CN111944806A - Molecular tag group for high-throughput sequencing pollution detection and application thereof - Google Patents
Molecular tag group for high-throughput sequencing pollution detection and application thereof Download PDFInfo
- Publication number
- CN111944806A CN111944806A CN202010751025.0A CN202010751025A CN111944806A CN 111944806 A CN111944806 A CN 111944806A CN 202010751025 A CN202010751025 A CN 202010751025A CN 111944806 A CN111944806 A CN 111944806A
- Authority
- CN
- China
- Prior art keywords
- molecular
- sample
- fragment
- tags
- throughput sequencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular label group for high-throughput sequencing pollution detection, which comprises a plurality of different molecular labels; different molecular tags are different in length; the molecular tag is a nucleic acid fragment. When the molecular label group is used for sample detection, a proper amount of copied molecular labels are mixed into a sample before sample pretreatment, wherein the sample types include but are not limited to blood, saliva, plasma, DNA and the like. And (3) carrying out links such as nucleic acid extraction, library construction, multiplex PCR (polymerase chain reaction), hybrid capture and the like on the sample mixed with the molecular tag, finally, rapidly and simply judging whether the sample is mixed or not and determining a pollution source by specifically amplifying the molecular tag contained in the library and detecting the length distribution of the amplified product by using a fragment analysis instrument.
Description
Technical Field
The invention relates to the field of bioinformatics and biotechnology, in particular to a molecular tag group for high-throughput sequencing pollution detection and application thereof.
Background
Compared with detection means such as first-generation sequencing, PCR and the like, the second-generation sequencing has relatively longer detection period and more complex detection process, and one detection period comprises the steps of sample pretreatment, nucleic acid extraction, library construction, sequencing, data analysis and the like. In the whole detection period, from the sample to the data, the data are subjected to a plurality of detection links and a plurality of detection personnel, and once the conditions of sample confusion, sample mutual pollution and the like occur, an error data analysis result is generated. Therefore, sample tracing and contamination identification are the prerequisite and guarantee for generating correct second-generation sequencing results.
A commonly used sample tracing method in the next generation sequencing is to add different labels to different samples so as to identify and split the samples in data. Specifically, in the process of library construction, universal linkers of a sequencing platform are added at two ends of the library in the second-generation sequencing, so that the library can be sequenced on the sequencing platform. The universal joint comprises a label sequence used for identifying and distinguishing samples in sequencing machine-off data, different label sequences can be added to different libraries in the same sequencing reaction, so that data analysts can separate the data of different sample libraries in the machine-off data and independently perform subsequent analysis. If the tag sequences in different libraries are cross-contaminated during the experiment, the data in one sample is mistakenly mixed with the data in another sample when the data are split. If such cross-contamination cannot be identified, erroneous analysis results may also be obtained.
There is also a method for tracing to the source of the sample in the next generation sequencing, that is, selecting some SNP sites, detecting these SNP sites in the sample DNA by a simpler and faster method, and comparing with the SNP typing in the final data, so as to determine whether the sample belongs to the same source. The method needs to add an additional SNP detection on the basis of the conventional detection process, and correspondingly increases the consumption of manpower, material resources and time cost.
Some laboratories avoid sample confusion by methods of noting at multiple positions of a sample collection tube, establishing a sample information tracking list, setting repeated experimental evaluation and markers under different processing conditions, and the like, and the operations are not only complicated but also not suitable for clinical detection.
Disclosure of Invention
In view of the above-mentioned shortcomings of the prior art, the present invention is directed to a molecular tag set for high-throughput sequencing contamination detection and its application.
The invention provides a molecular label group for high-throughput sequencing pollution detection, which comprises a plurality of different molecular labels; different molecular tags are different in length; the molecular tag is a nucleic acid fragment.
In a second aspect, the present invention provides a method for detecting contamination by high throughput sequencing, the method at least comprising the following steps: and introducing one or more molecular tags selected from the group of the molecular tags into each sample, wherein each sample includes at least one unique molecular tag which is different from the molecular tags introduced by other samples.
In a third aspect, the present invention provides a method for differentiating samples contaminated by high throughput sequencing, the method at least comprising the following steps: and introducing one or more molecular tags selected from the group of the molecular tags into each sample, wherein each sample includes at least one unique molecular tag which is different from the molecular tags introduced by other samples.
In a third aspect, the present invention provides a molecular tag set for detecting high-throughput sequencing contamination, or the use of the aforementioned method for detecting high-throughput sequencing contamination or the aforementioned method for distinguishing samples for high-throughput sequencing in gene sequencing.
As described above, the molecular tag set for high-throughput sequencing contamination detection and the application thereof of the present invention have the following beneficial effects:
when the molecular label group is used for sample detection, a proper amount of copied molecular labels are mixed into a sample before sample pretreatment, wherein the sample types include but are not limited to blood, saliva, plasma, DNA and the like. Carrying out links such as nucleic acid extraction, library construction, multiplex PCR, hybridization capture and the like on the sample mixed with the molecular tag, finally, rapidly and simply judging whether the sample is mixed or not and determining a pollution source by specifically amplifying the molecular tag contained in the library and detecting the length distribution of an amplification product by using a fragment analysis instrument; the method may also be used for differentiation of samples.
Drawings
FIG. 1: and analyzing the amplified product fragment of the sample A.
FIG. 2: and analyzing the fragment of the amplification product of the sample B.
FIG. 3: and analyzing the amplified product fragment of the sample D.
Detailed Description
The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.
Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.
When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples herein can be used in the practice of the invention, as would be known to one skilled in the art and the description of the invention.
Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.
The molecular label group for high-throughput sequencing pollution detection comprises a plurality of different molecular labels; different molecular tags are different in length; the molecular tag is a nucleic acid fragment.
