WO2011132890A2 - 바이오 에탄올 생산 향상용 형질전환체 및 그 균주를 이용한 에탄올 생성방법 - Google Patents
바이오 에탄올 생산 향상용 형질전환체 및 그 균주를 이용한 에탄올 생성방법 Download PDFInfo
- Publication number
- WO2011132890A2 WO2011132890A2 PCT/KR2011/002712 KR2011002712W WO2011132890A2 WO 2011132890 A2 WO2011132890 A2 WO 2011132890A2 KR 2011002712 W KR2011002712 W KR 2011002712W WO 2011132890 A2 WO2011132890 A2 WO 2011132890A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- glycerol
- transformant
- yeast
- fps1
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- SPPJRKXICASMOA-UHFFFAOYSA-N CCC(C)CON=O Chemical compound CCC(C)CON=O SPPJRKXICASMOA-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
- C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/06—Ethanol, i.e. non-beverage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/05—Oxidoreductases acting on the CH-OH group of donors (1.1) with a quinone or similar compound as acceptor (1.1.5)
- C12Y101/05003—Glycerol-3-phosphate dehydrogenase (1.1.5.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/0101—(2E,6E)-Farnesyl diphosphate synthase (2.5.1.10), i.e. geranyltranstransferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01029—Glycerone kinase (2.7.1.29), i.e. dihydroxyacetone kinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01006—Glycerol dehydrogenase (1.1.1.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01027—Erythritol kinase (2.7.1.27)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention inhibits glycerol production through deletion of the glycerol production gene of Saccharomyces cerevisiae , which has been engineered to use glycerol as a fermentation source, or bioethanol through overexpression of TATA binding protein SPT3 and 15.
- the present invention relates to a transformant having improved productivity and a method for producing ethanol using the transformant.
- Ethanol is currently forming a huge market as an industrial solvent, and the possibility of using it as a transport fuel for automobiles is becoming a reality, and demand for continuous increase is expected.
- Glycerol is a one-step reduced substance compared to glucose, which is C 6 H 12 O 6 with C 3 H 8 O 3 , which can provide improved reducing power in metabolic processes of microorganisms. Since many substances produced through fermentation often require reducing power in their metabolism, if glycerol can be effectively used as a substrate, the yield and productivity of the desired fermentation product can be improved. As the production of biodiesel has increased, the production of glycerol has increased, leading to a sharp drop in prices. As described above, as the production of biodiesel increases rapidly, the production of glycerol as a by-product increases, which may cause a problem of effectively treating by-products containing glycerol. Therefore, if glycerol can be used to effectively produce a useful fermentation product by fermentation can bring a number of side effects.
- the present inventors have reported a transformant with increased ethanol production capacity using glycerol in Saccharomyces cerevises (Yu et al. Bioresour Technol. 101 (11): 4157-61 (2010)).
- the study was carried out to improve the ethanol production capacity through the improvement of the strain developed to efficiently use the existing glycerol, the route of glycerol is produced as a by-product of about 10% in the production of ethanol in Saccharomyces cerevises By blocking the ethanol production was achieved.
- yeast strains such as S. cerevisiae, C. magnoliae, P. farinose, C. glycerinogens , bacteria such as B. subtilis and algae such as D. tertiolecta .
- microorganisms prepared by manipulating the glycerol biosynthetic pathway found in microorganisms known in the art as glycerol producing strains can be used.
- carbon substrates such as glucose are converted to glucose-6-phosphate by hexokinase in the presence of ATP.
- Glucose-6-phosphate is converted to fructose-6-phosphate by glucose-phosphate isomerase and again to fructose-1,6-diphosphate by the action of 6-phosphofructokinase.
- the diphosphate is converted to dihydroxyacetone phosphate (DHAP) by aldolase.
- DHAP dihydroxyacetone phosphate
- NADH-dependent glycerol-3-phosphate dehydrogenase converts DHAP to glycerol-3-phosphate (G3P), which in turn is dephosphorylated by glycerol-3-phosphate phosphatase to become glycerol (Hou J et al. Appl Microbiol Biotechnol. 85 (4): 1123-30. (2010).
- GPD1 has been known as a gene encoding glycerol-3-phosphate dehydrogenase which converts DHAP into glycerol-3-phosphate as a gene involved in the glycerol biosynthesis pathway of DHAP.
- GPP2 of Saccharomyces cerevisiae is also known as a gene encoding glycerol-3-phosphate phosphatase for converting glycerol-3-phosphate to glycerol.
- the glycerol production pathway in Saccharomyces cerevises is controlled by glycerol-3-phosphate dehydrogenase (gpd) in dihydroxyacetone phosphate (DHAP). After conversion to glycerol by glycerol-3-phosphate phosphatase in glycerol-3-phosphate and secreted extracellularly through the glycerol exocrine pathway Fps1 (Oliveira et al. Biochim Biophys Acta. 27; 1613 (1-2): 57-71 (2003).
- gpd glycerol-3-phosphate dehydrogenase
- DHAP dihydroxyacetone phosphate
- the glycerol production gene, glycerol-3-phosphate dehydrogenase2 and yeast glycerol channel Fps1 were used to increase ethanol production in transformants designed to use glycerol in Saccharomyces cerevisiae as a carbon source. It was also found that glycerol uptake protein (Gup1) helped restore osmotic pressure and increased ethanol production.
- the present inventors have developed a wide-ranging function of sigma factor to facilitate the whole-cell manipulation by similarly introducing several simultaneous gene expression changes by overexpressing the TATA conjugate protein.
- RNA polymerase II factors related to such eukaryotic cells can be widely applied to fungi, and RNA polymerase II factors related to such eukaryotic cells, especially when related to ethanol production.
- TATA binding protein SPT3,15
- SPT3,15 TATA binding protein
- the present invention solves the above problems, and the object of the present invention was devised by the necessity of the above is that the production of bioethanol by blocking the glycerol production path in yeast which is a production strain in the production of bioethanol when using glycerol as a fermentation source It is to provide a strain that has been improved to be augmented.
- Another object of the present invention is to provide a strain that has been improved so that the production of bio ethanol in yeast which is a production strain in the production of bio ethanol when using glycerol as a fermentation source.
- Another object of the present invention is to provide a method for producing the transformant.
- Still another object of the present invention is to provide a method for producing ethanol using the transformant.
- Another object of the present invention to provide a composition for producing ethanol comprising the transformant.
- the present invention is a plasmid lacking the genes of glycerol-3-phosphate dehydrogenase2 (FPS1) glycerol facilitator channel (FPS1) encoding the yeast glycerol channel FPS1 Provide a converter.
- FPS1 glycerol-3-phosphate dehydrogenase2
- FPS1 glycerol facilitator channel
- the glycerol-3-phosphate dehydrogenase 2 (glycerol-3-phosphate dehydrogenase) is preferably having an amino acid sequence of SEQ ID NO: 1, one of the proteins of SEQ ID NO: 1 Mutants having glycerol-3-phosphate dehydrogenase activity resulting from the above substitutions, deletions, additions, and the like, are also included in the glycerol-3-phosphate dehydrogenase of the present invention.
- the glycerol-3-phosphate dehydrogenase gene preferably has a nucleotide sequence set forth in SEQ ID NO: 2, the base described in SEQ ID NO: 2 in consideration of the degeneracy of the genetic code
- Genes having 80% homology with the sequence, preferably 85% homology, more preferably 90% homology, most preferably 95% homology, are also glycerol-3-phosphate dehydro of the present invention. Included in the genease gene.
- the FPS1 encoding the yeast glycerol channel Fps1 preferably has an amino acid sequence set forth in SEQ ID NO: 3, but one or more substitutions, deletions, additions, etc. to the protein set forth in SEQ ID NO: 3 Mutants with mutated glycerol facilitator channel activity are also included in the yeast glycerol channel of the present invention.
- the FPS1 gene encoding the yeast glycerol channel Fps1 preferably has the nucleotide sequence set forth in SEQ ID NO: 4, but is described in SEQ ID NO: 4 in consideration of the degeneracy of the genetic code Genes with 80% homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology with the nucleotide sequence are also included in the yeast glycerol channel gene of the present invention. do.
- the genetically deleted glycerol-3-phosphate dehydrogenase2 and yeast glycerol channel FPS1 are preferably yeast, more preferably Saccharomyces Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) is preferably derived from a microorganism, but not limited thereto.
- the transformant of the present invention is preferably derived from a microorganism of the genus Saccharomyces cerevisiae , but is not limited thereto.
- the present invention also provides a) a pPICZ having a cleavage map of FIG. 8 as a forward primer containing a sequence from the start codon of the yeast glycerol channel FPS1 up to 40 mer and a reverse primer containing the sequence from 1971 to the stop codon of the yeast glycerol channel FPS1.
- a PCR reaction using the vector diene as a template to obtain a PCR product including the start codon and the stop codon of the Fps1 gene; b) the start of glycerol-3-phosphate dehydrogenase2; The cleavage map of FIG.
- the forward primer including the gene from the start codon of the yeast glycerol channel FPS1 to 40 mer and the reverse primer containing the sequence from 1971 to the stop codon of the yeast glycerol channel FPS1, respectively, SEQ ID NO: 5 And the primers set forth in SEQ ID NO: 6, but are not limited thereto.
- Reverse primers containing the stop codon from 1324 of glycerol-3-phosphate dehydrogenase2 are preferably the primers set forth in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, but are not limited thereto.
- the present invention also provides a transformant comprising a glycerol dehydrogenase, a dihydroxyacetone kinase, and a glycerol uptake protein gene in the transformant of the present invention.
- the transformant is preferably yeast Saccharomyces cerevisiae YPH499 fps1 ⁇ gpd2 ⁇ (pGcyaDak, pGup1Cas) strain strain number KCCM11071P is not limited thereto.
- the present invention provides an expression vector pGcyaDakAdhPdc containing a gene encoding Saccharomyces cerevisiae pyruvate decarboxylase and a gene encoding alcohol dehydrogenase.
- the pyruvate decarboxylase (pyruvate decarboxylase) is preferably having an amino acid sequence of SEQ ID NO: 17, but one or more substitutions, deletions, additions, etc. mutations in the protein of SEQ ID NO: 17 Mutants with induced glycerol-3-phosphate dehydrogenase activity are also included in the pyruvic acid decarboxylic acid enzymes of the present invention.
- the gene encoding the pyruvate decarboxylase is preferably one having the nucleotide sequence of SEQ ID NO: 18, the sequence number in consideration of the degeneracy of the genetic code Genes having 80% homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology with the nucleotide sequence set forth in 18 are also used in the present invention. It is included in the acid enzyme gene.
- the alcohol dehydrogenase enzyme preferably has an amino acid sequence as set forth in SEQ ID NO: 19, but one or more substitutions, deletions, additions, etc. to the protein set forth in SEQ ID NO: 19 Mutants having the alcohol dehydrogenation activity which resulted from the mutation are also included in the enzyme of the present invention.
- the gene encoding the alcohol dehydrogenase enzyme preferably has a nucleotide sequence set forth in SEQ ID NO: 20, the sequence number in consideration of the degeneracy of the genetic code Genes having 80% homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology with the base sequence set forth in 20 are also alcohol dehydrogenation of the present invention. (alcohol dehydrogenase) is included in the gene encoding the enzyme.
- the expression vector is preferably an expression vector pGcyaDakAdhPdc having a cleavage map as described in FIG. 11, but is not limited thereto.
- the present invention is a gene encoding Saccharomyces cerevisiae pyruvate decarboxylase and a gene encoding alcohol dehydrogenase or Saccharomysis in the transformant of the present invention.
- a transformant further comprising an expression vector pGcyaDakAdhPdc containing a gene encoding a pyruvate decarboxylase and a gene encoding an alcohol dehydrogenase.
- the transformant of the present invention is preferably derived from a microorganism of the genus Saccharomyces cerevisiae , but is not limited thereto.
- the recombinant vector pGcyaDak, and pGupCas preferably has a cleavage map described in Figures 4 and 5, but is not limited thereto.
- the present invention contains a saccharide Roman Isis three Levy (hereinafter referred to, respectively 'SPT 3', 'SPT15' hereinafter) jiae SPT (S u p pressor of T y) 3 and SPT (S u p pressor of T y) 15 gene
- the expression vector pGupSpt3.15 is provided.
- the TATA binding protein SPT3 preferably has an amino acid sequence as set forth in SEQ ID NO: 25, but one or more substitutions, deletions, additions, etc., to the protein described in SEQ ID NO: 25 is a mutation having SPT3 activity. Sieves are also included in SPT3 of the present invention.
- the TATA binding protein SPT3 preferably has the nucleotide sequence set forth in SEQ ID NO: 26, but considering the degeneracy of the genetic code, the base sequence of SEQ ID NO: 26 and 80% of the phase Genes with homology, preferably 85% homology, more preferably 90% homology, most preferably 95% homology, are also included in the SPT3 gene of the present invention.
- the TATA binding protein SPT15 preferably has an amino acid sequence as set forth in SEQ ID NO: 27, but one or more substitutions, deletions, additions, etc. mutations are caused to the protein described in SEQ ID NO: 27. Mutants having TATA binding protein SPT15 activity are also included in the TATA binding protein SPT15 of the present invention.
- the TATA binding protein SPT15 preferably has the nucleotide sequence set forth in SEQ ID NO: 28, but in consideration of the degeneracy of the genetic code 80% of the nucleotide sequence set forth in SEQ ID NO: 28 Genes having homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology, are included in the TATA binding protein SPT15 gene of the present invention.
- the expression vector of the present invention preferably has a cleavage map described in Figure 14, but is not limited thereto.
- the present invention provides a transformant prepared by introducing the pGupSpt3.15 expression vector of the present invention into a transformant comprising a glycerol dehydrogenase, a dihydroxyacetone kinase, and a glycerol uptake protein gene,
- the transformant is preferably a transformant yeast Saccharomyces cerevisiae YPH499 (pGcyaDak, pGupSpt3.15Cas) having a strain accession number of KCCM 11153P, but is not limited thereto.
- the present invention also provides a method for producing ethanol comprising culturing the transformant of the present invention using glycerol as a substrate.
