit for diagnosing CVM. In certain embodiments, the kit further comprises a wash solution. In certain embodiments, the kit further comprises reagents for performing hybridization assays, mRNA isolation or purification means, detection means, and positive and negative controls. In certain embodiments, the kit further comprises instructions for using the kit. In certain embodiments, provided herein are kits for detecting the protein level of one or more biomarkers. In certain embodiments, the kit comprises a test strip coated with an antibody that recognizes a protein biomarker, a wash solution, reagents for performing the assay, protein isolation or purification means, detection means, and positive and negative controls. In certain embodiments, the kit further comprises instructions for using the kit. The kit may be customized for home use, clinical use, or scientific research use.
Further, the kit of the present invention may contain a plurality of different reagents suitable for practical use (e.g., for different detection methods), and is not limited to the reagents listed in the present invention, as long as they are based onCSF1RMutations in the Gene c.2749-2758 delGACAGGAGAG, c.2797G>The detection of T, c.2906-2909 dupATCA reagents for diagnosing CVM are included within the scope of the invention.
Further, the kit may employ, for example, a test strip, a membrane, a chip, a tray, a test strip, a filter, a microsphere, a slide, a multi-well plate, or an optical fiber. The solid support of the kit can be, for example, a plastic, a silicon wafer, a metal, a resin, a glass, a membrane, a particle, a precipitate, a gel, a polymer, a sheet, a sphere, a polysaccharide, a capillary, a film, a plate, or a slide.
Further, the preparation of the chip may employ conventional preparation methods of biochips known to those skilled in the art, including (but not limited to): preparing an oligonucleotide probe into a solution by adopting a solid phase carrier of a modified glass slide or a silicon chip, wherein the 5' end of the probe contains a poly-dT string modified by amino, then spotting the solution on the modified glass slide or the silicon chip by adopting a spotting instrument, arranging the solution into a preset sequence or array, and then placing the chip for fixation at night to obtain the chip; if the nucleic acid does not contain amino modifications, the preparation can also be referred to: the "Gene diagnostic technique-non-Radioactive operation Manual" edited by Wangshen five; L.L.erisi, V.R.Iyer, P.O.BROWN. expanding the metabolic and genetic control of gene expression a genetic scale, Science, 1997; 278:680 and maliren, jiang china main edition biochip, beijing: chemical industry Press, 2000, 1-130.
In a fourth aspect of the invention, a method for constructing a CVM zebrafish model is provided.
Further, the method comprises the steps of:
(1) culturing the embryo of the zebra fish;
(2) construction of mutations containing mutated gene sequencesCSF1RA plasmid;
(3) after the plasmid is linearized, transcription is carried out to obtain mRNA;
(4) injecting the mRNA into cells of the zebrafish embryo at the one-cell stage to the two-cell stage;
preferably, the mutant gene in step (2) isCSF1RC.2749_2758delgacaggag on gene;
preferably, the mRNA in step (4) is 50 pg.
Further, the zebra fish in the step (1) is preferably Tg (Ola. Sp7: nlsGFP) transgenic zebra fish.
In a fifth aspect, the invention provides the use of a mutation in a gene according to the first aspect of the invention in the preparation of a detection reagent according to the second aspect of the invention.
Further, the gene mutation sites are c.2749-2758 delGACAGGAGAG, c.2797G > T and c.2906-2909 dupATCA.
The skilled in the art designs specific amplification primers or specific recognition probes based on the sequences upstream and downstream of the gene mutation site, and the design methods of the primers and probes are conventional techniques known in the art.
In a sixth aspect, the present invention provides the use of a mutation in a gene according to the first aspect of the present invention or a detection reagent according to the second aspect of the present invention in the manufacture of a diagnostic product for CVM;
preferably, the diagnostic product of CVM is a diagnostic product of CVM according to the third aspect of the invention;
more preferably, the diagnostic product diagnoses whether the subject has CVM by detecting a mutation in a gene according to the first aspect of the invention in the sample;
most preferably, the source of the sample is the blood of the subject.
Furthermore, the diagnostic product comprises a kit, a chip and test paper.
The seventh aspect of the invention provides the application of the CVM zebra fish model prepared by the method in the fourth aspect of the invention in screening candidate drugs for treating CVM.