The molecular label group comprises more than two molecular labels with different lengths. The number of molecular tags in the molecular tag group can be flexibly applied. For example, the number of the cells may be 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 10 or more, 15 or more, 17 or more, or the like. And the existence of mutual pollution of several samples can be detected simultaneously by using several molecular labels.
The upper limit of the molecular tag may not be limited. If the number is small, the available combinations are small; if the quantity is large, the workload of the previous molecular label preparation is large.
Furthermore, in the molecular tag group corresponding to one sample, the length of at least one molecular tag is different from the length of the molecular tags of other samples to be detected.
Further, the sequence of the molecular tag has low homology with the sample. Preferably, the homology is less than 90%.
The homology is obtained by a sequence alignment method. Specifically, the molecular tag sequence is compared with the genome of the detected sample species by using a nucleic acid alignment (Nucleotide BLAST) function of an NCBI database, and Per.Ident in the comparison result represents the homologous ratio of the molecular tag sequence to a certain region of the genome sequence of the sample species.
Optionally, the molecular tag is not homologous to the sample; preventing interference with the sample results.
Further, the molecular tag comprises identical segments and length-specific segments, wherein the identical segments have the same length and the same base sequence.
A length-specific segment is one in which the sequence of segments differs in length.
The molecular tags may be derived from different sources of molecular tags. The molecular label can be prepared by means of gene synthesis, molecular cloning or PCR amplification and the like.
In one embodiment, each molecular tag in the set of molecular tags may be derived from the same source fragment of molecular tag. Amplification is conveniently carried out.
The molecular tag source fragment may be from a viral genomic sequence.
In one embodiment, the molecular signature source fragment is derived from the genomic sequence of virus phix 174. Preferably, the sequence of the molecular tag source fragment is as shown in SEQ ID NO: 18, respectively.
In one embodiment, the molecular tag sequence is selected from the group consisting of SEQ ID NOs: 1-17.
Further, the molecular tag is 100bp-20kb in length.
In one embodiment, when the sequencing sample is fragmented DNA, the molecular tag is a short fragment molecular tag, and the length of the short fragment molecular tag is 100-300 bp; when the sequencing sample is gDNA, the molecular tag is a long fragment molecular tag, and the length of the long fragment molecular tag is 1 kb-20 kb.
The long fragment molecular tag can be obtained by inserting the short fragment molecular tag into a vector. The vector may be a plasmid vector. Conventional molecular cloning vectors such as pESI-T vector, BlueScript vector, pBluescript vector, pGEM vector, pUC19 vector, etc.
The advantage of the labeling of long fragment molecules is that the molecular label is not easily lost during the extraction of genomic DNA. A general genome DNA extraction kit adopts a magnetic bead method or a column centrifugation method, and adsorbs genome DNA through carriers such as magnetic beads or silica gel membranes, wherein the adsorption is usually selective and tends to adsorb DNA fragments of more than 1kb, and most of small fragments of less than 1kb are lost. If short-fragment molecular tags are used, the recovery rate of the molecular tags in the extracted DNA is very low, and the corresponding molecular tags in the library constructed by the DNA may be difficult to amplify and enrich. Plasma free DNA has a short fragment (about 160 bp), and a nucleic acid adsorption carrier in a kit for extracting free DNA tends to adsorb small fragment nucleic acid, so that a plasma sample can be labeled with a short fragment molecule.
The method for detecting high-throughput sequencing contamination at least comprises the following steps: and introducing one or more molecular tags selected from the group of the molecular tags into each sample, wherein each sample includes at least one unique molecular tag which is different from the molecular tags introduced by other samples.
In one embodiment, the method comprises at least the steps of:
(1) introducing a molecular tag selected from the group of molecular tags previously described in each sample;
(2) obtaining nucleic acid fragments in each sample, connecting the nucleic acid fragments with a joint, and constructing a gene library;
(3) amplifying the product obtained in the step (2) by using a universal primer of a molecular label;
(4) analyzing the fragment length of the amplification product obtained in the step (3), and if the length peak of the specific molecular label of the n samples appears in the sample m, the m samples are polluted by the n samples; if no length peaks of other sample-specific molecular signatures appear in the m-sample, the m-sample is not contaminated.
The universal primer of the molecular label is a primer complementary with the same segment of the molecular label, and all the molecular labels can be amplified and enriched to obtain the molecular label.
In one embodiment, the method further comprises the steps of:
(21) hybridizing the gene library obtained in the step (2) with a hybridization probe for capturing to obtain a capture library; the hybridization probes include molecular tag-specific probes and sample probes.
The molecular tag specific probe is used for specifically capturing all molecular tags in a sample.
Further, the molecular tag specific probe is a part of the same segment of all molecular tags in a sample. All molecular tags in one sample can be captured simultaneously.
The sample probe sequence is selected according to the difference of samples and the difference of experimental purposes. The hybrid capture method is to capture a target region in a sample genomic library, and the sample probe refers to a probe for capturing the target region in the sample. The target region is determined according to the purpose of the whole experiment, for example, to detect a genetic disease, the sample probe covers the genetic disease-related gene region.
The invention also provides a high-throughput sequencing sample distinguishing method, which at least comprises the following steps: and introducing one or more molecular tags selected from the group of the molecular tags into each sample, wherein each sample includes at least one unique molecular tag which is different from the molecular tags introduced by other samples.
The method comprises at least the following steps:
(1) introducing into each sample a molecular tag selected from the group of molecular tags of any one of claims 1-7;
(2) obtaining nucleic acid fragments in each sample, connecting the nucleic acid fragments with a joint, and constructing a gene library;
(3) amplifying the product obtained in the step (2) by using a universal primer of a molecular label;
(4) analyzing the fragment length of the amplification product obtained in the step (3), and distinguishing the sample according to the specific molecular label in the sample.