- the glycerol is preferably glycerol produced as a by-product of biodiesel, but is not limited thereto.
- the present invention also provides a composition for producing ethanol comprising the transformant of the present invention.
- the ethanol product composition of the present invention is a polypeptide suitable for producing ethanol based on glycerol by culturing the transformant, for example. , Broths, cell lysates, purified or unpurified enzyme extracts or polypeptides, and the like.
- the expression vector for example, YEp13, YCp50, pRS-based, pYEX-based vectors and the like can be used.
- a promoter a GAL promoter, an AOD promoter, etc. can be used, for example.
- a method of introducing recombinant DNA into yeast for example, the electroporation method (Method Enzymol., 194, 182-187 (1990)), the spheroplast method (Proc. Natl. Acad. Sci. USA, 84, 1929-1933 (1978)), lithium acetate method (J. Bacteriol., 153, 163-168 (1983)), and the like.
- fragments for suppressing expression having various functions for suppressing or amplifying or inducing expression, markers for selection of transformants, resistance genes against antibiotics, or secreted out of the cells It is also possible to have a gene for encoding a signal for the purpose of.
- any conventional method used for culturing a host may be used.
- any method used for culturing ordinary microorganisms such as batch type, flow batch type, continuous culture, and reactor type, can be used.
- Transformants obtained by using bacteria such as Escherichia coli as a host As a medium for culturing, medium or synthetic medium, for example, LB medium, NB medium and the like can be given.
- the culture temperature is culturing in the above-mentioned temperature range to accumulate glycerol dehydrogenase and dihydroxyacetone kinase or glycerol uptake protein in the cells, and recover do.
- the carbon source is required for the growth of microorganisms, and for example, sugars such as glucose, fructose, sucrose, maltose, galactose, and starch; Lower alcohols such as ethanol, propanol and butanol; Polyhydric alcohols such as glycerol; Organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid and dodecanoic acid can be used.
- sugars such as glucose, fructose, sucrose, maltose, galactose, and starch
- Lower alcohols such as ethanol, propanol and butanol
- Polyhydric alcohols such as glycerol
- Organic acids
- nitrogen source examples include ammonium salts such as ammonia, ammonium chloride, ammonium sulfate, and ammonium phosphate, as well as those derived from natural products such as peptone, meat juice, yeast extract, malt extract, caseinate and corn steep liquor.
- ammonium salts such as ammonia, ammonium chloride, ammonium sulfate, and ammonium phosphate
- those derived from natural products such as peptone, meat juice, yeast extract, malt extract, caseinate and corn steep liquor.
- 1 potassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, etc. are mentioned, for example.
- antibiotics such as kanamycin, ampicillin, tetracycline, chloramphenicol, and streptomycin, to a culture liquid.
- an inducer suitable for the type of promoter may be added to the medium.
- an inducer suitable for the type of promoter may be added to the medium.
- IPTG isopropyl- (beta) -D-thiogalactopyranoside
- IAA indole acrylic acid
- Glycerol dehydrogenase and dihydroxyacetone kinase or glycerol uptake protein can be obtained by centrifuging the cells or supernatants from the cultures to obtain cell disruption. , Extraction, affinity chromatography, cation or anion exchange chromatography, gel filtration or the like can be carried out alone or in a suitable combination.
- Confirmation that the obtained purified substance is the target enzyme can be performed by a conventional method, for example, SDS-polyacrylamide gel electrophoresis, western blotting or the like.
- the present invention is a transformant with improved production capacity of bio ethanol as a byproduct by inhibiting glycerol production by-product through the deletion of the glycerol production gene of Saccharomyces cerevisiae , which has been manipulated to use glycerol as a fermentation source.
- the present invention relates to a method for producing ethanol using the transformant, and more specifically, glycerol-3-phosphate dehydrogenase 2, a synthetic pathway of glycerol produced by Saccharomyces cerevisiae .
- the present invention relates to a yeast transformant having a reduced glycerol production and a relatively improved ethanol production ability by deleting a gene of FPS1 encoding the yeast glycerol channel Fps1p and a method of increasing ethanol production using these.
- the glycerol uptake protein derived from Saccharomyces cerevisiae microorganism of the present invention is an enzyme that helps to have permeability and resistance to osmotic pressure against glycerol, and glycerol as a fermentation source in a strain that inhibits glycerol production ability. When used, it can help to be resistant to osmotic pressure.
- a yeast transformant that inhibits the production of glycerol produced from Saccharomyces cerevisiae microorganism prepared to use glycerol as a carbon source according to the present invention can be usefully used in the process.
- the yeast transformant which lacked the gene produced more ethanol than the yeast strain that did not.
- the glycerol production pathway in Saccharomyces cerevises is controlled by glycerol-3-phosphate dehydrogenase (gpd) in dihydroxyacetone phosphate (DHAP). After conversion to glycerol is converted to glycerol by glycerol-3-phosphate phosphatase in glycerol-3-phosphate and secreted extracellularly through the glycerol exocrine pathway Fps1.
- ethanol production was increased by deficiency of glycerol-3-phosphate dehydrogenase and yeast glycerol channel Fps1 gene in strains engineered to use glycerol as a carbon source.
- 1.5kb of PCR was carried out using a pPICZ vector diene as a template using a primer containing the genes from the start codon of Fps1 to 40mer in the forward and a primer containing the stop codon of Fps1 in the reverse.
- a product was obtained, and a Fps1 gene-deficient strain was prepared by homologous recombination of the obtained gene PCR product having zeocin resistance into yeast.
- a 1.5kb PCR product was obtained by PCR using pET28a vector diene as a template using primers containing genes from Gpd2 start codon to 40mer in the forward and primers containing Gpd2 stop codon in reverse.
- Fps1 and Gpd2 gene-deficient strains were prepared by homologous recombination of gene PCR products having resistance to yeast. Thereafter, yeast host cells were transformed using a recombinant vector in which both Gcy and Dak were inserted. Subsequently, the yeast-integration vector was constructed for the gene insertion of Gup1, and the gene was inserted into Saccharomyces cerevisiae. Ethanol production using glycerol of the protein expressed from the gene was investigated.
- yeast Saccharomyces cerevisiae in order to increase ethanol production using glycerol in a representative ethanol producing strain, yeast Saccharomyces cerevisiae , the present inventors derived glycerol-3-phosphate dehydrogenase 2 derived from Saccharomyces cerevisiae .
- yeast transformant was developed and deposited with the Korea Microorganism Conservation Center (KCCM), Yurim Building, Hongje 1-dong, Seodaemun-gu, Seoul, Korea, on March 10, 2010 with the deposit number KCCM11071P.
- KCCM Korea Microorganism Conservation Center
- the present invention was completed by confirming that the yeast transformant efficiently uses glycerol as a carbon source to increase ethanol production.
- glycerol-3-phosphate dehydrogenase which is involved in the glycerol production pathway in Saccharomyces cerevises, and the gene of Fps1, a glycerol exocrine pathway, are deleted, resulting in increased ethanol production.
- Increased ethanol production was increased by overexpression of pyruvate decarboxylase and alcohol dehydrogenase.
- PCR products of PDC1 and ADH1 were obtained by 1.6 and 1.0 kb, respectively, by PCR reactions with Saccharomyces cerevisiae, and the resulting PCR products were cloned into the pGcyaDak gene and transformed into yeast.
- Strains with increased ethanol production capacity were prepared by inserting the strains that blocked the glycerol production pathway, and then constructed into yeast-integration vector for the gene insertion of Gup1. Gene was inserted into Levi's. Ethanol production using glycerol of the protein expressed from the gene was investigated.
- yeast Saccharomyces cerevisiae in order to increase the production of ethanol using glycerol in a representative ethanol producing strain, yeast Saccharomyces cerevisiae , the present inventors derived pyruvate decarboxylase derived from Saccharomyces cerevisiae .
- yeast transformants were overexpressed and transformed into strains with blocked glycerol production pathways, and the Korea Microorganism Conservation Center (KCCM), Yurim Building, Hongje 1-dong, Seodaemun-gu, Seoul, Korea Was deposited on December 17, 2010 under Saccharomyces cerevisiae YPH499 fps1 ⁇ gpd2 ⁇ (p GcyaDakAdhPdc , p GupCas ) accession number KCCM11152P.
- the yeast transformant efficiently used glycerol as a carbon source to produce ethanol. By seeing that it increases efficiently The completion of the person.
- the glycerol production gene, glycerol-3-phosphate dehydrogenase2 and yeast glycerol channel Fps1 were used to increase ethanol production in transformants designed to use glycerol in Saccharomyces cerevisiae as a carbon source.
- a transformant using a gene encoding pyruvate decarboxylase and alcohol dehydrogenase was used, and ethanol production was increased.
- the present invention provides a transformant and its transformant having improved bioethanol production ability through overexpression of SPT3 and SPT3, which are TATA binding proteins of Saccharomyces cerevisiae , which have been manipulated to use glycerol as a fermentation source.
- the present invention relates to a method for producing ethanol, and more particularly, to improve ethanol production ability and resistance to osmotic pressure in transformants prepared to use glycerol as a fermentation source, yeast in Saccharomyces cerevisiae .
- the present invention relates to a transformant having improved ethanol production ability through overexpression of RNA polymerase factors such as TATA binding proteins, SPT3 and SPT15, and a method for increasing ethanol production using them.
- Glycerol was added to this strain with increased ethanol production capacity by increasing the resistance to ethanol production and osmotic pressure through overexpression of the TATA binding proteins SPT3 and SPT15 encoding genes derived from Saccharomyces cerevisiae microorganism of the present invention.
- the gene to be used efficiently it was confirmed that the ethanol production capacity is increased compared to the existing transformants.
- a yeast transformant that inhibits the production of glycerol produced from Saccharomyces cerevisiae microorganism prepared to use glycerol as a carbon source according to the present invention can be usefully used in the process.
- the gene-inserted yeast transformant produced a greater amount of ethanol than the yeast strain that was not.
- the PCR products of SPT3 and SPT15 were respectively obtained 1.0 kb and 0.7 kb by PCR using Saccharomyces cerevisiae as a template, and the TATA binding protein SPT3, SPT15 overexpressing strains were prepared. Thereafter, yeast host cells were transformed using a recombinant vector in which both Gcy and Dak were inserted. Subsequently, the yeast-integration vector was constructed for the gene insertion of Gup1, and the gene was inserted into Saccharomyces cerevisiae. Ethanol production using glycerol of the protein expressed from the gene was investigated.
- yeast transformant was developed and deposited in the Korea Microorganism Conservation Center (KCCM), Yurim Building, Hongje 1-dong, Seodaemun-gu, Seoul, Korea on December 17, 2010 with the deposit number KCCM11153P.
- KCCM Korea Microorganism Conservation Center
- glycerol-3-phosphate dehydrogenase derived from microorganisms of the genus Saccharomyces cerevisiae and glycerol exocrine pathway
- yeast glycerol Glycerol production was inhibited through gene deletion of channel Fps1, and glycerol uptake protein was applied to the transformants into which the glycerol dehydrogenase and dihydroxyacetone kinase genes were introduced.
- the recombinant vector inserted into the gene was introduced into the yeast strain. Then, it was confirmed that the ethanol production yield is higher than the yeast strain.
- Yeast transformants produced by blocking glycerol production genes in strains engineered to use glycerol as a carbon source according to the present invention can produce a large amount of ethanol using glycerol produced as a by-product of biodiesel, which is very useful. It is expected to be an invention.
- ethanol production was enhanced through overexpression of pyruvate decarboxylase and alcohol dehydrogenase, and these genes inhibited glycerol production through the gene deletion of gpd2 and Fps1, and also glycerol dehydrogenase and dihydroxy.
- Ethanol production compared to yeast strains containing no pyruvate decarboxylase and alcohol dehydrogenase, as a result of the introduction of the glycerol uptake protein into the transformant into which the acetone kinase gene was introduced. It was confirmed that the yield was higher.
- Figure 1 shows a PCR product for the identification of a homology arm for gene deletion of glycerol-3-phosphate dehydrogenase2 and FPS1 by performing agarose gel electrophoresis in the present invention
- Lane 1, 1 kb DNA marker Fps1 homology arms were formed at 5 'and 3' of the Zeocin-resistant gene for the deletion of Lane 2, Fps1, and Gpd2 homology arms at 5 'and 3' of the Kanamycin resistance gene for the deletion of Lane 3, Gpd2.
- the figure which confirmed that it formed was shown.
- Figure 2 is a schematic diagram showing a gene deletion method of glycerol-3-phosphate dehydrogenase2 and FPS1 presented in the present invention.
- Figure 3 (A) is a figure confirming the PCR product of the glycerol dehydrogenase gene by performing agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; Lane 2, Gcy PCR product, Figure 3 (B) is a figure confirming the PCR product of the dihydroxyacetone kinase gene by agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; Lane 2, Dak PCR product, Figure 3 (C) is a figure confirming the PCR product of the glycerol uptake protein gene by performing agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; Lane 2, Gup PCR product.
- FIG. 4 is a schematic diagram showing the recombination process of the recombinant vector pGcyaDak in which the glycerol dehydrogenase gene and the dihydroxyacetone kinase gene presented in the present invention are inserted in both directions.
- FIG. 5 is a schematic diagram showing the recombination process of the recombinant vector pGup constructed for the gene insertion of the glycerol uptake protein presented in the present invention.
- Figure 6 is a picture showing the effect on the osmotic pressure of the gene deletion strain YPH499fps1 ⁇ gpd2 ⁇ presented in the present invention by the osmotic pressure by the inserted pGup1cas.
- the medium used in FIG. 6 is (A) a medium containing glycerol as a carbon source (B) a medium in which 1 M NaCl, 10 mM glycerol was added to a YPD medium.
- Lane1 YPH499 (pESC-TRP), lane2, YPH499fps1 ⁇ gpd2 (pESC-TRP), lane3, YPH499fps1 ⁇ gpd2 (pGcyaDak), lane4, YPH499fps1 ⁇ gpd2 ⁇ (pGcyaDak, pGupCas).