Further, the method for screening candidate drugs for treating CVM comprises the following steps:
(1) applying the substance to be screened to a CVM zebrafish model;
(2) detecting the CVM symptom relieving condition of the zebra fish;
(3) if symptoms of CVM are alleviated in zebrafish following administration of the substance to be screened, the substance to be screened is a candidate for the treatment of CVM.
Therefore, the gene mutation described in the claims includes the corresponding mutant protein, and the modification of the gene mutation site described in the claims to the mutant protein is still included in the scope of the invention, and any modification and modification of the mutant site or the mutant protein will also fall in the scope of the invention.
The present invention may utilize any method known in the art for detecting genes and their encoded proteins. It will be appreciated by those skilled in the art that the means by which the gene is detected is not an important aspect of the present invention. The genes of the invention are detected using a variety of detection techniques known to those of ordinary skill in the art, including (but not limited to): nucleic acid sequencing, nucleic acid hybridization, nucleic acid amplification technology and immunodetection technology.
Further, methods for detecting gene mutations or protein mutations include (but are not limited to): taqman, mass spectrometry, DNA microarray, sequencing, microsequencing, hybridization, restriction fragment analysis, oligonucleotide ligation detection, allele-specific PCR-HRM or a combination thereof.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the specification of the present invention are only for describing specific embodiments and are not intended to limit the present invention, and furthermore, some terms are explained as follows.
The term "primer" as used herein refers to a single-stranded polynucleotide capable of hybridizing to a nucleic acid and allowing polymerization of the complementary nucleic acid, typically by providing a free 3' -OH group.
The term "probe" as used herein refers to a molecule that binds to a specific sequence or subsequence or other portion of another molecule. Unless otherwise indicated, "probe" generally refers to a polynucleotide probe that is capable of binding to another polynucleotide by complementary base pairing. Depending on the stringency of the hybridization conditions, a probe can bind to a target polynucleotide that lacks complete sequence complementarity to the probe. The probe may be directly or indirectly labeled, and includes within its scope a primer. Hybridization modalities, including (but not limited to): solution phase, solid phase, mixed phase or in situ hybridization assays.
The term "amplification" as used herein refers to the process of generating one or more copies of a reference nucleic acid sequence or its complement. Amplification may be linear or exponential (e.g., Polymerase Chain Reaction (PCR)). "copy" does not necessarily indicate complete sequence complementarity or identity with respect to the template sequence. For example, the copies may comprise nucleotide analogs such as deoxyinosine, intentional sequence alterations (such as sequence alterations introduced via primers comprising sequences that are hybridizable but not fully complementary to the template), and/or sequence errors that occur during amplification.
The term "exon" as used herein refers to the portion of mature mRNA that is retained, i.e., the portion of mature mRNA corresponding to a gene. Introns are the parts that are spliced out during mRNA processing and are not present in mature mRNA. Both exons and introns are for genes, the encoded part is an exon, the non-encoded part is an intron, and the intron has no genetic effect.
The term "diagnosis" as used herein refers to the identification or classification of a molecular or pathological state, disease or condition. It may also refer to the classification of a particular subtype of disease, for example by molecular characteristics (e.g., a subset of patients characterized by nucleotide variation in a particular gene or nucleic acid region).
The term "treatment" as used herein refers to a treatment involving a human or animal (e.g., as applied by a veterinarian) in which some desired therapeutic effect is achieved, e.g., inhibition of the progression of a condition (including reduction in the rate of progression, cessation of progression), amelioration of the condition, and cure of the condition. Treatment as a prophylactic measure (e.g., prophylaxis) is also included. The use of a patient who has not yet developed a condition but who is at risk of developing the condition is also encompassed by the term "treatment".
The invention has the advantages and beneficial effects that:
(1) exome sequencing and bioinformatics analysis of 538 CVM patients was performed, the first time inCSF1RThe mutant sites c.2749-2758 delGACAGGAGAG and c.2797G are found on the gene>T, c.2906_2909dupATCA, and the site of the mutation is the pathogenic mutation of CVM through in vitro and in vivo functional experiments.
(2) The invention provides a method for constructing a CVM zebra fish model, wherein the zebra fish model constructed by the method is expressed as a vertebral body phenotype of a CVM patient, and an important research model is provided for further researching the pathogenic mechanism of the CVM of human beings.
(3) The invention providesCSF1RThe related gene mutation is used as a marker for diagnosing CVM, and lays a foundation for controlling the incidence of CVM from etiology and realizing early diagnosis, early intervention and early treatment of CVM.