Since the sets of molecular tags added to the respective samples are known, different and specifically corresponding, for example, sample M corresponds to molecular tag set M, sample N corresponds to molecular tag set N, and sample P corresponds to molecular tag set P. When the fragment length of the amplification product obtained in the step (3) is analyzed, if only the length peak of the molecular label group M appears in a sample, the sample is known as a sample M; if only the length peak of the molecular label group N appears in one sample, the sample is known as a sample N; if only the length peak of the molecular signature group P appears in a sample, the sample is known as the sample P.
In one embodiment, the method further comprises the steps of:
(21) hybridizing the gene library obtained in the step (2) with a hybridization probe for capturing to obtain a capture library; the hybridization probes include molecular tag-specific probes and sample probes.
The molecular tag specific probe is used for specifically capturing all molecular tags in a sample.
Further, the molecular tag specific probe is a part of the same segment of all molecular tags in a sample. All molecular tags in one sample can be captured simultaneously.
The sample probe sequence is selected according to the difference of samples and the difference of experimental purposes. The hybrid capture method is to capture a target region in a sample genomic library, and the sample probe refers to a probe for capturing the target region in the sample. The target region is determined according to the purpose of the whole experiment, for example, to detect a genetic disease, the sample probe covers the genetic disease-related gene region.
The molecular tag set for detecting high-throughput sequencing contamination, or the method for detecting high-throughput sequencing contamination or the method for distinguishing samples by high-throughput sequencing can be used for gene sequencing.
Example 1 molecular tag preparation
The invention selects the genome sequence of virus phix174 as a molecular tag source, and the genome sequence of phix174 SEQ ID NO: 18 as a molecular label source, and amplifying to obtain a short fragment molecular label which can be used for fragmented DNA sample quality control. And connecting the short fragment molecular tag to a plasmid vector to obtain a long fragment molecular tag which can be used for quality control of a genome DNA sample.
Specifically, SEQ ID NO: 18:
TCCATGCGGTGCACTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGC。
meanwhile, an amplification primer is designed aiming at the molecular tag source fragment, the sequence of an amplification primer length-primer-F is GAGTTTATCGCTXXXXXXXXXXXXXXXXXXXXXX, wherein XXXXXXXXXXXXXXXXXXXXXX is a molecular tag length specificity sequence, the sequence can be amplified into sequences with different lengths by combining with different positions on the phix174 genome, and the sequence of an amplification primer length-primer-R is AAGCGGCTCACCTTTAGCATCAACAG
(SEQ ID NO: 19). Specific primers for the amplified molecular tag are as follows: (only 17 molecular tags of amplification primers are listed here, and there may be more than 17 in practical application)
The phix174 genomic DNA (NEB, CAT # N3021) was amplified using the above primers in the following manner:
| reagent | Volume (μ L) |
| 2×Taq Master Mix(Vazyme) | 25 |
| Primer and method for producing the same | 1 |
| phix174gDNA | 1 |
| Nuclease free water | 23 |
| Total volume | 50 |
The amplification procedure was as follows:
the sequence of the obtained amplification product, i.e. the short fragment molecular tag, is shown in the following table 1:
TABLE 1
Using the zero background TOPO-TA cloning kit (assist in san Francisco, 10908ES20), the amplified product was ligated into the vector pESI-T (which was contained in the above-described cloning kit) according to the procedures described in the product instructions, to obtain a long fragment molecular tag of approximately 2kb in length.
Example 2 mixing short fragment molecular tags into Whole blood samples
The short-fragment molecular tags of the molecular tag group shown in Table 1 were mixed in the whole blood samples A and B, respectively, wherein several short-fragment molecular tags of length-2, length-3, length-5 and length-6 were mixed in 10ml of the whole blood sample A, and each short-fragment molecular tag was mixed in 108Each copy, 10ml of whole blood sample B was mixed with several short-fragment molecular tags, length-1, length-2, length-4 and length-6, each of which was mixed with 108And (4) copying. And (3) performing gradient centrifugation on the two whole blood samples respectively, separating 4-5mL of blood plasma, and extracting cfDNA in the blood plasma. Gene library construction and hybrid capture were performed on cfDNA in two whole blood samples, respectively. The process is as follows:
2.1 end repair and addition of A
2.1.1 the reaction system is as follows:
| name of reagent | Volume (μ L) |
| |
20 |
| Nuclease-free water | 12 |
| End repair&A buffer | 15 |
| End repair&A Enzyme | 3 |
| Total volume | 50 |
2.1.2 the reaction was placed on a PCR instrument and the following procedure was run:
2.2 connecting joint
2.2.1 the linking system is as follows:
| name of reagent | Volume (μ L) |
| |
20 |
| Ligase Enzyme | 5 |
| Nuclease-free water | 13 |
| Joint | 2 |
| End-repair plus A product | 50 |
| Total volume | 90 |
2.2.2 ligation linker reaction procedure was as follows:
| reaction temperature | Reaction time |
| 4℃ | Hold |
| 22℃ | 60min |
| 4℃ | Hold |
2.3 fragment screening
Adding 100 mu L of magnetic beads into the product obtained in the step 2.2.2, and uniformly mixing; standing at room temperature for 5min, placing on a magnetic frame, and sucking off all supernatant when the solution is clear. The beads were washed twice with 75% ethanol. Then suspending the magnetic beads with 100. mu.L of nucleic-free water, standing at room temperature for 2min, adding 100. mu.L of PEG/NaCl solution to the supernatant, mixing, and standing at room temperature for 5 min. Placing on the magnetic frame again, and sucking and discarding all supernatant after the solution is clarified. The beads were washed twice with 75% ethanol. Adding 23 μ L of nucleic-free water, beating and mixing, standing for 2min at room temperature to obtain fragment screening product.
2.4 amplification to construct Gene libraries
2.4.1 amplification procedure as follows:
2.4.2 amplification System:
| name of reagent | Volume (μ L) |
| 2X KAPA HiFi Hot Start PCR Ready mix | 25 |
| Joint primer | 2 |
| Fragment screening products | 23 |
| Total volume | 50 |
And placing the amplification system on PCR, and running a program to respectively obtain the gene libraries of the samples A and B.