- Figure 7 is a graph confirming the production of ethanol production is increased by transforming the recombinant vector pGcyaDak, pGup to the gene-deficient strain presented in the present invention glycerol as a substrate.
- the symbol is squares, YPH499 (pGcyaDak, pGupCas)
- FIG. 9 shows a cleavage map of the pET28a vector.
- FIG. 10 is a diagram showing the gene encoding the pyruvate decarboxylase and alcohol dehydrogenase by performing agarose gel electrophoresis in the present invention, Lane 1, 1kb DNA marker; The following figure shows the lane 2, PDC1, lane 3, and ADH1 genes.
- FIG. 11 shows a gene of the pyruvate decarboxylase and the alcohol dehydrogenase of the present invention, a recombinant vector pGcyaDak in which a glycerol dehydrogenase gene and a dihydroxyacetone kinase gene are inserted in both directions.
- the schematic diagram which shows the recombination process to insert is shown.
- FIG. 12 is a graph confirming that the recombinant vector pGcyaDakAdhPdc, pGup in the gene-deficient strains presented in the present invention produces ethanol production by using glycerol as a substrate.
- the symbol is black ⁇ , YPH499 (pESC-TRP); blue ⁇ , Saccharomyces cerevisiae YPH499 fps1 ⁇ gpd2 ⁇ (pGcyaDak, pGupCas); red ⁇ , Saccharomyces cerevisiae YPH499 fps1 ⁇ gpd2 ⁇ (p GcyaDakAdhPdc , p GupCas ).
- FIG. 13 is a diagram illustrating PCR products for gene identification of TATA binding proteins SPT3 and SPT15 by agarose gel electrophoresis in the present invention, Lane 1, 1 kb DNA marker; Lane 2, SPT3, shows the picture identifying Lane 3, SPT15.
- FIG. 14 is a schematic diagram showing the recombination process of the recombinant vector pGupSpt3.15Cas in which the TATA binding proteins SPT3 and SPT15 are glycerol uptake protein genes inserted into the recombinant recombinant vector pGup.
- 15 is a schematic diagram showing the recombination process of the recombinant vector pGcyaDak in which the glycerol dehydrogenase gene and the dihydroxyacetone kinase gene presented in the present invention are inserted in both directions.
- FIG. 16 is a graph showing that ethanol production is increased by transforming pGcyaDak into an overexpression vector of the TATA binding proteins SPT3 and SPT15 presented in the present invention using glycerol as a substrate.
- the symbols are ⁇ , YPH499 (pESC-TRP); YPH499 (p GcyaDak , pGupCas ); ⁇ , YPH499 (p GcyaDak , pGupSpt3Cas ); X, YPH499 (p GcyaDak , pGupSpt3.15Cas ).
- Example 1 Deletion of Glycerol-3-phosphate dehydrogenase 2 (gpd2), Yeast Glycerol Channel Fps1 Gene in Yeast
- Glycerol-3-phosphate dehydrogenase2 (gpd2) for the blocking of the production pathway of glycerol, for the deletion of the yeast glycerol channel Fps1 gene forward (5-atgagtaatcctcaaaaagctctaaacgactgagccatattcaacgg
- Each PCR product was added to yeast YPH499 ( MAT a ura3-52lys2-801_amberade2-101_ochretrp1- ⁇ 63his3- ⁇ 200leu2- ⁇ 1 by adding a gene having Kanamycin resistance and a region having a similarity to Gpd2 at 5 'and 3'.
- yeast YPH499 MAT a ura3-52lys2-801_amberade2-101_ochretrp1- ⁇ 63his3- ⁇ 200leu2- ⁇ 1 by adding a gene having Kanamycin resistance and a region having a similarity to Gpd2 at 5 'and 3'.
- Fps1 and Gpd2 gene deletion strains were prepared by homologous recombination.
- the gene-deficient strains were selected using YPD medium (1% yeast extract, 2% Bacto peptone, and 2% glucose, 2% agar) containing Zeocin and Kanamycin, and PCR band and gene deletion method for gene deletion. Are shown in FIGS. 1 and 2, respectively. This was named Saccharomyces cerevisiae YPH499 fps1 ⁇ gpd2 ⁇ .
- ttttaggtaaattccgtg-3; SEQ ID NO: 14) was designed and synthesized primers to insert each recognition sequence. Then, PCR was performed using the synthesized primers. As a result, PCR bands of 936bp, 1755bp and 1683bp could be confirmed, respectively, and are shown in FIG. 3.
- the amplification product obtained in Example 1 was electrophoresed on a 0.8% agarose gel and DNA fragments on the agarose gel were recovered using a Biospin gel extraction kit (Bioflux).
- E. coli shuttle vectors yeast- E. coli shuttle vector
- ligation E. coli ( E. coli ) DH5a was transformed.
- the ligation of recombinant plasmid DNA was then isolated from the transformants.
- the recombinant vectors were named pESC-Gcy, pESC-Dak, and pESC-Gup, respectively.
- Dak was cloned using pESC-Gcy as a vector to transform Escherichia coli DH5a (Invitrogen).
- the recombinant plasmid DNA ligated from the transformant was isolated.
- the recombinant vector was pGcyaDak. It was named and shown in Fig. 4. Also, to include the BamH 1 recognition sequence for gene insertion of pESC-Gup1, a sense primer (5-ggatccatgt cagcattttaggtaaattccgtg-3; SEQ ID NO: 15) and an anti-sence primer (5-ggatccataatgtcgctgatcagcatcctg tct- 3; sequence number 16) was cloned into YIP-5, a yeast integration vector, and the gene was inserted into genomic DNA of Saccharomyces cerevisiae.
- Peptide bases from Saccharomyces cerevisiae's genomic DNA BY4741
- clone genes for increased ethanol production through overexpression of PDC1 and ADH1 two key enzymes that act for the conversion of pyruvic acid to ethanol.
- Pst (5- ctgcagatga gttatactgt cggtacctat-3; SEQ ID NO: 21), Sph (5- ttcggacaat tgttcgagga gatccgtacg-3; SEQ ID NO: 22 ), and ADH for the cloning of the PDC with reference to the sequence, Xba (5- tctagaatgg cttcttcaac tttttatatt- 3; SEQ ID NO: 23) , Sal (5- cttgagaagg actcgcgaaa gattcagctg-3; SEQ ID NO: 24) by primers were designed to insert each recognition sequence was synthesized. Then, PCR was performed using the synthesized primers. As a result, PCR bands of 1.6 kb and 1.0 kb, respectively, could be confirmed and shown in FIG. 10.
- Example 3-1 The amplification product obtained in Example 3-1 was electrophoresed on 0.8% agarose gel and DNA fragments on agarose gel were recovered using a Biospin gel extraction kit (Bioflux).
- PDC1 was cut with Pst, Sph ADH1 with Xba and Sal , and then with each restriction enzyme, and the genes of glycerol dehydrogenase and dihydroxyacetone kinase were bidirectionally inserted.
- E. coli DH5a (Invitrogen) was transformed by ligation to pGcyaDak. The recombinant plasmid DNA ligation was isolated from the transformants.
- p GupCas pGcyaDakAdhPdc was named and illustrated in FIG.
- tryptophan-deficient SD medium 0.67% yeast nitrogen base, 2 % glucose, 0.067% yeast nigrogen base w / o trp, 2% agar
- this saccharide Roman Isis three Levy jiae YPH499 fps1 ⁇ gpd2 ⁇ (pGcyaDakAdhPdc, pGupCas).
- Example 4-1 The amplification product obtained in Example 4-1 was electrophoresed on 0.8% agarose gel and DNA fragments on agarose gel were recovered using a Biospin gel extraction kit (Bioflux).
- SPT3 was digested with Spe Dak with Bgl and then with restriction enzymes Spe1 and Bgl and then ligated to pGup1 into which the glycerol uptake protein was inserted.E. Coli DH5a (Invitrogen) Then, the recombinant plasmid DNA ligated from the transformant was isolated, and the recombinant vectors were named pGupSpt3 and pGupSpt3.15, respectively, and are shown in FIG.
- pGupSpt3.15 BamH 1 A sense primer (5-ggatccatgt cagcattttaggtaaattccgtg-3; SEQ ID NO: 15) and an anti-sence primer (5-ggatccataatgtcgctgatcagcatcctg tct-3; SEQ ID NO: 16) were constructed to include the recognition sequence, which is a yeast integration vector. It was cloned into YIP-5 (ATCC) and named it pGupSpt3.15Cas, and it was diagrammed in FIG.
- the recombinant vector pGupSpt3.15Cas was transformed into a yeast host cell according to the experimental method provided by Clontech's EastMaker yeast transformation kit2 to a wild type strain (YPH499, Clontech Laboratories Inc.). I was. Subsequently, the transformants were selected using tryptophan deficient SD medium (0.67% yeast nitrogen base, 2% glucose, 0.067% yeast nigrogen base w / o trp, 2% agar). (pGcyaDak, pGupSpt3.Spt15Cas).
- YPH499 fps1 ⁇ gpd2 (pGcyaDak, pGupCas) and YPH499 (pGcyaDak, pGupCas) prepared in Example 2 were added to the substrate by shaking culture for 24 hours after incubation for 24 hours in SG medium induced by galactose expression.
- the absorbance is measured at 600nm wavelength in the fermented broth, it should be 1 each.
- the fermentation broth was incubated at 30 ° C. and 100 rpm, and the ethanol produced was measured by performing gas chromatography by taking a culture solution at a predetermined time.
- the method according to the execution result of glycerol-3-phosphate dehydrogenase and the second yeast gene is glycerol channel Fps1 been deficient YPH499 fps1 gpd2 ⁇ ⁇ (pGcyaDak, pGupCas) ethanol yield is higher than the measured YPH499 (pGcyaDak, pGupCas) in the It became. This result is shown in FIG.
- YPH499 (pGcyaDak, pGupCas) and YPH499 (pGcyaDak, pGupSpt3.15Cas) prepared in Example 4 were incubated for 24 hours after incubation for 24 hours in SG medium induced by galactose expression, and 2% of glycerol was added as a substrate.
- absorbance is measured at 600nm wavelength in fermentation broth, it should be 1 each.
- the fermentation broth was incubated at 30 ° C. and 100 rpm, and the ethanol produced was measured by performing gas chromatography by taking a culture solution at a predetermined time.
- the yield of ethanol was higher than that of YPH499 (pGcyaDak, pGupCas). This result is shown in FIG.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 글리세롤을 발효원으로 이용하도록 조작되어진 사카로마이세스 세레비지애 (Saccharomyces cerevisiae)의 글리세롤 생산 유전자의 결손을 통하여 글리세롤 생산을 저해시키거나, TATA 결합단백질 SPT3와 15의 과발현을 통하여 바이오 에탄올 생산능이 향상된 형질전환체 및 그 형질전환체를 이용한 에탄올 생산방법에 관한 것이다.
Description
본 발명은 글리세롤을 발효원으로 이용하도록 조작되어진 사카로마이세스 세레비지애 (Saccharomyces cerevisiae)의 글리세롤 생산 유전자의 결손을 통하여 글리세롤 생산을 저해시키거나, TATA 결합단백질 SPT3와 15의 과발현을 통하여 바이오 에탄올 생산능이 향상된 형질전환체 및 그 형질전환체를 이용한 에탄올 생산방법에 관한 것이다.
에탄올은 현재 산업 용매로써 거대한 시장을 형성하고 있으며, 앞으로 자동차 등의 수송연료로 사용 가능성이 현실화되고 있어 계속적인 수요 증가가 예상되고 있다.
글리세롤은 C3H8O3로 C6H12O6인 글루코오스 (glucose)에 비하여 1단계 환원된 물질로서 미생물의 대사 과정에서 보다 향상된 환원력을 제공할 수 있다. 발효를 통하여 생산되는 많은 물질이 그 대사과정에서 환원력을 요구하는 경우가 많기 때문에 글리세롤을 기질로 효과적으로 이용할 수 있다면, 원하는 발효산물의 수율 및 생산성의 향상을 가져 올 수 있다. 현재 바이오 디젤의 생산량이 늘어남에 따라 글리세롤의 생산량 늘어났기 때문에 가격이 급격히 하락하고 있는 실정이다. 상기한 바와 같이 바이오디젤의 생산량이 급증함에 따라, 부산물인 글리세롤의 생산도 늘어나 글리세롤을 포함하고 있는 부산물을 효과적으로 처리하는 문제가 발생할 것이다. 따라서 글리세롤을 이용하여 효과적으로 발효에 의해 유용한 발효산물을 생산할 수 있다면 많은 부속 효과를 가져 올 수 있다.
본 발명자들에서 의하여 사카로마이세스 세레비제에서의 글리세롤을 이용한 에탄올 생산능이 증대된 형질전환체가 보고되었다 (Yu et al. Bioresour Technol. 101(11):4157-61(2010)). 상기 연구는 기존의 글리세롤을 효율적으로 이용하도록 개발되어진 균주의 개량을 통한 에탄올 생산능의 증대를 위하여 사카로마이세스 세레비제에서의 에탄올 생산 시 약 10%정도의 부산물로 생산이 되어지는 글리세롤의 경로를 차단함으로써 에탄올 생산능의 증대를 이루었다.
미생물에 의한 글리세롤의 생산에는 S. cerevisiae, C. magnoliae, P. farinose, C. glycerinogens와 같은 효모 균주, B. subtilis 와 같은 박테리아 및 D. tertiolecta와 같은 조류가 생산 균주로 알려져 있다. 글리세롤 생산 균주로 종래에 알려진 미생물에서 발견된 글리세롤 생합성 경로를 조작하여 재조되는 미생물을 사용할 수 있음이 알려져 있다. 일반적으로, 포도당과 같은 탄소 기질은 ATP의 존재하의 헥소키나제에 의하여 글루코즈-6-포스페이트로 전환된다. 글루코즈-6-포스페이트는 글루코즈-포스페이트 이소머라제에 의하여 프럭토즈-6-포스페이트로 전환되고, 다시 6-포스포프럭토키나제의 작용에 의하여 프럭토즈-1,6-디포스페이트로 전환된다. 상기 디포스페이트는 알돌레이즈에 의하여 디히드록시아세톤 포스페이트(DHAP)로 된다. 최종적으로 NADH-의존성글리세롤-3-포스페이트 디히드로게나제가 DHAP를 글리세롤-3-포스페이트(G3P)로 전환시키고, G3P는 다시 글리세롤-3-포스페이트 포스파타제에 의하여 탈인산화되어 글리세롤로 된다 (Hou J et al. Appl Microbiol Biotechnol. 85(4):1123-30.(2010)).
종래 디히드로게나제가 DHAP를의 글리세롤 생합성 경로에 관여하는 유전자로서 DHAP를 글리세롤-3-포스페이트로 전환시키는 글리세롤-3-포스페이트 디히드로게나제를 코딩하는 유전자로서 GPD1이 알려져 있었다. 또한, 글리세롤-3-포스페이트를 글리세롤로 전환시키는 글리세롤-3-포스페이트 포스파타제를 코딩하는 유전자로서 사카로마이세스 세레비지애의 GPP2가 알려져 있다.
사카로마이세스 세레비제에서의 글리세롤 생산 경로는 디히드록시아세톤포스페이트 (dihydroxyacetone phosphate, DHAP) 에서 글리세롤-3-포스페이트 디히드로게나제 (glycerol-3-phosphate dehydrogenase, gpd)에 의하여 글리세롤-3-포스페이트로 전환된 후, 글리세롤-3-포스페이트에서의 글리세롤-3-포스페이트 포스파타제 (glycerol-3-phosphate phosphatase) 에 의하여 글리세롤로 전환되어지며 글리세롤 외분비 통로인 Fps1을 통하여 세포외부로 분비되어진다 (Oliveira et al. Biochim Biophys Acta. 27;1613(1-2):57-71(2003)).
본 발명에서는 사카로마이세스 세레비지애에서의 글리세롤을 탄소원으로 이용하도록 제작되어진 형질전환체에서의 에탄올 생산 증대를 위하여 글리세롤 생산 유전자, 글리세롤-3-포스페이트 디히드로게나제2 와 효모 글리세롤 채널 Fps1을 결손시켰으며 또한 글리세롤 업테이크 프로테인 (Gup1)이 삼투압에 대한 회복을 돕는다는 것을 확인하였으며 에탄올 생산량 증대를 이루었다.
또한 본 발명자들은 TATA 접합 단백질을 과발현 함으로써 여러 동시 유전자 발현 변화를 유사하게 도입하여 전세포 조작을 용이하게 하기 위한 시그마 인자의 광역 조절 기능을 개발하였다.
특히 에탄올 생성과 관계된 경우 진균, 및 그러한 진핵 세포에 관련된 RNA 폴리머라제 II 인자에 대해 광범위하게 적용될 수 있다. 표현형 특성, 특히 배양 배지에서 글리세롤(및 다른 당) 및/또는 에탄올의 내성, 및/또는 당업계에 공지된 다양한 공급원료로부터 세포에 의한 에탄올 생성의 개선을 위한, 다른 진핵 세포 및 이러한 세포의 상응하는 광역 전사 기구의 용도를 포함할 수 있다.
따라서 본 발명에서는 사카로마이세스 세레비지애에서의 글리세롤을 탄소원으로 이용하도록 제작되어진 형질전환체에서의 에탄올 생산 증대를 위하여 TATA 결합 단백질(SPT3,15)를 과 발현 하여 에탄올 생산량 증대를 이루었다.
본 발명은 상기의 문제점을 해결하고, 상기의 필요성에 의하여 안출된 것으로서 본 발명의 목적은 글리세롤을 발효원으로 이용시 바이오 에탄올 제조에 있어서 생산균주인 효모에서의 글리세롤 생산 경로를 차단하여 바이오에탄올 생산량이 증대될 수 있도록 개량되어진 균주를 제공하는 것이다.
본 발명의 또 다른 목적은 글리세롤을 발효원으로 이용시 바이오 에탄올 제조에 있어서 생산균주인 효모에서 바이오에탄올 생산량이 증대될 수 있도록 개량되어진 균주를 제공하는 것이다.
본 발명의 다른 목적은 상기 형질전환체를 제조하는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 형질전환체를 이용한 에탄올 생산방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 형질전환체를 포함하는 에탄올 생성용 조성물을 제공하는 것이다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 효모 글리세롤 채널 FPS1을 인코딩하는 FPS1 (glycerol facilitator channel)의 유전자가 결손된 형질전환체를 제공한다.
본 발명의 일 구체예에 있어서, 상기 글리세롤-3-포스페이트 디히드로게나제 2 (glycerol-3-phosphate dehydrogenase)는 서열번호 1에 기재된 아미노산 서열을 가지는 것이 바람직하나, 서열번호 1에 기재된 단백질에 하나 이상의 치환, 결손, 부가 등의 돌연변이가 유발된 글리세롤-3-포스페이트 디히드로게나제 활성을 가진 돌연변이체도 본 발명의 글리세롤-3-포스페이트 디히드로게나제에 포함된다.
본 발명의 일 구체예에 있어서, 상기 글리세롤-3-포스페이트 디히드로게나제 유전자는 서열번호 2에 기재된 염기 서열을 가지는 것이 바람직하나, 유전자 코드의 디제너러시를 고려하여 상기 서열번호 2에 기재된 염기서열과 80%의 상동성, 바람직하게는 85%의 상동성, 더욱 바람직하게는 90%의 상동성, 가장 바람직하게는 95%의 상동성을 가지는 유전자도 본 발명의 글리세롤-3-포스페이트 디히드로게나제 유전자에 포함된다.
본 발명의 또 다른 일 구체예에 있어서, 상기 효모 글리세롤 채널 Fps1을 인코딩하는 FPS1은 서열번호 3에 기재된 아미노산 서열을 가지는 것이 바람직하나, 서열번호 3에 기재된 단백질에 하나 이상의 치환, 결손, 부가 등의 돌연변이가 유발된 글리세롤 파실리테이터 채널 활성을 가진 돌연변이체도 본 발명의 효모 글리세롤 채널에 포함된다.
본 발명의 또 다른 일 구체예에 있어서, 상기 효모 글리세롤 채널 Fps1을 인코딩하는 FPS1유전자는 서열번호 4에 기재된 염기 서열을 가지는 것이 바람직하나, 유전자 코드의 디제너러시를 고려하여 상기 서열번호 4에 기재된 염기서열과 80%의 상동성, 바람직하게는 85%의 상동성, 더욱 바람직하게는 90%의 상동성, 가장 바람직하게는 95%의 상동성을 가지는 유전자도 본 발명의 효모 글리세롤 채널 유전자에 포함된다.
본 발명의 일 구체예에 있어서, 상기 유전자 결손된 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 효모 글리세롤 채널 FPS1은 바람직하게는 효모, 더욱 바람직하게는 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 속 미생물 유래인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 형질전환체는 효모, 바람직하게는 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 속 미생물 유래인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 a) 효모 글리세롤 채널 FPS1의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 효모 글리세롤 채널 FPS1의 1971에서 스탑 코돈까지의 서열이 포함된 리버스 프라이머로 도 8의 개열지도를 가지는 pPICZ 벡터 디엔에이를 주형으로 하여 PCR반응을 수행하여 Fps1 유전자의 시작 코돈과 스탑 코돈이 포함된 PCR 산물을 얻는 단계;b) 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 1324에서 스탑 코돈까지의 서열이 포함된 리버스 프라이머로 도 9의 개열지도를 가지는 pET28a 벡터 디엔에이를 주형으로 한 PCR반응을 통하여 PCR 산물을 얻는 단계; 및 c) 상기 각각의 PCR 산물을 효모에 상동 재조합(homologous recombination) 하는 단계를 포함하는 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 효모 글리세롤 채널 FPS1을 인코딩하는 FPS1 (glycerol facilitator channel) 유전자가 결손된 형질전환체 제조방법을 제공한다.
본 발명의 일 구체예에 있어서, 상기 효모 글리세롤 채널 FPS1의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 효모 글리세롤 채널 FPS1의 1971에서 스탑 코돈까지의 서열이 포함된 리버스 프라이머는 각각 서열번호 5와 서열번호 6에 기재된 프라이머인 것이 바람직하나 이에 한정되지 아니하고,상기 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 1324에서부터 스탑 코돈이 포함된 리버스 프라이머는 각각 서열번호 7 및 서열번호 8에 기재된 프라이머인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 상기 본 발명의 형질전환체에 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제, 및 글리세롤 업테이크 프로테인 유전자를 추가로 포함하는 형질전환체를 제공한다.
본 발명의 바람직한 구체예에 있어서, 상기 형질전환체는 균주 기탁번호가 KCCM11071P인 효모 사카로마이시스 세레비지애 YPH499fps1△gpd2△(pGcyaDak, pGup1Cas)인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 사카로마이시스 세레비지애 피루브산 탈카르복실산 효소(pyruvate decarboxylase)를 코딩하는 유전자와 알코올 탈수소화 효소(alcohol dehydrogenase)를 코딩하는 유전자를 함유하는 발현벡터 pGcyaDakAdhPdc를 제공한다.
본 발명의 일 구체예에 있어서, 상기 피루브산 탈카르복실산 효소 (pyruvate decarboxylase)는 서열번호 17 기재된 아미노산 서열을 가지는 것이 바람직하나, 서열번호 17 기재된 단백질에 하나 이상의 치환, 결손, 부가 등의 돌연변이가 유발된 글리세롤-3-포스페이트 디히드로게나제 활성을 가진 돌연변이체도 본 발명의 피루브산 탈카르복실산 효소에 포함된다.
본 발명의 일 구체예에 있어서, 상기 피루브산 탈카르복실산 효소 (pyruvate decarboxylase)를 코딩하는 유전자는 서열번호 18에 기재된 염기 서열을 가지는 것이 바람직하나, 유전자 코드의 디제너러시를 고려하여 상기 서열번호 18에 기재된 염기서열과 80%의 상동성, 바람직하게는 85%의 상동성, 더욱 바람직하게는 90%의 상동성, 가장 바람직하게는 95%의 상동성을 가지는 유전자도 본 발명의 피루브산 탈카르복실산 효소 유전자에 포함된다.
본 발명의 또 다른 일 구체예에 있어서, 상기 알코올 탈수소화(alcohol dehydrogenase) 효소는 서열번호 19에 기재된 아미노산 서열을 가지는 것이 바람직하나, 서열번호 19에 기재된 단백질에 하나 이상의 치환, 결손, 부가 등의 돌연변이가 유발된 알코올 탈수소화 활성을 가진 돌연변이체도 본 발명의 효소에 포함된다.
본 발명의 또 다른 일 구체예에 있어서, 상기 알코올 탈수소화(alcohol dehydrogenase) 효소를 코딩하는 유전자는 서열번호 20에 기재된 염기 서열을 가지는 것이 바람직하나, 유전자 코드의 디제너러시를 고려하여 상기 서열번호 20에 기재된 염기서열과 80%의 상동성, 바람직하게는 85%의 상동성, 더욱 바람직하게는 90%의 상동성, 가장 바람직하게는 95%의 상동성을 가지는 유전자도 본 발명의 알코올 탈수소화(alcohol dehydrogenase) 효소를 인코딩하는 유전자에 포함된다.
본 발명의 일 구현예에 있어서, 상기 발현벡터는 도 11에 기재된 개열지도를 가지는 발현벡터pGcyaDakAdhPdc인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 상기 본 발명의 형질전환체에 사카로마이시스 세레비지애 피루브산 탈카르복실산 효소(pyruvate decarboxylase)를 코딩하는 유전자와 알코올 탈수소화 효소(alcohol dehydrogenase)를 코딩하는 유전자 또는 사카로마이시스 세레비지애 피루브산 탈카르복실산 효소(pyruvate decarboxylase)를 코딩하는 유전자와 알코올 탈수소화 효소(alcohol dehydrogenase)를 코딩하는 유전자를 함유하는 발현벡터 pGcyaDakAdhPdc를 더욱 포함하는 형질전환체를 제공한다.
본 발명의 일 구체예에 있어서, 상기 본 발명의 형질전환체는 효모, 바람직하게는 사카로마이세스 세레비지애(Saccharomyces cerevisiae) 속 미생물 유래인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명의 상기 본 발명의 형질전환체의 제조방법에 의해 형성된 형질전환체에 c)단계 후에 추가적으로 재조합된 벡터 pGcyaDak, 및 pGupCas를 형질전환시키는 단계를 포함하는 글리세롤을 이용한 에탄올 생산용 형질전환체의 제조방법을 제공한다.
상기 본 발명의 형질전환체 제조방법의 일 구체예에 있어서, 상기 재조합된 벡터 pGcyaDak, 및 pGupCas는 도 4 및 5에 기재된 개열지도를 가지는 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 사카로마이시스 세레비지애 SPT(Suppressor of Ty)3와 SPT(Suppressor of Ty) 15(이하 각각 'SPT 3', 'SPT15'라 함) 유전자를 함유하는 발현벡터 pGupSpt3.15를 제공한다.
본 발명의 일 구체예에 있어서, TATA 결합단백질 SPT3는 서열번호 25에 기재된 아미노산 서열을 가지는 것이 바람직하나, 서열번호 25에 기재된 단백질에 하나 이상의 치환, 결손, 부가 등의 돌연변이가 SPT3 활성을 가진 돌연변이체도 본 발명의 SPT3에 포함된다.
본 발명의 일 구체예에 있어서, 상기 TATA 결합단백질 SPT3는 서열번호 26에 기재된 염기 서열을 가지는 것이 바람직하나, 유전자 코드의 디제너러시를 고려하여 상기 서열번호 26에 기재된 염기서열과 80%의 상동성, 바람직하게는 85%의 상동성, 더욱 바람직하게는 90%의 상동성, 가장 바람직하게는 95%의 상동성을 가지는 유전자도 본 발명의 SPT3 유전자에 포함된다.
본 발명의 또 다른 일 구체예에 있어서, 상기 TATA 결합단백질 SPT15 는 서열번호 27에 기재된 아미노산 서열을 가지는 것이 바람직하나, 서열번호 27에 기재된 단백질에 하나 이상의 치환, 결손, 부가 등의 돌연변이가 유발된 TATA 결합단백질 SPT15 활성을 가진 돌연변이체도 본 발명의 TATA 결합단백질 SPT15에 포함된다.
본 발명의 또 다른 일 구체예에 있어서, 상기 TATA 결합단백질 SPT15는 서열번호 28에 기재된 염기 서열을 가지는 것이 바람직하나, 유전자 코드의 디제너러시를 고려하여 상기 서열번호 28에 기재된 염기서열과 80%의 상동성, 바람직하게는 85%의 상동성, 더욱 바람직하게는 90%의 상동성, 가장 바람직하게는 95%의 상동성을 가지는 유전자도 본 발명의 TATA 결합단백질 SPT15 유전자에 포함된다.
본 발명의 일 구현예에 있어서, 상기 본 발명의 발현벡터는 도 14에 기재된 개열지도를 가지는 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 상기 본 발명의 pGupSpt3.15 발현벡터를 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제, 및 글리세롤 업테이크 프로테인 유전자를 포함하는 형질전환체에 도입하여 제조된 형질전환체를 제공하고, 상기 형질전환체는 균주 기탁번호가 KCCM 11153P인 형질 전환체 효모 사카로마이시스 세레비지애 YPH499(pGcyaDak, pGupSpt3.15Cas)인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 글리세롤을 기질로 하여 본 발명의 형질전환체를 배양하는 단계를 포함하는 에탄올 생산 방법을 제공한다.
본 발명의 바람직한 일 구체예에 있어서, 상기 글리세롤은 바이오디젤의 부산물로 생성된 글리세롤인 것이 바람직하나 이에 한정되지 아니한다.
또한 본 발명은 본 발명의 형질전환체를 포함하는 에탄올 생산용 조성물을 제공한다.본 발명의 에탄올 생성물 조성물은 예를 들어 상기 형질전환체를 배양하여 글리세롤을 기질로 하여 에탄올을 생성하는데 적합한 폴리펩타이드, 브로쓰, 세포 용해물, 정제 또는 정제되지 않은 효소 추출물 또는 폴리펩타이드 등을 포함한다.
본 발명에서 효모를 숙주로서 사용하는 경우는, 발현벡터로서, 예를 들면 YEp13, YCp50, pRS계, pYEX계 벡터 등이 이용가능하다. 프로모터로서는, 예를 들면 GAL프로모터, AOD프로모터 등을 사용할 수 있다. 효모에의 재조합체 DNA의 도입방법으로서는, 예를 들면 일렉트로포레이션법(Method Enzymol., 194, 182-187(1990)), 스페로플라스트법(Proc. Natl. Acad. Sci.USA, 84, 1929-1933(1978)), 아세트산리튬법(J. Bacteriol., 153, 163-168(1983)) 등이 이용가능하다.
또, 재조합벡터에는, 발현의 억제 또는 증폭, 또는 유도를 위한 각종의 기능을 가진 발현억제용의 단편이나, 형질전환체의 선택을 위한 마커나 항생물질에 대한 내성유전자, 또는, 균체밖으로의 분비를 목적으로 한 시그널을 코딩하는 유전자 등을 또 가진 것도 가능하다.
본 발명의 형질전환체를 배양하는 방법은, 숙주의 배양에 사용되는 통상의 방법을 사용하면 된다.
또 배양방법은, 배치(batch)식, 유동배치식, 연속배양, 리액터형식 등, 통상의 미생물의 배양에 사용하는 어떠한 방법도 사용할 수 있다.대장균 등의 세균을 숙주로 해서 얻게 된 형질전환체를 배양하는 배지로서는, 완전배지 또는 합성배지, 예를 들면 LB배지,NB배지 등을 들 수 있다. 또, 배양온도는 상기 언급한 적온의 범위에서 배양함으로써 글리세롤 디히드로게나제 (glycerol dehydrogenase)와 디히드록시아세톤 키나아제 (dihydroxyacetone kinase) 또는 글리세롤 업테이크 프로테인 (glycerol uptake protein)을 균체 내에 축적시키고, 회수한다.
탄소원은 미생물의 증식에 필요하고, 예를 들면 글루코스, 프럭토스, 슈크로스, 말토스, 갈락토스, 전분 등의 당류; 에탄올, 프로판올, 부탄올 등의 저급알콜류; 글리세롤 등의 다가알콜류; 아세트산, 시트르산, 숙신산, 타르타르산, 락트산, 글루콘산 등의 유기산; 프로피온산, 부탄산, 펜탄산, 헥산산, 헵탄산, 옥탄산, 노난산, 데칸산, 운데칸산, 도데칸산 등의 지방산 등을 이용할 수 있다.
질소원으로서는, 예를 들면 암모니아, 염화암모늄, 황산암모늄, 인산암모늄등의 암모늄염 외에, 펩톤, 고기즙, 효모엑기스,맥아엑기스, 카제인분해물, 옥수수 침지액 등의 천연물유래의 것을 들 수 있다. 또, 무기물로서는, 예를 들면 인산제 1칼륨,인산제 2칼륨, 인산마그네슘, 황산마그네슘, 염화나트륨 등을 들 수 있다. 배양액에, 카나마이신, 암피실린, 테트라사이클린, 클로람페니콜, 스트렙토마이신 등의 항생물질을 첨가해도 된다.
또, 프로모터가 유도성의 발현벡터를 사용해서 형질전환한 미생물을 배양하는 경우는, 프로모터의 종류에 적합한 유도물질을 배지에 첨가하면 된다. 예를 들면, 이소프로필-β-D-티오갈락토피라노시드(IPTG), 테트라사이클린, 인돌아크릴산(IAA) 등을 유도물질로서 들 수 있다.
글리세롤 디히드로게나제 (glycerol dehydrogenase)와 디히드록시아세톤 키나아제 (dihydroxyacetone kinase) 또는 글리세롤 업테이크 프로테인 (glycerol uptake protein)의 취득은, 얻게 되는 배양물 중으로부터, 균체 또는 상청액을 원심 회수하여, 균체파쇄, 추출, 친화성크로마토그래피, 양이온 또는 음이온교환크로마토그래피, 겔여과 등을 단독으로 또는 적당히 조합함으로써 행할 수 있다.
얻게 된 정제물질이 목적의 효소인 것의 확인은, 통상의 방법, 예를 들면 SDS-폴리아크릴아미드겔 전기영동, 웨스턴블로팅등에 의해 행할 수 있다.
이하, 본 발명을 설명한다.
본 발명은 글리세롤을 발효원으로 이용하도록 조작되어진 사카로마이세스 세레비지애 (Saccharomyces cerevisiae)의 글리세롤 생산 유전자의 결손을 통하여 부산물인 글리세롤 생산을 저해시킴으써 주산물인 바이오 에탄올 생산능이 향상된 형질전환체 및 그 형질전환체를 이용한 에탄올 생산방법에 관한 것으로, 더욱 상세하게는 사카로마이세스 세레비지애 (Saccharomyces cerevisiae)가 생산하는 글리세롤의 합성 경로인 글리세롤-3-포스페이트 디히드로게나제 2(glycerol dehydrogenase)와 효모 글리세롤 채널 Fps1p 를 인코딩하는 FPS1의 유전자를 결손 시켜 글리세롤의 생산량이 줄어들며 상대적으로 에탄올 생산능이 향상되어진 효모 형질 전환체 및 이들을 이용한 에탄올 생산 증대 방법에 대한 것이다.
본 발명의 사카로마이세스 세레비지애 속 미생물로부터 유래한 글리세롤-3-포스페이트 디히드로게나제 2(glycerol dehydrogenase)와 효모 글리세롤 채널 Fps1p 를 인코딩하는 FPS1의 유전자의 결손을 통한 글리세롤 생산능을 저해함으로써 에탄올 생산능이 증가된 이 균주에 글리세롤을 효율적으로 이용하는 유전자를 형질 전환시켜 기존의 형질전환체와 비교시 에탄올 생산능이 증가됨을 확인하였다. 또 본 발명의 사카로마이세스 세레비지애 속 미생물로부터 유래한 글리세롤 업테이크 프로테인은 글리세롤에 대해 투과성과 삼투압에 대한 내성을 가지도록 도움을 주는 효소로써 글리세롤 생산능이 저해된 균주에서 글리세롤을 발효원으로 이용할 때 삼투압에 대한 내성을 가지도록 도움을 줄 수 있다.
또한, 본 발명에 따라 글리세롤을 탄소원으로 이용하도록 제작되어진 사카로마이세스 세레비지애 속 미생물로부터 생산되어지는 글리세롤의 생산을 저해한 효모 형질 전환체는 공정에 유용하게 사용될 수 있다. 글리세롤을 기질로 한 발효결과 상기 유전자가 결손 되어진 효모 형질 전환체가 그렇지 않은 효모균주보다 많은 양의 에탄올을 생성하였다.
이하 본 발명을 상세하게 설명한다.
사카로마이세스 세레비제에서의 글리세롤 생산 경로는 디히드록시아세톤포스페이트 (dihydroxyacetone phosphate, DHAP) 에서 글리세롤-3-포스페이트 디히드로게나제 (glycerol-3-phosphate dehydrogenase, gpd)에 의하여 글리세롤-3-포스페이트로 전환된 후, 글리세롤-3-포스페이트에서의 글리세롤-3-포스페이트 포스파타제 ( glycerol-3-phosphate phosphatase) 에 의하여 글리세롤로 전환되어지며 글리세롤 외분비 통로인 Fps1을 통하여 세포외부로 분비되어진다. 본 발명에서는 글리세롤을 탄소원으로 이용하도록 조작되어진 균주에서의 글리세롤-3-포스페이트 디히드로게나제와 효모글리세롤채널 Fps1유전자를 결손시킴으로써 에탄올 생산이 증대되었다.
본 발명의 실시예에서는 forward에 Fps1의 start codon에서부터 40mer까지의 유전자가 포함되어진 프라이머와 reverse에 Fps1의 stop codon이 포함되어진 프라이머를 이용하여 pPICZ 벡터 디엔에이를 주형으로 한 PCR반응을 통하여 1.5kb의 PCR product를 얻었고, 얻어진 Zeocin내성을 가지도록 하는 유전자 PCR product를 효모에 homologous recombination 함으로써 Fps1유전자 결손 균주를 제작하였다. 또한 forward에 Gpd2의 start codon에서부터 40mer까지의 유전자가 포함되어진 프라이머와 reverse에 Gpd2의 stop codon이 포함되어진 프라이머를 이용하여 pET28a 벡터 디엔에이를 주형으로 한 PCR반응을 통하여 1.5kb PCR product를 얻었고, 얻어진 Kanamycin내성을 가지도록 하는 유전자 PCR product를 효모에 homologous recombination 함으로써 Fps1, Gpd2 유전자 결손 균주를 제작하였다. 이후, 상기 Gcy와 Dak을 양방향 삽입한 재조합 벡터를 이용하여 효모 숙주세포를 형질 전환시켰다. 이후, Gup1의 유전자 삽입을 위하여 효모-유전자 삽입벡터( yeast-integration vector)에 구축하였으며 이를 사카로마이세스 세레비지애에 유전자 삽입하였다. 상기 유전자로부터 발현되는 단백질의 글리세롤을 이용한 에탄올 생산을 조사하였다.
이로써, 본 발명에 따라 재조합되고 형질 전환 된 YPH499fps1△gpd2△(pGcyaDak, pGup1Cas)에 의하여 에탄올 생산이 증가되는 것을 확인할 수 있었다.
따라서 대표적인 에탄올 생산균주인 효모 사카로마이시스 세레비지애(Saccharomyces cerevisiae)에서의 글리세롤을 이용한 에탄올 생산량의 증대를 위하여 본 발명자는 사카로마이시스 세레비지애로부터 유래한 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase, gpd2)와 글리세롤 외분비 통로인 효모 글리세롤 채널 Fps1의 유전자 결손, 그 균주에 글리세롤을 이용하도록 유전자 도입된 재조합 벡터의 형질 전환 및 글리세롤 업테이크 프로테인 (Gup1)의 도입을 통하여 효모 형질 전환체를 개발하여 이를 대한민국 서울시 서대문구 홍제1동 유림빌딩 소재 한국미생물보존센터(KCCM)에 2010년 3월 10일 기탁번호 KCCM11071P로 기탁하였다. 뿐만 아니라 상기 효모 형질 전환체가 탄소원으로 글리세롤을 효율적으로 이용하여 에탄올 생산이 효율적으로 증가한다는 것을 확인함으로써 본 발명을 완성하였다.
또한 사카로마이세스 세레비제에서의 글리세롤 생산 경로에 관여하는 글리세롤-3-포스페이트 디히드로게나제 (glycerol-3-phosphate dehydrogenase, gpd)와 글리세롤 외분비 통로인 Fps1의 유전자를 결손 시킴으로 에탄올 생산 증대된 균주에서 피루브산 탈카르복실산 효소(pyruvate decarboxylase)와 알코올 탈수소화 효소(alcohol dehydrogenase)의 과발현을 통하여 보다 더 증대된 에탄올 생산량이 증대되었다.
본 발명의 실시예에서는 사카로마이세스 세레비지에를 주형으로 한 PCR반응을 통하여 PDC1와 ADH1 각각 1.6kb, 1.0kb의 PCR product를 얻었고, 얻어진 PCR product를 pGcyaDak 유전자에 클로닝하여 효모에 형질전환 함으로써 글리세롤 생산경로를 차단한 균주에의 삽입을 통하여 보다 에탄올 생산능이 증대된 균주를 제작하였으며 이후, Gup1의 유전자 삽입을 위하여 효모-유전자 삽입벡터( yeast-integration vector)에 구축하였으며 이를 사카로마이세스 세레비지애에 유전자 삽입하였다. 상기 유전자로부터 발현되는 단백질의 글리세롤을 이용한 에탄올 생산을 조사하였다.
이로써, 본 발명에 따라 재조합되고 형질 전환된 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDak, pGupCas)에 의하여 에탄올 생산이 증가되는 것을 확인할 수 있었다.
따라서 대표적인 에탄올 생산균주인 효모 사카로마이시스 세레비지애(Saccharomyces cerevisiae)에서의 글리세롤을 이용한 에탄올 생산량의 증대를 위하여 본 발명자는 사카로마이시스 세레비지애로부터 유래한 피루브산 탈카르복실산 효소(pyruvate decarboxylase)와 알코올 탈수소화 효소(alcohol dehydrogenase)를 과발현하였고, 글리세롤 생산 경로가 차단되어진 균주에의 형질전환을 통하여 효모 형질 전환체를 개발하여 이를 대한민국 서울시 서대문구 홍제1동 유림빌딩 소재 한국미생물보존센터(KCCM)에 2010년 12월 17일 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDakAdhPdc,pGupCas) 기탁번호 KCCM11152P로 기탁하였다.뿐만 아니라 상기 효모 형질 전환체가 탄소원으로 글리세롤을 효율적으로 이용하여 에탄올 생산이 효율적으로 증가한다는 것을 확인함으로써 본 발명을 완성하였다.
본 발명에서는 사카로마이세스 세레비지애에서의 글리세롤을 탄소원으로 이용하도록 제작되어진 형질전환체에서의 에탄올 생산 증대를 위하여 글리세롤 생산 유전자, 글리세롤-3-포스페이트 디히드로게나제2 와 효모 글리세롤 채널 Fps1을 결손시킨 형질전환체에서의 보다 높은 에탄올 생산능을 위하여 피루브산 탈카르복실산 효소와 알코올 탈수소화 효소 코딩하는 유전자를 도입한 형질전환체를 이용하였으며 에탄올 생산량 증대를 이루었다.
또한 본 발명은 글리세롤을 발효원으로 이용하도록 조작되어진 사카로마이세스 세레비지애 (Saccharomyces cerevisiae)의 TATA 결합단백질인 SPT3와 SPT3의 과발현을 통한 바이오 에탄올 생산능이 향상된 형질전환체 및 그 형질전환체를 이용한 에탄올 생산방법에 관한 것으로, 더욱 상세하게는 글리세롤을 발효원으로 이용하도록 제작되어진 형질전환체에서의 에탄올 생산능 및 삼투압에 대한 내성 증대를 위하여 사카로마이세스 세레비지애 (Saccharomyces cerevisiae)에서 효모 RNA 폴리머라제 인자, 예컨대 TATA 결합단백질인 SPT3와 SPT15의 과발현을 통하여 에탄올 생산능이 향상되어진 형질전환체 및 이들을 이용한 에탄올 생산 증대 방법에 대한 것이다.
본 발명의 사카로마이세스 세레비지애 속 미생물로부터 유래한 TATA 결합단백질 SPT3와 SPT15를 인코딩하는 유전자의 과발현을 통한 에탄올 생산능 및 삼투압에 대한 내성을 증대시킴으로써 에탄올 생산능이 증가된 이 균주에 글리세롤을 효율적으로 이용하는 유전자를 형질 전환시켜 기존의 형질전환체와 비교시 에탄올 생산능이 증가됨을 확인하였다. 또한, 본 발명에 따라 글리세롤을 탄소원으로 이용하도록 제작되어진 사카로마이세스 세레비지애 속 미생물로부터 생산되어지는 글리세롤의 생산을 저해한 효모 형질 전환체는 공정에 유용하게 사용될 수 있다. 글리세롤을 기질로 한 발효결과 상기 유전자 삽입된 효모 형질 전환체가 그렇지 않은 효모균주보다 많은 양의 에탄올을 생성하였다.
본 발명의 실시예에서는 사카로마이세스 세레비지에를 주형으로 한 PCR반응을 통하여 SPT3와 SPT15 각각 1.0kb, 0.7kb의 PCR product를 얻었고, 얻어진 PCR product를 효모에 형질전환 함으로써 TATA 결합 단백질 SPT3, SPT15 과발현 균주를 제작하였다. 이후, 상기 Gcy와 Dak을 양방향 삽입한 재조합 벡터를 이용하여 효모 숙주세포를 형질 전환시켰다. 이후, Gup1의 유전자 삽입을 위하여 효모-유전자 삽입벡터( yeast-integration vector)에 구축하였으며 이를 사카로마이세스 세레비지애에 유전자 삽입하였다. 상기 유전자로부터 발현되는 단백질의 글리세롤을 이용한 에탄올 생산을 조사하였다.
이로써, 본 발명에 따라 재조합되고 형질 전환 된 YPH499(pGcyaDak, pGupSpt3.15Cas)에 의하여 에탄올 생산이 증가되는 것을 확인할 수 있었다.
또한 이 효모 형질 전환체를 개발하여 이를 대한민국 서울시 서대문구 홍제1동 유림빌딩 소재 한국미생물보존센터(KCCM)에 2010년 12월 17일 기탁번호 KCCM11153P로 기탁하였다.
이상 살펴본 바와 같이, 본 발명에서는 사카로마이세스 세레비지애 (Saccharomyces cerevisiae) 속 미생물 유래의 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase, gpd2)와 글리세롤 외분비 통로인 효모 글리세롤 채널 Fps1의 유전자 결손을 통하여 글리세롤 생산을 억제하였으며 또한 글리세롤 디히드로게나제 (glycerol dehydrogenase)와 디히드록시아세톤 키나아제 (dihydroxyacetone kinase) 유전자가 도입된 형질전환체에 글리세롤 업테이크 프로테인 (glycerol uptake protein)을 유전자 삽입한 재조합 벡터를 효모 균주에 도입하였다. 이후, 상기 효모균주에 비하여 에탄올 생산수율이 높아진 것을 확인하였다. 본 발명에 따라 글리세롤을 탄소원으로 이용하도록 조작되어진 균주에의 글리세롤 생산 유전자를 차단함으로써 제작되어진 효모 형질 전환체는 바이오디젤의 부산물로 생성이 되는 글리세롤을 이용하여 많은 양의 에탄올을 생산할 수 있어 매우 유용한 발명인 것으로 기대된다.
또한 피루브산 탈카르복실산 효소와 알코올 탈수소화 효소를 과발현을 통하여 에탄올 생산능이 증대되었으며, 이들 유전자를 상기 gpd2와 Fps1의 유전자 결손을 통하여 글리세롤 생산을 억제하고, 또한 글리세롤 디히드로게나제와 디히드록시아세톤 키나아제 유전자가 도입된 형질전환체에 글리세롤 업테이크 프로테인을 유전자 삽입한 효모 균주에 도입한 결과, 피루브산 탈카르복실산 효소와 알코올 탈수소화 효소를 포함한 형질전환체가 포함하지 않은 효모균주에 비하여 에탄올 생산수율이 더 높아진 것을 확인하였다.
또한 TATA 결합단백질인 SPT3와 SPT15의 과발현을 통하여 에탄올 생산능이 향상되어진 형질전환체의 경우에 이러한 결합단백질의 과발현을 유도하지 아니한 효모 균주에 비하여 에탄올 생산수율이 높아진 것을 확인하였다.
도 1은 본 발명에서 아가로스 겔 전기영동을 수행하여 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 FPS1의 유전자 결손을 위한 homology arm의 확인을 위한 PCR 산물을 확인한 그림이고, Lane 1, 1kb DNA 마커; Lane 2, Fps1의 유전자 결손을 위하여 Zeocin 내성 유전자의 5'와 3'에 Fps1 homology arm이 형성된 것 이며, Lane 3, Gpd2의 유전자 결손을 위하여 Kanamycin 내성 유전자의 5'와 3'에 Gpd2 homology arm이 형성된 것을 확인한 그림을 나타낸다.
도 2는 본 발명에서 제시된 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 FPS1의 유전자 결손 방법을 나타낸 모식도이다.
도 3(A)는 본 발명에서 아가로스 겔 전기영동을 수행하여 글리세롤 디히드로게나제 유전자의 PCR 산물을 확인한 그림이고, Lane 1, 1kb DNA 마커; Lane 2, Gcy PCR 산물이며, 도 3(B)는 본 발명에서 아가로스 겔 전기영동을 수행하여 디히드록시아세톤 키나아제 유전자의 PCR 산물을 확인한 그림이고, Lane 1, 1kb DNA 마커; Lane 2, Dak PCR 산물이며, 도 3(C)는 본 발명에서 아가로스 겔 전기영동을 수행하여 글리세롤 업테이크 프로테인 유전자의 PCR 산물을 확인한 그림이고, Lane 1, 1kb DNA 마커; Lane 2, Gup PCR 산물을 나타낸다.
도 4는 본 발명에서 제시된 글리세롤 디히드로게나제 유전자와 디히드록시아세톤 키나아제 유전자가 양방향으로 삽입된 재조합 벡터 pGcyaDak의 재조합 과정을 나타낸 모식도이고,
도 5는 본 발명에서 제시된 글리세롤 업테이크 프로테인의 유전자 삽입을 위하여 구축한 재조합 벡터 pGup의 재조합 과정을 나타낸 모식도이다.
도 6은 본 발명에서 제시된 유전자 결손 균주 YPH499fps1△gpd2△의 삼투압에 대한 영향을 나타낸 그림으로 삽입된 pGup1cas에 의하여 삼투압에 의한 회복능력을 확인한 그림이다. 도 6에서 사용되어진 배지는 (A) glycerol을 carbon source로 한 배지 (B) YPD 배지에 1 M NaCl,10 mM glycerol이 첨가된 배지. Lane1, YPH499 (pESC-TRP), lane2, YPH499fps1Δgpd2 (pESC-TRP),lane3, YPH499fps1Δgpd2 (pGcyaDak), lane4, YPH499fps1Δgpd2Δ(pGcyaDak,pGupCas)을 나타낸다.
도 7은 본 발명에서 제시된 유전자 결손된 균주에 재조합 벡터 pGcyaDak, pGup를 형질전환하여 glycerol을 기질로 하여 에탄올 생산량이 증대됨을 생산함을 확인한 그래프이다. 도 7에서 심벌은 squares, YPH499 (pGcyaDak,pGupCas)
;diamonds, YPH499fps1Δgpd2Δ(pGcyaDak,pGupCas)을 나타낸다.
도 8은 pPICZ 벡터의 개열지도를 나타내고,
도 9는 pET28a 벡터의 개열지도를 나타낸다.
도 10은 본 발명에서 아가로스 겔 전기영동을 수행하여 피루브산 탈카르복실산 효소(pyruvate decarboxylase)와 알코올 탈수소화 효소(alcohol dehydrogenase)를 인코딩하는 유전자를 확인한 그림이고, Lane 1, 1kb DNA 마커; Lane 2, PDC1, Lane 3, ADH1 유전자를 확인한 그림을 나타낸다.
도 11은 본 발명에서 제시된 피루브산 탈카르복실산 효소(pyruvate decarboxylase)와 알코올 탈수소화 효소(alcohol dehydrogenase)를 글리세롤 디히드로게나제 유전자와 디히드록시아세톤 키나아제 유전자가 양방향으로 삽입된 재조합 벡터 pGcyaDak에 유전자 삽입하는 재조합 과정을 나타낸 모식도를 나타낸다.
도 12는 본 발명에서 제시된 유전자 결손된 균주에 재조합 벡터 pGcyaDakAdhPdc, pGup를 형질전환하여 glycerol을 기질로 하여 에탄올 생산량이 증대됨을 생산함을 확인한 그래프이다. 도 5에서 심벌은 검은색 ▲, YPH499 (pESC-TRP);푸른색 ◆,사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDak, pGupCas);붉은색 ■,사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDakAdhPdc,pGupCas)을 나타낸다.
도 13은 본 발명에서 아가로스 겔 전기영동을 수행하여 TATA 결합 단백질 SPT3와 SPT15의 유전자 확인을 위한 PCR 산물을 확인한 그림이고, Lane 1, 1kb DNA 마커; Lane 2, SPT3 이며, Lane 3, SPT15을 확인한 그림을 나타낸다.
도 14는 본 발명에서 제시된 TATA 결합 단백질 SPT3, SPT15가 글리세롤 업테이크 프로테인 유전자가 구축 재조합 벡터 pGup에 삽입된 재조합 벡터 pGupSpt3.15Cas의 재조합 과정을 나타낸 모식도이고,
도 15는 본 발명에서 제시된 글리세롤 디히드로게나제 유전자와 디히드록시아세톤 키나아제 유전자가 양방향으로 삽입된 재조합 벡터 pGcyaDak의 재조합 과정을 나타낸 모식도이며,
도 16은 본 발명에서 제시된 TATA 결합단백질 SPT3,SPT15의 과발현 벡터에 pGcyaDak를 형질전환하여 glycerol을 기질로 하여 에탄올 생산량이 증대됨을 생산함을 확인한 그래프이다. 도 16에서 심벌은 ◆,YPH499 (pESC-TRP); ■, YPH499 (pGcyaDak, pGupCas);▲,YPH499 (pGcyaDak, pGupSpt3Cas);X,YPH499(pGcyaDak, pGupSpt3. 15Cas)을 나타낸다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
실시예 1: 효모의 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase, gpd2),효모 글리세롤 채널 Fps1 유전자의 결손
글리세롤의 생산 경로의 차단을 위하여 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase, gpd2),효모 글리세롤 채널 Fps1 유전자의 결손을 위하여 forward (5-atgagtaatcctcaaaaagctctaaacgactgagccatattcaacgg
gaaacgtcttgctcagtttcatttgatgctcgatgagtttttccattatggtaatgctaagaaggtaacatga-3;서열번호 5)에 Fps1의 start codon에서부터 40mer까지의 유전자를 포함시켰으며 reverse(5'-gtcaaagtaaactacgagctactcaaaaaggtaataccattactattcttccattgtacttcatgttaccttcttatcattaccataatggaaaaactcatcgagcatcaaatgaaactg-3';서열번호 6)에 Fps1의 stop codon이 포함시켰으며 pPICZ 벡터 (Invitrogen, USA ; 도7a) 디엔에이를 주형으로 한 PCR반응을 통하여 1.5kb의 양 옆에 각각 Fps1 유전자의 start codon과 stop codon이 포함되어졌으며 Zeocin 내성을 가지는 PCR product를 얻었고,
또한 같은 방법으로 Gpd2의 유전자 결손을 위하여 forward (5-atgcttgctgtcagaagattaacaagatacacattccttagtgttgacaa
ttaatcatcggcatagtatagggadgctcgaaggctttaatttgcaagct-3;서열번호 7),reverse (5'-attgaagagctagacatcgatgacgaatagcccctgcgagcttccgaaattaaacgttcgataacttctcgatctgtagctactgcttattattcgtcatcgatgtctagctcttcaatagcttgcaaattaaagccttcgagcgtcccc;서열번호 8) 프라이머를 이용하여 pET28a 벡터(Invitrogen, USA ; 도7b) 디엔에이를 주형으로 한 PCR반응을 통하여 1.5kb PCR product를 얻었고,
얻어진 Kanamycin내성을 가지도록 하는 유전자와 5'와 3'에 Gpd2에 유사성을 가지는 부위를 첨가함으로써 각각의 PCR product를 효모 YPH499 (MATa ura3-52lys2-801_amberade2-101_ochretrp1-Δ63his3-Δ200leu2-Δ1) (Clontech Laboratories, Inc.) homologous recombination 함으로써 Fps1, Gpd2 유전자 결손 균주를 제작하였다. 이후, Zeocin, Kanamycin이 포함된 YPD배지 (1% yeast extract, 2% Bacto peptone, and 2% glucose, 2% agar)를 이용하여 유전자 결손된 균주를 선별하였으며 유전자 결손을 위한 PCR 밴드 및 유전자 결손 방법을 도식화하여 도면 1, 2에 각각 도시하였다. 이를 사카로마이시스 세레비지애 YPH499fps1△gpd2△ 라 명명하였다.
<실시예 2> 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제, 글리세롤 업테이크 프로테인 유전자의 형질전환
<실시예 2-1> 효모의 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제, 글리세롤 업테이크 프로테인 유전자의 증폭
글리세롤을 해당과정의 중간물질인 DHAP로 효율적으로 전환하기 위하여 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제 유전자를 클로닝하기 위하여 사카로마이시스 세레비지애의 지노믹디엔에이 (BY4741) 로부터 펩타이드 부분의 염기서열을 참고로 하여 Gcy의 클로닝을 위하여 BamH (5-ggatccatgcctgctactttacatga
ttct-3;서열번호 9), Sal( 5-gtcgacatacttgaatacttcgaaaggag-3;서열번호 10), Dak는 Spe (5-actagtatgtccgctaaatcgtttgaagtc-3;서열번호 11), Cla(5-atcgatatacaaggcgctttgaaccccctt-3;서열번호 12) 그리고 Gup1에는 EcoR(5-gaattcatgtcgctgatcagcatcctg-3;서열번호 13), Spe(5-actagtccagca
ttttaggtaaattccgtg-3;서열번호 14)으로 각각의 인식서열이 삽입되도록 프라이머를 디자인하여 합성하였다. 이후 상기 합성된 프라이머를 이용하여 PCR을 수행하였다. 그 결과 각각 936bp, 1755bp 그리고 1683bp의 PCR 밴드를 확인할 수 있었고 도면 3에 각각 도시하였다.
<실시예 2-2> 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제, 글리세롤 업테이크 프로테인 유전자의 클로닝
상기 실시예 1에서 얻은 증폭산물을 0.8% 아가로스 겔 상에서 전기영동하였고 아가로스 겔 상의 DNA 절편은 Biospin gel extraction kit (Bioflux)를 사용하여 회수하였다.
그 후, Gcy는 BamH, Sal, Dak는 Spe, Cla그리고 Gup1은 EcoR, Spe으로 절단한 후 효모-대장균 셔틀 벡터 (yeast-E. coli shuttle vector) 인 pESC-trp (Clontech) 에 라이게이션 (ligation) 시켜 에스세리시아 콜라이 (대장균, E. coli) DH5a에 형질 전환을 하였다. 이어 형질 전환체로부터 라이게이션 (ligation) 된 재조합 플라스미드 DNA를 분리하였다. 상기 재조합 벡터를 각각pESC-Gcy, pESC-Dak, pESC-Gup이라 명명하였다. 그 후 pESC-Gcy를 벡터로 하여 Dak를 클로닝하여 에스세리시아 콜라이 DH5a(인비트로겐(Invitrogen)에 형질 전환을 하였다. 이어 형질 전환체로부터 라이게이션 된 재조합 플라스미드 DNA를 분리하였다. 상기 재조합 벡터를 pGcyaDak이라 명명하였고 도면 4에 도시하였다. 또한 pESC-Gup1을 유전자 삽입하기 위하여 BamH1 인식서열을 포함하도록 sense primer (5-ggatccatgt cagcattttaggtaaattccgtg-3;서열번호 15) 그리고 anti-sence primer (5-ggatccataatgtcgctgatcagcatcctg tct-3;서열번호 16)를 제작하여 효모 유전자 삽입 벡터 (yeast integration vector)인 YIP-5에 클로닝하여 이를 사카로마이시스 세레비지애의 지노믹디엔에이에 유전자 삽입하였다.
재조합된 벡터 pGcyaDak, pGupCas를 유전자 결손된 균주(YPH499fps1△gpd2△)에 클론테크 (clontech)사의 이스트메이커 이스트 트랜스포메이션 키트 (YEASTMAKER yeast transformation kit2) 에서 제공하는 실험방법에 따라 효모 숙주세포를 형질 전환시켰다. 이후, 트립토판 결핍 SD배지 (0.67% yeast nitrogen base, 2% glucose, 0.067% yeast nigrogen base w/o trp, 2% agar)에 Zeocin과 Kanamycin을 이용하여 형질 전환체를 선별하였으며, 이를 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDak, pGupCas)라 명명하였다.
<실시예 3> 효모의 피루브산 탈카르복실산 효소(pyruvate decarboxylase)와 알코올 탈수소화 효소(alcohol dehydrogenase)를 코딩하는 유전자의 형질전환
<실시예 3-1> 효모의 PDC1과 ADH1의 유전자의 증폭
피루브산에서 에탄올로의 전환을 위하여 작용하는 두가지 핵심 효소인 PDC1과 ADH1의 과발현을 통한 에탄올 생산의 증대를 위하여 유전자를 클로닝하기 위하여 사카로마이시스 세레비지애의 지노믹디엔에이 (BY4741) 로부터 펩타이드 부분의 염기서열을 참고로 하여 PDC의 클로닝을 위하여 Pst(5-ctgcagatga gttatactgt cggtacctat-3;서열번호 21), Sph( 5-ttcggacaat tgttcgagga gatccgtacg-3;서열번호 22), ADH는 Xba (5-tctagaatgg cttcttcaac tttttatatt-3;서열번호 23), Sal(5-cttgagaagg actcgcgaaa gattcagctg-3;서열번호 24) 으로 각각의 인식서열이 삽입되도록 프라이머를 디자인하여 합성하였다. 이후 상기 합성된 프라이머를 이용하여 PCR을 수행하였다. 그 결과 각각 1.6kb, 1.0kb의 PCR 밴드를 확인할 수 있었고 도면 10에 각각 도시하였다.
<실시예 3-2> 효모의 PDC1과 ADH1의 유전자의 클로닝
상기 실시예 3-1에서 얻은 증폭산물을 0.8% 아가로스 겔 상에서 전기영동하였고 아가로스 겔 상의 DNA 절편은 Biospin gel extraction kit (Bioflux)를 사용하여 회수하였다.
그 후, PDC1은 Pst,Sph ADH1는 Xba, Sal로 절단한 후 각각의 제한효소로 절단한 후 글리세롤 디히드로게나제 (glycerol dehydrogenase)와 디히드록시아세톤 키나아제 (dihydroxyacetone kinase)의 유전자가 양방향 삽입되어진 pGcyaDak에 라이게이션(ligation) 시켜 대장균(E. coli) DH5a(인비트로겐(Invitrogen)에 형질전환을 하였다. 이어 형질 전환체로부터 라이게이션 (ligation) 된 재조합 플라스미드 DNA를 분리하였다. 상기 재조합 벡터를 각각pGupCaspGcyaDakAdhPdc이라 명명하였으며 이를 도11에 도식화 하였다.
재조합된 벡터 pGcyaDakAdhPdc, pGupCas를 글리세롤 생산경로가 차단되어진 돌연변이체 균주(YPH499fps1gpd2)에 클론테크 (clontech)사의 이스트메이커 이스트 트랜스포메이션 키트 (YEASTMAKER yeast transformation kit2) 에서 제공하는 실험방법에 따라 효모 숙주세포를 형질 전환시켰다. 이후, 트립토판 결핍 SD배지 (0.67% yeast nitrogen base, 2% glucose, 0.067% yeast nigrogen base w/o trp, 2% agar)을 이용하여 형질 전환체를 선별하였으며, 이를 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDakAdhPdc, pGupCas)라 명명하였다.
<실시예 4> 효모의 TATA 결합 단백질 SPT3, SPT15 유전자의 형질전환
<실시예 4-1> 효모의 TATA 결합 단백질 SPT3, SPT15 유전자의 증폭
글리세롤을 기질로 이용한 에탄올 생산시에 저해 인자인 에탄올 내성 및 삼투압에 대한 내성의 증대를 위하여 TATA 결합 단백질 SPT3,SPT15 유전자를 클로닝하기 위하여 사카로마이시스 세레비지애의 지노믹디엔에이 (BY4741) 로부터 펩타이드 부분의 염기서열을 참고로 하여 SPT3의 클로닝을 위하여 Spe(5-actagtcccg ccgccaccaa ggagatgatg gacaagcata agta-3;서열번호 29), Spe( 5-actagtttac atgataattg gtttag-3;서열번호 30), SPT15는 Bgl (5-agatctcccg ccgccaccaa ggagatggcc gatgaggaac gttt-3;서열번호 31), Bgl(5-agatcttcac atttttctaa attcactta-3;서열번호 32) 으로 각각의 인식서열이 삽입되도록 프라이머를 디자인하여 합성하였다. 이후 상기 합성된 프라이머를 이용하여 PCR을 수행하였다. 그 결과 각각 1.5kb, 0.7kb의 PCR 밴드를 확인할 수 있었고 도면 13에 각각 도시하였다.
<실시예 4-2> 효모의 TATA 결합 단백질 SPT3, SPT15 유전자의 클로닝
상기 실시예 4-1에서 얻은 증폭산물을 0.8% 아가로스 겔 상에서 전기영동하였고 아가로스 겔 상의 DNA 절편은 Biospin gel extraction kit (Bioflux)를 사용하여 회수하였다.
그 후, SPT3은 Spe Dak는 Bgl로 절단한 후 제한효소 Spe1, Bgl으로 절단한 후 글리세롤 업테이크 프로테인이 삽입되어진 pGup1 에 라이게이션(ligation) 시켜 대장균(E. coli) DH5a(인비트로겐(Invitrogen)에 형질전환을 하였다. 이어 형질 전환체로부터 라이게이션 (ligation) 된 재조합 플라스미드 DNA를 분리하였다. 상기 재조합 벡터를 각각pGupSpt3, pGupSpt3.15이라 명명하였으며 이를 14에 도식화 하였다.
또한 pGupSpt3.15을 유전자 삽입하기 위하여 BamH1 인식서열을 포함하도록 sense primer (5-ggatccatgt cagcattttaggtaaattccgtg-3;서열번호 15) 그리고 anti-sence primer (5-ggatccataatgtcgctgatcagcatcctg tct-3;서열번호 16)를 제작하여 효모 유전자 삽입 벡터 (yeast integration vector)인 YIP-5(ATCC)에 클로닝하여 이를 pGupSpt3.15Cas이라 명명하였으며 도 14에 도식화하였으며 이를 사카로마이시스 세레비지애의 지노믹디엔에이에 유전자 삽입하였다. 재조합된 벡터 pGupSpt3.15Cas를 야생형의 균주(YPH499, Clontech Laboratories Inc.)에 클론테크 (clontech)사의 이스트메이커 이스트 트랜스포메이션 키트 (YEASTMAKER yeast transformation kit2) 에서 제공하는 실험방법에 따라 효모 숙주세포를 형질 전환시켰다. 이후, 트립토판 결핍 SD배지 (0.67% yeast nitrogen base, 2% glucose, 0.067% yeast nigrogen base w/o trp, 2% agar)을 이용하여 형질 전환체를 선별하였으며, 이를 사카로마이시스 세레비지애 YPH499 (pGcyaDak, pGupSpt3.Spt15Cas)라 명명하였다.
<실시예 5> 글리세롤 생산 경로가 차단되어진 균주에서의 삼투압에 대한 영향 측정
글리세롤-3-포스페이트 디히드로게나제2와 효모 글리세롤 채널 Fps1 유전자가 결손되어진 균주에서의 삼투압에 대한 영향을 측정하기 위하여 각각의 서로 다른 배지 에서 Growth test를 시행하였다. 균주를 glucose를 carbon source로 이용하는 배지에서 배양 후 OD600에서 1까지로 희석한 후 1/10로 각각 희석하여 10ul씩 분주하여 colony 생성을 확인한다. 삼투압에 대한 영향을 확인하기 위하여 NaCl의 농도를 늘려가며 이용하였다. 이 결과를 도면 6에 도시하였다.
<실시예 6> 효모 형질 전환체를 이용한 바이오 에탄올의 생산
상기 실시예 2에서 제조된 YPH499fps1△gpd2(pGcyaDak, pGupCas)와 YPH499(pGcyaDak, pGupCas)를 갈락토오스로 발현 유도되는 SG배지에서 24시간 전배양 후 48시간 진탕 배양하여 2%의 글리세롤이 기질로 첨가된 발효배지에 600nm파장에서 흡광도를 측정했을 때 각각 1가 되도록 한다. 상기 발효배양액을 30℃, 100rpm에서 배양하며 일정한 시간별로 배양액을 채취하여 가스 크로마토그래피를 실시함으로 생산된 에탄올을 측정하였다. 상기 방법대로 실행결과 글리세롤-3-포스페이트 디히드로게나제2 와 효모 글리세롤 채널 Fps1 유전자가 결핍되어진 YPH499fps1△gpd2△(pGcyaDak, pGupCas)에서의 에탄올 생산수율이 YPH499 (pGcyaDak, pGupCas)보다 높게 측정이 되었다. 이 결과를 도면 7에 도시하였다.
<실시예 7> 효모 형질 전환체를 이용한 바이오 에탄올의 생산
상기 실시예 2에서 제조된 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDak, pGupCas)와 상기 실시예 3에서 제조된 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDakAdhPdc, pGupCas)를 갈락토오스로 발현 유도되는 SG배지에서 24시간 전배양 후 48시간 진탕 배양하여 2%의 글리세롤이 기질로 첨가된 발효배지에 600nm파장에서 흡광도를 측정했을 때 각각 1가 되도록 한다. 상기 발효배양액을 30℃, 100rpm에서 배양하며 일정한 시간별로 배양액을 채취하여 가스 크로마토그래피를 실시함으로 생산된 에탄올을 측정하였다. 상기 방법대로 실행결과 피루브산 탈카르복실산 효소(pyruvate decarboxylase)와 알코올 탈수소화 효소(alcohol dehydrogenase)유전자 과발현되어진 균주 사카로마이시스 세레비지애 YPH499fps1△gpd2△ YPH499fps1gpd2(pGcyaDakAdhPdc, pGupCas)에서의 에탄올 생산수율이 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDak, pGupCas)보다 높게 측정이 되었다. 이 결과를 도면 12에 도시하였다.
<실시예 8> 효모 형질 전환체를 이용한 바이오 에탄올의 생산
YPH499(pGcyaDak, pGupCas)와 상기 실시예 4에서 제조된 YPH499(pGcyaDak, pGupSpt3.15Cas)를 갈락토오스로 발현 유도되는 SG배지에서 24시간 전배양 후 48시간 진탕 배양하여 2%의 글리세롤이 기질로 첨가된 발효배지에 600nm파장에서 흡광도를 측정했을 때 각각 1가 되도록 한다. 상기 발효배양액을 30℃, 100rpm에서 배양하며 일정한 시간별로 배양액을 채취하여 가스 크로마토그래피를 실시함으로 생산된 에탄올을 측정하였다. 상기 방법대로 실행결과 TATA 결합 단백질이 과발현되어진 균주에서의 에탄올 생산수율이 YPH499 (pGcyaDak, pGupCas)보다 높게 측정이 되었다. 이 결과를 도면 16에 도시하였다.
Claims (18)
- 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 효모 글리세롤 채널 FPS1을 인코딩하는 FPS1 (glycerol facilitator channel)의 유전자가 결손된 형질전환체.
- 제 1항에 있어서, 상기 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)는 서열번호 1에 기재된 아미노산 서열을 가지고, 상기 효모 글리세롤 채널 FPS1는 서열번호 3에 기재된 아미노산 서열을 가지는 형질전환체.
- 제 1항에 있어서, 상기 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)는 서열번호 2에 기재된 염기 서열을 가지고, 상기 효모 글리세롤 채널 FPS1는 서열번호 4에 기재된 염기서열을 가지는 형질전환체.
- 제 1항 내지 제3항 중 어느 한 항에 있어서, 상기 형질전환체는 사카로마이세스 세레비지애(Saccharomyces cerevisiae)인 형질전환체.
- a) 효모 글리세롤 채널 FPS1의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 효모 글리세롤 채널 FPS1의 1971에서 스탑 코돈까지의 서열이 포함된 리버스 프라이머로 도 8의 개열지도를 가지는 pPICZ 벡터 디엔에이를 주형으로 하여 PCR반응을 수행하여 Fps1 유전자의 시작 코돈과 스탑 코돈이 포함된 PCR 산물을 얻는 단계;b) 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 1324에서 스탑 코돈까지의 서열이 포함된 리버스 프라이머로 도 9의 개열지도를 가지는 pET28a 벡터 디엔에이를 주형으로 한 PCR반응을 통하여 PCR 산물을 얻는 단계; 및c) 상기 각각의 PCR 산물을 효모에 상동 재조합(homologous recombination) 하는 단계를 포함하는 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 효모 글리세롤 채널 FPS1을 인코딩하는 FPS1 (glycerol facilitator channel) 유전자가 결손된 형질전환체 제조방법.
- 제 5항에 있어서, 상기 효모 글리세롤 채널 FPS1의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 효모 글리세롤 채널 FPS1의 스탑 코돈이 포함된 리버스 프라이머는 각각 서열번호 5 및 서열번호 6에 기재된 프라이머인 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 효모 글리세롤 채널 FPS1을 인코딩하는 FPS1 (glycerol facilitator channel) 유전자가 결손된 형질전환체 제조방법.
- 제 5항에 있어서, 상기 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 시작 코돈에서부터 40머까지의 유전자를 포함한 포워드 프라이머 및 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)의 스탑 코돈이 포함된 리버스 프라이머는 각각 서열번호 7 및 서열번호 8에 기재된 프라이머인 글리세롤-3-포스페이트 디히드로게나제2 (glycerol-3-phosphate dehydrogenase2)와 효모 글리세롤 채널 FPS1을 인코딩하는 FPS1 (glycerol facilitator channel) 유전자가 결손된 형질전환체 제조방법.
- 제 1항 내지 제3항 중 어느 한 항의 형질전환체에 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제, 및 글리세롤 업테이크 프로테인 유전자를 추가로 포함하는 형질전환체.
- 제 8항에 있어서, 상기 형질전환체는 균주 기탁번호가 KCCM 11071P인 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDak, pGupCas) 형질전환체.
- 제1항 또는 제8항 중 어느 한 항의 형질전환체에 사카로마이시스 세레비지애 피루브산 탈카르복실산 효소(pyruvate decarboxylase)를 코딩하는 유전자와 알코올 탈수소화 효소(alcohol dehydrogenase)를 코딩하는 유전자를 더욱 포함하는 형질전환체.
- 제 10항에 있어서, 상기 피루브산 탈카르복실산 효소(pyruvate decarboxylase)는 서열번호 17에 기재된 아미노산 서열을 가지고, 상기 알코올 탈수소화 효소(alcohol dehydrogenase)는 서열번호 19에 기재된 아미노산 서열을 가지는 형질전환체.
- 제 10항에 있어서, 상기 피루브산 탈카르복실산 효소(pyruvate decarboxylase)는 서열번호 18에 기재된 염기 서열을 가지고, 상기 알코올 탈수소화 효소(alcohol dehydrogenase)는 서열번호 20에 기재된 염기서열을 가지는 형질전환체.
- 제10항에 있어서, 상기 형질전환체는 균주 기탁번호가 KCCM 11152P인 형질 전환체 효모 사카로마이시스 세레비지애 YPH499fps1△gpd2△ (pGcyaDakAdhPdc,pGupCas)인 형질전환체.
- 사카로마이시스 세레비지애 SPT(Suppressor of Ty)3와 SPT15 유전자를 함유하는 발현벡터 pGupSpt3.15.
- 제 14항의 발현벡터를 글리세롤 디히드로게나제, 디히드록시아세톤 키나아제, 및 글리세롤 업테이크 프로테인 유전자를 포함하는 형질전환체에 도입하여 제조된 형질전환체.
- 제 15항에 있어서, 상기 형질전환체는 균주 기탁번호가 KCCM 11153P인 형질 전환체 효모 사카로마이시스 세레비지애 YPH499(pGcyaDak, pGupSpt3.15Cas)인 형질전환체.
- 글리세롤을 기질로 하여 제8항, 제10항 또는 제15항의 형질전환체를 배양하는 단계를 포함하는 글리세롤을 이용한 에탄올 생산 방법.
- 제8항, 제10항 또는 제15항의 형질전환체를 포함하는 에탄올 생성용 조성물.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/641,946 US8772000B2 (en) | 2010-04-19 | 2011-04-15 | Transformant for enhancing bioethanol production, and method for producing ethanol by using said strain |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2010-0035853 | 2010-04-19 | ||
| KR1020100035853A KR20110116438A (ko) | 2010-04-19 | 2010-04-19 | 바이오 에탄올 생산 향상용 글리세롤 생산 유전자 결손 변이체 및 그 균주를 이용한 에탄올 생성방법 |
| KR1020110003479A KR101262999B1 (ko) | 2011-01-13 | 2011-01-13 | 바이오 에탄올 생산 향상용 피루브산 탈카르복실산 효소와 알코올 탈수소화 효소를 코딩하는 유전자가 도입된 형질전환체 및 그 균주를 이용한 에탄올 생성방법 |
| KR10-2011-0003476 | 2011-01-13 | ||
| KR10-2011-0003479 | 2011-01-13 | ||
| KR1020110003476A KR101259956B1 (ko) | 2011-01-13 | 2011-01-13 | 바이오 에탄올 생산 향상용 tata 결합 단백질 spt3 와 15가 유전자 삽입된 형질전환체 및 그 균주를 이용한 에탄올 생성방법 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2011132890A2 true WO2011132890A2 (ko) | 2011-10-27 |
| WO2011132890A3 WO2011132890A3 (ko) | 2012-05-10 |
| WO2011132890A9 WO2011132890A9 (ko) | 2012-06-14 |
Family
ID=44834609
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2011/002712 Ceased WO2011132890A2 (ko) | 2010-04-19 | 2011-04-15 | 바이오 에탄올 생산 향상용 형질전환체 및 그 균주를 이용한 에탄올 생성방법 |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US8772000B2 (ko) |
| WO (1) | WO2011132890A2 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2506178A (en) * | 2012-09-25 | 2014-03-26 | Vib Vzw | Mutant yeast strain with decreased glycerol production |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AR097479A1 (es) * | 2013-08-29 | 2016-03-16 | Dsm Ip Assets Bv | Células convertidoras de glicerol y ácido acético con un transporte de glicerol mejorado |
| WO2016008819A1 (de) * | 2014-07-14 | 2016-01-21 | Jacobs University Bremen Ggmbh | Gentechnisch veränderte hefe mit verbessertem glycerol-katabolismus |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2060632A1 (en) * | 2007-10-29 | 2009-05-20 | Technische Universität Berlin | Method of modifying a yeast cell for the production of ethanol |
-
2011
- 2011-04-15 WO PCT/KR2011/002712 patent/WO2011132890A2/ko not_active Ceased
- 2011-04-15 US US13/641,946 patent/US8772000B2/en active Active
Non-Patent Citations (5)
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2506178A (en) * | 2012-09-25 | 2014-03-26 | Vib Vzw | Mutant yeast strain with decreased glycerol production |
Also Published As
| Publication number | Publication date |
|---|---|
| US20130109070A1 (en) | 2013-05-02 |
| WO2011132890A3 (ko) | 2012-05-10 |
| WO2011132890A9 (ko) | 2012-06-14 |
| US8772000B2 (en) | 2014-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bonnefoy et al. | Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1-mutation in Saccharomyces cerevisiae. | |
| WO2019027267A2 (ko) | Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법 | |
| WO2018124440A2 (ko) | 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법 | |
| WO2020135763A1 (zh) | 用于表达外源基因的毕赤酵母突变株 | |
| WO2019117398A1 (ko) | 5'-이노신산을 생산하는 미생물 및 이를 이용한 5'-이노신산의 생산 방법 | |
| CN112301013A (zh) | 复合酶及其在制备麦角硫因中的应用 | |
| WO2019203435A1 (ko) | 유기산 내성 효모 유래 신규 프로모터 및 이를 이용한 목적유전자의 발현방법 | |
| WO2022240071A1 (ko) | 카르노신, 히스티딘, 베타알라닌 생산용 재조합 미생물 및 이를 이용한 카르노신, 히스티딘, 베타알라닌의 생산방법 | |
| WO2021112469A1 (ko) | 신규한 분지쇄 아미노산 아미노트랜스퍼라제 변이체 및 이를 이용한 류신 생산방법 | |
| WO2022005225A1 (ko) | 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도 | |
| WO2020075986A2 (ko) | 알코올 생성이 억제된 재조합 내산성 효모 및 이를 이용한 젖산의 제조방법 | |
| KR101262999B1 (ko) | 바이오 에탄올 생산 향상용 피루브산 탈카르복실산 효소와 알코올 탈수소화 효소를 코딩하는 유전자가 도입된 형질전환체 및 그 균주를 이용한 에탄올 생성방법 | |
| WO2023121427A1 (ko) | 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법 | |
| WO2011132890A2 (ko) | 바이오 에탄올 생산 향상용 형질전환체 및 그 균주를 이용한 에탄올 생성방법 | |
| WO2012046924A1 (ko) | 아라비노스 대사경로가 도입된 자일리톨 생산균주 및 이를 이용한 자일리톨 생산방법 | |
| CN108624572B (zh) | 糖苷类化合物的甲基化转移酶基因 | |
| CN111944795B (zh) | 谷氨酸脱羧酶突变体及其应用 | |
| WO2012102552A2 (ko) | 3,6-안하이드로-l-갈락토오스에 작용하는 신규한 3,6-안하이드로-l-갈락토오스 데히드로게나제와 이 효소를 이용한 3,6-안하이드로 갈락토닉산의 생산 | |
| WO2020067618A1 (ko) | 알파-글루코시다제의 활성이 강화된 l-아미노산을 생산하는 미생물 및 이를 이용한 l-아미노산 생산 방법 | |
| WO2013103246A2 (ko) | 퀴놀린산을 생산하는 재조합 미생물 및 이를 이용한 퀴놀린산의 생산 방법 | |
| WO2018171400A1 (zh) | 阿卡波糖工程菌及其制备方法和应用 | |
| JP2002537759A5 (ko) | ||
| CN111690549A (zh) | 利用木糖生产原人参二醇的重组解脂耶氏酵母菌株及构建方法和应用 | |
| KR101259956B1 (ko) | 바이오 에탄올 생산 향상용 tata 결합 단백질 spt3 와 15가 유전자 삽입된 형질전환체 및 그 균주를 이용한 에탄올 생성방법 | |
| EP0483691A2 (en) | Xyloseisomerase gene of thermus aquaticus, xyloseisomerase and process for preparation of fructose |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11772178 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13641946 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11772178 Country of ref document: EP Kind code of ref document: A2 |