(4) The invention provides a marker for diagnosing CVM by detecting the genomic DNA of the blood of a subjectCSF1RWhether the mutation site is present in the gene (c.2749-2758 delGACAGGAGAG, c.2797G>T, c.2906_2909dupATCA), namely whether the subject suffers from CVM can be judged, and the diagnosis method is a non-invasive and non-invasive method, can quickly and effectively diagnose early and strive for the earliest intervention time.
Drawings
Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:
FIG. 1 shows 3 CVM patientsCSF1RMutation information and clinical phenotype of the carboxy-terminal mutation site, wherein, panel a:CSF1Rsanger sequencing results of rare mutation sites at the carboxy terminus, panel B: spine plain and Computed Tomography (CT) results maps;
FIG. 2 shows CVM patientsCSF1RPrediction and distribution of nonsense-mediated decay (NMD) of rare carboxy-terminal mutation sites, wherein, panel a: two identified in the CVM queueCSF1RNMD prediction of truncated variants, panel B:CSF1Ra simplified diagram of the protein;
FIG. 3 showsCSF1RFunctional studies of carboxy-terminal mutation sites in vivo and in vitro, wherein, panel a: from wild type or mutantCSF1RIn total cell lysates made from plasmid-transfected Cos-7 cellsCSF1RProtein level, panel B: in total cell lysates made from wild-type and mutant plasmid-transfected Cos-7 cellsCSF1RResults of quantitative analysis of protein expression levels, panel C: injection of wild typeCSF1RmRNA orCSF1R ΔC Tg of mRNA (Ola)Sp7: nlsGFP) fluorescence imaging of zebrafish; and (D) diagram: experimental groups (A)CSF1R mRNA，CSF1R ΔC mRNA) and control group of zebrafish showed a statistical profile of CVM phenotype<0.05，** p<0.01，*** p<0.001，**** p<0.0001。
Detailed Description
The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.
Example 1 screening of CVM-associated Gene mutations
1. Sample collection
583 patients diagnosed with Congenital Vertebral Malformations (CVM) in the Beijing coordination Hospital (PUMCH) between 2009 and 2018 were collected and included as part of the DISCO spinal malformation research platform (dissecting disorders in surgery and society, DISCO) (http:// www.discostudy.org /), and detailed clinical phenotypic information of the patients was recorded, including relevant imaging data such as X-ray, Computed Tomography (CT) and spinal three-dimensional reconstruction, whole-spine Magnetic Resonance Imaging (MRI), all subjects themselves or their parents signed informed consent books, approved by the Ethics Committee of the Beijing coordination Hospital.
2. Exome sequencing and data analysis
All collected CVM patients were exome sequenced. DNA was extracted from peripheral blood of patients and exome sequencing was performed on all subjects, an Illumina paired-end library was prepared from DNA samples and exome captured, followed by sequencing on Illumina HiSeq 4000 platform. Variants were called and filtered using an in-developed analytical Pipeline (PUMP).
In this study, all were extracted from the exome data summaryCSF1RThe rare variants in (1) were used for further analytical studies.
3. Variant interpretation and prioritization
Variant interpretation was performed based on the genome aggregation database (gnomAD, http:// gnomAD. Wherein the content of the first and second substances,CSF1Rthe rare variants in (a) were extracted and filtered according to the following criteria: (1) truncation (nonsense, frameshift, splice acceptor/donor) and Minor Allele Frequency (MAF). ltoreq.0.001; (2) missense variants missing from public databases in the general population.
4. Results of the experiment
The results of the experiments showed that 3 CVM patients were identifiedCSF1R3 novel deleterious heterozygous variants of (1), including 2 truncated variants and 1 missense variant (see table 1).