2.5 Gene library purification
Respectively adding 50 mu L of magnetic beads into the gene libraries of the samples A and B, and uniformly mixing; standing at room temperature for 5min, placing on a magnetic frame, and sucking off all supernatant when the solution is clear. The beads were washed twice with 75% ethanol. The beads were then suspended with 30. mu.L of uclease-free water and after standing at room temperature for 2min, the supernatant was pipetted into a new 1.5mL centrifuge tube.
2.6 hybridization
2.6.1 mixing the molecular label specific probe with the originally hybridized and captured probe (the probe for capturing the sample A and the sample B respectively) to obtain a capture probe group; 2fmol was added per hybridization reaction for each probe, and the molecular tag specific probe sequence was: GTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGC AAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGT (SEQ ID NO: 37).
2.6.2 two gene libraries from samples A and B were added to 4. mu.L of the capture probe set in 2.61, 8. mu.L of Universal Blockers and 5. mu.L of Blocker solution, mixed and concentrated to complete dryness, dissolved with 20. mu.L of Fast Hybridization mix, and added to 30. mu.L of Hybridization Enhancer. The following procedure was run on a PCR instrument with a hybridization time of 16 h.
| Temperature of | Time of day |
| 95℃ | ∞ |
| 95℃ | 5min |
| 60℃ | ∞ |
2.7 Capture
2.7.1 mu.L of streptavidin magnetic beads were washed 3 times with 200. mu.L of Fast binding buffer, and 200. mu.L of Fast binding buffer was added to suspend the magnetic beads.
2.7.2 after the hybridization, quickly transferring the hybridization system into a streptavidin magnetic bead tube, uniformly mixing, incubating at room temperature for 30min, centrifuging, standing on a magnetic frame for 1min, and absorbing and removing the supernatant after the solution is clarified.
2.7.3 washing twice with 200 μ L Fast Wash Buffer 1 preheated to 70 deg.C, suspending the magnetic beads with 200 μ L Wash Buffer 2 preheated to 48 deg.C, incubating at 48 deg.C for 5min, standing on magnetic frame for 1min, and removing the supernatant after the solution is clarified.
2.7.4 the above step was repeated twice, then the residual supernatant was completely removed, 22.5. mu.L of nucleic-free water was added, mixed well, and transferred to a 0.2mL PCR tube to obtain a captured product.
2.8 amplification to obtain capture libraries of sample A and sample B
The amplification procedure was as follows:
the amplification system was as follows:
| name of reagent | Volume (μ L) |
| KAPA HiFi HotStart ReadyMix | 25 |
| Joint primer | 2.5 |
| Trapping the product | 22.5 |
| Total volume | 50 |
2.9 library purification
Adding 90 mu L of magnetic beads into the capture library obtained in the step 2.8, and uniformly mixing; standing at room temperature for 5min, placing on a magnetic frame, and sucking off all supernatant when the solution is clear. The beads were washed twice with 75% ethanol. Then, the magnetic beads were suspended in 30. mu.L of nucleic-free water, and after standing at room temperature for 2min, the supernatant was aspirated into a new 1.5mL centrifuge tube to obtain a purified capture library.
2.10 molecular tag Universal primer amplification Capture library
2.10.1 amplification of purified capture libraries from samples A and B with molecular tagged Universal primers, respectively, the F sequence of the Universal primer is ACACGACGCTCTTCCGATCTGAGTTTTATCGCT (SEQ ID NO: 38) and the R sequence is CCTTGGCACCCGAGAATTCCAAAGCGGCTCACCTTTA (SEQ ID NO: 39).
2.10.2 the amplification system is:
2.10.3 the amplification procedure was:
2.11 fragment analysis of the amplification product with the fragment analyzer Qsep100
The amplified products of the library of the sample A and the sample B obtained in the step 2.10 are subjected to fragment analysis by using a fragment analyzer Qsep100, and the result of the fragment analysis is shown in FIG. 1 and FIG. 2. Wherein, the short fragment molecular labels mixed in the sample A are respectively length-2, length-3, length-5 and length-6, theoretically, the product lengths obtained after the universal primer amplification are 188bp, 192bp, 200bp and 204bp, and the actual amplification product qsep detection lengths are 188bp, 192bp, 199bph and 203 bp. The molecular labels mixed in the sample B are respectively length-1, length-2, length-4 and length-6, theoretically, the lengths of products obtained after the amplification of the universal primers should be 184bp, 188bp, 196bp and 204bp, and the detection lengths of actual amplification products qsep are 185bp, 188bp, 196bp and 204 bp. The molecular tag lengths added initially for two samples are in one-to-one correspondence with the fragment distribution of the resulting library amplification products, and no peaks corresponding to short fragment molecular tag lengths appear for the other samples. It can be judged that the two samples are not confused or cross-contaminated.
Example 3 incorporation of Long fragment molecular tags into Whole blood samples
The whole blood samples C and D were mixed with long-fragment molecular tags prepared according to the short-fragment molecular tags of Table 1, wherein the molecular tags mixed in 2mL of the whole blood sample C included long-fragment molecular tags corresponding to several short-fragment molecular tags of length-7, length-9 and length-13, and each of the long-fragment molecular tags was mixed in 108Each copy was mixed with a long-fragment molecular tag corresponding to several short-fragment molecular tags including length-9, length-13 and length-17 in a 2mL whole blood sample D, and each long-fragment molecular tag was mixed with 108And (4) copying. From the C sample, 200. mu.L of the sample was mixed into the D sample, and the sample was artificially contaminated. And (5) carrying out genome DNA extraction on the sample D, and constructing a genome library of the sample D. The construction process is as follows:
3.1 fragmentation, end repair and addition of A
100ng of the genomic DNA of the D sample was taken, and nucleic-free water was supplemented to 50. mu.L, 10. mu.L of Smerase Mix was added thereto, mixed well and placed on ice. The PCR instrument was set up with the following program:
| temperature of | Time of day |
| 4℃ | 1min |
| 30℃ | 20min |
| 72℃ | 20min |
| 4℃ | ∞ |
And when the program starts to run at 4 ℃, putting the reaction system into a PCR instrument.
3.2 ligating the linkers to obtain ligated products
3.2.1 the connection system was formulated according to the following table:
| name of reagent | Volume (μ L) |
| 5x Fast- |
20 |
| Fast-Pace T4 DNA Ligase | 5 |
| Joint | 1.5 |
| Nuclease-free water | 13.5 |
| Step 3.1 products | 60 |
| |
100 |
3.2.2 set up and run the following PCR program:
| temperature of | Time of |
| 20℃ | 15min |
| 4℃ | ∞ |
3.3 fragment screening
Adding 100 mu L of magnetic beads into the connection product obtained in the step 3.2, and uniformly mixing; standing at room temperature for 5min, placing on a magnetic frame, and sucking off all supernatant when the solution is clear. The beads were washed twice with 75% ethanol. Suspending the magnetic beads by 100 mu L of nucleic-free water, standing for 2min at room temperature, adding 65 mu L of magnetic bead supernatant, mixing uniformly, and standing for 5min at room temperature; placing on a magnetic frame, sucking 160 μ L of supernatant into a new centrifuge tube after the solution is clarified, adding 20 μ L of magnetic beads into the supernatant, mixing, and standing at room temperature for 5 min; placing on a magnetic frame, and sucking and discarding all supernatant after the solution is clarified. The beads were washed twice with 75% ethanol. Adding 24 μ L of clean-free water, mixing, and standing at room temperature for 2 min.
3.4 amplification to construct genomic library of sample D
The reaction system is as follows:
| solutions of | Volume (μ L) |
| 2X KAPA HiFi Hot Start PCR Ready mix | 25 |
| DNA | 24 |
| Joint primer | 1 |
| Total | 50 |
The amplification procedure was as follows:
3.5 genomic library purification
Adding 50 mu L of magnetic beads into the amplified product, namely the genome library of the sample D, and uniformly mixing; standing at room temperature for 5min, placing on a magnetic frame, and sucking off all supernatant when the solution is clear. The beads were washed twice with 75% ethanol. The beads were then suspended in 30. mu.L of nucleic-free water, allowed to stand at room temperature for 2min, and the supernatant was pipetted into a fresh 1.5mL centrifuge tube.
3.6 Universal primers amplification of genomic libraries from sample D
3.6.1 amplification of the genomic library of sample D with molecular tagged Universal primers, the F sequence of the universal primer is ACACGACGCTCTTCCGATCTGAGTTTTATCGCT (SEQ ID NO: 38) and the R sequence is CCTTGGCACCCGAGAATTCCAAAGCGGCTCACCTTTA (SEQ ID NO: 39).
3.6.2 the amplification system is:
| reagent | Volume/. mu.L |
| 2×Taq Master Mix(Vazyme) | 25 |
| Universal primer | 1 |
| Genomic library of sample D | 1 |
| Nuclease free water | 23 |
| Total volume | 50 |
3.6.3 the amplification procedure was:
3.7 fragment analysis of the amplified product with the fragment analyzer Qsep100
Carrying out fragment analysis on the amplified product of the genome library of the sample D obtained in the step 3.6 by using a fragment analyzer Qsep100, wherein the fragment analysis result is shown in figure 3, the short fragment molecular tags corresponding to the long fragment molecular tags mixed in the sample C are respectively length-7, length-9 and length-13, and the product lengths obtained after the amplification of the universal primers theoretically are 208bp, 216bp and 232 bp; the short fragment molecular tags corresponding to the long fragment molecular tags mixed in the sample D are respectively length-9, length-13 and length-17, and theoretically, the lengths of the products obtained after the universal primer amplification are 216bp, 232bp and 248 bp. And the sample D is polluted by the sample C, and a peak of the molecular label length corresponding to the sample C should be in the molecular label amplification product. The detection length of the actual amplification product qsep of the sample D is 209bp, 215bp, 230bp and 247bp, wherein the peak with the length of 209bp comes from a molecular label in the sample C, so that the sample D can be judged to be polluted by the sample C.
The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the methods and compositions set forth herein, as well as variations of the methods and compositions of the present invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.
Sequence listing
<110> Shanghai Wehn biomedical science and technology, Inc
<120> molecular tag group for high-throughput sequencing pollution detection and application thereof
<160> 39
<170> SIPOSequenceListing 1.0
<210> 1
<211> 143
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gagttttatc gctacaggta gcgttgaccc taattttggt cgtcgggtac gcaatcgccg 60
ccagttaaat agcttgcaaa atacgtggcc ttatggttac agtatgccca tcgcagtctg 120
ttgatgctaa aggtgagccg ctt 143
<210> 2
<211> 147
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gagttttatc gcttcctaca ggtagcgttg accctaattt tggtcgtcgg gtacgcaatc 60
gccgccagtt aaatagcttg caaaatacgt ggccttatgg ttacagtatg cccatcgcag 120
tctgttgatg ctaaaggtga gccgctt 147
<210> 3
<211> 151
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gagttttatc gctcacttcc tacaggtagc gttgacccta attttggtcg tcgggtacgc 60
aatcgccgcc agttaaatag cttgcaaaat acgtggcctt atggttacag tatgcccatc 120
gcagtctgtt gatgctaaag gtgagccgct t 151
<210> 4
<211> 155
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gagttttatc gctcggacac ttcctacagg tagcgttgac cctaattttg gtcgtcgggt 60
acgcaatcgc cgccagttaa atagcttgca aaatacgtgg ccttatggtt acagtatgcc 120
catcgcagtc tgttgatgct aaaggtgagc cgctt 155
<210> 5
<211> 159
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gagttttatc gcttatgcgg acacttccta caggtagcgt tgaccctaat tttggtcgtc 60
gggtacgcaa tcgccgccag ttaaatagct tgcaaaatac gtggccttat ggttacagta 120
tgcccatcgc agtctgttga tgctaaaggt gagccgctt 159
<210> 6
<211> 163
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gagttttatc gctactttat gcggacactt cctacaggta gcgttgaccc taattttggt 60
cgtcgggtac gcaatcgccg ccagttaaat agcttgcaaa atacgtggcc ttatggttac 120
agtatgccca tcgcagtctg ttgatgctaa aggtgagccg ctt 163
<210> 7
<211> 167
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gagttttatc gctgtgcact ttatgcggac acttcctaca ggtagcgttg accctaattt 60
tggtcgtcgg gtacgcaatc gccgccagtt aaatagcttg caaaatacgt ggccttatgg 120
ttacagtatg cccatcgcag tctgttgatg ctaaaggtga gccgctt 167
<210> 8
<211> 171
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gagttttatc gcttgcggtg cactttatgc ggacacttcc tacaggtagc gttgacccta 60
attttggtcg tcgggtacgc aatcgccgcc agttaaatag cttgcaaaat acgtggcctt 120
atggttacag tatgcccatc gcagtctgtt gatgctaaag gtgagccgct t 171
<210> 9
<211> 175
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gagttttatc gcttccatgc ggtgcacttt atgcggacac ttcctacagg tagcgttgac 60
cctaattttg gtcgtcgggt acgcaatcgc cgccagttaa atagcttgca aaatacgtgg 120
ccttatggtt acagtatgcc catcgcagtc tgttgatgct aaaggtgagc cgctt 175
<210> 10
<211> 179
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gagttttatc gctcatttcc atgcggtgca ctttatgcgg acacttccta caggtagcgt 60
tgaccctaat tttggtcgtc gggtacgcaa tcgccgccag ttaaatagct tgcaaaatac 120
gtggccttat ggttacagta tgcccatcgc agtctgttga tgctaaaggt gagccgctt 179
<210> 11
<211> 183
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gagttttatc gcttcttcat ttccatgcgg tgcactttat gcggacactt cctacaggta 60
gcgttgaccc taattttggt cgtcgggtac gcaatcgccg ccagttaaat agcttgcaaa 120
atacgtggcc ttatggttac agtatgccca tcgcagtctg ttgatgctaa aggtgagccg 180
ctt 183
<210> 12
<211> 187
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gagttttatc gctgccgtct tcatttccat gcggtgcact ttatgcggac acttcctaca 60
ggtagcgttg accctaattt tggtcgtcgg gtacgcaatc gccgccagtt aaatagcttg 120
caaaatacgt ggccttatgg ttacagtatg cccatcgcag tctgttgatg ctaaaggtga 180
gccgctt 187
<210> 13
<211> 191
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gagttttatc gctaatggcc gtcttcattt ccatgcggtg cactttatgc ggacacttcc 60
tacaggtagc gttgacccta attttggtcg tcgggtacgc aatcgccgcc agttaaatag 120
cttgcaaaat acgtggcctt atggttacag tatgcccatc gcagtctgtt gatgctaaag 180
gtgagccgct t 191
<210> 14
<211> 195
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gagttttatc gctagctaat ggccgtcttc atttccatgc ggtgcacttt atgcggacac 60
ttcctacagg tagcgttgac cctaattttg gtcgtcgggt acgcaatcgc cgccagttaa 120
atagcttgca aaatacgtgg ccttatggtt acagtatgcc catcgcagtc tgttgatgct 180
aaaggtgagc cgctt 195
<210> 15
<211> 199
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gagttttatc gctgtacagc taatggccgt cttcatttcc atgcggtgca ctttatgcgg 60
acacttccta caggtagcgt tgaccctaat tttggtcgtc gggtacgcaa tcgccgccag 120
ttaaatagct tgcaaaatac gtggccttat ggttacagta tgcccatcgc agtctgttga 180
tgctaaaggt gagccgctt 199
<210> 16
<211> 203
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gagttttatc gcttatggta cagctaatgg ccgtcttcat ttccatgcgg tgcactttat 60
gcggacactt cctacaggta gcgttgaccc taattttggt cgtcgggtac gcaatcgccg 120
ccagttaaat agcttgcaaa atacgtggcc ttatggttac agtatgccca tcgcagtctg 180
ttgatgctaa aggtgagccg ctt 203
<210> 17
<211> 207
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gagttttatc gcttgagtat ggtacagcta atggccgtct tcatttccat gcggtgcact 60
ttatgcggac acttcctaca ggtagcgttg accctaattt tggtcgtcgg gtacgcaatc 120
gccgccagtt aaatagcttg caaaatacgt ggccttatgg ttacagtatg cccatcgcag 180
tctgttgatg ctaaaggtga gccgctt 207
<210> 18
<211> 180
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tccatgcggt gcactttatg cggacacttc ctacaggtag cgttgaccct aattttggtc 60
gtcgggtacg caatcgccgc cagttaaata gcttgcaaaa tacgtggcct tatggttaca 120
gtatgcccat cgcagttcgc tacacgcagg acgctttttc acgttctggt tggttgtggc 180
<210> 19
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
aagcggctca cctttagcat caacag 26
<210> 20
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gagttttatc gctgtagcgt tgaccctaa 29
<210> 21
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
gagttttatc gctacaggta gcgttgacc 29
<210> 22
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gagttttatc gcttcctaca ggtagcgtt 29
<210> 23
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
gagttttatc gctcacttcc tacaggtag 29
<210> 24
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gagttttatc gctcggacac ttcctacag 29
<210> 25
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gagttttatc gcttatgcgg acacttcct 29
<210> 26
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
gagttttatc gctactttat gcggacact 29
<210> 27
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
gagttttatc gctgtgcact ttatgcgga 29
<210> 28
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
gagttttatc gcttgcggtg cactttatg 29
<210> 29
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
gagttttatc gcttccatgc ggtgcactt 29
<210> 30
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
gagttttatc gcttcttcat ttccatgcg 29
<210> 31
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
gagttttatc gctgccgtct tcatttcca 29
<210> 32
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
gagttttatc gctaatggcc gtcttcatt 29
<210> 33
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
gagttttatc gctagctaat ggccgtctt 29
<210> 34
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
gagttttatc gctgtacagc taatggccg 29
<210> 35
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
gagttttatc gcttatggta cagctaatg 29
<210> 36
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gagttttatc gcttgagtat ggtacagct 29
<210> 37
<211> 100
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
gtagcgttga ccctaatttt ggtcgtcggg tacgcaatcg ccgccagtta aatagcttgc 60
aaaatacgtg gccttatggt tacagtatgc ccatcgcagt 100
<210> 38
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
acacgacgct cttccgatct gagttttatc gct 33
<210> 39
<211> 37
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
ccttggcacc cgagaattcc aaagcggctc accttta 37
Claims (13)
1. A molecular tag set for high-throughput sequencing contamination detection,
the molecular label group comprises a plurality of different molecular labels; different molecular tags are different in length; the molecular tag is a nucleic acid fragment.
2. The set of molecular tags for high-throughput sequencing contamination detection of claim 1, further comprising one or more of the following features:
1) the sequence of the molecular tag has low homology with the sample; preferably, the homology is less than 90%;
2) the molecular tags comprise identical segments and length specificity segments, the identical segments have the same length, and the base arrangement sequences are identical;
3) each molecular label in the molecular label group is derived from the same molecular label source fragment.
3. The set of molecular tags for high-throughput sequencing contamination detection of claim 2, further comprising one or more of the following features:
1) the molecular label group comprises more than two molecular labels with different lengths;
2) the molecular tag source fragment is from a viral genomic sequence.
4. The set of molecular tags for high-throughput sequencing contamination detection according to claim 3, wherein the molecular tag source fragment is derived from the genomic sequence of virus phix174, preferably the sequence of the molecular tag source fragment is as shown in SEQ ID NO: 18, respectively.
5. The set of molecular tags for high-throughput sequencing contamination detection according to claim 4, wherein the sequence of the molecular tags in the set of molecular tags is selected from the group consisting of SEQ ID NO: 1-17.
6. The set of molecular tags for high-throughput sequencing contamination detection according to claim 1, wherein the molecular tags have a length of 100bp to 20 kb.
7. The set of molecular tags for high-throughput sequencing contamination detection according to claim 6, wherein when the sequencing sample is fragmented DNA, the molecular tags are short-fragment molecular tags, and the length of the short-fragment molecular tags is 100-300 bp; when the sequencing sample is gDNA, the molecular tag is a long fragment molecular tag, and the length of the long fragment molecular tag is 1 kb-20 kb.
8. A method for detecting high throughput sequencing contamination, said method comprising at least the steps of: introducing one or more molecular tags selected from the group of molecular tags according to any one of claims 1 to 7 into each sample, wherein each sample includes at least one unique molecular tag, which is different from the other sample.
9. The method for detecting high throughput sequencing contamination according to claim 8, wherein said method comprises at least the steps of:
(1) introducing into each sample a molecular tag selected from the group of molecular tags of any one of claims 1-7;
(2) obtaining nucleic acid fragments in each sample, connecting the nucleic acid fragments with a joint, and constructing a gene library;
(3) amplifying the product obtained in the step (2) by using a universal primer of a molecular label;
(4) analyzing the fragment length of the amplification product obtained in the step (3), and if the length peak of the specific molecular label of the n samples appears in the sample m, the m samples are polluted by the n samples; if no length peaks of other sample-specific molecular signatures appear in the m-sample, the m-sample is not contaminated.
10. The method for high throughput sequencing contamination detection according to claim 9, wherein said method further comprises the steps of:
(21) hybridizing the gene library obtained in the step (2) with a hybridization probe for capturing to obtain a capture library; the hybridization probes include molecular tag-specific probes and sample probes.
11. A high throughput sequencing-based sample differentiation method, said method comprising at least the steps of: introducing one or more molecular tags selected from the group of molecular tags according to any one of claims 1 to 7 into each sample, wherein each sample includes at least one unique molecular tag, which is different from the other sample.
12. The method for high throughput sequencing of sample differentiation according to claim 11, wherein said method comprises at least the following steps:
(1) introducing into each sample a molecular tag selected from the group of molecular tags of any one of claims 1-7;
(2) obtaining nucleic acid fragments in each sample, connecting the nucleic acid fragments with a joint, and constructing a gene library;
(3) amplifying the product obtained in the step (2) by using a universal primer of a molecular label;
(4) analyzing the fragment length of the amplification product obtained in the step (3), and distinguishing the sample according to the specific molecular label in the sample.
13. Use of the set of molecular tags for high-throughput sequencing contamination detection according to any one of claims 1-7, or the method for high-throughput sequencing contamination detection according to any one of claims 8-10, or the method for sample discrimination by high-throughput sequencing according to any one of claims 11-12 for genetic sequencing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010751025.0A CN111944806A (en) | 2020-07-30 | 2020-07-30 | Molecular tag group for high-throughput sequencing pollution detection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010751025.0A CN111944806A (en) | 2020-07-30 | 2020-07-30 | Molecular tag group for high-throughput sequencing pollution detection and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111944806A true CN111944806A (en) | 2020-11-17 |
Family
ID=73338635
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010751025.0A Pending CN111944806A (en) | 2020-07-30 | 2020-07-30 | Molecular tag group for high-throughput sequencing pollution detection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111944806A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115798590A (en) * | 2022-12-26 | 2023-03-14 | 上海亿康医学检验所有限公司 | Sample tracing method, sample storage vessel, equipment and readable storage medium |
| CN117649875A (en) * | 2023-12-15 | 2024-03-05 | 石家庄博瑞迪生物技术有限公司 | Molecular detection sample quality control method and system based on probe capture technology |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106257989A (en) * | 2014-02-10 | 2016-12-28 | 贝拉医疗新加坡私人贸易有限公司 | The comparison of NGS system and the method relating to the comparison of described NGS system |
| CN109628568A (en) * | 2019-01-10 | 2019-04-16 | 上海境象生物科技有限公司 | A kind of internal standard and its application polluted for differentiating and calibrating high-flux sequence |
| CN110656157A (en) * | 2019-10-16 | 2020-01-07 | 重庆市人口和计划生育科学技术研究院 | Quality control product for tracing high-throughput sequencing sample and design and use method thereof |
| CN110970091A (en) * | 2019-12-20 | 2020-04-07 | 北京优迅医学检验实验室有限公司 | Label quality control method and device |
| WO2020106893A1 (en) * | 2018-11-21 | 2020-05-28 | Karius, Inc. | Direct-to-library methods, systems, and compositions |
| CN111304309A (en) * | 2020-03-06 | 2020-06-19 | 上海韦翰斯生物医药科技有限公司 | Detection method for sequencing platform tag sequence pollution |
| WO2020132628A1 (en) * | 2018-12-20 | 2020-06-25 | Guardant Health, Inc. | Methods, compositions, and systems for improving recovery of nucleic acid molecules |
-
2020
- 2020-07-30 CN CN202010751025.0A patent/CN111944806A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106257989A (en) * | 2014-02-10 | 2016-12-28 | 贝拉医疗新加坡私人贸易有限公司 | The comparison of NGS system and the method relating to the comparison of described NGS system |
| WO2020106893A1 (en) * | 2018-11-21 | 2020-05-28 | Karius, Inc. | Direct-to-library methods, systems, and compositions |
| WO2020132628A1 (en) * | 2018-12-20 | 2020-06-25 | Guardant Health, Inc. | Methods, compositions, and systems for improving recovery of nucleic acid molecules |
| CN109628568A (en) * | 2019-01-10 | 2019-04-16 | 上海境象生物科技有限公司 | A kind of internal standard and its application polluted for differentiating and calibrating high-flux sequence |
| CN110656157A (en) * | 2019-10-16 | 2020-01-07 | 重庆市人口和计划生育科学技术研究院 | Quality control product for tracing high-throughput sequencing sample and design and use method thereof |
| CN110970091A (en) * | 2019-12-20 | 2020-04-07 | 北京优迅医学检验实验室有限公司 | Label quality control method and device |
| CN111304309A (en) * | 2020-03-06 | 2020-06-19 | 上海韦翰斯生物医药科技有限公司 | Detection method for sequencing platform tag sequence pollution |
Non-Patent Citations (2)
| Title |
|---|
| RICHARD A. MOORE等: "Sample Tracking Using Unique Sequence Controls", 《THE JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
| 佚名: "全自动核酸蛋白分析系统Qsep100", 《百度文库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115798590A (en) * | 2022-12-26 | 2023-03-14 | 上海亿康医学检验所有限公司 | Sample tracing method, sample storage vessel, equipment and readable storage medium |
| CN117649875A (en) * | 2023-12-15 | 2024-03-05 | 石家庄博瑞迪生物技术有限公司 | Molecular detection sample quality control method and system based on probe capture technology |
| CN117649875B (en) * | 2023-12-15 | 2024-05-31 | 石家庄博瑞迪生物技术有限公司 | Molecular detection sample quality control method and system based on probe capture technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107177670B (en) | Method for detecting Parkinson disease pathogenic gene mutation in high throughput manner | |
| US9567633B2 (en) | Method for detecting hydroxylmethylation modification in nucleic acid and use thereof | |
| CN106554955B (en) | Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof | |
| CN109576347B (en) | Sequencing joint containing single-molecule label and construction method of sequencing library | |
| CN105368930B (en) | The determination method that enzymes combinations are sequenced in genotyping technique is sequenced | |
| CN109486923B (en) | Primer system for sequencing multiple amplicons, application thereof and method for constructing sequencing library | |
| US10435736B2 (en) | Target region enrichment method based on multiplex PCR, and reagent | |
| CN110853708B (en) | Design method of nucleic acid capture probe for HLA typing | |
| CN111440896A (en) | Novel β coronavirus variation detection method, probe and kit | |
| WO2012000150A1 (en) | Pcr primers for determining hla-a,b genotypes and methods for using the same | |
| CN111944806A (en) | Molecular tag group for high-throughput sequencing pollution detection and application thereof | |
| CN104894233A (en) | Multi-sample and multi-segment DNA methylation high-throughput sequencing method | |
| CN109295500B (en) | Single cell methylation sequencing technology and application thereof | |
| CN111154846A (en) | Detection method of methylated nucleic acid | |
| CN114015749A (en) | Construction method of mitochondrial genome sequencing library based on high-throughput sequencing and amplification primer | |
| CN113462749A (en) | High-sensitivity amplicon library construction kit, library construction method and application | |
| CN111304309A (en) | Detection method for sequencing platform tag sequence pollution | |
| CN108130359A (en) | A kind of DNA methylation detection kit and its application | |
| CN116463408A (en) | ABO gene amplification primer, amplification system, amplification method, sequencing library construction method and sequencing method | |
| CN109486922B (en) | Method for detecting microbial target sequence based on single primer probe capture | |
| CN112080555A (en) | DNA methylation detection kit and detection method | |
| CN109797437A (en) | A kind of construction method of sequencing library when detecting multiple samples and its application | |
| CN105603052B (en) | Probe and use thereof | |
| CN110600082B (en) | Nucleic acid capture probe for HLA typing and design method thereof | |
| CN117568499A (en) | Kit for quantitatively detecting multiple pathogen genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201117 |