CN106554955B

CN106554955B - Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof

Info

Publication number: CN106554955B
Application number: CN201610932549.3A
Authority: CN
Inventors: 刘琦; 赵金银; 邢晓星; 杨兰; 许立志; 于闯; 李�杰
Original assignee: Dalian Gentalker Biotechnology Co ltd
Current assignee: Dalian Gentalker Biotechnology Co ltd
Priority date: 2016-10-25
Filing date: 2016-10-25
Publication date: 2020-07-14
Anticipated expiration: 2036-10-25
Also published as: CN106554955A

Abstract

The invention provides a method and a kit for constructing a sequencing library of PKHD1 gene mutation by using a high-throughput sequencing technology, and application thereof. The method for constructing the sequencing library of the PKHD1 gene mutation comprises the following steps: a first round of amplification; digesting the primer; performing second round amplification; purifying and recovering all DNA bands; sequencing; and (6) analyzing.

Description

Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a method and a kit for constructing a PKHD1 gene mutation sequencing library by a high-throughput sequencing technology and application thereof.

Background

Polycystic Kidney Disease (PKD) refers to a disease in which multiple cysts occur in the kidney and lead to structural and functional impairment of the kidney, such cysts affecting other organs. Depending on the genetic pattern, PKD is further classified into Autosomal Dominant Polycystic Kidney Disease (ADPKD) and Autosomal Recessive Polycystic Kidney Disease (ARPKD). PKD patient cysts tend to show persistent and increasing formation and enlargement.

ARPKD is a recessive genetic disease with an incidence of 1/20000 in live infants. ARPKD has a major impact on fetuses, newborns and children. ARPKD can cause severe polycystic kidney phenotypes in the fetus, such as biliary defects, oligohydramnios, and the like. About half of neonates with ARPKD die after birth due to hypoplasia of the lungs caused by hypoamniotic fluid. Systemic hypertension, renal insufficiency, portal hypertension are also a major cause of high morbidity and mortality in surviving infants. Research proves that ARPKD is caused by PKHD1 gene variation, and the invention mainly aims at autosomal recessive inheritance polycystic kidney disease (PKHD1 gene variation).

PKHD1 is the only causative gene of human autosomal recessive polycystic kidney disease known at present. ARPKD is a monogenic genetic disease with polycystic kidney phenotype that is common in children. The clinical characterization of ARPKD varies greatly both within and outside the family. About 50% of patients have developed morbidity during fetal life and about 30% die at birth with respiratory and renal dysfunction. It is believed that the diversity of PKHD1 mutations may be responsible for the diversity of clinical manifestations of ARPKD. At least 300 PKHD1 mutations have been reported. These included 184 missense mutations, 37 nonsense mutations, 62 insertion or deletion (frameshift) mutations and 21 classical splice site mutations. These mutations are distributed almost throughout the PKHD1 gene, and preliminary analysis between PKHD1 mutation sites and clinical symptoms indicates that most children with missense mutations encoding truncated mutations die during perinatal and neonatal periods, while children who survive past neonatal periods carry at least one missense mutation. Since the gene of PKHD1 is a very large gene, 67 exons are contained, 66 exons are contained in the protein coding region, and 4074 amino acids are totally coded. Therefore, the detection of the PKHD1 gene is a time-consuming, labor-intensive and technically demanding task.

At present, various methods are developed for molecular diagnosis of the ARPKD diseases, but each method has certain defects.

The DNA family gene linkage analysis method comprises the following steps: is a method based on family research. It is to use genetic marker to classify in the family, and then use mathematical means to calculate whether the genetic marker is co-separated with the disease in the family. Linkage analysis is to study the relationship between pathogenic genes and reference sites (genetic markers) by using the principle of linkage. By covering a suitable density of genetic markers (markers), one can find a marker that is tightly linked to the disease-causing gene, and thus obtain the exact location of the disease-causing gene on the chromosome. The disadvantage of this approach is that a sufficient number of family members are required to participate in the identification together, and the linkage analysis approach will not be applicable when the proband is a new mutation.

The basic principle of the method is that firstly, PCR of a target region is amplified, then a PCR product is heated and denatured into a single-chain state, and then the change of a base peak value in the PCR product is detected by a high-pressure liquid chromatography technology so as to judge whether mutation occurs.

Other variant screening methods: denaturing Gradient Gel Electrophoresis (DGGE), single-strand conformation polymorphism analysis (SSCP) and high-resolution melting curve method (HRM) can be applied to the detection of PKHD1 gene, but the methods have the defects that the mutation sites cannot be directly determined, and only the mutation is screened.

Although the traditional one-generation sequencing (Sanger sequencing) is still the gold standard for diagnosing human genetic disease variation, the technology cannot meet the requirements of sequencing on huge genes and large samples due to the defects of low sequencing efficiency, high cost, small flux and the like of the technology due to the limitation of the technology, and the method is still ineffective if sequencing on all exons in the whole genome range is required to discover new variant genes or sites. In addition, sanger sequencing requires very complicated preliminary preparation work, the whole experimental process comprises multiple steps of amplification, purification, sequencing PCR, repurification and the like, time and labor are consumed, the cost is high, and cross contamination and PCR amplification failure are possible. With the development of the classified genome sequencing technology and the construction of the international human genome haplotype map (HapMap), the high-throughput sequencing technology (NGS) based on the exon sequencing technology has been unprecedentedly developed. The method not only can accurately identify common variation or rare variation with high flux, but also greatly reduces the sequencing cost. NGS has triggered a new round of exploring the hot tide of complex genetic diseases, and a large number of new genetic variations associated with human traits or complex diseases have been discovered and invented in as short as a few years, providing important basis for further understanding the molecular mechanisms of human genetic disease occurrence.

The NGS technology greatly reduces the sequencing cost, has the characteristics of high throughput, low cost, low sequencing error rate and the like, and is rapidly developed in recent years. By applying the NGS technique, it is possible to sequence a mixture of nucleic acid molecules, and simultaneously distinguish and detect each individual sequence, enabling simultaneous sequencing of large batches of target sequences.

Sequence capture is a technique for selective enrichment of specific regions of the genome by calling the target region out of the genome by a suitable method for sequencing. There are two main methods of sequence capture currently in use: PCR and hybridization. The PCR method has the advantages of high sensitivity, high specificity, good repeatability and the like, has good application prospect in a second-generation sequencing technology platform, and is suitable for capturing some smaller regions, particularly some continuous regions. The application of the NGS technology can obviously improve the detection efficiency, sensitivity and specificity of the PKHD1 gene mutation.

Disclosure of Invention

The present inventors have made extensive and intensive studies with respect to the deficiencies of the prior art, and as a result, have completed the present invention.

An object of the present invention is to provide a method for constructing a sequencing library of mutations in the PKHD1 gene.

It is another object of the present invention to provide a kit for constructing a sequencing library of mutations in the PKHD1 gene.

In order to achieve the purpose, the invention introduces one section of oligonucleotide sequence at each end of the product by utilizing PCR reaction, the two sections of oligonucleotide sequences are respectively the same as a D5adaptor primer (D5adaptor) sequence and an N7adaptor primer (N7adaptor) sequence of the company illumina, and the PCR product can be directly used as a sequencing library to be applied to sequencers of Nextseq500/550, Hiseq 2000/2500/3000, Miseq and the like of the company illumina through the oligonucleotide sequences introduced at the two ends of the PCR product.