Subject DISCO-CSS 170368. The subject was a 14 year old girl undergoing spinal surgery and the flat spinal column showed the patient to have a right curvature of the spine with the coronal Cobb angle of the major curvature (T2-L1) being 114 °. The results of CT and spinal three-dimensional reconstruction are shown for congenital fusion at T5-T9, dysplasia at T3-9, hyperplasia of the half vertebrae at L4 and abnormalities of the 6 th and 7 th ribs on the left (see FIG. 1B). In addition, a total spine MRI examination was performed, and the results showed mild redness and swelling and syringomyelia, and girls were free from symptoms such as dyspnea, numbness or weakness of limbs, soreness of waist or pain of limbs, and the like during the course of the disease. The clinical diagnosis of the subject was severe congenital scoliosis, pulmonary insufficiency, diplomalgia and syringomyelia. Identified in the subject by exome sequencing analysisCSF1RThe novel truncated variant of (NM-005211.3: c.2749-2758 delGACAGGAGAG), in patientsCSF1RThe deletion of 10 nucleotides between positions 2749 and 2758 in exon 21 of the gene results inCSF1RA frameshift mutation occurred. The patentees investigated the potential of nonsense-mediated mRNA decay (NMD) of the NMD Esc predictor (see fig. 2A) and showed that mrnas carrying this mutation might escape NMD, and therefore, this frameshift mutation might produce abnormal protein products (p.asp)917SerfsTer32)。
Subject DISCO-CSS 180319. The subject was a 10-year-old CVM confirmed girl patient whose imaging examination revealed a primary curve with a Cobb angle of 56 ° (T3-T7). In addition, structural disorders of T3-T7 were also observed in the CT and spine three-dimensional reconstruction results (see FIG. 1B). Identified in the subject by exome sequencing analysisCSF1RMissense variant of (NM-005211.3: c.2797G)>T), which may lead to amino acid changes (p.gly933cys), after replacement of glycine by cystine, which tends to be oxidized and to form disulfide bonds between each other, possibly affectingCSF1RThe formation of homodimers and their biological function.
Subject DISCO-CSS 170278. The subject was a 16 year old boy patient with lateral thoracic and lumbar curvatures, and the subject's spinal plate results indicated the presence of the T10 half vertebrae (see FIG. 1B), identified in the subject by exome sequencing analysisCSF1RA missense variant of (NM-005211.3: c.2906-2909 dupATCA), which may result in a reading frame shift, i.e., the last two amino acids of CSF1R are deleted and several additional amino acids are added to the carboxy-terminus of the protein.
In addition, three rare ones identified in the study cohortCSF1RVariants are all located in or near the carboxy-terminal region downstream of the PTK domain (see FIG. 2B), whileCSF1RThe carboxy-terminal region of (a) contains a plurality of autophosphorylation sites involved in protein metabolism.
TABLE 1 deleterious and rare cases screened for CVM patientsCSF1RMutations
Figure 237450DEST_PATH_IMAGE001
Example 2 validation of disease-causing Gene mutations by Sanger sequencing
Sanger sequencing of genomic DNA from all subject individuals was performed to correctly confirm all variants identified in example 1.
1. Experimental methods
Amplifying variant-encoding amplicons from genomic DNA obtained from a CVM patient using PCR;
TABLE 2 amplification System
Figure 693577DEST_PATH_IMAGE002
TABLE 3 amplification conditions
Figure 961747DEST_PATH_IMAGE003
The amplification system is shown in Table 2, and the amplification conditions are shown in Table 3; the primers used for PCR amplification and Sanger sequencing were as follows:
(1) mutation 1 (c.2749_2758delGACAGGAGAG)
A forward primer: GCCGAGCTGTTGAGTGAAAT (SEQ ID NO.1)
Reverse primer: TCTAGTGAGCACCTGACCTG (SEQ ID NO.2)
(2) Mutation 2 (c.2797G > T)
A forward primer: TGGTACTCCCTGTCGTCAAC (SEQ ID NO.3)
Reverse primer: AGGTCTCTCTAGGGGTGTGTG (SEQ ID NO.4)
(3) Mutation 3 (c.2906 _2909dupATCA)
A forward primer: TGGTACTCCCTGTCGTCAAC (SEQ ID NO.5)
Reverse primer: AGGTCTCTCTAGGGGTGTGTG (SEQ ID NO.6)
The amplification product was purified using the Axygen AP-GX-50 kit (batch No.: 05915KE 1). Sanger sequencing was then performed on ABI3730XL instrument.
2. Results of the experiment
The results are shown in FIG. 1A, and confirmed by Sanger sequencingCSF1RVariants of (c.2749-2758 delGACAGGAGAG, c.2797G>The presence of T, c.2906-2909 dupATCA confirmed that the mutation was a true mutation.
Example 3 in vitro functional verification of disease-causing Gene mutations
To study furtherCSF1RThe present example, using the pEGFP-C1 vector plasmid, willCSF1RVariants of (c.2749-2758 delGACAGGAGAG, c.2797G>T, c.2906-2909 dupATCA were transfected into CIn os-7 cells, all plasmids were verified by DNA sequencing and in transfected cells analyzed by Western blottingCSF1RExpression of (2).
1. Plasmid construction and site-directed mutagenesis
The constructed plasmid includes wild typeCSF1RPlasmids and mutantsCSF1RA plasmid;
(1) respectively designing primers to amplify wild typeCSF1RMutant typeCSF1RThe mutant sequence of (c.2749-2758 delGACAGGAGAG, c.2797G)>T, c.2906_2909dupATCA), adding primers which are designed and synthesized by homologous recombination sequences with the vector before and after the target gene according to the seamless cloning principle, wherein the primers are respectively as follows:
Figure 891657DEST_PATH_IMAGE004
(2) PCR amplification
The reaction system and reaction conditions for PCR amplification are shown in tables 4 and 5;
TABLE 4 reaction System
Figure 587080DEST_PATH_IMAGE005
TABLE 5 reaction conditions
Figure 235231DEST_PATH_IMAGE006
(3) Cutting agarose and recovering the synthesized PCR fragment;
(4) EcoRI/BamHI double enzyme cutting vector pCS2+, the enzyme cutting system is shown in Table 6;
TABLE 6 enzyme digestion System
Figure 713616DEST_PATH_IMAGE007
Enzyme digestion is carried out for 0.5h at 37 ℃, and then enzyme digestion products are recovered;
(5) carrying out recombination reaction and transformation, wherein a recombination reaction system is shown in a table 7;
TABLE 7 recombination reaction System
Figure 888246DEST_PATH_IMAGE008
a) Mixing, performing recombination reaction at 37 deg.C for 30 min, and ice-cooling the recombination reaction solution for 5 min;
b) and (3) transformation: to the recombinant product, 100. mu.L of ToP10 competent cells were added, mixed well with 42 ℃ heat shock for 60 s, and ice water bath for 120 s, and the transformed mixture was spread evenly on LB plate containing ampicillin resistance and cultured overnight at 37 ℃.
(6) Positive clone screening and identification
Selecting a single clone to carry out PCR identification reaction, wherein identification primers are as follows:
CMV-F：CGCAAATGGGCGGTAGGCGTG (SEQ ID NO.15)
CSF1R-CX-1R：CACTGGTGTGAAGAGGAACT (SEQ ID NO.16)
2. cell culture and plasmid transfection
Cos-7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen), and fetal bovine serum (Gibco), penicillin (50U/mL) and streptomycin (50. mu.g/mL) were added to 6-well plates. Respectively combining wild type and mutant typeCSF1RThe plasmid (pEGFP-C1 plasmid 1. mu.g) was transfected into the above cells, and the cells were collected after 48 hours.
3. Western blot for verifying expression condition of related proteins in cells
Taking part of the cells collected after 48 hours, extracting total protein and carrying out Western blot to verify the inside of the cellsCSF1RProtein expression, protein expression in cell lysates was assessed using the following antibodies: mouse anti-GFP monoclonal antibodies (1: 1000, ZSJQB co., Ltd.) and mouse anti-GAPDH monoclonal antibodies (1: 1000, ZSJQB co., Ltd.).
4. Statistical analysis
Statistical differences between the different experimental and control groups were evaluated using the chi-square test, all statistical procedures using GraphPad Prism8, with P.ltoreq.0.05 considered statistically significant. Wherein, p <0.05, p <0.01, p <0.001 and < 0.0001.
5. Results of the experiment
The results are shown in FIGS. 3A and 3B, which show that the wild type was transfectedCSF1RTransfection of mutants compared to cells of plasmidsCSF1RIn cells of plasmidsCSF1RThe expression level of the protein is obviously increased (c.2797G)>T, p = 0.00259; c.2906_2909dupATCA, p = 0.00005; c.2749_2758delgacaggag, p =0.00004), indicatingCSF1RMutation sites on the gene c.2749-2758 delGACAGGAGAG, c.2797G>T, c.2906_2909dupATCA can be improvedCSF1RStability of the protein.
Example 4 in vivo functional verification of disease-causing Gene mutation
To further verify the disease-causing gene mutation, this example performed a verification experiment using transgenic zebrafish.