According to the invention, oligonucleotide sequences are introduced into two ends of a product, and simultaneously, the amplification strategy of multiplex PCR is combined, so that the amplification of one or more specific exons of the PKHD1 gene of each sample can be simultaneously realized, and a sequencing library of one or more specific exons of the PKHD1 gene of the sample can be directly obtained.

The invention introduces distinguishable D5adaptor primer sequence and N7adaptor primer sequence at two ends of the PCR product of the sample respectively, wherein the label (index) information contained in the D5adaptor primer and the N7adaptor primer can be used as label sequences for subsequently distinguishing different samples.

In the present invention, the D5 linker primer sequence consists of a 5 'universal sequencing primer sequence, a tag sequence (i.e., i5, see bold below), and a 3' universal sequencing primer sequence in tandem, and the N7 linker primer sequence consists of a 5 'universal sequencing primer sequence, a tag sequence (i.e., i7, see bold below), and a 3' universal sequencing primer sequence in tandem.

In the invention, two oligonucleotide sequences are respectively introduced into two ends of a product by utilizing a PCR reaction, wherein the two oligonucleotide sequences are respectively identical to a D5adaptor primer sequence and an N7adaptor primer sequence, and the D5adaptor primer sequence is selected from:

D501

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:1)、

D502

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:2)、

D503

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:3)、

D504

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:4)、

D505

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:5)、

D506

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:6)、

D507

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT) (SEQ ID NO:7) and

D508

(AATGATACGGCGACCACCGAGATCTACAC

ACACTCTTTCCCTACACGACGCTCTTCCGATCT) (SEQ ID NO:8), and

the N7adaptor primer sequence is selected from:

N701

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTC CGATCT)(SEQ ID NO:9)、

N702

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTCC GATCT)(SEQ ID NO:10)、

N703

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTC CGATCT)(SEQ ID NO:11)、

N704

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTCC GATCT)(SEQ ID NO:12)、

N705

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTCC GATCT)(SEQ ID NO:13)、

N706

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTCC GATCT)(SEQ ID NO:14)、

N707

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTCC GATCT)(SEQ ID NO:15)、

N708

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTC CGATCT)(SEQ ID NO:16)、

N709

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTCC GATCT)(SEQ ID NO:17)、

N710

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTC CGATCT)(SEQ ID NO:18)、

N711

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTC CGATCT) (SEQ ID NO:19) and

N712

(CAAGCAGAAGACGGCATACGAGAT

GTGACTGGAGTTCAGACGTGTGCTCTTC CGATCT) (SEQ ID NO: 20).

Accordingly, in one aspect, the present invention provides a method of constructing a sequencing library of mutations in the PKHD1 gene, comprising the steps of:

first round amplification: employing a first round of forward amplification primers consisting of a sequence identical to all or part of one of the D5 linker primer sequence and N7 linker primer sequence selected above (i.e., the entire sequence of one of ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:22) or a sequence consisting of 13 or more consecutive deoxyribonucleotides beginning at the 3' end thereof, for example, CCTACACGACGCTCTTCCGATCT (SEQ ID NO:23)) and a sequence consisting of all or part of a forward specific amplification primer sequence of each exon of PKHD1 gene linked in series to all or part of a 3' end universal sequencing primer sequence selected from the other of D5 linker primer sequence and N7 linker primer sequence (i.e., the entire sequence of the other of ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:22) or a sequence consisting of 13 or more consecutive deoxyribonucleotides beginning at the 3' end thereof, for example, TTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:24)) identical sequences and the reverse specific amplification primer sequences of each exon of the PKHD1 gene are connected in series to form a first round amplification primer combination, and one or more exons of the PKHD1 gene of each sample are amplified by the combination of the first round amplification primers of the first round reverse amplification primers, wherein the specific amplification primer sequence of each exon plays a role in multiplex amplification, and the amplification result leads to the addition of part or all of the universal sequencing primer sequence at both ends of each amplification product fragment, wherein the D5 adapter primer sequence is selected from SEQ ID NO: 1-SEQ ID NO:8, and the N7 adapter primer sequence is selected from SEQ ID NO: 9-SEQ ID NO: 20;

digesting a primer: digesting the remaining primers and primer dimers in the first round amplification products with a single-stranded digestive enzyme;

and (3) second round amplification: taking the product of the first round of amplification as a template, and adopting a combination of a second round of amplification primer (namely, a combination of a D5 linker primer sequence and an N7 linker primer sequence) consisting of a second round of forward amplification primer which is the same as one selected from the D5 linker primer sequence and the N7 linker primer sequence and a second round of reverse amplification primer which is the same as the other selected from the D5 linker primer sequence and the N7 linker primer sequence, wherein the amplification plays a role in the universal sequencing primer sequence, and the final amplification product is added with a tag sequence which can distinguish the D5 linker primer sequence and the N7 linker primer sequence of each sample as a result of amplification, wherein the D5 linker primer sequence is selected from SEQ ID NO: 1-SEQ ID NO:8, and the N7 linker primer sequence is selected from SEQ ID NO: 9-SEQ ID NO: 20;

purifying and recovering all DNA bands, preferably using a purified magnetic bead screen to recover all DNA bands between the target area ranges;

sequencing: after the recycled products are quantified, mixing the products with different labels according to the requirement of sequencing data quantity, and then carrying out on-machine sequencing;

and (3) analysis: and on the basis of the label sequence of each sample, corresponding the obtained sequencing result to the sample one by one, and according to the primer sequence of each gene, corresponding the sequence to each gene of the sample.

In the present invention, preferably, the exons of the PKHD1 gene may include one or more exons selected from the group consisting of PKHD1 gene exons 1 to 67.

In the method for constructing the sequencing library of the PKHD1 gene mutation, preferably, the combination of the first round amplification primers comprises one or more pairs selected from SEQ ID NO. 25 to SEQ ID NO. 230, preferably, the combination of the first round amplification primers comprises SEQ ID NO. 25 to SEQ ID NO. 230, and more preferably, the combination of the first round amplification primers comprises SEQ ID NO. 25 to SEQ ID NO. 230.

In the present invention, preferably, the number of the sample may be 96 or less (8 kinds of D5 adapter primers and 12 kinds of N7 adapter primers in one-to-one combination).

The library can be directly applied to a sequencer such as Nextseq500/550, Hiseq 2000/2500/3000, Miseq and the like of the company illumina for machine sequencing. Meanwhile, after the second round of amplification, a D5adaptor primer sequence and an N7adaptor primer sequence which are commonly used by the company of illumina are introduced into the product, and the product can be directly used for sequencing a library to perform high-throughput sequencing.