1. Breeding and cultivating zebra fish
The Tg (Ola. Sp7: nlsGFP) transgenic zebrafish was used, and the Sp7 promoter drives GFP expression in osteoblasts and is used for constructing an animal model. Zebra fish is bred in 28 deg.C environment, and fed with saline shrimp 2 times per day. From the cell stage of the two-to four-cell stage to 3 days after fertilization, embryos were incubated in methylene blue to avoid fungal infection.
2. In vitro mRNA transcription
Human wild typeCSF1RThe DNA sequence of (a) was cloned into the PCS2+ plasmid to construct a human wild typeCSF1RA plasmid. Insertion variants (c.2749-2758 delGACAGGAGAG) were then constructed to generate human mutations containing the mutated gene sequenceCSF1RA plasmid. After linearization of the plasmid, transcription was performed using the mMESSAGE mMACHINE ™ SP6 Ultra transcription kit (Ambion) to obtain the corresponding mRNA.
3. Embryo injection
Mixing wild typeCSF1R mRNA and mutatedCSF1RmRNA (50 pg each) was dissolved in distilled water (2 nL each) and injected into the embryos at the cell stage from the single cell stage to the two cell stage, respectively, while an equal amount of water was injected into the embryos as a control group. The experimental and control groups retained all individuals for phenotypic evaluation.
The invention overexpresses the mutationCSF1RAllele (NM-005211.3: c.2749-2758 delGACAGGAGAG) The mutant depletes all the carboxy-terminal region downstream of the PTK domain, and the mutated mRNA deleted carboxy-terminal region is referred to asCSF1R ΔCmRNA。
4. Fluorescence imaging and phenotypic evaluation
Fluorescence images of 14 dpf (14 days post fertilization) zebrafish larvae were collected by fluorescence microscopy. Vertebral morphology was observed and recorded for phenotypic evaluation and statistical analysis.
5. Statistical analysis
Statistical differences between the different experimental and control groups were evaluated using the chi-square test, all statistical procedures using GraphPad Prism8, with P.ltoreq.0.05 considered statistically significant. Wherein, p <0.05, p <0.01, p <0.001 and < 0.0001.
6. Results of the experiment
The results show that fluorescence images of the spine were collected by fluorescence microscopy at 21 dpf (21 days post fertilization).CSF1RThe mRNA overexpression group of zebrafish exhibited vertebral malformations including vertebral fusion, half vertebrae and fused pedicles (see FIG. 3C), covering the phenotype of human CVM, these vertebral-associated phenotypes indicating,CSF1Rthe dose effect expressed may be the cause of vertebral malformation. Experimental groups (A)CSF1R mRNA：24%，7/29；CSF1R ΔCmRNA: 52%, 13/25) and control (0%) showed significant differences in the percentage of CVM phenotype (chi-square test,CSF1R mRNA：p=0.00635；CSF1R ΔCmRNA: p ═ 0.00002), and injection at embryonic stageCSF1RmRNA in zebrafish, injectedCSF1R ΔCZebrafish with mRNA had a significantly higher percentage of vertebral malformed phenotype (chi-square test p =0.03452) (see fig. 3D), indicating that humansCSF1R ΔCThe proportion of vertebral body deformity of the zebra fish caused by the injection of mRNA is higher than that of wild mRNA, and further proves thatCSF1ROf (c) is the pathogenicity of the variant of the carboxy-terminal region of (a).
Through the in vitro and in vivo functional verification experiments, the research confirmsCSF1RMutation sites on the gene c.2749-2758 delGACAGGAGAG, c.2797G>T, c.2906_2909dupATCA are connected through interfering ubiquitin proteinInhibition of c-Cbl binding by ligaseCSF1RThereby increasingCSF1RExpression level of protein, enhancementCSF1RFurther affecting bone metabolism and vertebral development, resulting in the development of CVM.
The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.
Sequence listing
<110> Beijing coordination hospital of Chinese academy of medical sciences
<120> CSF1R related gene mutation as marker for diagnosing CVM and application thereof
<141> 2021-11-17
<150> 2021102659988
<151> 2021-03-11
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gccgagctgt tgagtgaaat 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tctagtgagc acctgacctg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tggtactccc tgtcgtcaac 20
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aggtctctct aggggtgtgt g 21
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tggtactccc tgtcgtcaac 20
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aggtctctct aggggtgtgt g 21
<210> 7
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gctacttgtt ctttttgcag gatccatggg cccaggagtt ctgctgctcc tg 52
<210> 8
<211> 55
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
attaatttgg cgcgcctcga attctcagca gaactgatag ttgttgggct gcagc 55
<210> 9
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ccacactgat aagtgtgatg aggcccaagt gc 32
<210> 10
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
cacacttatc agtgtggcca ctgcactgca gc 32
<210> 11
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tcaatcagtt ctgctgagaa ttcgaggcgc gcc 33
<210> 12
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ctcagcagaa ctgattgata gttgttgggc tgcagc 36
<210> 13
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
caagagagcg ggactatacc aatctgccga gca 33
<210> 14
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tatagtcccg ctctcttggg cctgctcctg a 31
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cgcaaatggg cggtaggcgt g 21
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cactggtgtg aagaggaact 20

Claims (10)

1. A genetic mutation for diagnosing CVM characterized in that said genetic mutation isCSF1RA mutation in a gene;
said mutation isCSF1RC.2749_2758delGACAGGAGAG, c.2797G on the gene>T、c.2906_2909dupATCA。
2. A detection reagent for detecting a gene mutation according to claim 1.
3. The detection reagent according to claim 2, wherein the detection reagent comprises a specific amplification primer and/or a specific recognition probe for the gene mutation;
the gene mutation is c.2749-2758 delGACAGGAGAG, c.2797G > T, c.2906-2909 dupATCA.
4. The detection reagent according to claim 3, wherein the sequences of the specific amplification primers of the gene mutation c.2749-2758 delGACAGGAGAG, c.2797G > T, c.2906-2909 dupATCA are shown as SEQ ID NO.1-SEQ ID NO.2, SEQ ID NO.3-SEQ ID NO.4, and SEQ ID NO.5-SEQ ID NO.6, respectively.
5. The detection reagent of claim 2, wherein the reagent further comprises dNTPs, Taq enzyme, Mg2+And PCR reaction buffer.
6. A diagnostic product for CVM comprising the detection reagent of any one of claims 2 to 5;
the diagnostic product comprises a kit, a chip and test paper.
7. A method for constructing a CVM zebra fish model, comprising the steps of:
(1) culturing the embryo of the zebra fish;
(2) construction of mutations containing mutated gene sequencesCSF1RA plasmid;
(3) after the plasmid is linearized, transcription is carried out to obtain mRNA;
(4) injecting the mRNA into cells of the zebrafish embryo at the one-cell stage to the two-cell stage;
the mutation in the step (2) is a gene mutation described in claim 1.
8. Use of the gene mutation of claim 1 for the preparation of the detection reagent of any one of claims 2 to 5.
9. Use of a genetic mutation according to claim 1 or a detection reagent according to any one of claims 2 to 5 for the preparation of a diagnostic product for CVM;
the diagnostic product of CVM according to claim 6;
the diagnostic product diagnoses whether the subject has CVM by detecting a mutation in the gene of claim 1 in a sample.
10. Use of the CVM zebrafish model prepared according to the method of claim 7 for screening a candidate drug for the treatment of CVM.
CN202111395426.8A 2021-03-11 2021-11-23 CSF1R related gene mutation as marker for diagnosing CVM and application thereof Pending CN113981071A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2021102659988 2021-03-11
CN202110265998 2021-03-11

Publications (1)

Publication Number Publication Date
CN113981071A true CN113981071A (en) 2022-01-28

Family

ID=79750037

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111395426.8A Pending CN113981071A (en) 2021-03-11 2021-11-23 CSF1R related gene mutation as marker for diagnosing CVM and application thereof

Country Status (1)

Country Link
CN (1) CN113981071A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116463353A (en) * 2022-12-23 2023-07-21 首都医科大学附属北京天坛医院 Construction method and application of Csf1r gene mutation mouse model