In another aspect, the present invention provides a kit for constructing a sequencing library of mutations in PKHD1 gene, the kit comprising:

first round amplification primer combinations: designing corresponding amplification primers according to a PKHD1 gene to be detected, designing the length of a PCR product according to the size range of the product applicable to a sequencer and a sequencing method, adding a sequence which is identical to all or part of a universal sequencing primer sequence of a D5adaptor primer sequence and an N7adaptor primer sequence to the 5 ' ends of a forward amplification primer and a reverse amplification primer respectively to form a first round amplification primer combination, wherein the first round forward amplification primer consists of a sequence which is identical to all or part of a universal sequencing primer sequence of the 3' end of one selected from the D5adaptor primer sequence and the N7adaptor primer sequence (namely, a sequence which is identical to the sequence of the other one selected from ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:22) or a sequence which is formed by more than 13 continuous deoxyribonucleotides from the 3' end of the other one selected from the D5adaptor primer sequence and the N7adaptor primer sequence, such as CCTACACGACGCTCTTCCGATCT (SEQ ID NO:23) and a forward specific amplification primer sequence of each exon of the PKHD1 gene in series connection, and the first round reverse amplification primer consists of a sequence identical to all or part of a sequencing primer sequence common to the 3 'end selected from the other of the D5 linker primer sequence and the N7 linker primer sequence (i.e., the whole sequence of the other of ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:22) or a sequence consisting of 13 or more consecutive deoxyribonucleotides starting at the 3' end thereof, e.g., TTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:24)) and a reverse specific amplification primer sequence for each exon of PKHD1 gene, linked in series, wherein the D5 linker primer sequence is selected from D501-D508(SEQ ID NO: 1-SEQ ID NO:8), and the N7 linker primer sequence is selected from N701-N712(SEQ ID NO: 9-SEQ ID NO: 20);

the universal sequencing primer sequence of the invention, which is a high-throughput sequencing primer sequence of the illumina company, respectively corresponds to the universal sequencing primer sequence of the 3' end on the D5 joint primer and the N7 joint primer;

second round amplification primer combinations: consisting of a second round forward amplification primer identical to one selected from the D5 and N7adaptor primer sequences and a second round reverse amplification primer identical to the other selected from the D5 and N7adaptor primer sequences (i.e., a combination of a D5 and N7adaptor primer sequences).

The combination of second-round amplification primers was a combination of tag sequences using different D5 adapter primers and N7 adapter primer sequences (tag sequences were a sequence of one of D5 adapter primer and N7 adapter primer sequences (i.e., [ i5] and [ i7]) according to the number of samples) so as to make each sample distinguishable, using a combination of second-round amplification primers consisting of the same second-round forward amplification primer as one selected from the D5 adapter primer sequence and N7 adapter primer sequence and the same second-round reverse amplification primer as the other one selected from the D5 adapter primer sequence and N7 adapter primer sequence (i.e., a combination of D5 adapter primer sequence and N7 adapter primer sequence), wherein the D5 adapter primer sequence is selected from D501-D508(SEQ ID NO: 1-SEQ ID NO:8), the N7 adapter primer sequence is selected from N701-N712(SEQ ID NO: 9-SEQ ID NO:20), wherein the combination of second round amplification primers comprises one or more pairs of tag primer sequences selected from one of D501 to D508(SEQ ID NO:1 to SEQ ID NO:8) and one of N701 to N712(SEQ ID NO:9 to SEQ ID NO:20) to make each sample distinguishable.

In the kit for constructing the sequencing library of the PKHD1 gene mutation, preferably, the combination of the first round amplification primers comprises one or more pairs selected from SEQ ID NO. 25-SEQ ID NO. 230, preferably, the combination of the first round amplification primers comprises SEQ ID NO. 25-SEQ ID NO. 230, and more preferably, the combination of the first round amplification primers comprises SEQ ID NO. 25-SEQ ID NO. 230.

In the present invention, preferably, the kit further comprises a DNA polymerase, and all the enzymes used are high-fidelity DNA polymerases, thereby reducing the DNA mutation rate caused by amplification.

In the present invention, preferably, the kit further comprises a single-stranded digestive enzyme, wherein the single-stranded digestive enzyme is exonuclease i (exouclase i), and the single-stranded specific exonuclease is 3'→ 5' exonuclease, and does not decompose double-stranded DNA and RNA.

In the present invention, it is preferable that NGS technology will significantly improve the efficiency, sensitivity and specificity of detecting mutations in PKHD1 gene.

In the present invention, more preferably, the present invention provides a kit for constructing a sequencing library comprising exon regions of the PKHD1 gene, wherein the PKHD1 exon regions may comprise one or more exon regions selected from the following 67 exon regions (preferably, may comprise the following 67 exon regions; more preferably, may consist of the following 67 exon regions), the kit comprising:

first round amplification primer combination: comprising one or more pairs of primers selected from the group consisting of the primers in the following table, preferably comprising, more preferably consisting of the primers in the following table,

in the present invention, the above exons are well known in the art, and the sequence information is available from, for example, GenBank, PKHD1NM 138694.

A second round amplification primer combination comprising one or more pairs of tag primer sequences selected from one of D501 to D508(SEQ ID NO:1 to SEQ ID NO:8) and one of N701 to N712(SEQ ID NO:9 to SEQ ID NO:20) to make each sample distinguishable:

the invention has the following beneficial effects:

according to the invention, the cycle number of the multiplex PCR reaction is optimized, so that the first round of multiplex PCR reaction only carries out linear amplification, the difference of amplification efficiency among multiplex primers is reduced to the maximum extent, and the quantity of related products of each exon of the PKHD1 gene in the multiplex amplification product is close to the maximum extent through parallel amplification of the universal primers during the second round of amplification, so that the effectiveness of sequencing data is improved.

In the present invention, the first round of amplification uses a mixture of universal sequencing primer sequences for high throughput sequencing plus specific primers for each exon of the PKHD1 gene, where multiple amplifications are performed on the specific sequences for each exon preceded by universal sequencing primer sequences. The second round of amplification primers uses a linker sequence + a tag sequence + a universal sequencing sequence, and the amplification at this time uses the universal sequencing sequence, and the final products are all preceded by distinguishable tag sequences, and can be directly used as sequencing libraries for high-throughput sequencing (Nextseq 500/550, Hiseq 2000/2500/3000, Miseq, etc.). Through the reasonable primer design and PCR strategy, the D5adaptor primer and the N7adaptor primer sequence are directly added at the 5' end of the PCR product. By introducing the distinguishable label sequences into each sample, the sequencing result of each sample can be found back through the unique label sequences when the samples are detected by the second generation high-throughput sequencing technology, and the method can be applied to simultaneously detecting a plurality of different gene sites of a large number of samples, thereby greatly reducing the sequencing cost.

Detailed Description

The present invention will now be described in further detail with reference to examples, which are given for illustration of the present invention and are not intended to limit the present invention.

The equipment and reagents used in the following examples are as follows: blood genome extraction Kit (Tiangen Biochemical technology Co., Ltd.), high speed centrifuge SIGMA 3-30K, nucleic acid amplification instrument ABI 9700, Illumina sequencer, multiple amplification reagent GeneRead DNAseq panel PCR Kit v2(181942), high fidelity amplification enzyme Kapa biosystems HiFi HS (kk2602), Exonuclease Takara (Exonase I (E. coli)), and purified magnetic bead Beckman AgencourtAmpure XP.

Example 1

67 exons of the gene PKHD1 that caused autosomal recessive polycystic kidney disease were sequenced for a total of 15, namely 15 samples of normal human genomic DNA.

1) Designing a primer:

designing corresponding amplification primers aiming at 67 exons of the PKHD1 gene, wherein the related parameters are as follows: the Tm value is 58.0-62.0 ℃, the GC value is 40.0-60.0%, and the size of the primer is 22 +/-3 bp. The forward and reverse amplification primers were each added at their 5 'ends with a sequence identical to the sequence of the universal sequencing primer for high throughput sequencing of the 3' ends of the D5 adapter primer and N7 adapter primer, as follows, with the sequence of the universal sequencing primer for high throughput sequencing introduced underlined (i.e., SEQ ID NO:23 and SEQ ID NO: 24):

in this example, for the second round of amplification primer selection, 15 pairs of tag sequence combinations are used according to 15 samples, and distinguishable tag sequences are added to each target fragment of each sample in the second round of amplification, the primers are designed as follows, wherein the underline indicates the introduced universal sequencing sequence (i.e., the universal sequence in the first round, which functions as an amplification primer in the second round):

table 1: 15 samples correspond to a list of 15 pairs of labels

	D504	D505	D506	D507	D508
						N703	1#	4#	7#	10#	13#
N704	2#	5#	8#	11#	14#
						N705	3#	6#	9#	12#	15#

2) First round amplification:

after each pair of primers is individually qualified, 103 pairs of primers are respectively diluted to 100. mu.M and then mixed in equal amounts, wherein the PCR system comprises 4.4. mu. L5 x PCR buffer, 2. mu. L mixed primers, 1.5. mu. L taq (5U/. mu. L), 2.5. mu. L template DNA (5 ng/. mu. L), ddH₂O is supplemented to 22 mu L the PCR reaction is carried out according to the following conditions that the template DNA is denatured and kept at 95 ℃ for 15min, and the PCR reaction is cycled:

the following 20 cycles were performed:

step 1: 30 seconds at 95 ℃;

step 2: at 60 ℃ for 4 minutes;

after 20 cycles, 72 ℃ was maintained for 10min and finally at 4 ℃.

3) Digestion primer

The first round of amplification products are subjected to residual primer digestion by Takara Exonuclease I, the enzyme digestion system is Exonuclease I (50U/. mu. L) 0.5 mu. L products 20 mu. L,

the enzyme digestion reaction is carried out according to the following conditions: 30min at 37 ℃;

4) and (3) purification and recovery: 0.6-0.9 Xmagnetic beads were used to screen fragments between 200 and 400bp (non-specific amplification of the second round of amplification was reduced)

5) Second round of amplification

15 pairs of distinguishable label combinations are formed by respectively pairing the upstream and downstream of the label primers, the recognizable label sequences are respectively added to 15 samples during the second round of PCR amplification, the label combinations at the two ends of the samples are shown in Table 2, the PCR system comprises HiFiHS (kk2602)2X mix 25 mu L, 0.75 mu L forward amplification primer, 0.75 mu L reverse amplification primer, PCR products screened after 5-10 mu L digestion of the primers (the addition amount of the screened PCR products after digestion is between 80 and 120 ng), ddH₂O to 50. mu. L PCR was performed by denaturing the template DNA at 98 ℃ for 45s and cycling the PCR:

the following 8 cycles were performed:

step 1: at 98 ℃ for 15 s;

step 2: at 60 ℃ for 30 s;

and 3, step 3: at 72 ℃ for 30 s;

after the completion of 13 cycles, 72 ℃ was maintained for 1min and finally at 4 ℃.

TABLE 2 sample two-end tag combination table

6) And (3) recovering: recovering all DNA bands within the range of 350bp-450 bp;

7) sequencing: after quantifying the recovered products, mixing the products with different labels according to the requirement of sequencing data amount, and then performing machine sequencing (Nextseq500, PE 150);

8) and (3) analysis: the sequencing result of the Illumina Nextseq500 product is a series of DNA sequences, the obtained sequencing result is firstly in one-to-one correspondence with the samples by searching the label sequences which can be distinguished by 15 samples in the sequencing result, and then the sequences are corresponding to each target region of the samples according to the primer sequence of each exon. Each exon in the 15 samples was able to find the corresponding data in the sequencing results, the number of reads (number of sequences) for each sample is shown in Table 3 below, and the number of sequences for each exon sequence is shown in Table 4 below (only data for sample # 1 are shown).

TABLE 3 number of sequences and GC _ Numbers for each sample

TABLE 4 number of sequences corresponding to target sequence in exon region of PKHD1 (sample No. 1 as an example)

Table 3 shows that by the method, libraries for sequencing are successfully constructed, and each library can correspondingly obtain a corresponding sequencing sequence, so that the detection of the PKHD1 gene mutation by the high-throughput sequencing technology is successful.

Table 4 illustrates the sequence numbers of 103 pairs of primers in multiplex amplification using one sample as an example, showing the effectiveness of multiplex amplification further illustrating that primers designed for 67 exons of PKHD1 gene are all useful.

<110> Dalian Tai Biotechnology Ltd

<120> method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof

<130>DI16-1142-XC37

<160>230

<170>PatentIn version 3.3

<210>1

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D501

<400>1

aatgatacgg cgaccaccga gatctacact agatcgcaca ctctttccct acacgacgct 60

cttccgatct 70

<210>2

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D502

<400>2

aatgatacgg cgaccaccga gatctacacc tctctataca ctctttccct acacgacgct 60

cttccgatct 70

<210>3

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D503

<400>3

aatgatacgg cgaccaccga gatctacact atcctctaca ctctttccct acacgacgct 60

cttccgatct 70

<210>4

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D504

<400>4

aatgatacgg cgaccaccga gatctacaca gagtagaaca ctctttccct acacgacgct 60

cttccgatct 70

<210>5

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D505

<400>5

aatgatacgg cgaccaccga gatctacacg taaggagaca ctctttccct acacgacgct 60

cttccgatct 70

<210>6

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D506

<400>6

aatgatacgg cgaccaccga gatctacaca ctgcataaca ctctttccct acacgacgct 60

cttccgatct 70

<210>7

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D507

<400>7

aatgatacgg cgaccaccga gatctacaca aggagtaaca ctctttccct acacgacgct 60

cttccgatct 70

<210>8

<211>70

<212>DNA

<213> Artificial sequence

<220>

<223>D508

<400>8

aatgatacgg cgaccaccga gatctacacc taagcctaca ctctttccct acacgacgct 60

cttccgatct 70

<210>9

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N701

<400>9

caagcagaag acggcatacg agattaaggc gagtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>10

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N702

<400>10

caagcagaag acggcatacg agatcgtact aggtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>11

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N703

<400>11

caagcagaag acggcatacg agataggcag aagtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>12

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N704

<400>12

caagcagaag acggcatacg agattcctga gcgtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>13

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N705

<400>13

caagcagaag acggcatacg agatggactc ctgtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>14

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N706

<400>14

caagcagaag acggcatacg agattaggca tggtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>15

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N707

<400>15

caagcagaag acggcatacg agatctctct acgtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>16

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N708

<400>16

caagcagaag acggcatacg agatcagaga gggtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>17

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N709

<400>17

caagcagaag acggcatacg agatgctacg ctgtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>18

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N710

<400>18

caagcagaag acggcatacg agatcgaggc tggtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>19

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N711

<400>19

caagcagaag acggcatacg agataagagg cagtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>20

<211>66

<212>DNA

<213> Artificial sequence

<220>

<223>N712

<400>20

caagcagaag acggcatacg agatgtagag gagtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>21

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> sequencing primer sequence common to the 3' end of the D5adaptor primer sequence

<400>21

acactctttc cctacacgac gctcttccga tct 33

<210>22

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> sequencing primer sequence common to the 3' end of N7adaptor primer sequence

<400>22

gtgactggag ttcagacgtg tgctcttccg atct 34

<210>23

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> part of sequencing primer sequence common to the 3' end of the D5adaptor primer sequence

<400>23

cctacacgac gctcttccga tct 23

<210>24

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> part of the sequencing primer sequence common to the 3' end of the N7adaptor primer sequence

<400>24

ttcagacgtg tgctcttccg atct 24

<210>25

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon1-F

<400>25

cctacacgac gctcttccga tctacctttt ttttctgttt ctgtctcc 48

<210>26

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon2_1-F

<400>26

cctacacgac gctcttccga tctttaaacc caaaagcaaa taccttaaca cc 52

<210>27

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon2_2-F

<400>27

cctacacgac gctcttccga tctacacatt ctactgacct gccaaaa 47

<210>28

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon3-F

<400>28

cctacacgac gctcttccga tctcccttca ggcccacttt taca 44

<210>29

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon4-F

<400>29

cctacacgac gctcttccga tctagataag caaaaatccc tcatcctgtc 50

<210>30

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon5-F

<400>30

cctacacgac gctcttccga tctctggctc atttacaatt tgcctttca 49

<210>31

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon6-F

<400>31

cctacacgac gctcttccga tctgaagaag ttaaattttc ccactcataa aaacca 56

<210>32

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon7_1-F

<400>32

cctacacgac gctcttccga tctccagttg caattacatt aacaaagttt gc 52

<210>33

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon7_2-F

<400>33

cctacacgac gctcttccga tctaacaaac acacacttac ctatcaatgt act 53

<210>34

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon8-F

<400>34

cctacacgac gctcttccga tcttgtgttg tatccatgtg gacgaa 46

<210>35

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon9-F

<400>35

cctacacgac gctcttccga tctttatcct catgagaacc aatcttgcaa t 51

<210>36

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon10-F

<400>36

cctacacgac gctcttccga tcttccgtca taaaaagata aagaaagtaa gcaaga 56

<210>37

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon11-F

<400>37

cctacacgac gctcttccga tctgggtgtt aatggtcatc aagaaatgg 49

<210>38

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon12-F

<400>38

cctacacgac gctcttccga tctcttcctc ctgcatccct catg 44

<210>39

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon13-F

<400>39

cctacacgac gctcttccga tctgctcact gagtaagcca gtcaaata 48

<210>40

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon14-F

<400>40

cctacacgac gctcttccga tcttccttat ctgtctccta gcctcac 47

<210>41

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon15-F

<400>41

cctacacgac gctcttccga tctacatgag agccttaact ttgattcttt ct 52

<210>42

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon16_1-F

<400>42

cctacacgac gctcttccga tcttgaatct ggacaccaat cctcatc 47

<210>43

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon16_2-F

<400>43

cctacacgac gctcttccga tctcagcaag gttataatga cccctcag 48

<210>44

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon17-F

<400>44

cctacacgac gctcttccga tctttgaaga agtctcccac cagatg 46

<210>45

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon18-F

<400>45

cctacacgac gctcttccga tcttgatgaa aaagacaatc agaatgaagc c 51

<210>46

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon19-F

<400>46

cctacacgac gctcttccga tctccagaga gcaataccaa tacctacc 48

<210>47

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon20-F

<400>47

cctacacgac gctcttccga tctactgtcc ccaaaacagt gaatcc 46

<210>48

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon21-F

<400>48

cctacacgac gctcttccga tctgcttgtg gaggagagag aatttgat 48

<210>49

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon22-F

<400>49

cctacacgac gctcttccga tctaaggcca acaagcattc ttagga 46

<210>50

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon23-F

<400>50

cctacacgac gctcttccga tctggatgtt gttcccttgg gaatgt 46

<210>51

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon24-F

<400>51

cctacacgac gctcttccga tctgcagcaa atccatgcca ctag 44

<210>52

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon25-F

<400>52

cctacacgac gctcttccga tctcacttag ggtggcccat tca 43

<210>53

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon26-F

<400>53

cctacacgac gctcttccga tctatcacca gctacatggc ctcta 45

<210>54

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon27_1-F

<400>54

cctacacgac gctcttccga tctagagggt ctcaccaaca tcaaga 46

<210>55

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon27_2-F

<400>55

cctacacgac gctcttccga tctagtaaac aaaagacagt gagtcacagt 50

<210>56

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon28-F

<400>56

cctacacgac gctcttccga tcttatatta acagtggtca ctcacccaga 50

<210>57

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon29-F

<400>57

cctacacgac gctcttccga tctttgattg ccctttttat aggaccaatg 50

<210>58

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon30-F

<400>58

cctacacgac gctcttccga tctccatcaa acaaatccaa aattaatgca agtg 54

<210>59

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon31-F

<400>59

cctacacgac gctcttccga tcttctctga cctcactggc aaattaatc 49

<210>60

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_1-F

<400>60

cctacacgac gctcttccga tcttgtggtt accagagaca ccca 44

<210>61

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_2-F

<400>61

cctacacgac gctcttccga tctttccaga agtgaaagga gctacc 46

<210>62

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_3-F

<400>62

cctacacgac gctcttccga tctccctaat cagcacagtg gtcag 45

<210>63

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_4-F

<400>63

cctacacgac gctcttccga tctcattccc tgtgggaaca atgc 44

<210>64

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_5-F

<400>64

cctacacgac gctcttccga tctccagaac aagcataccc atttcttg 48

<210>65

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_6-F

<400>65

cctacacgac gctcttccga tctaattgct ggagcaccac aga 43

<210>66

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_7-F

<400>66

cctacacgac gctcttccga tctaggctaa cctggcagag aatg 44

<210>67

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_8-F

<400>67

cctacacgac gctcttccga tctgctcgcc tccgttaagt tca 43

<210>68

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_9-F

<400>68

cctacacgac gctcttccga tctttgtgat ttctccttgc atggc 45

<210>69

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon33_1-F

<400>69

cctacacgac gctcttccga tcttaacagg tggcctcaga ttctaacta 49

<210>70

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon33_2-F

<400>70

cctacacgac gctcttccga tcttgtagca ttagccagga ctcg 44

<210>71

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon34_1-F

<400>71

cctacacgac gctcttccga tctctgccca atgatctggc aca 43

<210>72

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon34_2-F

<400>72

cctacacgac gctcttccga tctctgccca atgatctggc aca 43

<210>73

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon35_1-F

<400>73

cctacacgac gctcttccga tctagcgttt ccgtatctca gtaatcttg 49

<210>74

<211>55

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon35_2-F

<400>74

cctacacgac gctcttccga tctaactatg aattcagata ttgtgcatta gacca 55

<210>75

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon36_1-F

<400>75

cctacacgac gctcttccga tcttgagtcc aaagaaaggc ctttca 46

<210>76

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon36_2-F

<400>76

cctacacgac gctcttccga tctatgcttg tgttagtgtc cagca 45

<210>77

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon37_1-F

<400>77

cctacacgac gctcttccga tctgatcaat tgcctcactc accgt 45

<210>78

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon37_2-F

<400>78

cctacacgac gctcttccga tctagcaaac aattgggaac ggtagt 46

<210>79

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon38_1-F

<400>79

cctacacgac gctcttccga tctttgtcaa aatgtctacc attatttaag cagaag 56

<210>80

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon38_2-F

<400>80

cctacacgac gctcttccga tctagtgaca atctcttcca tcggtttg 48

<210>81

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon39-F

<400>81

cctacacgac gctcttccga tcttgctcat tagactttcc aacaaaacac 50

<210>82

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon40-F

<400>82

cctacacgac gctcttccga tctagaaaga aacatgagaa agtcctaggt c 51

<210>83

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon41-F

<400>83

cctacacgac gctcttccga tctgtgtcct acacaagaat gcagaaattc 50

<210>84

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon42-F

<400>84

cctacacgac gctcttccga tctatgcaca ataaacttaa gagacctaac attttg 56

<210>85

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon43-F

<400>85

cctacacgac gctcttccga tctcacccct gattgagaaa gaactttatg 50

<210>86

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon44-F

<400>86

cctacacgac gctcttccga tctgcccaaa gtgctctcat tgtg 44

<210>87

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon45_1-F

<400>87

cctacacgac gctcttccga tctaaaaagc ttacctgggc acca 44

<210>88

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon45_2-F

<400>88

cctacacgac gctcttccga tctagaaaat gacctaaccc tggattagtg 50

<210>89

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon46-F

<400>89

cctacacgac gctcttccga tctgggccca gcacatgtaa ttttg 45

<210>90

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon47-F

<400>90

cctacacgac gctcttccga tctgccttat ttatcatctg ttctgtctat tcaaat 56

<210>91

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon48_1-F

<400>91

cctacacgac gctcttccga tctatgattc agcagctgtc aaaattattc c 51

<210>92

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon48_2-F

<400>92

cctacacgac gctcttccga tctacccgac caaagcttga attga 45

<210>93

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon49_1-F

<400>93

cctacacgac gctcttccga tctttgcaat gagtaggtct cttggtc 47

<210>94

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon49_2-F

<400>94

cctacacgac gctcttccga tctagcttat attcatctgg ccaaaatact attgaa 56

<210>95

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon50_1-F

<400>95

cctacacgac gctcttccga tctccataac acacagctgt ccctt 45

<210>96

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon50_2-F

<400>96

cctacacgac gctcttccga tctggttctg acctggtgat ggaag 45

<210>97

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon51-F

<400>97

cctacacgac gctcttccga tctaacagta tgacaaggtg gaatttgtag aa52

<210>98

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon52-F

<400>98

cctacacgac gctcttccga tctgggttca gcctgtctgt gatt 44

<210>99

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon53-F

<400>99

cctacacgac gctcttccga tctagcccct tctcacagaa tataattctc a 51

<210>100

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon54-F

<400>100

cctacacgac gctcttccga tctacaagca cacaatacac acacatg 47

<210>101

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon55-F

<400>101

cctacacgac gctcttccga tcttcatatt gtaacaaaat ctcaagcaga agc 53

<210>102

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon56-F

<400>102

cctacacgac gctcttccga tctaggttac caaacatggt cttcctag 48

<210>103

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon57-F

<400>103

cctacacgac gctcttccga tcttgtccca gatgaatagg ctcca 45

<210>104

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_1-F

<400>104

cctacacgac gctcttccga tctccactga tttggttctg aggtgaata 49

<210>105

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_2-F

<400>105

cctacacgac gctcttccga tctaccattg tggctatcaa tactcagc 48

<210>106

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_3-F

<400>106

cctacacgac gctcttccga tctgcagaaa atacatacac tactgccaaa ag 52

<210>107

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_4-F

<400>107

cctacacgac gctcttccga tctggcctga ccctctaaat ctatgc 46

<210>108

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_5-F

<400>108

cctacacgac gctcttccga tctacattgt cagaccaaag cagttca 47

<210>109

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon59_6-F

<400>109

cctacacgac gctcttccga tctttaatgt accttaccat tctaagattc atttct 56

<210>110

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon59_7-F

<400>110

cctacacgac gctcttccga tctttatctt ttatctttag catcctggtc ctc 53

<210>111

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon60-F

<400>111

cctacacgac gctcttccga tctacaagca cccttgcctc tac 43

<210>112

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_1-F

<400>112

cctacacgac gctcttccga tctctgttgg cgaatcacca atttcaa 47

<210>113

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_2-F

<400>113

cctacacgac gctcttccga tctaatcagc cctcatttgg atgtgaatat 50

<210>114

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_3-F

<400>114

cctacacgac gctcttccga tctaagcgca aaacttgagg agtttg 46

<210>115

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_4-F

<400>115

cctacacgac gctcttccga tcttcctctc cttgtaggac aacataca 48

<210>116

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_5-F

<400>116

cctacacgac gctcttccga tcttgtcagc aatggccttt aaggt 45

<210>117

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_6-F

<400>117

cctacacgac gctcttccga tctaactgga tataacttct gaattgccca a 51

<210>118

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_7-F

<400>118

cctacacgac gctcttccga tctgaaacag tgtcttaaca agtctttcca ttt 53

<210>119

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon62-F

<400>119

cctacacgac gctcttccga tctaaaagat aggctgaatg ctacatgct 49

<210>120

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon63-F

<400>120

cctacacgac gctcttccga tctaacattt tctgtgcaga taaagtggta ac 52

<210>121

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon64-F

<400>121

cctacacgac gctcttccga tctgaataaa agcacactgt ataaaattac ctggag 56

<210>122

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon65_1-F

<400>122

cctacacgac gctcttccga tcttttagag aagctcacaa aaatttgtct ttgg 54

<210>123

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon65_2-F

<400>123

cctacacgac gctcttccga tctgatgatg gtcgacttct ccttcc 46

<210>124

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon66-F

<400>124

cctacacgac gctcttccga tctaggctca gaccatccac agt 43

<210>125

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon67_1-F

<400>125

cctacacgac gctcttccga tctctctctt cttagttgtc ccagcag 47

<210>126

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon67_2-F

<400>126

cctacacgac gctcttccga tctgcttact cagccgactt tgc 43

<210>127

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon67_3-F

<400>127

cctacacgac gctcttccga tcttgtgatg ccagtagtac cagga 45

<210>128

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon1-R

<400>128

ttcagacgtg tgctcttccg atcttcatta aacttaccca tggtcagg 48

<210>129

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon2_1-R

<400>129

ttcagacgtg tgctcttccg atctcctggc tgatctctct gatgagta 48

<210>130

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon2_2-R

<400>130

ttcagacgtg tgctcttccg atcttcctta atttcccagg tttcagaaca g 51

<210>131

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon3-R

<400>131

ttcagacgtg tgctcttccg atctttgctt aaaatattgc agaaggtagt ggt 53

<210>132

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon4-R

<400>132

ttcagacgtg tgctcttccg atctgtcctg tgtcaatgac aattctatgc 50

<210>133

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon5-R

<400>133

ttcagacgtg tgctcttccg atctcaagtg ggctgctagc tttg 44

<210>134

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon6-R

<400>134

ttcagacgtg tgctcttccg atctaccttc aagtaatgct gtctgagg 48

<210>135

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon7_1-R

<400>135

ttcagacgtg tgctcttccg atctggatta tcactggaag attggaaact tttg 54

<210>136

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon7_2-R

<400>136

ttcagacgtg tgctcttccg atctagtatt aattttctgg gccatgacct g 51

<210>137

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon8-R

<400>137

ttcagacgtg tgctcttccg atctgccatg tttcctctga gttttgtg 48

<210>138

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon9-R

<400>138

ttcagacgtg tgctcttccg atcttggttt tcttttgctt tctactttcc tg 52

<210>139

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon10-R

<400>139

ttcagacgtg tgctcttccg atcttgatat tggagtcttt gggcttatga aa 52

<210>140

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon11-R

<400>140

ttcagacgtg tgctcttccg atctcaatag aggttagttc ccaatcttcc ttt 53

<210>141

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon12-R

<400>141

ttcagacgtg tgctcttccg atcttctagg tcatattctg gtctatattt ggaagc 56

<210>142

<211>57

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon13-R

<400>142

ttcagacgtg tgctcttccg atctcacaca cacacataca taaatttctt taattcg 57

<210>143

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon14-R

<400>143

ttcagacgtg tgctcttccg atctaaggtg cgccctgtaa tgt 43

<210>144

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon15-R

<400>144

ttcagacgtg tgctcttccg atctagggca gtcatttgtt ggttca 46

<210>145

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon16_1-R

<400>145

ttcagacgtg tgctcttccg atcttgtttg agaaagagat gcctggaa 48

<210>146

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon16_2-R

<400>146

ttcagacgtg tgctcttccg atctaagcag agcatcatgg gatagc 46

<210>147

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon17-R

<400>147

ttcagacgtg tgctcttccg atcttgatgc tgtgttcctc agagatttc 49

<210>148

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon18-R

<400>148

ttcagacgtg tgctcttccg atcttgtctc tagtcagcca atccct 46

<210>149

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon19-R

<400>149

ttcagacgtg tgctcttccg atctcacatg tagggaagct ctgtctttt 49

<210>150

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon20-R

<400>150

ttcagacgtg tgctcttccg atctgactcc tcactacgta ttgtttgaat ga 52

<210>151

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon21-R

<400>151

ttcagacgtg tgctcttccg atctgctcta accggagagg actg 44

<210>152

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon22-R

<400>152

ttcagacgtg tgctcttccg atctcacaca gcaagtctac catcttaagt 50

<210>153

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon23-R

<400>153

ttcagacgtg tgctcttccg atctatcctt cagacaaggt cctcct 46

<210>154

<211>55

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon24-R

<400>154

ttcagacgtg tgctcttccg atctggtgga ttaattagtg tctgtgtttt ctgta 55

<210>155

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon25-R

<400>155

ttcagacgtg tgctcttccg atcttagctg tctgattatc tgaaacacaa tgt 53

<210>156

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon26-R

<400>156

ttcagacgtg tgctcttccg atctagcttg ggagcacttc acatatac 48

<210>157

<211>55

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon27_1-R

<400>157

ttcagacgtg tgctcttccg atctagaggt ctctcaaatg aagtaatatc actga 55

<210>158

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon27_2-R

<400>158

ttcagacgtg tgctcttccg atcttgtcag acagatttgc tacctgttg 49

<210>159

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon28-R

<400>159

ttcagacgtg tgctcttccg atcttgtctg cctgtatggt tggtg 45

<210>160

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon29-R

<400>160

ttcagacgtg tgctcttccg atctagttct cttcccttaa gtcagtcct 49

<210>161

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon30-R

<400>161

ttcagacgtg tgctcttccg atctccacat gtcagaggct attggatt 48

<210>162

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon31-R

<400>162

ttcagacgtg tgctcttccg atctacagtt tgctcttctc ctcaaaatac a 51

<210>163

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_1-R

<400>163

ttcagacgtg tgctcttccg atctcctgac ggtgaacatc ggt 43

<210>164

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_2-R

<400>164

ttcagacgtg tgctcttccg atctggagct gcaaacattg acatttttat agg 53

<210>165

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_3-R

<400>165

ttcagacgtg tgctcttccg atctggtcct tttacttgtg tgattttgag ttt 53

<210>166

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_4-R

<400>166

ttcagacgtg tgctcttccg atctccagga ccccactacc tgt 43

<210>167

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_5-R

<400>167

ttcagacgtg tgctcttccg atctcatgga tgccttgtcc acaaac 46

<210>168

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_6-R

<400>168

ttcagacgtg tgctcttccg atcttgtatg aagcggcagc aaca 44

<210>169

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_7-R

<400>169

ttcagacgtg tgctcttccg atctagtacg tcagaagcag atggga 46

<210>170

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_8-R

<400>170

ttcagacgtg tgctcttccg atcttttcac taacacatgc cctaccttc 49

<210>171

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon32_9-R

<400>171

ttcagacgtg tgctcttccg atctggtact tgtgggcaat cggt 44

<210>172

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon33_1-R

<400>172

ttcagacgtg tgctcttccg atctggaatg tctcagctgc tgtgt 45

<210>173

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon33_2-R

<400>173

ttcagacgtg tgctcttccg atctgcggat tctgaggatg tgaaaaga 48

<210>174

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon34_1-R

<400>174

ttcagacgtg tgctcttccg atctgttctc tctgtggttc tttcctaatg g 51

<210>175

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon34_2-R

<400>175

ttcagacgtg tgctcttccg atctcctcta catttgcgag gaaagttc 48

<210>176

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon35_1-R

<400>176

ttcagacgtg tgctcttccg atctaagcta atggcttgca atgattaata agagta 56

<210>177

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon35_2-R

<400>177

ttcagacgtg tgctcttccg atctgagtgt gagacgccca atca 44

<210>178

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon36_1-R

<400>178

ttcagacgtg tgctcttccg atctgacaac gtcacagtgg agaatg 46

<210>179

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon36_2-R

<400>179

ttcagacgtg tgctcttccg atctccgccc aaaaacaatg aatgaac 47

<210>180

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon37_1-R

<400>180

ttcagacgtg tgctcttccg atctcaggga ctgacaattt tccctttg 48

<210>181

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon37_2-R

<400>181

ttcagacgtg tgctcttccg atctcctggc tgtgaggaat ggaa 44

<210>182

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon38_1-R

<400>182

ttcagacgtg tgctcttccg atctaagttg tcatcatcag tggaacagg 49

<210>183

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon38_2-R

<400>183

ttcagacgtg tgctcttccg atcttgggat tctttggcta aataacatca ca 52

<210>184

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon39-R

<400>184

ttcagacgtg tgctcttccg atctgtgatg tcctcagttc tatcatcctc t 51

<210>185

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon40-R

<400>185

ttcagacgtg tgctcttccg atctacatgc tttaggttct ctggacttta ttt 53

<210>186

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon41-R

<400>186

ttcagacgtg tgctcttccg atctcaacag aatctcagga gccatatcta attt 54

<210>187

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon42-R

<400>187

ttcagacgtg tgctcttccg atctcacacc caaagaagta gtgttgc 47

<210>188

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon43-R

<400>188

ttcagacgtg tgctcttccg atctgaatca agggtgttga gttgagtaca 50

<210>189

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon44-R

<400>189

ttcagacgtg tgctcttccg atctaacaag agtctttctt tccagcaac 49

<210>190

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon45_1-R

<400>190

ttcagacgtg tgctcttccg atctccatct accttcattc tccctaatac attact 56

<210>191

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon45_2-R

<400>191

ttcagacgtg tgctcttccg atctctgttc cagagcttca cagtttg 47

<210>192

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon46-R

<400>192

ttcagacgtg tgctcttccg atctagctac aggaagtccg caag 44

<210>193

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon47-R

<400>193

ttcagacgtg tgctcttccg atcttgtgtc cagttttctt attttgcttt catc 54

<210>194

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon48_1-R

<400>194

ttcagacgtg tgctcttccg atcttcttgc ttctatggaa accctttcag 50

<210>195

<211>55

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon48_2-R

<400>195

ttcagacgtg tgctcttccg atctgccatt gtgtaataat ctttctgttt tccaa 55

<210>196

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon49_1-R

<400>196

ttcagacgtg tgctcttccg atctaattga tgaaagagga atgtattgga ttcaga 56

<210>197

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon49_2-R

<400>197

ttcagacgtg tgctcttccg atctctaacc ctcgtggctg gatg 44

<210>198

<211>42

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon50_1-R

<400>198

ttcagacgtg tgctcttccg atctgggagt cgagtgggtc tg 42

<210>199

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon50_2-R

<400>199

ttcagacgtg tgctcttccg atctgttgtt ttggcagggt ggtg 44

<210>200

<211>58

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon51-R

<400>200

ttcagacgtg tgctcttccg atctctgttt tgaaaattta ggcaactaga atttagca 58

<210>201

<211>49

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon52-R

<400>201

ttcagacgtg tgctcttccg atctggaggt gaaaatacca ctagcatcc 49

<210>202

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon53-R

<400>202

ttcagacgtg tgctcttccg atctaacacg taattcttgt ttttgtgaca tatctg 56

<210>203

<211>56

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon54-R

<400>203

ttcagacgtg tgctcttccg atctgcaatt tctccctctc tttcttttaa tttcaa 56

<210>204

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon55-R

<400>204

ttcagacgtg tgctcttccg atcttggaat gacttttact tacctggctt t 51

<210>205

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon56-R

<400>205

ttcagacgtg tgctcttccg atcttagatg atttgtgctg cactgttagt 50

<210>206

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon57-R

<400>206

ttcagacgtg tgctcttccg atctccagct agtgattttt gaaacaggtt tt 52

<210>207

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_1-R

<400>207

ttcagacgtg tgctcttccg atcttggagatagagaacat tactctggta gac 53

<210>208

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_2-R

<400>208

ttcagacgtg tgctcttccg atctatccaa gaggaggtcg aattggta 48

<210>209

<211>44

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_3-R

<400>209

ttcagacgtg tgctcttccg atcttttcac atccgaggcc acaa 44

<210>210

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_4-R

<400>210

ttcagacgtg tgctcttccg atctggaaag tacctgatga catgcatttg 50

<210>211

<211>57

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon58_5-R

<400>211

ttcagacgtg tgctcttccg atctgagtac ttttaaatga caatattgtg tttggca 57

<210>212

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon59_6-R

<400>212

ttcagacgtg tgctcttccg atctagagaa cagtggaatt atgcaccc 48

<210>213

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon59_7-R

<400>213

ttcagacgtg tgctcttccg atctatcctg gatagcttta actaacttag ggt 53

<210>214

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon60-R

<400>214

ttcagacgtg tgctcttccg atctttcttc ttgctgctta tcatgaaatg aaag 54

<210>215

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_1-R

<400>215

ttcagacgtg tgctcttccg atctaaatca ggtttattca cgagatgcct 50

<210>216

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_2-R

<400>216

ttcagacgtg tgctcttccg atctcccaat gactgtggaa actatctcaa 50

<210>217

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_3-R

<400>217

ttcagacgtg tgctcttccg atctctgacc aagtggtcct aattcttgat ag 52

<210>218

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_4-R

<400>218

ttcagacgtg tgctcttccg atctccatca ggcaaatcac caaagtc 47

<210>219

<211>53

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_5-R

<400>219

ttcagacgtg tgctcttccg atctatctat tggtgccaac tatttcaaca tca 53

<210>220

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_6-R

<400>220

ttcagacgtg tgctcttccg atctagttat agatgatggc aagagtgatg g 51

<210>221

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon61_7-R

<400>221

ttcagacgtg tgctcttccg atctgggtat tttcatttgg atgcaatgtg g 51

<210>222

<211>52

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon62-R

<400>222

ttcagacgtg tgctcttccg atcttggaaa attgctacca tagggatatg tg 52

<210>223

<211>57

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon63-R

<400>223

ttcagacgtg tgctcttccg atcttccatc ttttctaact tcacaaaatt ctcttct 57

<210>224

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon64-R

<400>224

ttcagacgtg tgctcttccg atctccttta ttgtccaaat gtctgccttc 50

<210>225

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon65_1-R

<400>225

ttcagacgtg tgctcttccg atctccattt gctgtcttgc ctgtg 45

<210>226

<211>57

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon65_2-R

<400>226

ttcagacgtg tgctcttccg atcttgttat tgttggaatc ttgtgattct ctagaaa 57

<210>227

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon66-R

<400>227

ttcagacgtg tgctcttccg atctcctaaa tgctgatggt cccactt 47

<210>228

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon67_1-R

<400>228

ttcagacgtg tgctcttccg atcttatgcc cagacttcag acaagaga 48

<210>229

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon67_2-R

<400>229

ttcagacgtg tgctcttccg atctaggaaa gttagccgcc acatt 45

<210>230

<211>54

<212>DNA

<213> Artificial sequence

<220>

<223>PKHD1_exon67_3-R

<400>230

ttcagacgtg tgctcttccg atctttgtca gaaatgctaa gtatgcaaaa tgtg 54

Claims

1. A method for constructing a sequencing library of mutations in PKHD1 gene, comprising the steps of:

first round amplification: amplifying one or more exons of the PKHD1 gene of each sample by adopting a first round amplification primer combination comprising a first round forward amplification primer and a first round reverse amplification primer, wherein the first round amplification primer combination consists of SEQ ID NO. 25-SEQ ID NO. 230,

wherein, the primers are respectively diluted to 100 mu M and then mixed in equal amount, the PCR system comprises 4.4 mu L5 XPCR buffer, 2 mu L mixed primers, 1.5 mu L of taq with the concentration of 5U/mu L, 2.5 mu L of template DNA with the concentration of 5 ng/mu L, ddH₂O is added to 22 mu L, and the PCR reaction condition is that the template DNA is denatured and kept at 95 ℃ for 15 minutes;

the following 20 cycles were performed:

step 1: 30 seconds at 95 ℃;

step 2: at 60 ℃ for 4 minutes;

after 20 cycles, 72 ℃ for 10 minutes, and finally 4 ℃;

and (3) second round amplification: taking the first round amplification product as a template, and amplifying by adopting a second round amplification primer, wherein the second round amplification primer comprises one or more pairs consisting of a forward tag primer selected from SEQ ID NO. 1-SEQ ID NO. 8 and a reverse tag primer selected from SEQ ID NO. 9-SEQ ID NO. 20 so as to enable each sample to be distinguishable,

wherein, the second round of amplification is carried out through the tag primer sequence, and the PCR system comprises KapaHiFiHS 2X mix 25 mu L with the product number of kk2602, a forward tag primer of 0.75 mu L, a reverse tag primer of 0.75 mu L, a first round of amplification product screened after digesting the primers of 5-10 mu L, ddH₂O is added to 50 mu L, and the PCR reaction condition is that the first round amplification product is denatured and kept at 98 ℃ for 45 seconds;

the following 8 cycles were performed:

step 1: 15 seconds at 98 ℃;

step 2: 30 seconds at 60 ℃;

and 3, step 3: 30 seconds at 72 ℃;

after 8 cycles, 72 ℃ for 1 minute, and finally 4 ℃;

all DNA bands were recovered by purification.

2. A kit for constructing a sequencing library of mutations in the PKHD1 gene, the kit comprising:

first round amplification primer combinations: the kit comprises a first round of forward amplification primers and a first round of reverse amplification primers to amplify PKHD1 genes of each sample, wherein the combination of the first round of amplification primers consists of SEQ ID NO. 25-SEQ ID NO. 230;

second round amplification primers: one or more pairs consisting of a forward tag primer selected from SEQ ID NO. 1 to SEQ ID NO. 8 and a reverse tag primer selected from SEQ ID NO. 9 to SEQ ID NO. 20, so that each sample can be distinguished.

3. The kit of claim 2, wherein the kit further comprises a DNA polymerase.

4. The kit of claim 3, wherein the DNA polymerase is a high fidelity DNA polymerase.

5. The kit of claim 2, wherein the kit further comprises a single-stranded digestive enzyme.

6. The kit of claim 5, wherein the single stranded digestive enzyme is exonuclease I.