CN117248011A (en) * 2023-11-02 2023-12-19 首都医科大学附属北京天坛医院 Primer group for detecting CSF1R microglial encephalopathy pathogenic gene

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102006019480A1 (en) * 2006-04-26 2007-10-31 Sirs-Lab Gmbh Use of gene expression profiles to detect any postoperative tissue incompatibility reactions after liver transplantation
CN104830856A (en) * 2015-05-26 2015-08-12 上海基龙生物科技有限公司 Single nucleotide mutant primer group and detection method thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102006019480A1 (en) * 2006-04-26 2007-10-31 Sirs-Lab Gmbh Use of gene expression profiles to detect any postoperative tissue incompatibility reactions after liver transplantation
WO2007124820A2 (en) * 2006-04-26 2007-11-08 Sirs-Lab Gmbh Method for in vitro monitoring of postoperative changes following liver transplantation
CN104830856A (en) * 2015-05-26 2015-08-12 上海基龙生物科技有限公司 Single nucleotide mutant primer group and detection method thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BOWEN LIU ET AL.: "Variants Affecting the C-Terminal of CSF1R Cause Congenital Vertebral Malformation Through a Gain-of-Function Mechanism", 《FRONT CELL DEV BIOL.》, pages 641133 *
CLARE PRIDANS ET AL.: "CSF1R mutations in hereditary diffuse leukoencephalopathy with spheroids are loss of function", 《SCIENTIFIC REPORTS》, pages 3013 *
COSV53840645 SOMATIC SNV: "COSV53840645 SOMATIC SNV", 《ENSEMBL》 *
CUIHUA LENG ET AL.: "A novel dominant-negative mutation of the CSF1R gene causes adult-onset leukoencephalopathy with axonal spheroids and pigmented glia", 《AM J TRANSL RES》, vol. 11, no. 9, pages 6097 *
LV-PING ZHUANG ET AL.: "Clinical features and genetic characteristics of hereditary diffuse leukoencephalopathy with spheroids due to CSF1R mutation: a case report and literature review", 《ANN TRANSL MED》, pages 11 *
刘博文: "先天性椎体畸形致病基因与发病机制的新探索", 《中国知网》, pages 1 - 51 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116463353A (en) * 2022-12-23 2023-07-21 首都医科大学附属北京天坛医院 Construction method and application of Csf1r gene mutation mouse model
CN116463353B (en) * 2022-12-23 2023-09-19 首都医科大学附属北京天坛医院 Construction method and application of Csf1r gene mutation mouse model
CN117248011A (en) * 2023-11-02 2023-12-19 首都医科大学附属北京天坛医院 Primer group for detecting CSF1R microglial encephalopathy pathogenic gene

Similar Documents

Publication Publication Date Title
Liu et al. DNA methylation and psychiatric disorders
US20180274032A1 (en) Genetic Variants Underlying Human Cognition and Methods of Use Thereof as Diagnostic and Therapeutic Targets
JP6078211B2 (en) Genetic changes associated with autism and the phenotype of autism and its use for diagnosis and treatment of autism
CN110541025B (en) Detection method, primer composition and kit for Duchenne muscular dystrophy gene defect
JP5934726B2 (en) Method for analyzing the presence of disease markers in a blood sample of a subject
JPH09512702A (en) Compositions and methods for DNA mismatch repair genes
CN113981071A (en) CSF1R related gene mutation as marker for diagnosing CVM and application thereof
CN108138242A (en) Determine the method being mutated in genomic DNA, the purposes of this method and the kit for implementing this method
HUE028135T2 (en) Transcription infidelity, detection and uses thereof
KR20200081380A (en) Genetic regulation
Seymen et al. Novel ITGB6 mutation in autosomal recessive amelogenesis imperfecta
JP6449147B2 (en) Method for detecting T cell lymphoma
KR20230146139A (en) Next generation sequencing (ngs)-based hybrid diagnostic panel for analyzing variation of cancer gene and anticancer drug-related gene
Dai et al. Revealing diverse alternative splicing variants of the highly homologous SMN1 and SMN2 genes by targeted long-read sequencing
US20180113133A1 (en) Gene relevant to papillary thyroid tumors
CN110272994B (en) Gene mutation diagnosis of CVM and application thereof
Cinque et al. A novel complex genomic rearrangement affecting the KCNJ2 regulatory region causes a variant of Cooks syndrome
CN108486230B (en) Kit for noninvasive detection of MITF gene mutation and preparation method thereof
CN115094065B (en) Application of RUNX2 gene mutation in preparation of kit for screening cranioclavicular dysplasia patients
CN113151445B (en) Mutation site of ATRX gene related to mental retardation diseases and detection kit
US20210010092A1 (en) Gene relevant to papillary thyroid tumors
CN113943791B (en) Application of UC002yug.2-rs2246640 as female obesity biomarker
CN114622013B (en) Juvenile idiopathic scoliosis detection product
CA2804923A1 (en) Assays for detecting wdr62 mutations
KR102327623B1 (en) SNP for asthma diagnosis and asthma diagnosis method using the same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination