WO2011131371A1 - Lipid binding nucleic acids - Google Patents

Lipid binding nucleic acids Download PDF

Info

Publication number
WO2011131371A1
WO2011131371A1 PCT/EP2011/002068 EP2011002068W WO2011131371A1 WO 2011131371 A1 WO2011131371 A1 WO 2011131371A1 EP 2011002068 W EP2011002068 W EP 2011002068W WO 2011131371 A1 WO2011131371 A1 WO 2011131371A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid molecule
nucleotides
nucleotide sequence
sip
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2011/002068
Other languages
English (en)
French (fr)
Inventor
Werner Purschke
Sven Klussmann
Klaus Buchner
Frank SCHWÖBEL
Kai HÖHLIG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
TME Pharma AG
Original Assignee
Noxxon Pharma AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Noxxon Pharma AG filed Critical Noxxon Pharma AG
Priority to JP2013505367A priority Critical patent/JP5941904B2/ja
Priority to US13/642,555 priority patent/US8871920B2/en
Priority to EP11716838A priority patent/EP2561079A1/en
Priority to CN201180024560.5A priority patent/CN102906265B/zh
Priority to AU2011244628A priority patent/AU2011244628B9/en
Publication of WO2011131371A1 publication Critical patent/WO2011131371A1/en
Priority to KR1020197016125A priority patent/KR102080142B1/ko
Priority to JP2013547842A priority patent/JP2014504865A/ja
Priority to US13/978,804 priority patent/US9976145B2/en
Priority to CA2824073A priority patent/CA2824073A1/en
Priority to EP12700093.3A priority patent/EP2663640B1/en
Priority to AU2012206750A priority patent/AU2012206750A1/en
Priority to CN201280007720XA priority patent/CN103339258A/zh
Priority to KR1020137017897A priority patent/KR20140026357A/ko
Priority to PCT/EP2012/000089 priority patent/WO2012095303A1/en
Anticipated expiration legal-status Critical
Priority to JP2017075557A priority patent/JP2017148055A/ja
Priority to US15/985,626 priority patent/US20190367921A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/92Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers

Definitions

  • the present invention is related to a nucleic acid molecule capable of a binding to a lipid, preferably a phospholipid, more preferably sphingosine 1 -phosphate, the use thereof for the manufacture of a medicament, a diagnostic agent, and a detecting agent, respectively, a composition comprising such nucleic acid molecule, a complex comprising such nucleic acid molecule, a method for screening of an antagonist of an activity mediated by the lipid or an analogue of a lipid using such nucleic nucleic acid molecule, and a method for the detection of such nucleic acid molecule.
  • Lipids and lipid derivatives are best known for their function as structural elements in cellular membranes or as a substrate for ⁇ -oxidation or glycolysis. More recently, lipids and lipid derivatives have become recognized as signaling molecules that play an important role in disease. There are many examples of bioactive lipid signaling molecules including phospholipids such as phosphatidyl inositol (abbr. PI), phosphatidyl serine (abbr. PS), diacylglyceride (abbr. DAG), phosphatidyl glycerol (abbr. PG) and phosphatidic acid (abbr. PA), lysophosphatidyl choline, platelet activating factor and cardiolipins.
  • phospholipids such as phosphatidyl inositol (abbr. PI), phosphatidyl serine (abbr. PS), diacylglyceride (abbr. DAG), phosphatidyl glycerol (abbr.
  • lipid signaling molecules include eicosanoids, which encompass cannabinoids, prostaglandins, isoeicosanoids and leukotrienes.
  • Lipids can act as second messengers or through the direct interaction with their own specific receptor. Lipid signaling pathways are activated through various different stimuli and are involved in the regulation of a diverse array of cellular processes including adhesion, motility, proliferation, apoptosis and differentiation. Sphingolipids and their derivatives have extracellular and intracellular signaling function and play important roles in human disease.
  • lipid signaling molecules include ceramide, ceramide-1 -phosphate, sphingomyelin, sphingosine, sphingosine- 1 -phosphate, sphinganine, and sphinganine-1 -phosphate.
  • Sphingosine 1 -phosphate is a 380 Dalton phospholipid with the molecular formula Ci 8 H 38 N0 P. Once considered simply a breakdown product of ceramide, SIP is now known to have an important function in diverse biological processes such as cell growth, cell proliferation, angiogenesis, and lymphocyte trafficking (for review see Kim et al., Biochim Biophys Acta. 2009 1791 :692-6; Maceyka et al, J Lipid Res. 2009 50 Suppl:S272-6; Takabe et al., Pharmacol Rev. 2008 60(2): 181-95).
  • SIP has antiapoptotic effects and promotes cell growth and proliferation. Its precursors sphingosine and ceramide have opposite functions, inducing cell cycle arrest and cell death. Because SIP and its precursors exhibit such opposing actions it is thought that the relative balance of the different sphingosine metabolites rather than their absolute amount - controlled primarily by the interplay of sphingosine phosphatases and sphingosine kinases - determines cell fate. This complex regulatory system is referred to as the "sphingolipid rheostat".
  • EDG EDG1/S 1 P
  • EDG5/S 1P 2 EDG3/S1P 3
  • EDG6/S1P 4 EDG8/S IP5
  • Each receptor couples to heterodimeric G-proteins (Gq, Gl , G12-13), activating downstream signaling molecules such as small GTPases of the Rho family (Zhou and Murthy, Am J Physiol Cell Physiol. 2004, 286:C1 130-Cl 138; Kume et al, J Pharmacol Exp Ther. 2007 320:766-773), mitogen-activated protein kinase (Guo et al., Eur J Biochem.
  • SIP S1PR-induced vascular tone
  • wound healing vascular tone
  • motility motility
  • morphogenesis proliferation and differentiation
  • SIP in the regulation of vascular tone, wound healing, trafficking of immune cells, neuronal signaling, angiogenesis, reproduction and cardiovascular function.
  • the spectrum of responses depends on the pattern of receptor expression in the cells and tissues and the corresponding effector.
  • activation of a particular SI PR can have the opposite effect than activation of another in, for example, endothelial cell (Lee et al., Mol Cell. 2001 8:693-704.; imura et al., Biochem J. 2000 348:71-76.; Ryu et al., Circ Res. 2002 90:325-332.).
  • Activation of one S 1PR can differentially regulate GTPases of the Rho family (Garcia et al., J Clin Invest. 2001 108:689-701 ; Gon et al., Proc Natl Acad Sci USA. 2005 102:9270-9275; Liu et al., J Clin Invest. 2000 106:951-961). In addition, there is crosstalk to other growth factor signaling pathways.
  • SIP present in circulating blood and lymph is made primarily by platelets, activated mast cells and mononuclear phagocytes, and secreted.
  • S IP is found at concentrations between 0.1 to 1 mM, sometimes up to 5 mM, but only a fraction is available to activate SIPRs as most SIP is bound to albumin or other plasma proteins.
  • the alteration of the endogenous levels of S 1 P can lead to pathophysiological conditions, including inflammation and autoimmune diseases, asthma, angiogenesis, heart disease, cancer, ocular disease, and cerebrovascular disease.
  • Another approach to interfere with SIP dependent pathophysiology is to affect the endogenous SIP levels. This could be achieved by targeting S IP kinases to alter the amount of SIP made through phorsphorylation of sphingosine or by targeting SIP phosphatases to affect the amount of SIP that is being dephosphorylated.
  • Another approach to affect the endogenous levels of bioactive S 1 P is through the direct inhibition of SIP effects by a molecular interaction with a neutralizing agent. The present invention describes a way to neutralize SIP.
  • a still further problem underlying the present invention is to provide a means for the manufacture of a diagnostic agent for the diagnosing of a disease, whereby the disease is characterized by a lipid, preferably a phospholipid, more preferably SIP being, either directly or indirectly involved in the pathogenetic mechanism of such disease.
  • the problem underlying the present invention is solved in a first aspect which is also the first embodiment of the first aspect, by a nucleic acid molecule capable of binding to a lipid.
  • the nucleic acid is an antagonist of an activity mediated by the lipid.
  • the lipid is a phospholipid, preferably the phospholipid is sphingosine 1 -phosphate.
  • the nucleic acid molecule comprises a central stretch of nucleotides, wherein the central stretch of nucleotides comprises a nucleotide sequence of
  • the central stretch of nucleotides comprises a nucleotide sequence selected from the group of 5' AAUAGCCGUUGAAACGCCUUUAGAGAAGCACUAG 3', 5' AAUAGCCGAUGAAACGCCUUUAGAGAAGCACUAG 3' and
  • the nucleic acid molecule comprises in 5'->3' direction a first terminal stretch of nucleotides, the central stretch of nucleotides and a second terminal stretch of nucleotides, wherein the first terminal stretch of nucleotides comprises three to six nucleotides, and the second terminal stretch of nucleotides comprises three to six nucleotides.
  • the nucleic acid molecule comprises in 5'->3' direction a second terminal stretch of nucleotides, the central stretch of nucleotides and a first terminal stretch of nucleotides, wherein the first terminal stretch of nucleotides comprises three to six nucleotides, and the second terminal stretch of nucleotides comprises three to six nucleotides.
  • the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' X ⁇ XaSUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CASX4X5X6 3', wherein
  • the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XiX 2 X 3 SUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CASX4X 5 X 6 3', wherein
  • Xi is A, X 2 is G, X 3 is S, * is S, X 5 is C, and X is U or
  • Xi is absent, X 2 is G, X 3 is S, t is S, X 5 is C, and X 6 is U or
  • Xi is A, X 2 is G, X 3 is S, 3 ⁇ 4 is S, X 5 is C, and X is absent or
  • Xi is absent, X 2 is G, X 3 is S, X» is S, X 5 is C, and X is absent.
  • the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' AGCGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACGCU 3' or b) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACGC 3'.
  • the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XiX 2 X 3 SUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CASX4X 5 X 6 3', wherein
  • Xi is absent, X 2 is absent, X 3 is S, X 4 is S, X 5 is C, and X 6 is absent or
  • Xi is absent, X 2 is G, X 3 is S, X 4 is S, X 5 is absent, and X 6 is absent or
  • a) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' CGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACG 3' or b) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CAGC 3' or c) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACC 3', preferably the first terminal stretch
  • the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' XjX 2 X 3 SUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CAS jXsXe 3', wherein
  • Xi is absent, X 2 is absent, X 3 is S or absent, X4 is S or absent, X 5 is absent, and X is absent.
  • the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CAC 3'.
  • the central stretch of nucleotides is essential for binding to sphingosine 1 -phosphate.
  • the first terminal stretch of nucleotides and the second terminal stretch of nucleotides optionally hybridize with each other, wherein upon hybridization a double-stranded structure is formed.
  • the double-stranded structure consists of three to six basepairs.
  • the nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ. ID. Nos 12 to 26, 41 and 42, preferably a nucleotide sequence according to any one of SEQ.ID.Nos 12, 13, 15, 18, 19, 23 to 26, 41 and 42, more preferably a nucleotide sequence according to any one of SEQ ID Nos 12, 18, 23, 24, 41 and 42.
  • the nucleic acid molecule comprises a nucleotide sequence according to SEQ. ID. NO. 18 or a nucleic acid molecule which is homologous thereto, wherein the homology is at least 85%.
  • the nucleic acid molecule comprises a nucleotide sequence according to SEQ. ID. N0.41 or a nucleic acid molecule which is homologous thereto, wherein the homology is at least 85%.
  • the nucleic acid molecule comprises a nucleotide sequence according to SEQ. ID. NO. 42 or a nucleic acid molecule which is homologous thereto, wherein the homology is at least 85%.
  • the affinity of the nucleic acid molecule is increased compared to a reference nucleic acid molecule, wherein the reference nucleic acid molecule comprises a nucleotide sequence according to SEQ. ID. NO.
  • nucleic acid molecule consists of ribonucleotides
  • nucleic acid molecule comprises a nucleotide sequence according to SEQ. ID. NO. 18 and wherein one or more nucleotides of the nucleotide sequence according to SEQ. ID. No. 18 is a deoxyribonucleotide rather than a ribonucleotide.
  • the nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ.ID.Nos 27 to 37, 39 and 40, preferably a nucleotide sequence according to any one of SEQ.ID.Nos 30, 34 to 37, 39 and 40, more preferably a nucleotide sequence according to any one of SEQ. ID. Nos. 36, 37, 39 and 40.
  • the nucleic acid molecule comprises a nucleotide sequence according to SEQ. ID. NO. 36 or a nucleic acid molecule which is homologous thereto, wherein the homology is at least 85%, wherein the homologous nucleic acid comprises ribonucleotides and at least one deoxyribonucleotide.
  • the nucleic acid molecule comprises a modification group, wherein excretion rate from an organism of the nucleic acid molecule comprising the modification group is decreased compared to a nucleic acid not comprising the modification group.
  • the nucleic acid molecule comprises a modification group, wherein the nucleic acid molecule comprising the modification group has an increased retention time in an organism compared to a nucleic acid molecule not comprising the modification group.
  • the modification group is selected from the group comprising biodegradable and non-biodegradable modifications, preferably the modification group is selected from the group comprising of polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate and poly (2- hydroxyethyl)-L-glutamine.
  • the modification group is a polyethylene glycol, preferably consisting of a linear polyethylene glycol or branched polyethylene glycol wherein the molecular weight of the polyethylene glycol is preferably from about 20,000 to about 120,000 Da, more preferably from about 30,000 to about 80,000 Da and most preferably about 40,000 Da.
  • the modification group is hydroxyethyl starch, wherein preferably the molecular weight of the hydroxyethyl starch is from about 50 to about 1000 kDa, more preferably from about 100 to about 700 kDa and most preferably from 200 to 500 kDa.
  • the modification group is coupled to the nucleic acid molecule via a linker, whereby preferably the linker is a biodegradable linker.
  • the modification group is coupled to the 5 '-terminal nucleotide and/or the 3 '-terminal nucleotide of the nucleic acid molecule and/or to a nucleotide of the nucleic acid molecule between the 5 '-terminal nucleotide of the nucleic acid molecule and the 3 '-terminal nucleotide of the nucleic acid molecule.
  • the organism is an animal or a human body, preferably a human body.
  • the nucleotides of or the nucleotides forming the nucleic acid molecule are L- nucleotides.
  • the nucleic acid molecule is an L-nucleic acid.
  • the nucleic acid molecule comprises at least one binding moiety which is capable of binding sphingosine 1 -phosphate, wherein such binding moiety consists of L-nucleotides.
  • the nucleic acid molecule is for use in a method for the treatment and/or prevention of a disease.
  • the disease is treated or ameliorated by inhibition of angiogenensis and/or fibrosis.
  • the disease is an ocular diseases, preferably such ocular disease is selected from the group comprising age-related macular degeneration, diabetic retinopathy with diabetic macular edema, retinal pigmented epithelium detachment in either age-related macular degeneration or diabetic retinopathy, proliferative vitreoretinopathy and retinal fibrosis in age-related macular degeneration or diabetic retinopathy.
  • the disease is treated or ameliorated by inhibition of angiogenensis and/or proliferation.
  • the disease is cancer, preferably such cancer is selected from the group comprising breast cancer, ovarian cancer, melanoma, lung cancer, hyperplasia such as prostate hyperplasia.
  • the disease is an inflammatory disease, wherein such inflammatory disease is selected from the group comprising autoimmune disease, pneumonia, sepsis and trauma such as ventilator-induced lung injury.
  • the autoimmune disease is selected from the group comprising multiple sclerosis, rheumatoid arthritis, psoriasis, asthma and inflammatory bowel disease.
  • a pharmaceutical composition comprising a nucleic acid molecule as defined in any one of the embodiments of the first aspect and optionally a further constituent, wherein the further constituent is selected from the group comprising pharmaceutically acceptable excipients, pharmaceutically acceptable carriers and pharmaceutically active agents.
  • the pharmaceutical composition comprises a nucleic acid molecule as defined in any one of the embodiments of the first aspect and a pharmaceutically acceptable carrier.
  • a third aspect which is also the first embodiment of the third aspect, by the use of a nucleic acid molecule according to any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty- ninth, the fortieth, the forty-first and the forty-second embodiment of the first aspect for
  • the medicament is for use in human medicine or for use in veterinary medicine.
  • a fourth aspect which is also the first embodiment of the fourth aspect, by the use of a nucleic acid molecule according to any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty- ninth, the fortieth, the forty-first and the forty-second embodiment of the first aspect for
  • the medicament is for the treatment and/or prevention of ocular diseases, cancer, or inflammatory disease.
  • the ocular disease is selected from the group comprising age-related macular degeneration, diabetic retinopathy with diabetic macular edema, retinal pigmented epithelium detachment in either age-related macular degeneration or diabetic retinopathy, proliferative vitreoretinopathy and retinal fibrosis in age-related macular degeneration or diabetic retinopathy.
  • the cancer is selected from the group comprising breast cancer, ovarian cancer, melanoma, lung cancer, hyperplasia such prostate hyperplasia.
  • the inflammatory disease is selected from the group comprising autoimmune disease, pneumonia, sepsis and trauma such as ventilator-induced lung injury.
  • the autoimmune disease is selected from the group comprising multiple sclerosis, rheumatoid arthritis, psoriasis, asthma and inflammatory bowel disease.
  • a complex comprising a nucleic acid molecule according to any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty- second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty-ninth, the fortieth, the forty-first and the forty-second embodiment of
  • the lipid is a phospholipid, preferably the phospholipid is sphingosine 1- phosphate.
  • a sixth aspect which is also the first embodiment of the sixth aspect, by the use of a nucleic acid molecule according to any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty- ninth, the fortieth, the forty-first and the forty-second embodiment of the first aspect for
  • a seventh aspect which is also the first embodiment of the seventh aspect, by a method for the screening of an antagonist of an activity mediated by a lipid or an analogue of the lipid comprising the following steps: providing a candidate antagonist of the of the activity mediated by the lipid and/or an analogue of the lipid, providing a nucleic acid as defined in any one of the embodiments of the first aspect, providing a test system which provides a signal in the presence of an antagonist of the activity mediated by the lipid and/or an analogue of the lipid, and
  • the lipid is a phospholipid, preferably the phospholipid is sphingosine 1 -phosphate.
  • kits for the detection of a lipid comprising a nucleic acid molecule according to any one of the first, the second, the third, the fourth, the fifth, the sixth, the seventh, the eighth, the ninth, the tenth, the eleventh, the twelfth, the thirteenth, the fourteenth, the fifteenth, the sixteenth, the seventeenth, the eighteenth, the nineteenth, the twentieth, the twenty-first, the twenty-second, the twenty-third, the twenty-fourth, the twenty-fifth, the twenty-sixth, the twenty-seventh, the twenty-eighth, the twenty-ninth, the thirtieth, the thirty-first, the thirty-second, the thirty-third, the thirty-fourth, the thirty-fifth, the thirty-sixth, the thirty-seventh, the thirty-eighth, the thirty-ninth, the fortieth, the forty-first
  • a ninth aspect which is also the first embodiment of the ninth aspect, by a method for the detection of a nucleic acid as defined in any one of the embodiments of the first aspect in a sample, wherein the method comprises the steps of: a) providing a capture probe, wherein the capture probe is at least partially complementary to a first part of the nucleic acid molecule as defined in any one of the embodiments of the first aspect, and a detection probe, wherein the detection probe is at least partially complementary to a second part of the nucleic acid molecule as defined in any one of the embodiments of the first aspect, or, alternatively, the capture probe is at least partially complementary to a second part of the nucleic acid molecule as defined in any one of the embodiments of the first aspect and the detection probe is at least partially complementary to the first part of the nucleic acid molecule as defined in any one of the embodiments of the first aspect;
  • step a) optionally detecting whether or not the capture probe is hybridized to the nucleic acid molecule as defined any one of the embodiments of the first aspect provided in step a);
  • the detection probe comprises a detection means, and/or wherein the capture probe is immobilized to a support, preferably a solid support.
  • any detection probe which is not part of the complex is removed from the reaction so that in step e) only a detection probe which is part of the complex, is detected.
  • step e) comprises the step of comparing the signal generated by the detection means when the capture probe and the detection probe are hybridized in the presence of the nucleic acid molecule as defined in any one of the embodiments of the first aspect or part thereof, and in the absence of said nucleic acid or part thereof.
  • the present invention is based on the surprising finding that:
  • lipid preferably a phospholipid, more preferably SIP;
  • nucleic acid molecules which are nucleic molecules according to the present invention, share a consensus sequence of nucleotides, wherein the consensus sequence of the nucleic acid molecules according to the present invention is preferably essential for the binding charateristics of the nucleic acid molecules according to the present invention, more preferably essential for the binding to SIP;
  • c) the binding affinity to a lipid, preferably to a phospholipid, more preferably to SIP of nucleic acid molecules according to the present invention would be improved by replacing a limited number of ribonucleotides by 2'-deoxyribonucleotides.
  • nucleic acids are preferably also referred to herein as the nucleic acid molecules according to the present invention, the nucleic acids according to the present invention, the inventive nucleic acids or the inventive nucleic acid molecules.
  • nucleic acid and nucleic acid molecule are used herein in a synonymous manner if not indicated to the contrary.
  • the features of the nucleic acid according to the present invention as described herein can be realised in any aspect of the present invention where the nucleic acid is used, either alone or in any combination.
  • nucleic acid molecules having high binding affinity, to a lipid, a phospholipid and in particular SIP could be identified, is insofar surprising as no nucleic acid molecules binding to a lipid, a phospholipid and in particular SIP could be identified so far, although nucleic acid molecules directed to almost all target classes such peptides, proteins, nucleic acids, small molecules, antibiotics, amino acids, nucleotides were identified as described in 'The aptamer handbook' (Klussmann, Klussmann, S. (eds.); The Aptamer Handbook, 1. Edition - February 2006, Wiley- VCH, Weinheim).
  • a phospholipid such as S 1 P is mainly characterized by its uncharged aliphatic moiety and the one negatively charged phosphate group. Taking the charge and the negative charge of the phosphate group of such lipid into account, it is surprising that the inventors could identify nucleic acid molecules binding to a lipid, and more specifically to a phospholipid. Due to the phosphates in the sugar backbone of nucleic acid molecules, nucleic acid molecules themselves are negatively charged. Therefore, binding of a nucleic acid molecule to another negatively charged molecule or moiety is not very likely.
  • nucleic acid molecules having a three-dimensional structure Apart from charge repulsion also seize affects the accessibility of target molecules by nucleic acid molecules having a three-dimensional structure.
  • nucleic acid molecules against small molecules have affinities in the micromolar range (James, 2000 Encyclopedia of Analytical Chemistry, pp. 4848-4871) which renders them inappropriate for therapeutic use.
  • the best SIP binding nucleic acid molecules according to the present invention show high binding affinities, expressed by K D values, which allow the use of such nucleic acid molecules in vivo, more specifically in a method for treatment or diagnosis of a mammal, preferably man.
  • the KD value of the nucleic acid molecules according to the present invention is less than 100 nM, more preferably less than 50 nM.
  • the nucleic acid molecules according to the invention have a KD value which is equal to or less than any value defined by the range from 5 to 53 nM.
  • the nucleic acid molecules according to the invention have an IC 50 value which is equal to or less than any value defined by the range from 5 to 31 nM.
  • the nucleic acid molecules according to the present invention bind specifically SIP (also referred to as D-erythro-sphingosine-1 -phosphate), but not to D-erythro-sphingosine lackinh the phosphate group.
  • nucleic acid molecules according to the present invention are preferably antagonists of an activity mediated by a lipid, preferably by a phospholipid, more preferably by SIP.
  • SIP receptor antagonists and agonists have been identified and described, which, because of their binding to said lipid, have an impact on these lipid mediated activity/activities.
  • nucleic acid molecules according to the present invention are antagonist of SIP and thereby mediate the functions of all SIP receptors rather than addressing and more spefically binding to a single S 1 P receptor
  • Lipids according to the present invention are, preferably selected from the group, comprsing waxes, sterols, fat-soluble vitamins (such as vitamins A, D, E and ), monoglycerides, diglycerides, phospholipids, and others, but not limited thereto.
  • Lipids may be broadly defined as hydrophobic or amphiphilic small molecules; the amphiphilic nature of some lipids allows them to form structures such as vesicles, liposomes, or membranes in an aqueous environment.
  • Biological lipids originate entirely or in part from two distinct types of biochemical subunits or "building blocks": ketoacyl and isoprene groups. Using this approach, lipids may be divided into eight categories: fatty acyls, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, polyketides (derived from condensation of ketoacyl subunits), sterol lipids and prenol lipids (derived from condensation of isoprene subunits).
  • lipid is sometimes used as a synonym for fats, fats are a subgroup of lipids called triglycerides. Lipids also encompass molecules such as fatty acids and their derivatives (including tri-, di-, and monoglycerides and phospholipids), as well as other sterol-containing metabolites such as cholesterol.
  • Phospholipids are a class of lipids and are a major component of all cell membranes as they can form lipid bilayers. Most phospholipids contain a diglyceride, a phosphate group, and a simple organic molecule such as choline; one exception to this rule is sphingomyelin, which is derived from sphingosine instead of glycerol.
  • Sphingolipids are a class of lipids derived from the aliphatic amino alcohol sphingosine.
  • the long-chain bases sometimes simply known as sphingoid bases, are the first non-transient products of de novo sphingolipid synthesis in both yeast and mammals.
  • These compounds specifically known as phytosphingosine and dihydrosphingosine (also known as sphinganine, although this term is less common), are mainly C 18 compounds, with somewhat lower levels of C20 bases.
  • Ceramides and glycosphingolipids are N-acyl derivatives of these compounds.
  • the sphingosine backbone is O-linked to a (usually) charged head group such as ethanolamine, serine, or choline.
  • the backbone is also amide-linked to an acyl group, such as a fatty acid.
  • Sphingosine 1 -phosphate (abbr. SIP) is a 380 Dalton phospholipid with the molecular formula C, 8 H 38 N0 5 P. Synonyms of SIP are
  • the S I P binding nucleic acid molecules of the present invention can be characterised in terms of stretches of nucleotides which are also referred to herein as Boxes.
  • the different types of S 1 P binding nucleic acids comprise different stretches of nucleotides.
  • SIP binding nucleic acid molecules of the present invention comprise at their 5 '-end and the 3' -end terminal stretches of nucleotides: the first terminal stretch of nucleotides and the second terminal stretch of nucleotides.
  • the first terminal stretch of nucleotides and the second terminal stretch of nucleotides can hybridize to each other, whereby upon hybridization a double-stranded structure is formed.
  • the three stretches of nucleotides of SIP binding nucleic acids - the first terminal stretch of nucleotides, the central stretch of nucleotides and second terminal stretch of nucleotides - are arranged to each other in 5' - 3 '-direction: the first terminal stretch of nucleotides - the central stretch of nucleotides - the second terminal stretch of nucleotides.
  • the second terminal stretch of nucleotides, the central stretch of nucleotides and the terminal first stretch of nucleotides are arranged to each other in 5' - 3'- direction.
  • the differences in the sequences of the defined boxes or stretches between the different S IP binding nucleic acid molecules influences the binding affinity to SIP.
  • the central stretch and their nucleotide sequences as are individually and more preferably in their entirety essential for binding to human SIP.
  • nucleic acid moleculess according to the present invention or stretches thereof or any part(s) thereof can, in principle, hybridise with each other. Upon such hybridisation a double-stranded structure is formed. It will be acknowledged by the ones skilled in the art that such hybridisation may or may not occur, particularly under in vitro and/or in vivo conditions. Also, in case of such hybridisation, it is not necessarily the case that the hybridisation occurs over the entire length of the two stretches where, at least based on the rules for base pairing, such hybridisation and thus formation of a double-stranded structure may, in principle, occur.
  • a double-stranded structure is a part of a molecule or a structure formed by two or more separate strands or two spatially separated stretches of a single strand, whereby at least one, preferably two or more base pairs exist which are base- pairing preferably in accordance with the Watson-Crick base pairing rules. It will also be acknowledged by the one skilled in the art that other base pairing such as Hoogsten base pairing may exist in or form such double-stranded structure.
  • arrangement means the order or sequence of structural or functional features or elements described herein in connection with the nucleic acid moleculess disclosed herein.
  • the nucleic acid molecules according to the present invention are capable of binding of the molecules of the present invention to SIP.
  • SIP binding results from a combination of three-dimensional structural traits or elements of the individual nucleic acid molecule, which are caused by orientation and folding patterns of the sequence of nucleotides forming such traits or elements, whereby preferably such traits or elements are the first terminal stretch of nucleotides, the central stretch of nucleotides and for the second terminal stretch of nucleotides of the SIP binding nucleic acid molecules.
  • the individual trait or element may thus be formed by various different individual sequences the degree of variation of which may vary depending on the three-dimensional structure such element or trait has to form.
  • the overall binding characteristic of the nucleic acid molecule results from the interplay of the various elements and traits, respectively, which ultimately results in the interaction and more specifically binding of the nucleic acid molecule with its target, i. e. SIP.
  • SIP target
  • the central stretch that is characteristic for SIP binding nucleic acid moelculess of the present invention seems to be important for mediating and/or establisingthe binding of the claimed nucleic acid with SIP.
  • the nucleic acid moleculess according to the present invention are suitable for the detection of SIP.
  • nucleic acid molecules according to the present invention are antagonists of an activity mediated by the SIP Because of this the nucleic acid moleculess according to the present invention are suitable for the treatment and prevention, respecticely, of any disease which is associated with or caused by either SIP.
  • the scientific rational may be taken from the prior art which establishes that SIP is involved or associated with a variety of diseases and conditions, respectively, and which is incorporated herein by reference.
  • the nucleic acid molecules according to the present invention shall also comprise nucleic acid molecules which are substantially homologous to the particular sequences, and preferably the particular sequences of the nucleic acid moelcules according to the present invention disclosed herein.
  • the term substantially homologous shall be understood such that the homology is at least 75%, preferably 85%, more preferably 90% and most preferably more than 95 %, 96 %, 97 %, 98 % or 99%.
  • the actual percentage of homologous nucleotides present in the nucleic acid molecule according to the present invention relative to a reference nucleotide sequence or reference nucleic acid molecule according to the present invention will depend on the total number of nucleotides present in the nucleic acid molecule. The percent modification can be based upon the total number of nucleotides present in the nucleic acid molecule.
  • the homologous nucleotides of the nucleic acid molecule of the present invention are selected from the group comprising ribonucleotides and 2'-deoxyribonucleotides.
  • the homology can be determined as known to the person skilled in the art. More specifically, a sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • the test sequence is preferably the sequence or nucleic acid molecule which is said to be or to be tested whether it is homologous, and if so, to what extent, to another nucleic acid molecule, whereby such another nucleic acid molecule is also referred to as the reference sequence.
  • the reference sequence is a nucleic acid molecule as described herein, more preferably a nucleic acid molecule having a sequence according to any SEQ.ID.No 12, 18, 36, 41 and 42.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman (Smith & Waterman, 1981 ) by the homology alignment algorithm of Needleman & Wunsch (Needleman & Wunsch, 1970) by the search for similarity method of Pearson & Lipman (Pearson & Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection.
  • BLAST basic local alignment search tool
  • NCBI National Center for Biotechnology Information
  • the nucleic acid molecule according to the present invention shall also comprise those nucleic acid molecules comprising one or several of the nucleic acid sequences disclosed herein or part thereof, preferably to the extent that the nucleic acid molecules or said parts are involved in the binding to human SIP.
  • Such nucleic acid molecule is, in an embodiment, one of the nucleic acid molecules described herein, or a derivative and/or a metabolite thereof, whereby such derivative and/ or metabolite are preferably a truncated nucleic acid molecule compared to the nucleic acid molecules described herein. Truncation may be related to either or both of the ends of the nucleic acid molecules as disclosed herein.
  • truncation may be related to the inner sequence of nucleotides of the nucleic acid molecule, i.e. it may be related to the nucleotide(s) between the 5' and the 3' terminal nucleotide, respectively. Moreover, truncation shall comprise the deletion of as little as a single nucleotide from the sequence of the nucleic acid molecule s disclosed herein. Truncation may also be related to one or more than one stretch of the nucleic acid molecule(s) of the present invention, whereby the stretch can be as little as one nucleotide long.
  • binding of a nucleic acid molecule according to the present invention can be determined by the ones skilled in the art molecule using routine experiments or by using or adopting a method as described herein, preferably as described herein in the example part.
  • the nucleic acid molecules according to the present invention may be either D-nucleic acid molecules (D-nucleic acid molecules) or L-nucleic acids (L-nucleic acid molecules).
  • the nucleic acids are L-nucleic acid molecules.
  • one or several parts of the nucleic acid molecule are present as D-nucleic acids or at least one or several parts of the nucleic acids are L-nucleic acids.
  • the term "part" of the nucleic acids molecule shall mean as little as one nucleotide.
  • Such nucleic acid molecules are generally referred to herein as D- and L- nucleic acids, respectively.
  • the nucleic acid molecules according to the present invention consist of L-nucleotides and comprise at least one D-nucleotide.
  • D-nucleotide is preferably attached to a part different from the stretches defining the nucleic acids according to the present invention, preferably those parts thereof, where an interaction with other parts of the nucleic acid moleculeis involved.
  • such D- nucleotide is attached at a terminus of any of the stretches and of any nucleic acid molecule according to the present invention, respectively.
  • such D- nucleotides may act as a spacer or a linker, preferably attaching modifications or modification groups, such as PEG and HES to the nucleic acids according to the present invention.
  • nucleic acid molecules described herein in their entirety in terms of their nucleic acid sequence(s) are limited to the particular nucleotide sequence(s).
  • the terms “comprising” or “comprise(s)” shall be interpreted in such embodiment in the meaning of containing or consisting of.
  • nucleic acid molecules according to the present invention are part of a longer nucleic acid molecule whereby this longer nucleic acid comprises several parts whereby at least one such part is a nucleic acid molecule according to the present invention, or a part thereof.
  • the other part(s) of these longer nucleic acid molecules can be either one or several D-nucleic acid(s) or one or several L-nucleic acid(s). Any combination may be used in connection with the present invention.
  • These other part(s) of the longer nucleic acid either alone or taken together, either in their entirety or in a particular combination, can exhibit a function which is different from binding, preferably from binding to SIP.
  • nucleic acid molecules according to the invention comprise, as individual or combined moieties, several of the nucleic acid molecules of the present invention.
  • nucleic acid moleculecomprising several of the nucleic acid molecules of the present invention is also encompassed by the term longer nucleic acid molecule.
  • L-nucleic acids or L-nucleic acid molecules as used herein are nucleic acids consisting of L- nucleotides, preferably consisting completely of L-nucleotides.
  • D-nucleic acids or D-nucleic acid molecules as used herein are nucleic acids consisting of D- nucleotides, preferably consisting completely of D-nucleotides.
  • any nucleotide sequence is set forth herein in 5' -» 3' direction.
  • any position of a nucleotide is determined or referred to relative to the 5' end of a sequence, a stretch or a substretch.
  • a second nucleotide is the second nucleotide counted from the 5' end of the sequence, stretch and substretch, respectively.
  • a penultimate nucleotide is the seond nucleotide counted from the 3' end of a sequence, stretch and substretch, respectively.
  • the nucleic acid molecule of the present invention consists of D- nucleotides, L-nucleotides or a combination of both with the combination being e.g. a random combination or a defined sequence of stretches consisting of at least one L-nucleotide and at least one D-nucleic acid
  • the nucleic acid may consist of desoxyribonucleotide(s), ribonucleotide(s) or combinations thereof.
  • L-nucleic acid molecules are enantiomers of naturally occurring nucleic acid molecules.
  • D-nucleic acid molecules are not very stable in aqueous solutions and particularly in biological systems or biological samples due to the widespread presence of nucleases.
  • Naturally occurring nucleases, particularly nucleases from animal cells are not capable of degrading L-nucleic acid molecules. Because of this the biological half-life of the L-nucleic acid moleculeis significantly increased in such a system, including the animal and human body.
  • L-nucleic acid molecules which specifically bind to a target molecule through a mechanism different from Watson Crick base pairing, or aptamers which consists partially or completely of L-nucleotides, particularly with those parts of the aptamer being involved in the binding of the aptamer to the target molecule, are also called Spiegelmers.
  • the inventive nucleic acid molecule of the present inventions may be present as single-stranded or double-stranded nucleic acids.
  • the nucleic acids molecules according to the present invention are single-stranded nucleic acids which exhibit defined secondary structures due to the primary sequence and may thus also form tertiary structures.
  • the nucleic acids molecules according to the present invention may also be double-stranded in the meaning that two strands which are complementary or partially complementary to each other are hybridised to each other. This confers stability to the nucleic acid molecule which, in particular, will be advantageous if the nucleic acid molecule is present in the naturally occurring D-form rather than the L-form.
  • the nucleic acid molecules of the present invention may be modified. Such modifications may be related to the single nucleotide of the nucleic acid moleculeand are well known in the art. Examples for such modification are described in, among others, Venkatesan (2003); Kusser (2000); Aurup (1994); Cummins (1995); Eaton (1995); Green (1995); Kawasaki (1993); Lesnik (1993); and Miller (1993). Such modification can be a H atom, a F atom or 0-CH3 group or NH2-group at the 2' position of the individual nucleotide of which the nucleic acid molecule consists. Also, the nucleic acid molecule according to the present invention can comprise at least one LNA nucleotide. In an embodiment the nucleic acid molecule according to the present invention consists of LNA nucleotides.
  • the present inventors surprisingly found that non-chemical modificactions or substitutions in a SIP binding RNA molecule of the present invention, i.e. an L-nucleic acid molecule of the present invention consisting of L-ribonucleotides, lead to an improved binding affinity of the SIP binding RNA molecule of the present invention in comparison to the parent SIP binding RNA nucleic acid molecule according to the present invention, i.e. a nucleic acid molecule of the present invention consisting of ribonucleotides, without such non-chemical modificaction(s) or substitution(s).
  • the non-chemical modification or substitions are preferably selected from the group of replacingone or more L-ribonucleotide(s) in an RNA nucleic acid molecule according to the present invention, i.e. a nucleic acid molecule of the present invention consisting of ribonucleotides by one or more L-deoxyribonucleotide(s).
  • binding affinity of an S 1 P binding nucleic acid - the RNA aptmer L-S1P-215-F9-002 solely consisting of ribonucleotides - was improved by replacingup to five ribonucleotides by up to five deoxyribonucleotides, preferably by replacingfour ribonucleotides by four deoxyribonucleotides.
  • the nucleic acid molecule according to the present invention may be a multipartite nucleic acid.
  • a multipartite nucleic acid molecule as used herein, is a nucleic acid which consists of at least two nucleic acid strands. These at least two nucleic acid strands form a functional unit whereby the functional unit is a ligand to a target molecule.
  • the at least two nucleic acid strands may be derived from any of the inventive nucleic acid molecule s by either cleaving the nucleic acid to generate two strands or by synthesising one nucleic acid corresponding to a first part of the inventive, i.e.
  • nucleic acid molecule and another nucleic acid corresponding to the second part of the overall nucleic acid molecule. It is to be acknowledged that both the cleavage and the synthesis may be applied to generate a multipartite nucleic acid where there are more than two strands as exemplified above. In other words, the at least two nucleic acid strands are typically different from two strands being complementary and hybridising to each other although a certain extent of complementarity between the various nucleic acid parts may exist.
  • a fully closed, i.e. circular structure for the nucleic acids according to the present invention is realized, i.e. that the nucleic acids according to the present invention are closed, preferably through a covalent linkage, whereby more preferably such covalent linkage is made between the 5' end and the 3' end of the nucleic acid sequences as disclosed herein.
  • the present inventors have discovered that the nucleic acids according to the present invention exhibit a very favourable KD value range.
  • a possibility to determine the binding constants of the nucleic acid molecules according to the present invention is the use of surface plasmon resonance as described in example 4 and 6 which confirms the above finding that the nucleic acids according to the present invention exhibit a favourable KD value range.
  • An appropriate measure in order to express the intensity of the binding between the individual nucleic acid molecule and to the target which is in the present case SIP, is the so-called D value which as such as well the method for its determination are known to the one skilled in the art.
  • the nucleic acids according to the present invention are characterized by a certain KD value.
  • the KD value shown by the nucleic acids according to the present invention is below 1 ⁇ .
  • a KD value of about 1 ⁇ is said to be characteristic for a non-specific binding of a nucleic acid to a target.
  • the KD value of a group of compounds such as the nucleic acids according to the present invention are within a certain range.
  • the above-mentioned KD of about 1 ⁇ is a preferred upper limit for the KD value.
  • the preferred lower limit for the KD of target binding nucleic acids can be about 10 picomolar or higher.
  • the KD values of individual nucleic acids binding to SIP is preferably within this range.
  • Preferred ranges can be defined by choosing any first number within this range and any second number within this range.
  • Preferred upper values are 250 nM and 100 nM, preferred lower values are 50 nM, 10 nM, 1 nM, 100 pM and 10 pM.
  • the nucleic acid molecules according to the present invention may have any length provided that they are still able to bind to the target molecule. It will be acknowledged in the art that there are preferred lengths of the nucleic acids according to the present inventions. Typically, the length is between 15 and 120 nucleotides. It will be acknowledged by the ones skilled in the art that any integer between 15 and 120 is a possible length for the nucleic acids according to the present invention. More preferred ranges for the length of the nucleic acids according to the present invention are lengths of about 20 to 100 nucleotides, about 20 to 80 nucleotides, about 20 to 60 nucleotides, about 20 to 50 nucleotides and about 30 to 50 nucleotides.
  • the nucleic acids disclosed herein comprise a moiety which preferably is a high molecular weight moiety and/or which preferably allows to modify the characteristics of the nucleic acid in terms of, among others, residence time in the animal body, preferably the human body.
  • a particularly preferred embodiment of such modification is PEGylation and HESylation of the nucleic acids according to the present invention.
  • PEG stands for poly(ethylene glycole) and HES for hydroxyethly starch.
  • PEGylation as preferably used herein is the modification of a nucleic acid according to the present invention whereby such modification consists of a PEG moiety which is attached to a nucleic acid according to the present invention.
  • HESylation as preferably used herein is the modification of a nucleic acid according to the present invention whereby such modification consists of a HES moiety which is attached to a nucleic acid according to the present invention.
  • the modifications such as linear poly (ethylene) glycol, branched poly (ethylene) glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate, poly (2- hydroxyethyl)-L-glutamine and polyethylene glycol as well as the process of modifying a nucleic acid using such modifications, is described in European patent application EP 1 306 382, the disclosure of which is herewith incorporated in its entirety by reference.
  • the molecular weight is preferably about 20,000 to about 120,000 Da, more preferably from about 30,000 to about 80,000 Da and most preferably about 40,000 Da.
  • the molecular weight is is preferably from about 50 to about 1000 kDa, more preferably from about 100 to about 700 kDa and most preferably from 200 to 500 kDa.
  • HES exhibits a molar substitution of 0.1 to 1.5, more preferably of 1 to 1.5 and exhibits a substitution sample expressed as the C2/C6 ratio of approximately 0.1 to 15, preferably of approximately 3 to 10.
  • the process of HES modification is, e.g., described in German patent application DE 1 2004 006 249.8 the disclosure of which is herewith incorporated in its entirety by reference.
  • the modification can, in principle, be made to the nucleic acid molecules of the present invention at any position thereof.
  • such modification is made either to the 5' -terminal nucleotide, the 3 '-terminal nucleotide and/or any nucleotide between the 5' nucleotide and the 3' nucleotide of the nucleic acid molecule.
  • the modification and preferably the PEG and/or HES moiety can be attached to the nucleic acid molecule of the present invention either directly or through a linker. It is also within the present invention that the nucleic acid molecule according to the present invention comprises one or more modifications, preferably one or more PEG and/or HES moiety. In an embodiment the individual linker molecule attaches more than one PEG moiety or HES moiety to a nucleic acid molecule according to the present invention.
  • the linker used in connection with the present invention can itself be either linear or branched. This kind of linkers are known to the ones skilled in the art and are further described in the patent applications WO2005074993 and WO2003035665.
  • the linker is a biodegradable linker.
  • the biodegradable linker allows to modify the characteristics of the nucleic acid according to the present invention in terms of, among other, residence time in the animal body, preferably in the human body, due to release of the modification from the nucleic acid according to the present invention. Usage of a biodegradable linker may allow a better control of the residence time of the nucleic acid according to the present invention.
  • a preferably embodiment of such biodegradable linker are biodegradable linker as described in but not limited to the international patent applications WO2006/052790, WO2008/034122, WO2004/092191 and WO2005/099768, whereby in the international patent applications WO2004/092191 and WO2005/099768, the linker is part of a polymeric oligonucleotide prodrug that consists of one or two modifications as described herein, a nucleic acid molecule and the biodegradable linker in between.
  • the modification or modification group is a biodegradable modification, whereby the biodegradable modification can be attached to the nucleic acid molecule of the present invention either directly or through a linker.
  • the biodegradable modification allows to modify the characteristics of the nucleic acid according to the present invention in terms of, among other, residence time in the animal body, preferably in the human body, due to release of the modification from the nucleic acid according to the present invention. Usage of biodegradable modification may allow a better control of the residence time of the nucleic acid according to the present invention.
  • a preferably embodiment of such biodegradable modification is biodegradable as described in but not restricted to the international patent applications WO2002/065963, WO2003/070823, WO2004/1 13394 and WO2000/41647, in WO2000/41647 preferably page 18, line 4 to 24.
  • modifications can be used to modify the characteristics of the nucleic acids according to the present invention, whereby such modifications are selected from the group of proteins, lipids such as cholesterol and sugar chains such as amylase, dextran etc.
  • the present inventors assume that the glomerular filtration rate of the thus modified nucleic acid is significantly reduced compared to the nucleic acids not having this kind of high molecular weight modification which results in an increase in the residence time in the body.
  • the specificity of the nucleic acid according to the present invention is not affected in a detrimental manner.
  • the nucleic acids according to the present invention have surprising characteristics - which normally cannot be expected from pharmaceutically active compounds - such that a pharmaceutical formulation providing for a sustained release is not necessarily required to provide for a sustained release.
  • nucleic acids according to the present invention in their modified form comprising a high molecular weight moiety, can as such already be used as a sustained release-formulation.
  • modification(s) of the nucleic acid molecules as disclosed herein and the thus modified nucleic acid molecules and any composition comprising the same may provide for a distinct, preferably controlled pharmacokinetics and biodistribution thereof. This also includes residence time in circulation and distribution to tissues. Such modifications are further described in the patent application WO2003035665.
  • nucleic acids disclosed herein do not comprise any modification and particularly no high molecular weight modification such as PEGylation or HESylation. Such embodiment is particularly preferred when the nucleic acid shows preferential distribution to any target organ or tissue in the body or when a fast clearance of the nucleic acids from the body after administration is desired. Nucleic acids as disclosed herein with a preferential distribution profile to any target organ or tissue in the body would allow establishment of effective local concentrations in the target tissue while keeping systemic concentration of the nucleic acids low. This would allow the use of low doses which is not only beneficial from an economic point of view, but also reduces unnecessary exposure of other tissues to the nucleic acid agent, thus reducing the potential risk of side effects.
  • inventive nucleic acids which are also referred to herein as the nucleic acids according to the present invention, and/or the antagonists according to the present invention may be used for the generation or manufacture of a medicament.
  • Such medicament or a pharmaceutical composition according to the present invention contains at least one of the inventive nucleic acids, optionally together with further pharmaceutically active compounds, whereby the inventive nucleic acid preferably acts as pharmaceutically active compound itself.
  • Such medicaments comprise in preferred embodiments at least a pharmaceutically acceptable carrier.
  • Such carrier may be, e.g., water, buffer, PBS, glucose solution, preferably a 5% glucose salt balanced solution, starch, sugar, gelatine or any other acceptable carrier substance.
  • Such carriers are generally known to the one skilled in the art. It will be acknowledged by the person skilled in the art that any embodiments, use and aspects of or related to the medicament of the present invention is also applicable to the pharmaceutical composition of the present invention and vice versa.
  • the present invention provides a means to neutralize SIP by identification and use of SIP binding nucleic acid. Because the nucleic acids according to the present invention interact with human and animal SIP, a skilled person is expected to understand that the SIP binding nucleic acid of the present invention can be used for the treatment, prevention and/or diagnosis of any disease of humans and animals described herein. In connection therewith, it is to be acknowledged that the nucleic acids of the present invention can be used for the treatment and prevention of diseases, disorders, or conditions described herein, irrespective of the mode of action underlying such disease, disorder, or condition.
  • nucleic acid molecules according to the present invention in connection with the various diseases, disorders and conditions is provided, thus rendering the claimed therapeutic, preventive and diagnostic applicability of the nucleic acid molecules according to the present invention plausible.
  • SIP SIP and its receptors S IPi, S1P 2 , S1P 3 , S1P 4 and S1P 5 as outlined in connection therewith said interaction may be addressed by the nucleic acid molecules according to the present invention such that the claimed therapeutic, preventive and diagnostic effect is achieved.
  • the particularities of the disease, disorders and conditions, of the patients and any detail of the treatment regimen described in connection therewith may be subject to preferred embodiments of the instant application.
  • Neutralization of SIP might be beneficial in diseases and conditions that are, at least in part, characterized by one or more pathological processes regulated by S 1 P, such as hyperproliferation, aberrant neovascularization, angiogenesis, fibrogenesis, fibrosis, scarring, abberrant cell trafficking, abberant vascular integrity, inflammation, and autoimmune response.
  • SIP promotes cell growth by stimulating cell proliferation and survival. As such, decreasing the effective in vivo concentrations of SIP is expected to be beneficial in treating or preventing hyperproliferative disorders.
  • Hyperproliferative disorders are defined as disease and/or disorders and/or diseased conditions associated with an uncontrolled proliferation of cells.
  • S 1 P-associated hyperproliferative disorders including hyperplasias, neoplasias, disorders associated with endothelial cell proliferation and disorders associated with fibroblast proliferation. In most cases the neoplasia will be a cancer.
  • Hyperproliferative disorders associated with endothelial cells can result in diseases of angiogenesis.
  • diseases and conditions are cancers caused by solid tumors or hematological tumors, angiomas, endometriosis, obesity, age-related macular degeneration, and various retinopathies, as well as the proliferation of endothelial cells and smooth muscle cells that cause restenosis as a consequence of stenting in the treatment of atherosclerosis.
  • SIP a highly potent proangiogenic agent.
  • S IP stimulates chemotactic motility of human venous endothelial cells (HUVECs) and induces differentiation of multicellular structures [Liu et al., J Clin Invest.
  • an agent that directly binds to and neutralizes SIP is useful to counter SIP mediated effects in the treatment of proangiogenic activity in pathologic conditions including but not limited to cancer and ocular diseases associated with retinal and choroidal neovascularization (Caballero, Exp Eye Res 2009, 88: 367- 377; Skoura, J Clin Invest 2007, 1 17: 2506-2516;Xie, J Cell Physiol 2009, 218: 192-198) such as age-related macular degeneration.
  • Hyperproliferative disorders involving fibroblasts include but are not limited to disorders of excessive scarring (for example, fibrosis) such as age-related macular degeneration [Caballero, Exp Eye Res. 2009 Mar;88(3):367-77], cardiac remodeling and failure associated with myocardial infarction [Takuwa Cardiovasc Res. 2010 Feb l ;85(3):484-93], scleroderma [Bu, Arthritis Rheum. 2010 Jul;62(7):21 17-26], cystic fibrosis [Uhlig, Am J Respir Crit Care Med. 2008 Dec 1 ; 1 8(1 1): 1 100-14], and excessive wound healing such as commonly occurs as a consequence of surgery or injury, keloids, and fibroid tumors and stenting.
  • excessive scarring for example, fibrosis
  • SIP activates fibroblast migration, proliferation and stimulates their production of collagen.
  • SIP produced locally by damaged cells could be responsible for aberrant wound healing, fibrogenesis and fibrosis.
  • an agent that directly binds to and neutralizes SIP is useful to counter SlP-mediated effects in the treatment of diseases and conditions associated with an excessive activity or number of fibroblasts including but not limited to ocular diseases such as age-related macular degeneration, cardiovascular diseases, and scleroderma.
  • SIP regulates motility, adhesion and trafficking of lymphocytes. The egress of lymphocytes from lymphoid tissues is believed to follow a SI Pn gradient with low SI P concentrations in the tissue and high SIP concentrations in the circulation.
  • S 1 P also stimulates migration, proliferation and survival of other immune cells, such as neutrophils, mast cells and dendritic cells as well as of fibroblasts, epithelial cells, pericytes and other cell types, by these means regulating neovascularization and vascular permeability [Annabi, Exp Hematol. 2003 Jul; 31(7):640-9; Paik, Genes Dev. 2004 Oct l ;18(19):2392-403; Chae, J Clin Invest 2004, 1 14, 1082-9].
  • a neutralizing agent such as a SIP binding nucleic acid molecule may be used to direct effector T lymphocytes away from inflammation sites thereby being useful in the treatment of diseases including but not limited to autoimmune disease and ocular diseases with inflammatory components, such as choroidal neovascularization seen in age-related macular degeneration.
  • SIP plays an important role in regulation of endothelial and epithelial barriers [Marsolais and Rosen, Nat Rev Drug Discov, 2009 Apr;8(4):297-307].
  • the vascular endothelial cell barrier separates the vascular components from the interstitium. Disruption of these barriers causes a higher vascular permeability leading to inflammation and affecting the organ function.
  • S IP maintains the integrity of the barrier. This is thought to be mediated primarily by its interaction with SI PI [Singleton, FASEB J. 2005 Oct; 19(12): 1646-56; Freistritzer and Riewald, Blood. 2005 Apr 15;105(8):3178-84], although other SIPR may be involved as well.
  • SI PI Antagonism of SI PI was shown to induce vascular leakage [Sanna et al., Nat Chem Biol. 2006 Aug;2(8):434- 41] and there is evidence that the balance between SI PI and S1P2 is important in the S IP mediated regulation of vascular permeability. Under normal circumstances it may be important to maintain the integrity of the endothelial and epithelial barriers and increased vascular permeability contributes to in acute lung injury and sepsis [Wang, Microvasc Res., 2009 Jan; 77(l):39-45.]. On the other hand there may be diseases or pathological situations where a temporary disruption of such barrier is desirable or beneficial.
  • vascular stabilization is important for neoangiogenesis and tumor metastasis [Paik, Genes Dev. 2004 Oct 1 ; 18(19):2392-403]. Reducing the expression of S1P1 by siRNA suppressed vascular stabilization in tumor xenograft models resulting in a dramatic suppression of tumor growth [Chae, J Clin Invest 2004, 1 14, 1082-9].
  • Functional SIP receptor antagonist FTY720 has been shown to inhibit VEGF-induced vascular permeability, tumor vascularization and growth in a murine melanoma model [LaMontagne, Cancer Res. 2006 Jan 1 ; 66(1):221-31].
  • the transient direct neutralization of SIP may be beneficial in conditions where the disruption of endothelial or epithelial barrier is useful to treat a pathological state, either on its own or in combination with one or more additional therapeutic medication(s), whose effect(s) or treatment of a pathological state may be enhanced by such disruption of the barrier.
  • the effect of an agent that directly interferes with SI P itself and thus blocks the activation of all extracellular SIP receptors on vascular permeability has not been shown yet. It remains subject of speculation whether vascular permeability is increased or decreased. Both may be useful for the treatment of diseases as laid out above.
  • SIP binding nucleic acid molecules Due to the involvement of bioactive lipids in various pathological processes including hyperproliferation, neovascularization, angiogenesis, aberrant fibrogenesis, inflammation and vascular stability, decreasing the effective in vivo concentration of SIP through direct interaction with a neutralizing agent, such as an SIP binding nucleic acid molecules may therefore be relevant for treating pathological conditions in which SIP may cause or contribute to the condition.
  • a neutralizing agent such as an SIP binding nucleic acid molecules may therefore be relevant for treating pathological conditions in which SIP may cause or contribute to the condition.
  • diseases and conditions may be systemic or localized to one or more specific body systems, parts or organs.
  • Classes of diseases or disorders amenable to treatment by such methods include but are not limited to cancer, infection and inflammation, autoimmune disorders, cerebrovascular diseases, cardiovascular diseases, ocular diseases, scarring, ventilation-induced lung injury, skin diseases, diseases or disorders associated with excessive fibrogenesis and fibrosis, diseases or disorders associated with pathologic angiogenesis, diseases or disorders associated with aberrant neovascularization,diseases or disorders associated with aberrant vascular stability, and diseases or disorders associated with transplantations as described in greater detail below.
  • Cancer cells often escape from therapeutic regimes by constantly mutating and evolving, thus becoming resistant to cytotoxics or antiangiogenic agents.
  • An important mechanism how cancer cells become resistant to treatment is the up-regulation of sphingosine kinase 1 (SphK 1) and in turn the release of SIP into the tumor microenvironment [Raguz, Br J Cancer 2008, 99: 387- 3912008; Cuvillier, Curr Mol Pharmacol 2010, 3: 53-65).
  • SphK 1 sphingosine kinase 1
  • SIP-mediated chemoresistance involves a cross-talk between SIP and hypoxia-inducible transcription factor (HIF) where the response of cancer cells to hypoxia involves the up-regulation of the SIP/SphK system [Ader, Cancer Res 2009, 68: 8635-8642].
  • HIF hypoxia-inducible transcription factor
  • Age-related macular degeneration is the leading cause of blindness in the western world in patients over age 60 [Bylsma and Guymer (2005), Clin Exp Optom, vol 88: 322-34, Gryziewicz (2005), Adv Drug Deliv Rev, vol 57: 2092-8, and Liu and Regillo (2004), Curr Opin Ophthalmol, vol 15: 221 -6.].
  • VEGF choroidal neovascularization
  • VEGF contributes to the pathogenesis of AMD by increasing CNV and vascular permeability which results in the occurrence of intra- and subretinal edema.
  • current therapy focuses on the inhibition of VEGF by intravitreal injection of anti-VEGF monoclonal antibody.
  • SIP exudative (i.e. wet) AMD-associated CNV, fibrosis and inflammation.
  • SIP induces the recruitment of epithelial cells to the site of vascularisation and stimulates the generation of early blood vessel structures [Lee, Biochem Biophys Res Commun 1999, 264: 743-750] and it promotes the formation of N-cadherin-mediated junctions between epithelial cells and mural cells in an VEGF-independent manner [Paik, Genes Dev. 2004 Oct l ;18(19):2392-403].
  • SIP furthermore supports neovascularization by cross-activating other pro-angiogenic factors, such as bFGF and VEGF [Igarashi, Proc Natl Acad Sci USA 2003, 100: 10664-9].
  • Cross-talk of SIP with pro-fibrotic factors, such as TGFb, PDGF and connective tissue growth factor and the induction through SIP of collagen expression by retinal pigmented epithelial cells strongly suggests a role of SIP in AMD-associated fibrogenesis [Xin, J Biol Chem 2004, 279: 35255- 35262; Hobson, Science 2001, 291 : 1800-1803; Katsuma, FEBS Lett 2005, 579: 2576-2582; Swaney, Exp Eye Res 2008, 87: 367-375].
  • Diabetic retinopathy is a common complication in patients with diabetes.
  • DR is an ischemic retinopathy, thus characterized by compromised retinal blood flow.
  • the pathology of DR involves VEGF-driven retinal neovascularization which can ultimately lead to intraocular hemorrhaging, fractional retinal detachment and increased vascular permeability.
  • SIP serotonizing SIP
  • RPE detachment occurs secondary to ocular diseases associated with neovascularization, increased vascular permeability and stimulation of fibrogenesis, such as AMD and DR.
  • SIP is strongly upregulated by RPE upon laser-induced injury [Caballero, Exp Eye Res 2009, 88: 367-377].
  • Evidence for a beneficial effect of antagonizing S IP in RPE detachment is provided by a clinical phase 1 trial of monoclonal anti-S I P antibody sonepcizumab. Patients with occult disease experienced a resolution of RPE detachment, an effect that has not been investigated for anti-VEGF treatment [Sabbadini, Br J Pharmacol. 201 1 Mar;162(6): 1225-38].
  • Proliferative vitreoretinopathy is the most common complication of a retinal detachment. PVR pathophysiology finally results in excessive scarring of the retina.
  • SIP Stimulated endothelial growth factor
  • VEGF vascular endothelial growth factor
  • bFGF vascular endothelial growth factor
  • IL-6 IL-6
  • IL-8 the inhibitory effect of neutralizing anti-SIP antibody on these factors
  • Retinal fibrosis leads to irreversible damage of photoreceptors and visual loss in AMD and DR. This process is not addressed by currently available treatments.
  • Neutralizing anti-S IP antibody blocked CNV formation and sub-retinal fibrosis in laser-induced disruption of Bruch's membrane, a model of exudative AMD [Caballero, Exp Eye Res 2009, 88: 367-377].
  • SIP was shown to decrease outflow facility in porcine and human eyes, thus increasing outflow resistance and intraocular pressure [Mettu, Invest Ophthalmol Vis Sci. 2004 Jul;45(7):2263-71 ; Stamer, Exp Eye Res. 2009 Dec;89(6):980-8].
  • S1P2 receptor activation increases conventional outflow resistance [Sumida, Am J Physiol Cell Physiol. 201 1 Feb 2].
  • a neutralizing agent such as a S 1 P binding nucleic acid molecule
  • ischemic retinopathies associated with VEGF-driven proliferation of pathological retinal neovascularization.
  • SIP ischemic retinopathy
  • retinal venous occlusive disease CAD
  • macular puckers cellophane retinopathy
  • PDR proliferative diabetic retinopathy
  • retinal neovascular diseases include but are not limited to sickle cell retinopathy, retinal venous occlusive disease, macular puckers (cellophane retinopathy), proliferative diabetic retinopathy (PDR), and retinal neovascular diseases.
  • ocular conditions characterized, at least in part, by aberrant neovascularization or angiogenesis include contact lens overwear, infections of the cornea, including herpes simplex, herpes zoster and protozoan infection, pterygium, infectious uveitis, lymphangiogenesis after corneal transplantation and transplant rejection, chronic retinal detachment, complications of refractive surgery such as haze, stromal scarring and regression, sickle cell retinopathy, venous occlusive disease, retinal angiomatous proliferation, and idiopathic polypoidal choroidal vasculopathy.
  • contact lens overwear infections of the cornea, including herpes simplex, herpes zoster and protozoan infection, pterygium, infectious uveitis, lymphangiogenesis after corneal transplantation and transplant rejection, chronic retinal detachment, complications of refractive surgery such as haze, stromal scarring and regression, sickle cell retinopathy, venous occ
  • ocular diseases with an inflammatory or immune component include chronic vitritis, autoimmune uveoretinits, allergic conjunctivitis, vernal conjunctivitis, herpes simplex, herpes zoster, and protozoan infections [Ciulla, et al. (2001), Curr Opin Ophthalmol, vol 12: 442-9], and ocular histoplasmosis.
  • SIP is involved in the regulation of scarring.
  • Scarring of the anterior portion of the eye is involved in trauma (resulting from various hazards ranging from airborne debris to blunt trauma that can for example result from surgery, and chemicals) [Dart et al (2003), Eye, vol 17: 886-92], Ocular Cicatricial Pemphigoid (OCP) (a chronic cicatrizing (scar-forming) autoimmune disease that primarily affects the conjunctiva), Stevens Johnson Syndrome (SJS), and Toxic Epidermal Necrolysis (TEN) (life-threatening adverse reactions to medications), Pterygium (a winglike triangular membrane that occurs in the interpalpebral fissure that can result in visual loss; VEGF may play an important role in the development of pterygium
  • SIP promotes hyperproliferation during hyperplasia and neoplasia by stimulating cell
  • Neoplasia refers to abnormal, uncontrolled and disorganized cell growth. In most cases neoplasia will be cancer. Several lines of evidence suggest that it is the balance of SIP in relation to sphingosine and ceramide that determines cell fate [Morita et al., 2000, Melendez and Khaw, 2002; Baumruker and Prieschl, 2000]. Cancer cells have been shown to up-regulate SPHK1 thereby increasing the SIP concentrations in the tumor microenvironment [Pyne, Nat Rev Cancer 2010, 10: 489-503].
  • SPHK was over-expressed in patients with solid tumors, among others those of breast, colon, lung, ovary, stomach, uterus, kidney, prostate, and rectum [French, et al., Cancer Res 63: 5962-5969, 2003; Fyrst, Nat Chemical Biology 2010, 489-497].
  • Increased expression of SPHK correlates with a significant decrease in survival rates in patients with several forms of cancer [Sabbadini, Br J Pharmacol. 201 1 Mar;162(6): 1225-38].
  • SIP neutralizing antibodies were shown to inhibit the proliferation of cancerous cell lines, their invasiveness and their resistance to doxorobucin-induced apoptosis in vitro, i.e. A549, HT-29, MCF-7 cells [Visentin, Cancer Cell. 2006 Mar; 9(3):225-38].
  • SIP vascular endothelial growth factor
  • VEGF vascular endothelial growth factor
  • bFGF vascular endothelial growth factor
  • SIP stimulates DNA synthesis and chemotactic motility of human venous endothelial cells (HUVECs), while inducing differentiation of multicellular structures, all of which is suggestive of S IP's role in early bloodvessel formation (Argraves, et al., 2004; Lee et al., 1999; Liu et al., J Clin Invest. 2000 106:951- 961).
  • SIP promotes the migration of bone marrow-derived EC precursors to neovascularization sites (Annabi, Exp Hematol. 2003 Jul; 31(7):640-9.) ⁇ Cells that over-express SI Pi are resistant to the anti-angiogenic agents thalidomide and Neovastat (Annabi, Exp Hematol. 2003 Jul; 31(7):640-9.).
  • thalidomide and Neovastat Annabi, Exp Hematol. 2003 Jul; 31(7):640-9.
  • SIP transactivates EGF (Shida, et al., 2004) and VEGF2 receptors (Spiegel & Milstien, 2003), and VEGF up-regulates SI Pi receptor expression (Igarashi, et al., 2003).
  • SIP acting via SIP] and the "VEGF axis" is required for hind-limb angiogenesis and neovascularization (Chae, et al., 2004).
  • Anti-angiogenic drug monoclonal anti-VEGF antibody bevacizumab (Avastin, Genentech) has been approved for treatment of colon cancer in combination with chemotherapy. SIP has also been shown to be involved in metastasis [Takuwa, Biochim Biophys Acta 2002, 1582: 1 12-120].
  • Functional SIP receptor antagonist FTY720 inhibited tumor growth and tumor-associated angiogenesis in models of hepatocellular carcinoma, blast crisis chronic myelogenous leukemia, Philadelphia chromosome-positive acute lymphocytic leukemia, chronic lymphocytic leukemia, lymphoblastic leukemia/lymphoma, and lung tumors [Ho, Mol Cancer Ther 2005, 4: 1430-1438; Neviani, J Clin Invest 2007, 1 17: 2408-2421 ; Liu, Blood 2008, 11 1 : 275-284; Lucas da Silva, J Exp Ther Oncol 2008, 7: 9-15].
  • SIP tumor-promoting functions of SIP are mediated by its cell surface receptors
  • SIP may as well act as an intracellular second messenger [Hait, Science 2009, 325: 1254-1257; Alvarez, Nature 2010, 465: 1084-1088].
  • SIP has for example been identified as a direct intracellular ligand of histone deacetylases, which are as well implicated in the development and progression of cancer [Hait, Science 2009, 325: 1254-1257].
  • a neutralizing anti-SIP antibody significantly blocked tumor growth and tumor-associated angiogenesis.
  • the antibody inhibited bFGF- and VEGF-induced angiogenesis in a murine Matrigel plug assay, and the antibody inhibited the release of proangiogenic growth factors (VEGF, IL-8, IL-6) from tumor cells in vitro and in vivo. It inhibited tumor progression in mouse models of breast carcinoma, ovarian cancer, in a lung adenocarcinoma xenograft model and in an allograft model of murine melanoma [Visentin, Cancer Cell. 2006 Mar; 9(3):225-38].
  • Hyperplasia is referred to as a hyperproliferation of cells in a normal tissue or organ.
  • a clinically relevant example is bengin prostate hyperplasia.
  • the hyperproliferative effect of SIP has been associated with hyperplasia.
  • Phenoxodiol which results in a decrease of SIP content has been tested in different types of cancer and prostate cancer [Marshall Edwards press release June 1 , 2010].
  • SIP regulates motility, adhesion and trafficking of lymphocytes.
  • SI P regulates the exit of lymphocytes from lymphoid organs and their retention at the site of inflammation [Matloubian, Nature 2004, 427, 355-360; Ledgerwood, Nat. Immunol. 2008, 9, 42-53].
  • Reduction of plasma SIP levels results in lymphopenia, thus, directing pathogenic T lymphocytes away from inflammation sites thereby being useful in the treatment of inflammatory diseases [Schwab, Science 2005, 309(5741): 1735-9; Japtok and Kleuser, Curr Opin Investig Drugs. 2009 Nov; 10(1 1): 1 183-94].
  • FTY720 is phosphorylated in vivo and serves as an agonist for all SIP receptors 1, 3, 4, and 5). Activation of SIP receptors by FTY720 in turn results in a down-regulation of receptor availability at the cell surface. This renders cells unresponsive to SIP and blocks the egress of lymphocytes from lymphoid tissues resulting in an immunosuppressive effect of FTY720 [Mandala, Science 2002, 296: 346-349; Graler, Faseb J 2004, 18: 551 -553]. FTY720 showed efficacy in various autoimmune models and is approved for the treatment of multiple sclerosis.
  • SIP and S1P1 receptor expression is reported to be upregulated in synovial lining cells, vascular endothelial cells, and inflammatory mononuclear cells in synovium rheumatoid arthritis compared to osteoarthritis patients [Kitano, Arthritis Rheum. 2006 Mar;54(3):742-53; Lai, J Immunol. 2008 Dec l ;181(l l):8010-7].
  • a sphingosine kinase inhibitor significantly inhibited disease severity and reduced articular inflammation and joint destruction [Lai, J Immunol. 2008 Dec l ;181(l l):8010-7].
  • functional SIP receptor antagonist FTY720 inhibited bone destruction in the SKG mouse model of rheumatoid arthritis [Tsunemi, Clin Immunol. 2010 Aug; 136(2): 197-204].
  • SIP receptor functional antagonist FTY720 Due to the immunosuppressive effect of SIP receptor functional antagonist FTY720 it is suggested that reducing the effective in vivo concentration of SIP with neutralizing agents, such as S 1 P-binding nucleic acid molecules, will be beneficial for the treatment of inflammatory skin diseases, such as lupus erythematosus, psoriasis, and atopic dermatitis [Herzinger, Am J Clin Dermatol. 2007;8(6):329-36].
  • S 1 P receptor antagonist FTY720 significantly reduced proteinuria and tubuli injury in streptozotocin-treated rats. This indicates that inhibition of SIP by a neutralizing agent, such as a SIP binding nucleic acid molecule, could be beneficial in diabetic nephropathy.
  • S1P2 receptor signalling has been implicated in the pathogenesis of atherosclerosis[Skoura, Arterioscler Thromb Vase Biol. 201 1 Jan;31(l):81-5].
  • disease and/or disorders and/or diseased conditions for the treatment and/or prevention of which the medicament according to the present invention may be used include, but are not limited to
  • ocular diseases preferably such ocular disease is selected from the group comprising age- related macular degeneration, diabetic retinopathy with diabetic macular edema, retinal pigmented epithelium detachment in either age-related macular degeneration or diabetic retinopathy, proliferative vitreoretinopathy and retinal fibrosis in age-related macular degenerationor diabetic retinopathy,
  • cancer preferably such cancer is selected from the group comprising breast cancer, ovarian cancer, melanoma, lung cancer, hyperplasia such as prostate hyperplasia, c) inflammatory disease, wherein preferably such inflammatory disease is selected from the group comprising autoimmune disease, multiple sclerosis, rheumatoid arthritis, psoriasis, asthma, inflammatory bowel disease, pneumonia, sepsis and trauma such as ventilator- induced lung injury and sepsis, wherein preferably the autoimmune disease is selected from the group comprising multiple sclerosis, rheumatoid arthritis, psoriasis, asthma and inflammatory bowel disease.
  • the medicament comprises a further pharmaceutically active compound.
  • such further pharmaceutically active compound is a further nucleic acid according to the present invention.
  • the medicament comprises at least one more nucleic acid which binds to a target molecule different from SIP or exhibits a function which is different from the one of the nucleic acids according to the present invention.
  • at least one more nucleic acid exhibits a function similar or identical to the one of one or several of the further pharmaceutically active compound(s) disclosed herein.
  • the medicament is alternatively or additionally used, in principle, for the prevention of any of the disease disclosed in connection with the use of the medicament for the treatment of said diseases.
  • Respective markers therefore, i.e. for the respective diseases are known to the ones skilled in the art.
  • the respective marker is SIP.
  • such medicament is for use in combination with other treatments for any of the diseases disclosed herein, particularly those for which the medicament of the present invention is to be used.
  • a composition according to the invention can also be administered in combination with another therapeutic agent or therapeutic regimen.
  • the modulation of SIP through a neutralizing agent may be useful in inducing a temporary modulation of vascular permeability to allow or enhance treatment with a second therapeutic reagent whose effect may be increased or improved through such a combinatorial treatment.
  • the medicament according to the present invention may be used for the treatment and/or prevention of cancer in combination with a second medicament or a second pharmaceutically active agent, whereby the second medicament or the second pharmaceutically active agent damages, destroys and/or labels (the) cancer cells.
  • a second medicament or second pharmaceutically active agent are preferably selected from but not restricted to the group comprising
  • antibodies such as Rituximab (target CD20), Cetuximab (target epidermal growth factor receptor), Ibritumomab-Tiuxetan (target CD20), Tositumomab (target CD20), Trastuzumab (target HER2/neu), Bevacizumab (target VEGF);
  • alkylating agents such as cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil, Doxorubicin, Melphalan;
  • anti-metabolites such as purineazathioprine, mercaptopurine, Fludarabine;
  • plant alkaloids such vinca alkaloids, plant terpenoids such as taxanes, preferably Docetaxel, Paclitaxel, podophyllotoxin, epothilone;
  • topoisomerase inhibitors such as camptothecins, Irinitecan
  • the medicament according to the present invention may be used for the treatment and/or prevention of an ocular disease in combination with a second medicament or a second pharmaceutically active agent, whereby the second medicament or the second pharmaceutically active agent is preferably selected from but not restricted to the group comprising
  • calcineurin inhibitors those known to suppress the immune system such as calcineurin inhibitors, cyclosporins, methotrexate, azathioprin, tacrolimus, rapamycin, chlorambucil, leflunomide, mycophenolate mofetil, brequinar, mizoribin, thalidomide, or deoxyspergualin; corticosteroids like prednisone, methylprednisolone, hydrocortisone, dexamethasone, triamcinolone, betamethasone, effervescent, or budesonide.
  • anti -inflammatory or anti-angiogenic biologies can be used in combination such as IL-10, erlizumab, tolermab, rituximab, gomiliximab, basiliximab, daclizumab, HuMax-TAC, visilizumab, HuMaxCD4, clenoliximab, MAX 16H5, TNX 100, toralizumab, alemtuzumab, CY 1788, galiximab, pexelizumab, eculizumab, PMX-53, ETI 104, FG 3019, bertilimumab, 249417 (anti-factor IX) abciximab, YM 337, omalizumab, talizumab, fontolizumab, J695 (anti-IL12), HuMaxIL-15, mepolizumab, elsilimomab, HuDREG, anakinra, Xom
  • Combination therapy includes the administration of a medicament of the invention and at least a second agent as part of a specific treatment regimen intended to provide the beneficial effect from the co-action of these therapeutic agents, i. e. the medicament of the present invention and said second agent.
  • the beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents.
  • Administration of these therapeutic agents in combination typically is carried out over a defined time period (usually minutes, hours, days or weeks depending upon the combination selected).
  • “Combination therapy” may, but generally is not, intended to encompass the administration of two or more of these therapeutic agents as part of separate monotherapy regimens that incidentally and arbitrarily result in the combinations of the present invention.
  • “Combination therapy” is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially simultaneous administration can be accomplished, for example, by administering to a subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents.
  • Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, topical routes, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues.
  • the therapeutic agents can be administered by the same route or by different routes.
  • a first therapeutic agent of the combination selected may be administered by injection while the other therapeutic agents of the combination may be administered topically.
  • Combination therapy also can embrace the administration of the therapeutic agents as described above in further combination with other biologically active ingredients.
  • the combination therapy further comprises a non-drug treatment
  • the non-drug treatment may be conducted at any suitable time so long as a beneficial effect from the co-action of the combination of the therapeutic agents and non-drug treatment is achieved.
  • the beneficial effect is still achieved when the non-drug treatment is temporally removed from the administration of the therapeutic agents, preferably by days or even weeks.
  • the medicament according to the present invention can be administered, in principle, in any form known to the ones skilled in the art.
  • a preferred route of administration is systemic administration, more preferably by parenteral administration, preferably by injection.
  • the medicament may be administered locally.
  • Other routes of administration comprise intramuscular, intraperitoneal, and subcutaneous, per orum, intranasal, intratracheal or pulmonary with preference given to the route of administration that is the least invasive, while ensuring efficiancy.
  • Parenteral administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Additionally, one approach for parenteral administration employs the implantation of a slow-release or sustained-released systems, which assures that a constant level of dosage is maintained, that are well known to the ordinary skill in the art.
  • preferred medicaments of the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, inhalants, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • Other preferred topical preparations include creams, ointments, lotions, aerosol sprays and gels.
  • the medicament of the present invention will generally comprise an effective amount of the active component(s) of the therapy, including, but not limited to, a nucleic acid molecule of the present invention, dissolved or dispersed in a pharmaceutically acceptable medium.
  • Pharmaceutically acceptable media or carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the medicament of the present invention.
  • the present invention is related to a pharmaceutical composition.
  • Such pharmaceutical composition comprises at least one of the nucleic acids according to the present invention and preferably a pharmaceutically acceptable vehicle.
  • vehicle can be any vehicle or any binder used and/or known in the art. More particularly such binder or vehicle is any binder or vehicle as discussed in connection with the manufacture of the medicament disclosed herein.
  • the pharmaceutical composition comprises a further pharmaceutically active agent.
  • compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection; as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inhalants and the like.
  • injectables either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection; as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inhalants and the like.
  • sterile formulations such as saline-based washes, by surgeons, physicians or health care workers to treat a particular area in the operating field may also be particularly useful.
  • Compositions may also be delivered via microdevice, microparticle or sponge.
  • a medicament Upon formulation, a medicament will be administered in a manner compatible with the dosage formulation, and in such amount as is pharmacologically effective.
  • the formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed.
  • the medicament of the invention can also be administered in such oral dosage forms as timed release and sustained release tablets or capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions. Suppositories are advantageously prepared from fatty emulsions or suspensions.
  • the pharmaceutical composition or medicament may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances.
  • adjuvants such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers.
  • they may also contain other therapeutically valuable substances.
  • the compositions are prepared according to conventional mixing, granulating, or coating methods, and typically contain about 0.1 % to 75%, preferably about 1% to 50%, of the active ingredient.
  • Liquid, particularly injectable compositions can, for example, be prepared by dissolving, dispersing, etc.
  • the active compound is dissolved in or mixed with a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form the injectable solution or suspension.
  • a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like.
  • solid forms suitable for dissolving in liquid prior to injection can be formulated.
  • the medicaments and nucleic acid molecules, respectively, of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles.
  • Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines.
  • a film of lipid components is hydrated with an aqueous solution of drug to a form lipid layer encapsulating the drug, what is well known to the ordinary skill in the art.
  • nucleic acid molecules described herein can be provided as a complex with a lipophilic compound or non-immunogenic, high molecular weight compound constructed using methods known in the art.
  • liposomes may bear such nucleic acid molecules on their surface for targeting and carrying cytotoxic agents internally to mediate cell killing.
  • nucleic-acid associated complexes is provided in U.S. Patent No. 6,01 1 ,020.
  • the medicaments and nucleic acid molecules, respectively, of the present invention may also be coupled with soluble polymers as targetable drug carriers.
  • soluble polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl-methacrylamide-phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues.
  • the medicaments and nucleic acid molecules, respectively, of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drag, for example, polylactic acid, polyepsilon capro lactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross- linked or amphipathic block copolymers of hydrogels.
  • Effective plasma levels of the nucleic acid according to the present invention preferably range from 500 fM to 200 ⁇ , preferably from 1 nM to 20 ⁇ , more preferably from 5 nM to 20 ⁇ , most preferably 50 nM to 20 ⁇ in the treatment of any of the diseases disclosed herein.
  • the nucleic acid molecules and medicaments, respectively, of the present invention may preferably be administered in a single daily dose, every second or third day, weekly, every second week, in a single monthly dose or every third month.
  • the medicament as described herein constitutes the pharmaceutical composition disclosed herein.
  • the present invention is related to a method for the treatment of a subject who is need of such treatment, whereby the method comprises the administration of a pharmaceutically effective amount of at least one of the nucleic acids according to the present invention.
  • the subject suffers from a disease or is at risk to develop such disease, whereby the disease is any of those disclosed herein, particularly any of those diseases disclosed in connection with the use of any of the nucleic acids according to the present invention for the manufacture of a medicament.
  • nucleic acid as well as the antagonists according to the present invention can be used not only as a medicament or for the manufacture of a medicament, but also for cosmetic purposes, particularly with regard to the involvement of S 1 P in inflamed regional skin lesions. Therefore, a further condition or disease for the treatment or prevention of which the nucleic acid, the medicament and/or the pharmaceutical composition according to the present invention can be used, is inflamed regional skin lesions.
  • a diagnostic or diagostic agent or diagnostic means is suitable to detect, either directly or indirectly SIP, preferably SIP as described herein and more preferably S IP as described herein in connection with the various disorders and diseases described herein.
  • the diagnostic is suitable for the detection and/or follow-up of any of the disorders and diseases, respectively, described herein.
  • detection is possible through the binding of the nucleic acids according to the present invention to SIP.
  • binding can be either directly or indirectly be detected.
  • the respective methods and means are known to the ones skilled in the art.
  • the nucleic acids according to the present invention may comprise a label which allows the detection of the nucleic acids according to the present invention, preferably the nucleic acid bound to SIP.
  • a label is preferably selected from the group comprising radioactive, enzymatic and fluorescent labels.
  • nucleic acids preferably a nucleic acid according to the present invention
  • the detection is preferably done by a secondary antibody which is modified with radioactive, enzymatic and fluorescent labels and bind to the target-binding antibody at its Fc-fragment.
  • the nucleic acid is modified with such a label, whereby preferably such a label is selected from the group comprising biotin, Cy-3 and Cy-5, and such label is detected by an antibody directed against such label, e.g.
  • an anti-biotin antibody an anti-Cy3 antibody or an anti-Cy5 antibody, or - in the case that the label is biotin - the label is detected by streptavidin or avidin which naturally bind to biotin.
  • streptavidin or avidin is preferably modified with a respective label, e.g. a radioactive, enzymatic or fluorescent label (like an secondary antibody).
  • nucleic acid molecules according to the invention are detected or analysed by a second detection means, wherein the said detection means is a molecular beacon.
  • a molecular beacon is known to persons skilled in the art and reviewed by Mairal et al. (Mairal et al., 2008, Anal Bioanl Chem 390(4), 989-1007).
  • step (c) reacting the sample with the nucleic acid, preferably in a reaction vessel whereby step (a) can be performed prior to step (b), or step (b) can be preformed prior to step (a).
  • a further step d) is provided, which consists in the detection of the reaction of the sample with the nucleic acid.
  • the nucleic acid of step b) is immobilised to a surface.
  • the surface may be the surface of a reaction vessel such as a reaction tube, a well of a plate, or the surface of a device contained in such reaction vessel such as, for example, a bead.
  • the immobilisation of the nucleic acid to the surface can be made by any means known to the ones skilled in the art including, but not limited to, non-covalent or covalent linkages.
  • the linkage is established via a covalent chemical bond between the surface and the nucleic acid.
  • the nucleic acid is indirectly immobilised to a surface, whereby such indirect immobilisation involves the use of a further component or a pair of interaction partners.
  • Such further component is preferably a compound which specifically interacts with the nucleic acid to be immobilised which is also referred to as interaction partner, and thus mediates the attachment of the nucleic acid to the surface.
  • the interaction partner is preferably selected from the group comprising nucleic acids, polypeptides, proteins and antibodies.
  • the interaction partner is an antibody, more preferably a monoclonal antibody.
  • the interaction partner is a nucleic acid, preferably a functional nucleic acid.
  • such functional nucleic acid is selected from the group comprising aptamers, spiegelmers, and nucleic acids which are at least partially complementary to the nucleic acid.
  • the binding of the nucleic acid to the surface is mediated by a multi-partite interaction partner.
  • Such multi-partite interaction partner is preferably a pair of interaction partners or an interaction partner consisting of a first member and a second member, whereby the first member is comprised by or attached to the nucleic acid and the second member is attached to or comprised by the surface.
  • the multipartite interaction partner is preferably selected from the group of pairs of interaction partners comprising biotin and avidin, biotin and streptavidin, and biotin and neutravidin.
  • the first member of the pair of interaction partners is biotin.
  • a preferred result of such method is the formation of an immobilised complex of SI P and the nucleic acid, whereby more preferably said complex is detected. It is within an embodiment that from the complex the SIP is detected.
  • a respective detection means which is in compliance with this requirement is, for example, any detection means which is specific for that/those part(s) of the SIP.
  • a particularly preferred detection means is a detection means which is selected from the group comprising nucleic acids, polypeptides, proteins and antibodies, the generation of which is known to the ones skilled in the art.
  • the method for the detection of S IP also comprises that the sample is removed from the reaction vessel which has preferably been used to perform step c).
  • the method comprises in a further embodiment also the step of immobilising an interaction partner of SIP on a surface, preferably a surface as defined above, whereby the interaction partner is defined as herein and preferably as above in connection with the respective method and more preferably comprises nucleic acids, polypeptides, proteins and antibodies in their various embodiments.
  • a particularly preferred detection means is a nucleic acid according to the present invention, whereby such nucleic acid may preferably be labelled or non-labelled. In case such nucleic acid is labelled it can directly or indirectly be detected.
  • Such detection may also involve the use of a second detection means which is, preferably, also selected from the group comprising nucleic acids, polypeptides, proteins and embodiments in the various embodiments described herein.
  • the second detection means is a molecular beacon.
  • Either the nucleic acid or the second detection means or both may comprise in a preferred embodiment a detection label.
  • the detection label is preferably selected from the group comprising biotin, a bromo-desoxyuridine label, a digoxigenin label, a fluorescence label, a UV-label, a radio-label, and a chelator molecule.
  • the second detection means interacts with the detection label which is preferably contained by, comprised by or attached to the nucleic acid. Particularly preferred combinations are as follows: the detection label is biotin and the second detection means is an antibody directed against biotin, or wherein
  • the detection label is biotin and the second detection means is an avidin or an avidin carrrying molecule, or wherein
  • the detection label is biotin and the second detection means is a streptavidin or a stretavidin carrying molecule, or wherein
  • the detection label is biotin and the second detection means is a neutravidin or a neutravidin carrying molecule, or
  • the detection label is a bromo-desoxyuridine and the second detection means is an antibody directed against bromo-desoxyuridine, or wherein
  • the detection label is a digoxigenin and the second detection means is an antibody directed against digoxigenin, or wherein
  • the detection label is a chelator and the second detection means is a radio-nuclide, whereby it is preferred that said detection label is attached to the nucleic acid. It is to be acknowledged that this kind of combination is also applicable to the embodiment where the nucleic acid is attached to the surface. In such embodiment it is preferred that the detection label is attached to the interaction partner.
  • the second detection means is detected using a third detection means, preferably the third detection means is an enzyme, more preferably showing an enzymatic reaction upon detection of the second detection means, or the third detection means is a means for detecting radiation, more preferably radiation emitted by a radionuclide.
  • the third detection means is specifically detecting and/or interacting with the second detection means.
  • the sample can be removed from the reaction, more preferably from the reaction vessel where step c) and/or d) are preformed.
  • the nucleic acid according to the present invention comprises a fluorescence moiety and whereby the fluorescence of the fluorescence moiety is different upon complex formation between the nucleic acid and SIP and free SIP.
  • the nucleic acid is a derivative of the nucleic acid according to the present invention, whereby the derivative of the nucleic acid comprises at least one fluorescent derivative of adenosine replacing adenosine.
  • the fluorescent derivative of adenosine is ethenoadenosine.
  • the complex consisting of the derivative of the nucleic acid according to the present invention and the S 1 P is detected using fluorescence.
  • a signal is created in step (c) or step (d) and preferably the signal is correlated with the concentration of S 1 P in the sample.
  • the assays may be performed in 96-well plates, where components are immobilized in the reaction vessels as described above and the wells acting as reaction vessels.
  • the inventive nucleic acid may further be used as starting material for drug discovery.
  • One approach is the screening of compound libraries whereas such compound libraries are preferably low molecular weight compound libraries.
  • the screening is a high throughput screening.
  • high throughput screening is the fast, efficient, trial-and-error evaluation of compounds in a target based assay. In best case the analysis are carried by a colorimetric measurement. Libraries as used in connection therewith are known to the one skilled in the art.
  • SIP analogues S IP agonists or SIP antagonists
  • Such competitive assays may be set up as follows.
  • the inventive nucleic acid preferably a spiegelmer which is a target binding L-nucleic acid
  • SIP analogues labelled SIP may be added to the assay.
  • a potential analogue would compete with the SIP molecules binding to the aptmer which would go along with a decrease in the signal obtained by the respective label.
  • Screening for agonists or antagonists may involve the use of a cell culture assay as known to the ones skilled in the art.
  • the kit according to the present invention may comprise at least one or several of the inventive nucleic acids, preferably for the detection of a lipid, more preferably for the detection of SIP.. Additionally, the kit may comprise at least one or several positive or negative controls.
  • a positive control may, for example, be SIP, particularly the one against which the inventive nucleic acid is selected or to which it binds, preferably, in liquid form.
  • a negative control may, e.g., be a peptide which is defined in terms of biophysical properties similar to SIP, but which is not recognized by the inventive nucleic acids.
  • said kit may comprise one or several buffers.
  • the various ingredients may be contained in the kit in dried or lyophilised form or solved in a liquid.
  • the kit may comprise one or several containers which in turn may contain one or several ingredients of the kit.
  • the kit comprises an instruction or instruction leaflet which provides to the user information on how to use the kit and its various ingredients.
  • the pharmaceutical and bioanalytical determination of the nucleic acid according to the present invention is elementarily for the assessment of its pharmacokinetic and biodynamic profile in several humours, tissues and organs of the human and non-human body.
  • any of the detection methods disclosed herein or known to a person skilled in the art may be used.
  • a sandwich hybridisation assay for the detection of the nucleic acid according to the present invention is provided.
  • the capture probe is complementary to the first part and the detection probe to the second part of the nucleic acid according to the present invention.
  • the capture probe is immobilised to a surface or matrix.
  • the detection probe preferably carries a marker molecule or label that can be detected as previously described herein.
  • the detection of the nucleic acid according to the present invention can be carried out as follows: The nucleic acid according to the present invention hybridises with one of its ends to the capture probe and with the other end to the detection probe. Afterwards unbound detection probe is removed by, e. g., one or several washing steps. The amount of bound detection probe which preferably carries a label or marker molecule can be measured subsequently as, for example, outlined in more detail in WO/2008/052774 which is incorporated herein by reference. As preferably used herein, the term treatment comprises in a preferred embodiment additionally or alternatively prevention and/or follow-up.
  • the terms disease and disorder shall be used in an interchangeable manner, if not indicated to the contrary.
  • the term comprise is preferably not intended to limit the subject matter followed or described by such term. However, in an alternative embodiment the term comprises shall be understood in the meaning of containing and thus as limiting the subject matter followed or described by such term.
  • 5'-GG is D-RNA
  • Fig. 1 shows an alignment of sequences of SI P binding nucleic acids
  • Fig. 2 shows the minimal binding sequence of the SI P binding nucleic acid 215-F9-001 and its derivatives
  • Fig. 3 shows analysis of SIP binding aptamer 215-F9-001(also referred to as S1P-215-
  • Fig. 4 shows the effect of the Spiegelmer 215-F9-001-5'-PEG (also refered to as NOX-
  • Fig. 5 shows the effect of the Spiegelmer NOX-S92 (also referred to as 215-F9-001-5'-)
  • NOX-S93 also referred to as 215-F9-002-D01-19-21-32-5'-PEG
  • Figs. 6 show derivatives of SIP binding aptmer 215-F9-002 (also refered to as L-
  • S1P-215-F9-002 consisting of ribonucleotide(s) (A, U, G, C) and at least one 2 ' - deoxyribonucleotide(s) (dA, dT, dG, dC);
  • Fig. 7 shows the results of the competitive aptmer pull-down assays carried out withn derivatives of SIP binding aptmer 215-F9-002 (also refered to as L- S1P-215-F9-002) consisting of ribonucleotide(s) (A, U, G, C) and at least one 2 ' - deoxyribonucleotide(s) (dA, dT, dG, dC): 0.3nM radioactively labeled L-S 1P- 215-F9-002-5 'diD-G binding to 8nM biotinylated D-e-S I P at 37°C competed by 50nM unlabeled aptmer (triplicates) as indicated;
  • Fig. 8 shows the results of the competitive aptamer pull-down assays derivatives of
  • SIP binding aptmer 215-F9-002 (also refered to as L-S1P-215-F9-002) consisting of ribonucleotide(s) (A, U, G, C) and at least one 2 ' - deoxyribonucleotide(s) (dA, dT, dG, dC), whereby
  • VEGF-A Vascular Endothelial Growth Factor- A
  • SIP sphingosine-1 -phosphate
  • Example 1 Nucleic acids that bind Sphingosine 1-phosphate (SIP)
  • SIP binding nucleic acids and derivatives thereof could be generated: the nucleotide sequences of which are depicted in Figure 1, 2 and 6. The nucleic acids were characterized as
  • aptamers i. e. as D-nucleic acid using a direct pull-down assay (Example 3) and/or a competitive pull-down assay (Example 3)
  • spiegelmers i. e. L-nucleic acid using a competitive pull-down assay (Example 6), an in vitro assay with the SIP receptor EDG-3/SlP 3 or EDG-1/S1 Pi (Example 4).
  • spiegelmers were tested in an in vitro angiogenesis assay (Example 7) and in vivo (Example 5). The aptmers and aptamers were synthesized as described in Example 2.
  • nucleic acid molecules thus generated exhibit slightly different sequences, whereby one main type was identified and defined as SIP binding nucleic acids, and are depicted in Figs. 1 , 2 and 6.
  • nucleotide sequence motifs For definition of nucleotide sequence motifs, the IUPAC abbreviations for ambiguous nucleotides are used: s strong G or C;
  • R purine G or A
  • V U A or C or G
  • the S IP binding nucleic acids comprise one central stretch of nucleotides defining a potential S 1 P binding motif.
  • S I P binding nucleic acids comprise at their 5 '-end and the 3 '-end terminal stretches of nucleotides: the first terminal stretch of nucleotides and the second terminal stretch of nucleotides.
  • the first terminal stretch of nucleotides and the second terminal stretch of nucleotides can hybridize to each other, whereby upon hybridization a double-stranded structure is formed.
  • hybridization is not necessarily given in the molecule.
  • the three stretches of nucleotides of S IP binding nucleic acids - the first terminal stretch of nucleotides, the central stretch of nucleotides and second terminal stretch of nucleotides - are arranged to each other in 5 ' -> 3 '-direction: the first terminal stretch of nucleotides - the central stretch of nucleotides - the second terminal stretch of nucleotides.
  • the first terminal stretch of nucleotides, the central stretch of nucleotides and the terminal second stretch of nucleotides are arranged to each other in 5' -> 3 '-direction: the second terminal stretch of nucleotides - the central stretch of nucleotides - the first terminal stretch of nucleotides.
  • sequences of the defined box or stretches may be different between the S 1 P binding nucleic acids which influences the binding affinity to SIP. Based on binding analysis of the different SIP binding nucleic acids the central stretch and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to human S I P.
  • the S IP binding nucleic acids according to the present invention are shown in Figs. 1 and 2. All of them were tested as aptamers for their ability to bind S I P, more precisely biotinylated L-e-S I P (also referred to as L-e-S lP(bio)).
  • the first SIP binding nucleic acid that was characterized for its binding affinity to S I P is nucleic acid 215-F9-001 .
  • the SIP binding nucleic acids 215-H1 1-001 , 215-H9-001, 215-F10-001 , 222-A10-002 and 222- A 12-002 were tested as aptamers in comparative competition pull-down assays vs. SI P binding nucleic acid 215-F9-001.
  • SI P binding nucleic acids 215-F 10-001 and 215-H 1 1-001 showed similar binding affinity as 215-F9-001 (Fig. 1).
  • the SIP binding nucleic acids 215-H9-001, 222- A 10-002 and 222- A 12-002 showed reduced binding affinity in comparison to SIP binding nucleic acid 215-F9-001 (Fig. 1).
  • the derivatives 215-F9-002 and 215-F9-003 of SIP binding nucleic acid 215-F9-001 showed similar binding to S IP as 215-F9-001 whereas the derivatives 215-F9-004, 215-F9-008 and 215- F9-009 showed reduced binding affinity in a competitive pull-down assay in comparison to SIP binding nucleic acid 215-F9-001 (Fig. 2).
  • the SIP binding nucleic acids according to the present invention comprise a central stretch of nucleotides with a length of 34 or 35 nt.
  • the SIP binding nucleic acids according to the present invention share the sequence 5 ' WAUUGCCGA WUGU AACGCCUU WAGAG AAAGC ACU AG 3 ' or 5' WAUUGCCGWUGU AACGCCUU WAGAG AAAGC ACU AG 3' for the central stretch of nucleotides.
  • the SIP binding nucleic acids 215-F9-001, 215-H 1 1-001, 215-F 10-001 and the derivates of 215-F9-001 that showed the best binding affinity to S IP comprise the following sequences for the central stretch:
  • the 5'- and 3-terminal stretches of SIP bindig nucleic acids comprise three (e.g. 215-F9-004), four (e.g. 215-F9-003), five (e.g. 215-F9-002) or six (e.g. 215-F10-001) nucleotides (Fig. 1 and Fig. 2), whereby the stretches optionally hybridize with each other, whereby upon hybridization a double-stranded structure is formed.
  • This double-stranded structure can consist of three to six basepairs. However, such hybridization is not necessarily given in the molecule.
  • Xi is A or absent
  • X 2 is G or absent
  • X 3 is S or absent
  • X4 is S or absent
  • X 5 is C or absent
  • X is U or absent.
  • the SIP binding sequence 215-F9-004 with three nucleotide long terminal stretches and the identical central stretch as SIP binding sequence 215-F9-001 showed decreased binding affinity in comparison to SIP binding sequence 215-F9-001 with six nucleotide long terminal stretches(Fig.2). Therefore the prefered length of the terminal stretches of SIP binding nucleic acids according to the present invention is 4 - 6 nucleotides.
  • the generic formula are of 5' XiX 2 X 3 SUG 3' (first terminal stretch of nucleotides) and 5' CAS jXsXe 3' (second stretch of nucleotides), wherein a) Xi is A, X 2 is G, X 3 is S, t is S, X 5 is C, and X 6 is U or
  • Xi is absent, X 2 is G, X 3 is S, X4 is S, X 5 is C, and X 6 is U or
  • Xi is A, X 2 is G, X 3 is S, X4 is S, X 5 is C, and X is absent or
  • Xi is absent, X 2 is G, X 3 is S, X 4 is S, X 5 is C, and X 6 is absent, wherein preferably a) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' AGCGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACGCU 3' (see e.g. 215-F9-001) or b) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACGC 3 (see e.g. 215-F9-002)'.
  • the generic formula are of 5' XiX 2 X 3 SUG 3' (first terminal stretch of nucleotides) and 5' CASX 4 X 5 X 6 3' (second stretch of nucleotides), wherein a) Xi is absent, X 2 is absent, X 3 is S, X 4 is S, X 5 is C, and X is absent or
  • Xi is absent, X 2 is G, X 3 is S, X 4 is S, X 5 is absent, and X 6 is absent,
  • Xi is absent, X 2 is absent, X 3 is S, X4 is S, X 5 is absent, and X 6 is absent, wherein preferably a) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' CGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACG 3' (see 215-F9-003) or b) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GCUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CAGC 3' (see 215-F9-008) or c) the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GGUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CACC 3' (see 215-F9-009), more preferably the first terminal stretch of nu
  • first terminal stretches of nucleotides and the second terminal stretches of nucleotides of S 1 P binding nucleic acids with three to four nucleotides the generic formula are of 5' XiX 2 X 3 SUG 3' (first terminal stretch of nucleotides) and 5' CASX 4 X 5 X 6 3' (second stretch of nucleotides), wherein
  • Xi is absent, X 2 is absent, X 3 is S or absent, Xi is S or absent, X 5 is absent, and X 6 is absent, wherein preferably the first terminal stretch of nucleotides comprises a nucleotide sequence of 5' GUG 3' and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5' CAC 3' (see 215- F9-009).
  • spiegelmers 215-F9-001, 215- F9-002 were synthesized as aptmers comprising an amino-group at its 5 '-end.
  • amino- modified tikmers 215-F9-001-5'-Amino and 215-F9-002-5'- Amino a 40 kDa PEG-moiety was coupled leading to SIP binding adormers 215-F9-001 -5'-PEG (also referred to as NOX- S92) and 215-F9-002-5'-PEG (also referred to as NOX-S91). Synthesis and PEGylation of the aptmer is described in Example 2.
  • SIP binding aptmers were tested to inhibit / antagonize the function of SIP in vitro and in vivo. As shown in Example 4, SIP binding aptmers inhibit the interaction and signalling of SIP to the receptors EDG-3/SlP 3 and EDG-l/S lPi in vitro (Fig. 4 and 9). As shown in Example 7, SIP binding aptmers 215-F9-002-5'-PEG (also referred to as NOX-S91) inhibits angiogenesis in vitro.
  • spiegelmer 215-F9-001-5'-PEG also referred to as NOX- S92
  • NOX-S92 The efficacy of aptamer 215-F9-001-5'-PEG (also referred to as NOX- S92) was tested in vivo, wherein 215-F9-001-5'-PEG (also referred to as NOX-S92) induced a lymphopenia due to binding to SIP (Example 5, Fig. 5).
  • L-S1P-215-F9-002 In order to assess whether, starting from single nucleotide replacements which proved to be suitable to increase binding affinity, replacing more than one ribonucleotide by more than 2'- deoxyribonucleotide in the sequence of SIP binding aptmer L-S1P-215-F9-002 would result in further improvement in binding affinity to D-e-SIP, aptmers consisting of ribonucleotides and two up to five 2 '-deoxyribonucleotides were synthesized: L-S1P-215-F9-002-D21-22, L- S1P-215-F9-002-D21-19, L-S1P-215-F9-002-D21-19-22, L-S 1P-215-F9-002-D01-19-21-32 and L-S1P-215-F9-002-01-1 1-19-21-32 (Fig.
  • the inventors surprisingly observed that the binding affinity of D-e-S IP binding aptmer L-S1P-215-F9-002 was improved by a factor of more than five by replacing ribonucleotides by 2'-deoxyribonucleotides at the position 1 , 19, 21 and 32 (see aptmer L-S 1P-215-F9-002-D01 -19-21-32, Fig. 6).
  • the SIP binding aptmers 5 '-40kDa-PEG-L-SlP-215-F9-002 also referred to as NOX-S91
  • 5 '-40kDa-PEG-L-SlP-215-F9-002-D01-19-21-32 also referred to as NOX-S93
  • the SIP binding aptmers 5 ' -40kDa-PEG-L-SlP-215-F9-001 also referred to as NOX-S92
  • 5 ' -40kDa- PEG-L-S1P-215-F9-002-D01-19-21 -32 also referred to as NOX-S93
  • Aptamers D-RNA nucleic acids or D-DNA modified D-RNA nucleic acids
  • spiegelmers L- RNA nucleic acids or L-DNA modified L-RNA nucleic acids
  • ABI 394 synthesizer Applied Biosystems, Foster City, CA, USA
  • 2'TBDMS RNA and DNA phosphoramidite chemistry with standard exocyclic amine protecting groups (Damha and Ogilvie, 1993).
  • RNA part of the oligonucleotide rA(N-Bz)-, rC(N- Ac)-, rG(N-ibu)-, and rU- phosphoramidites in the D- and L-configuration were used, while for the DNA part dA(N-Bz)-, dC(N-Ac)-, dG(N-ibu)-, and dT in the D- and L-configuration were applied. All phosphoramidites were purchased from ChemGenes, Wilmington, MA. After synthesis and deprotection aptamers and aptamers were purified by gel electrophoresis.
  • a 40 kDa polyethylene glycol (PEG) moiety was covalently coupled at the 5 '-end of the aptmers.
  • the pH of the Spiegelmer solution was brought to 8.4 with 1 M NaOH. Then, 40 kDa PEG-NHS ester (Jenkem Technology, Allen, TX, USA) was added at 37°C every 30 min in six portions of 0.25 equivalents until a maximal yield of 75 to 85% was reached. The pH of the reaction mixture was kept at 8 - 8.5 with 1 M NaOH during addition of the PEG-NHS ester.
  • the reaction mixture was blended with 4 ml urea solution (8 M), and 4 ml buffer B (0.1 M triethylammonium acetate in H 2 0) and heated to 95°C for 15 min.
  • the PEGylated Spiegelmer was then purified by RP-HPLC with Source 15RPC medium (Amersham), using an acetonitrile gradient (buffer B; buffer C: 0.1 M triethylammonium acetate in acetonitrile). Excess PEG eluted at 5% buffer C, PEGylated Spiegelmer at 10 - 15% buffer C. Product fractions with a purity of >95% (as assessed by HPLC) were combined and mixed with 40 ml 3 M NaOAC.
  • the PEGylated Spiegelmer was desalted by tangential-flow filtration (5 K regenerated cellulose membrane, Millipore, Bedford MA).
  • the affinity of SIP binding nucleic acids was measured in a pull down assay format at " 37 °C using aptamers (D-RNA nucleic acids) and biotinylated L-e-SlP.
  • Aptamers were radioactively labeled at the 5 '-end by T4 polynucleotide kinase (Invitrogen, Düsseldorf, Germany) using [ ⁇ - 32 P]-labeled ATP (Hartmann Analytic, Braunschweig, Germany).
  • the specific radioactivity of labeled aptamers was 200,000 - 800,000 cpm/pmol.
  • Aptamers were incubated after de- and renaturation at 300 pM concentration at 37°C in selection buffer (20 mM Tris-HCl pH 7.4; 150 mM NaCl; 5 mM KC1; 1 mM MgCl 2 ; 1 mM CaCl 2 ; 0.1% [w/vol] Tween-20; 4 mg/ml bovine serum albumin) together with varying amounts of biotinylated L-e-SIP for 3 - 12 hours in order to reach equilibrium at low concentrations. Selection buffer was supplemented with 10 ⁇ g/ml yeast RNA (Ambion, Austin, USA) in order to prevent adsorption of binding partners to surfaces of the used plasticware or the immobilization matrix.
  • selection buffer was supplemented with 10 ⁇ g/ml yeast RNA (Ambion, Austin, USA) in order to prevent adsorption of binding partners to surfaces of the used plasticware or the immobilization matrix.
  • the concentration range of biotinylated L- e-SlP was set from 192 pM to 3000 nM; total reaction volume was 0.1 ml.
  • Biotinylated L-e-SIP and complexes of aptamers and biotinylated L-e-S IP were immobilized on 2 ⁇ Streptavidin Ultralink Plus beads (Pierce Biotechnology, Rockford, USA) which had been preequilibrated with selection buffer before addition to the binding reactions. Beads were kept in suspension for 20 min at the respective temperature in a thermomixer to immobilize biotinylated L-e-SIP and the complexes of biotinylated L-e-SIP and bound aptamers.
  • Immobilized radioactivity was quantitated in a scintillation counter after detaching the supernatant and appropriate washing.
  • the percentage of binding or normalized binding was plotted against the concentration of biotinylated L-e-SIP and dissociation constants were obtained using software algorithms (GRAFIT; Erithacus Software; Surrey U.K.) assuming a 1 : 1 stoichiometry.
  • Another pull-down assay format was used for the determination of affinity constants of SIP binding nucleic acids by competition of a labeled aptamer with varying amounts of a non-labeled aptamer.
  • the non-labeled aptamer competed with the labeled aptamer for binding to biotinylated L-e-SIP, thus decreasing the binding signal according to the affinity of the aptamer to L-e-SIP.
  • the assay was performed at 37 °C with 150 pM radioactively labeled aptamer together with a constant amount of 20 nM biotinylated L-e-SIP in 0.4 ml selection buffer for 3 - 12 hours.
  • the same assay format was used for comparative ranking of a set of different aptamers however with the exception that instead of a full concentration range only three different concentrations of each non-labeled aptamer (e.g. 5, 50, 500 nM) were applied to the test tube together with one labeled aptamer that served as a reference. The aptamer that was found most active in the test could then serve as a new reference for comparative analysis of further aptamer variants.
  • each non-labeled aptamer e.g. 5, 50, 500 nM
  • Stable transfected CHO-cells expressing the human S1P3 receptor (EDG3/S 1P 3 ) and the human G-Protein G a i 5 are seeded with 5 x 10 4 cells per well in a black 96 well-plate with clear bottom (Greiner) and cultivated overnight at 37°C and 5% C0 2 in UltraCHO medium (Lonza) which contained in addition 100 units/ml penicillin, 100 ⁇ g/ml streptomycin and 10 ⁇ g/ml blasticidin.
  • the stimulation solutions (D-e-SIP + various concentrations of aptmer) are made up as 10X concentrated solutions in UltraCHO medium containing 20 mM HEPES and 5 mM Probenecid (CHO-U+) in a 96 well "low profile" PCR plate. The solutions are mixed thoroughly and incubated on a thermomixer at 37°C for 30 to 60 min. In each (vertical) row a buffer control (no D-e-SIP) and a D-e-SIP control (no aptmer) are included.
  • Measurement of fluorescence signals is done at an excitation wavelength of 485 nm and an emission wavelength of 520 nm in a Fluostar Optima multidetection plate reader (BMG).
  • BMG Fluostar Optima multidetection plate reader
  • the aptmers 215-F9-001-5'-PEG (also referred to as NOX-S92) and 215-F9-002-5'-PEG (also referred to as 5 '-40kDa-PEG-L-SlP-215-F9-002 and NOX-S91) were found to inhibit S IP- induced Ca ⁇ -release with an IC 50 of about 10 nM (Means +/- std.dev. from three independent experiments) (Fig. 4 and 9C).
  • PathHunterTM eXpress EDG-1 CH0-K1 ⁇ -arrestin GPCR cells were seeded at 1 x 10 4 cells per well in a white 96 well-plate with clear bottom (Greiner) and cultivated for 48h at 37°C and 5% C0 2 in ⁇ Culture Medium (DiscoverX).
  • Stimulation solutions D-e-SIP + various concentrations of Spiegelmer
  • HBSS Gibco
  • ⁇ stimulation solution were added per well (triplicates) and cells were incubated for 90min at 37°C and 5% C0 2 .
  • 5'-40kDa-PEG-L-SlP-215-F9-002 also referred to as 215-F9-002-5'-PEG and NOX-S91
  • 5'-40kDa-PEG-L-SlP-215-F9-002-D01-19-21-32 also referred to as NOX-S91
  • SlP(D-e-SlP)-induced arrestin recruitment in a reporter cell line expressing human SIP-receptor EDGl with IC 50 values of 22.5nM and 10.3nM, respectively (Fig. 9A, 9B).
  • Example 5 Activity of SIP binding aptmers in vivo
  • NOX-S92 or NOX-S93 Treatment with aptamers NOX-S92 or NOX-S93 induced a lymphopenia as indicated by a reduction from basal levels of 8.6 to 4.9 x 10 3 lymphocytes / (NOX-S92) after eight hours or from 8.7 to 4.6 x 10 3 lymphocytes / yah blood (NOX-S93) twenty-four hours post application (see Fig. 5).
  • Affinity constants of S I P binding aptmers were determined by competitive pull-down assays.
  • two guanosine residues in the D-configuration were added to the 5'-end of the L-S 1 P-215-F9- 002 aptmer.
  • Unlabeled aptmers were then tested for their ability to compete with 300- 600pM radiolabeled aptmer L-S 1P-215-F9-002-5 'diD-G for binding to a constant amount of biotinylated D-e-S I P, i.e.
  • D-e-S IP was used at a concentration of 8nM resulting in a final binding of approximately 10% of radiolabeled aptmer L-S 1P-215-F9-002-5 ' diD-G in the absence of competitor aptmers.
  • Assays were performed in 250 ⁇ 1 selection buffer (20 mM Tris-HCl pH 7.4; 150 mM NaCl; 5 mM C1; 1 mM MgCl 2 ; 1 mM CaCl 2 ; 0.1 % [w/vol] Tween- 20; 4mg/ml bovine serum albumin; 10 ⁇ g/ml Yeast-R A) for 3 - 4 hours at 37 °C.
  • Biotinylated D-e-S I P and complexes of spiegelmer and biotinylated S IP were immobilized on 5 ⁇ Neutravidin Ultralink Plus beads (Pierce Biotechnology, Rockford, USA) which had been pre- equilibrated with selection buffer before addition to the binding reactions.
  • VEGF-A Vascular Endothelial Growth Factor- A
  • SIP sphingosine-1 -phosphate
  • the angiogenesis stimulators SIP [100 nM final assay concentration] or VEGF-A [25 ng/mL final assay concentration] were added after 30 min by pipetting 100 ⁇ of a 10-fold concentrated working dilution on top of the polymerized gel.
  • a dose-range (10 nM - 10 ⁇ in half- log increments) of the S IP-binding aptmers was added to allow the calculation of an IC50.
  • Vehicle only and either angiogenesis stimulator alone plus aptmer vehicle served as control wells (basal sprouting and maximal sprouting induction).
  • Sunitinib was used as a positive control substance in the VEGF-induced sprouting assay.
  • HUVEC spheroids were incubated at 37°C for 24 hours and fixed by adding 4% Roti-Histofix.
  • Sprouting intensity of treated HUVEC spheroids was quantified by determining the cumulative sprout length per spheroid using an image analysis system consisting of an inverted microscope and the digital imaging software Analysis 3.2 (Soft imaging system, Munster, Germany). The mean of the cumulative sprout length of 10 randomly selected spheroids was analyzed as an individual data point. IC50 determination was done with GraphPad Prism version 5.02 software with constrain of bottom to 0 and top to 100 using a nonlinear regression curve fit with variable hill slope. The equation is a four-parameter logistic equation. For calculation the median of basal sprouting was subtracted from all other data points. The median control VEGF-A or SIP sprouting was set to 100%.
  • NOX-S91 and NOX-S93 inhibited sprouting that was induced by either SIP or VEGF-A.
  • NOX-S93 showed stronger inhibition in SIP induced EC sprouting than NOX-S91.
  • NOX-S93 showed a stronger inhibition (3.4 x 10 7 M) than NOX-S91 (7.5 x 10 7 M).
  • Both drugs exhibited lower IC50 values in the VEGF-A-induced sprouting (see Fig. 10).
  • the IC50 values for NOX S91 and NOX-S93 were 2.1 x 10-7 M and 2.4 x 10-7 M on VEGF-A induced EC sprouting. Sunitinib was used as positive control and showed inhibition of HUVEC sprouting in the same range with an IC 50 value of 2.5 x 10-7 M (see Fig. 10).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Plant Pathology (AREA)
  • Rheumatology (AREA)
  • Pulmonology (AREA)
  • Endocrinology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Pain & Pain Management (AREA)
PCT/EP2011/002068 2010-04-21 2011-04-21 Lipid binding nucleic acids Ceased WO2011131371A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
JP2013505367A JP5941904B2 (ja) 2010-04-21 2011-04-21 脂質に結合する核酸
US13/642,555 US8871920B2 (en) 2010-04-21 2011-04-21 Lipid binding nucleic acids
EP11716838A EP2561079A1 (en) 2010-04-21 2011-04-21 Lipid binding nucleic acids
CN201180024560.5A CN102906265B (zh) 2010-04-21 2011-04-21 脂质结合核酸
AU2011244628A AU2011244628B9 (en) 2010-04-21 2011-04-21 Lipid binding nucleic acids
PCT/EP2012/000089 WO2012095303A1 (en) 2011-01-10 2012-01-10 Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
CA2824073A CA2824073A1 (en) 2011-01-10 2012-01-10 Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
JP2013547842A JP2014504865A (ja) 2011-01-10 2012-01-10 標的分子との結合親和性を有する核酸分子およびその生成方法
US13/978,804 US9976145B2 (en) 2011-01-10 2012-01-10 Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
KR1020197016125A KR102080142B1 (ko) 2011-01-10 2012-01-10 목표 분자에 결합력을 갖는 l-형 핵산 및 이를 제조하는 방법
EP12700093.3A EP2663640B1 (en) 2011-01-10 2012-01-10 Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
AU2012206750A AU2012206750A1 (en) 2011-01-10 2012-01-10 Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
CN201280007720XA CN103339258A (zh) 2011-01-10 2012-01-10 具有对于靶分子的结合亲和力的核酸分子及产生所述核酸分子的方法
KR1020137017897A KR20140026357A (ko) 2011-01-10 2012-01-10 목표 분자에 결합력을 갖는 핵산 및 이를 제조하는 방법
JP2017075557A JP2017148055A (ja) 2011-01-10 2017-04-05 標的分子との結合親和性を有する核酸分子およびその生成方法
US15/985,626 US20190367921A1 (en) 2011-01-10 2018-05-21 Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP10004253 2010-04-21
EP10004253.0 2010-04-21
EP11000117.9 2011-01-10
EP11000117 2011-01-10

Publications (1)

Publication Number Publication Date
WO2011131371A1 true WO2011131371A1 (en) 2011-10-27

Family

ID=44201395

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/002068 Ceased WO2011131371A1 (en) 2010-04-21 2011-04-21 Lipid binding nucleic acids

Country Status (5)

Country Link
US (1) US8871920B2 (enExample)
EP (1) EP2561079A1 (enExample)
JP (1) JP5941904B2 (enExample)
CN (1) CN102906265B (enExample)
WO (1) WO2011131371A1 (enExample)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012095303A1 (en) * 2011-01-10 2012-07-19 Noxxon Pharma Ag Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
WO2018001565A1 (en) 2016-07-01 2018-01-04 Centogene Ag Use of lyso-gb1 as druggable target
WO2020005325A1 (en) * 2018-06-29 2020-01-02 The Procter & Gamble Company Aptamers for hair care applications

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112014016939A2 (pt) 2012-01-10 2019-09-24 Noxxon Pharma Ag ácidos nucleicos que se ligam especificamente a cgrp
KR102034203B1 (ko) 2012-01-10 2019-10-18 아프타리온 바이오테크 아게 새로운 C5a 결합 핵산
CN109475756A (zh) * 2016-02-17 2019-03-15 儿童医疗中心有限公司 Ffa1(gpr40)作为神经血管生成疾病或病症的治疗标靶
WO2019222340A1 (en) 2018-05-17 2019-11-21 The Procter & Gamble Company Systems and methods for hair coverage analysis
US11172873B2 (en) 2018-05-17 2021-11-16 The Procter & Gamble Company Systems and methods for hair analysis
CN112771164B (zh) 2018-06-29 2026-03-27 宝洁公司 用于个人护理应用的适配体
CN109402127B (zh) * 2018-09-29 2021-12-10 复旦大学附属眼耳鼻喉科医院 一组与结缔组织生长因子特异性结合的高亲和力核酸适配体及其应用
CA3134968A1 (en) 2019-04-16 2020-10-22 Juan Esteban Velasquez Aptamers for odor control applications
AU2020313090A1 (en) * 2019-07-17 2021-12-23 Noxopharm Limited Immuno-oncology therapy using isoflavone compounds
US12039732B2 (en) 2021-04-14 2024-07-16 The Procter & Gamble Company Digital imaging and learning systems and methods for analyzing pixel data of a scalp region of a users scalp to generate one or more user-specific scalp classifications

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6011020A (en) 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
WO2000041647A1 (en) 1999-01-19 2000-07-20 The Children's Hospital Of Philadelphia Sustained delivery of polyionic bioactive agents
US6225063B1 (en) * 1998-05-22 2001-05-01 University Technology Corporation RNA channels in biological membranes
WO2002065963A1 (en) 2001-02-16 2002-08-29 Expression Genetics, Inc. Biodegradable cationic copolymers of poly(alkylenimine) and poly(ethylene glycol) for the delivery of bioactive agents
WO2003035665A1 (de) 2001-10-26 2003-05-01 Noxxon Pharma Ag Modifizierte l-nukleinsäure
EP1306382A1 (de) 2001-10-26 2003-05-02 Noxxon Pharma AG Modifizierte L-Nukleinsäure
WO2003070823A2 (en) 2002-02-20 2003-08-28 The General Hospital Corporation Conjugates comprising a biodegradable polymer and uses therefor
WO2004092191A2 (en) 2003-04-13 2004-10-28 Enzon Pharmaceuticals, Inc. Polymeric oligonucleotide prodrugs
WO2004113394A2 (en) 2003-06-20 2004-12-29 Warwick Effect Polymers Limited Living radical polymerization initiator comprising a functional group capable of reacting with polypeptides or the like, comb polymer obtained therewith, polypeptide conjugates and drugs obtained therefrom
WO2005074993A2 (de) 2004-02-09 2005-08-18 Noxxon Pharma Ag Verfahren zur herstellung von konjugaten aus polysacchariden und polynukleotiden
WO2005099768A2 (en) 2004-03-23 2005-10-27 Complex Biosystems Gmbh Polymeric prodrug with a self-immolative linker
WO2006052790A2 (en) 2004-11-05 2006-05-18 The Children's Hospital Of Philadelphia Biodegradable linkers for molecular therapies
WO2008034122A2 (en) 2006-09-15 2008-03-20 Enzon Pharmaceuticals, Inc. Hindered ester-based biodegradable linkers for oligonucleotide delivery
WO2008052774A2 (en) 2006-10-31 2008-05-08 Noxxon Pharma Ag Methods for detection of a single- or double-stranded nucleic acid molecule
WO2008124654A1 (en) * 2007-04-06 2008-10-16 Lpath, Inc. Methods for decreasing immune response and treating immune conditions

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101418369B1 (ko) 2005-05-04 2014-07-24 녹손 파르마 아게 스피에겔머들의 신규 용도
US20090074720A1 (en) * 2005-10-28 2009-03-19 Sabbadini Roger A Methods for decreasing immune response and treating immune conditions

Patent Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6011020A (en) 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US6225063B1 (en) * 1998-05-22 2001-05-01 University Technology Corporation RNA channels in biological membranes
WO2000041647A1 (en) 1999-01-19 2000-07-20 The Children's Hospital Of Philadelphia Sustained delivery of polyionic bioactive agents
WO2002065963A1 (en) 2001-02-16 2002-08-29 Expression Genetics, Inc. Biodegradable cationic copolymers of poly(alkylenimine) and poly(ethylene glycol) for the delivery of bioactive agents
WO2003035665A1 (de) 2001-10-26 2003-05-01 Noxxon Pharma Ag Modifizierte l-nukleinsäure
EP1306382A1 (de) 2001-10-26 2003-05-02 Noxxon Pharma AG Modifizierte L-Nukleinsäure
WO2003070823A2 (en) 2002-02-20 2003-08-28 The General Hospital Corporation Conjugates comprising a biodegradable polymer and uses therefor
WO2004092191A2 (en) 2003-04-13 2004-10-28 Enzon Pharmaceuticals, Inc. Polymeric oligonucleotide prodrugs
WO2004113394A2 (en) 2003-06-20 2004-12-29 Warwick Effect Polymers Limited Living radical polymerization initiator comprising a functional group capable of reacting with polypeptides or the like, comb polymer obtained therewith, polypeptide conjugates and drugs obtained therefrom
WO2005074993A2 (de) 2004-02-09 2005-08-18 Noxxon Pharma Ag Verfahren zur herstellung von konjugaten aus polysacchariden und polynukleotiden
WO2005099768A2 (en) 2004-03-23 2005-10-27 Complex Biosystems Gmbh Polymeric prodrug with a self-immolative linker
WO2006052790A2 (en) 2004-11-05 2006-05-18 The Children's Hospital Of Philadelphia Biodegradable linkers for molecular therapies
WO2008034122A2 (en) 2006-09-15 2008-03-20 Enzon Pharmaceuticals, Inc. Hindered ester-based biodegradable linkers for oligonucleotide delivery
WO2008052774A2 (en) 2006-10-31 2008-05-08 Noxxon Pharma Ag Methods for detection of a single- or double-stranded nucleic acid molecule
WO2008124654A1 (en) * 2007-04-06 2008-10-16 Lpath, Inc. Methods for decreasing immune response and treating immune conditions

Non-Patent Citations (124)

* Cited by examiner, † Cited by third party
Title
"The aptamer handbook"
"The Aptamer Handbook", February 2006, WILEY-VCH
A. KHVOROVA: "RNAs that bind and change the permeability of phospholipid membranes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 96, no. 19, 14 September 1999 (1999-09-14), pages 10649 - 10654, XP055001934, ISSN: 0027-8424, DOI: 10.1073/pnas.96.19.10649 *
A. VLASSOV: "Binding and disruption of phospholipid bilayers by supramolecular RNA complexes", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 98, no. 14, 3 July 2001 (2001-07-03), pages 7706 - 7711, XP055001933, ISSN: 0027-8424, DOI: 10.1073/pnas.141041098 *
ADER, CANCER RES, vol. 68, 2009, pages 8635 - 8642
AIELLO, DIABETES, vol. 46, 1997, pages 1473 - 1480
ALVAREZ, NATURE, vol. 465, 2010, pages 1084 - 1088
AMBATI ET AL., SURV OPHTHALMOL, vol. 48, 2003, pages 257 - 93
ANNABI, EXP HEMATOL., vol. 31, no. 7, July 2003 (2003-07-01), pages 640 - 9
BANNO ET AL., J BIOL CHEM., vol. 274, 1999, pages 27385 - 27391
BETAT H ET AL: "Aptamers that recognize the lipid moiety of the antibiotic moenomycin A", BIOLOGICAL CHEMISTRY 200310 DE LNKD- DOI:10.1515/BC.2003.165, vol. 384, no. 10-11, October 2003 (2003-10-01), pages 1497 - 1500, XP002647337, ISSN: 1431-6730 *
BU, ARTHRITIS RHEUM., vol. 62, no. 7, July 2010 (2010-07-01), pages 2117 - 26
BYLSMA, GUYMER, CLIN EXP OPTOM, vol. 88, 2005, pages 322 - 34
CABALLERO, EXP EYE RES, vol. 88, 2009, pages 367 - 377
CABALLERO, EXP EYE RES., vol. 88, no. 3, March 2009 (2009-03-01), pages 367 - 77
CHAE, J CLIN INVEST, vol. 114, 2004, pages 1082 - 9
CIULLA ET AL., CURR OPIN OPHTHALMOL, vol. 12, 2001, pages 442 - 9
CUVILLIER, CURR MOL PHARMACOL, vol. 3, 2010, pages 53 - 65
DART ET AL., EYE, vol. 17, 2003, pages 886 - 92
DEGUCHI, ONCOL REP., vol. 16, no. 4, October 2006 (2006-10-01), pages 699 - 703
DIKIC ET AL., NATURE, vol. 383, 1996, pages 547 - 550
DOUGHERTY ET AL., CORNEA, vol. 15, 1996, pages 537 - 540
EICHLER ET AL., CURR PHARM DES, vol. 12, 2006, pages 2645 - 60
EULBERG D ET AL: "Spiegelmers: biostable aptamers", CHEMBIOCHEM - A EUROPEAN JOURNAL OF CHEMICAL BIOLOGY, WILEY VCH, WEINHEIM, DE, vol. 4, no. 10, 6 October 2003 (2003-10-06), pages 979 - 983, XP002364015, ISSN: 1439-4227, DOI: DOI:10.1002/CBIC.200300663 *
FITZPATRICK, PHARMACOLOGY, vol. 87, no. 3-4, 2011, pages 135 - 43
FREISTRITZER, RIEWALD, BLOOD, vol. 105, no. 8, 15 April 2005 (2005-04-15), pages 3178 - 84
FRENCH ET AL., CANCER RES, vol. 63, 2003, pages 5962 - 5969
FYRST, NAT CHEMICAL BIOLOGY, 2010, pages 489 - 497
GARCIA ET AL., J CLIN INVEST., vol. 108, 2001, pages 689 - 701
GELLINGS LOWE, CARDIOVASC RES, vol. 82, 2009, pages 303 - 312
GON ET AL., PROC NATL ACAD SCI USA., vol. 102, 2005, pages 9270 - 9275
GONDA ET AL., BIOCHEM J., vol. 337, 1999, pages 67 - 75
GRALER, FASEB J, vol. 18, 2004, pages 551 - 553
GRYZIEWICZ, ADV DRUG DELIV REV, vol. 57, 2005, pages 2092 - 8
GUO ET AL., EUR J BIOCHEM., vol. 257, 1998, pages 403 - 408
HAIT, SCIENCE, vol. 325, 2009, pages 1254 - 1257
HERZINGER, AM J CLIN DERMATOL., vol. 8, no. 6, 2007, pages 329 - 36
HO, MOL CANCER THER, vol. 4, 2005, pages 1430 - 1438
HOBSON, SCIENCE, vol. 291, 2001, pages 1800 - 1803
IDZKO, J CLIN INVEST, vol. 116, 2006, pages 2935 - 2944
IGARASHI, PROC NATL ACAD SCI USA, vol. 100, 2003, pages 10664 - 9
JAMES: "Encyclopedia of Analytical Chemistry", 2000, pages: 4848 - 4871
JAPTOK, KLEUSER, CURR OPIN INVESTIG DRUGS., vol. 10, no. 11, November 2009 (2009-11-01), pages 1183 - 94
JUAN RIVERA ET AL: "The alliance of sphingosine-1-phosphate and its receptors in immunity", NATURE REVIEWS IMMUNOLOGY, vol. 8, no. 10, 1 October 2008 (2008-10-01), pages 753 - 763, XP055002039, ISSN: 1474-1733, DOI: 10.1038/nri2400 *
KATSUMA, FEBS LETT, vol. 579, 2005, pages 2576 - 2582
KATSUNORI HORII ET AL: "Development of a Sphingosylphosphorylcholine Detection System Using RNA Aptamers", MOLECULES, vol. 15, no. 8, 20 August 2010 (2010-08-20), pages 5742 - 5755, XP055001924, ISSN: 1420-3049, DOI: 10.3390/molecules15085742 *
KIM ET AL., BIOCHIM BIOPHYS ACTA, vol. 1791, 2009, pages 692 - 6
KIMURA ET AL., BIOCHEM J., vol. 348, 2000, pages 71 - 76
KITANO, ARTHRITIS RHEUM., vol. 54, no. 3, March 2006 (2006-03-01), pages 742 - 53
KORFF, AUGUSTIN, J CELL BIOL, vol. 143, 1998, pages 1341 - 52
KORFF, AUGUSTIN, J CELL SCI, vol. 112, 1999, pages 3249 - 58
KUME ET AL., J PHARMACOL EXP THER., vol. 320, 2007, pages 766 - 773
LAI, J IMMUNOL, vol. 181, 2008, pages 8010 - 17
LAI, J IMMUNOL, vol. 183, 2009, pages 2097 - 2103
LAI, J IMMUNOL., vol. 181, no. 11, 1 December 2008 (2008-12-01), pages 8010 - 7
LAMONTAGNE, CANCER RES., vol. 66, no. 1, 1 January 2006 (2006-01-01), pages 221 - 31
LEDGERWOOD, NAT. IMMUNOL., vol. 9, 2008, pages 42 - 53
LEE ET AL., CORNEA, vol. 20, 2001, pages 238 - 42
LEE ET AL., MOL CELL, vol. 8, 2001, pages 693 - 704
LEE, BIOCHEM BIOPHYS RES COMMUN, vol. 264, 1999, pages 743 - 750
LEE, J TRAUMA, vol. 57, no. 5, 2004, pages 955 - 60
LIU ET AL., J CLIN INVEST., vol. 106, 2000, pages 951 - 961
LIU, BLOOD, vol. 111, 2008, pages 275 - 284
LIU, REGILLO, CURR OPIN OPHTHALMOL, vol. 15, 2004, pages 221 - 6
LUCAS DA SILVA, J EXP THER ONCOL, vol. 7, 2008, pages 9 - 15
MACEYKA ET AL., J LIPID RES., vol. 50, 2009, pages 272 - 6
MAINES, INVEST OPHTHALMOL VIS SCI, vol. 47, 2006, pages 5022 - 5031
MAIRAL ET AL., ANAL BIOANL CHEM, vol. 390, no. 4, 2008, pages 989 - 1007
MANDALA, SCIENCE, vol. 296, 2002, pages 346 - 349
MARSOLAIS, ROSEN, NAT REV DRUG DISCOV, vol. 8, no. 4, April 2009 (2009-04-01), pages 297 - 307
MASSIN, DIABETES CARE, vol. 33, no. 11, 2010, pages 2399 - 405
MATLOUBIAN, NATURE, vol. 427, 2004, pages 355 - 360
METTU, INVEST OPHTHALMOL VIS SCI., vol. 45, no. 7, July 2004 (2004-07-01), pages 2263 - 71
MILSTIEN, SPIEGEL, CANCER CELL, vol. 9, 2006, pages 148 - 150
MORRIS, AUTOIMMUNITY, vol. 44, no. 2, March 2011 (2011-03-01), pages 115 - 28
MÜLLER, PULM PHARMACOL THER., 23 March 2011 (2011-03-23)
NEVIANI, J CLIN INVEST, vol. 117, 2007, pages 2408 - 2421
NISHIUMA, AM J PHYSIOL LUNG CELL MOL PHYSIOL., vol. 294, no. 6, June 2008 (2008-06-01), pages 1085 - 93
O'BRIEN, J LIPID RES, vol. 50, 2009, pages 2245 - 2257
OKAMOTO ET AL., J BIOL CHEM., vol. 273, 1998, pages 27104 - 27110
PAIK, GENES DEV., vol. 18, no. 19, 1 October 2004 (2004-10-01), pages 2392 - 403
PETERS ET AL: "Sphingosine-1-phosphate signaling in the cardiovascular system", CURRENT OPINION IN PHARMACOLOGY, ELSEVIER SCIENCE PUBLISHERS, NL, vol. 7, no. 2, 17 March 2007 (2007-03-17), pages 186 - 192, XP005933409, ISSN: 1471-4892, DOI: DOI:10.1016/J.COPH.2006.09.008 *
PUNEET, SCIENCE, vol. 328, no. 5983, 4 June 2010 (2010-06-04), pages 1290 - 4
PYNE, NAT REV CANCER, vol. 10, 2010, pages 489 - 503
RAGUZ, BR J CANCER, vol. 99, 2008, pages 387 - 3912008
ROVIEZZO, AM J RESPIR CELL MOL BIOL., vol. 42, no. 5, May 2010 (2010-05-01), pages 572 - 7
RYU ET AL., CIRC RES., vol. 90, 2002, pages 325 - 332
SABBADINI, BR J PHARMACOL., vol. 162, no. 6, March 2011 (2011-03-01), pages 1225 - 38
SAKURAI, INVEST OPHTHALMOL VIS SCI, vol. 44, 2003, pages 3578 - 3585
SANNA ET AL., NAT CHEM BIOL., vol. 2, no. 8, August 2006 (2006-08-01), pages 434 - 41
SATO ET AL., MOL PHARMACOL., vol. 55, 1999, pages 126 - 133
SCHWAB, SCIENCE, vol. 309, no. 5741, 2005, pages 1735 - 9
SEDLAKOVA ET AL., TRANSPLANTATION, vol. 79, 2005, pages 297 - 303
See also references of EP2561079A1 *
SHIMIZU, CIRCULATION, vol. 111, 2005, pages 222 - 229
SINGLETON, FASEB J., vol. 19, no. 12, October 2005 (2005-10-01), pages 1646 - 56
SKOURA, ARTERIOSCLER THROMB VASC BIOL., vol. 31, no. 1, January 2011 (2011-01-01), pages 81 - 5
SKOURA, J CLIN INVEST, vol. 117, 2007, pages 2506 - 2516
SNIDER, FASEB J., vol. 23, no. 1, January 2009 (2009-01-01), pages 143 - 52
STAMER, EXP EYE RES., vol. 89, no. 6, December 2009 (2009-12-01), pages 980 - 8
SUMIDA, AM J PHYSIOL CELL PHYSIOL., 2 February 2011 (2011-02-02)
SWANEY, EXP EYE RES, vol. 87, 2008, pages 367 - 375
T. JANAS: "Specific RNA binding to ordered phospholipid bilayers", NUCLEIC ACIDS RESEARCH, vol. 34, no. 7, 13 April 2006 (2006-04-13), pages 2128 - 2136, XP055001937, ISSN: 0305-1048, DOI: 10.1093/nar/gkl220 *
TAKABE ET AL., PHARMACOL REV., vol. 60, no. 2, 2008, pages 181 - 95
TAKUWA, BIOCHIM BIOPHYS ACTA, vol. 1582, 2002, pages 112 - 120
TAKUWA, CARDIOVASC RES, vol. 85, 2009, pages 484 - 493
TAKUWA, CARDIOVASC RES., vol. 85, no. 3, 1 February 2010 (2010-02-01), pages 484 - 93
TERESA JANAS ET AL: "The selection of aptamers specific for membrane molecular targets", CELLULAR & MOLECULAR BIOLOGY LETTERS, vol. 16, no. 1, 1 March 2011 (2011-03-01), pages 25 - 39, XP055001923, ISSN: 1425-8153, DOI: 10.2478/s11658-010-0023-3 *
TEZEL, KAPLAN, TRENDS MOL MED, vol. 10, 2004, pages 417 - 20
TSUNEMI, CLIN IMMUNOL., vol. 136, no. 2, August 2010 (2010-08-01), pages 197 - 204
UHLIG, AM J RESPIR CRIT CARE MED., vol. 178, no. 11, 1 December 2008 (2008-12-01), pages 1100 - 14
VATER A ET AL: "TOWARD THIRD-GENERATION APTAMERS: SPIEGELMERS AND THEIR THERAPEUTIC PROSPECTS", CURRENT OPINION IN DRUG DISCOVERY AND DEVELOPMENT, CURRENT DRUGS, LONDON, GB, vol. 6, no. 2, 1 January 2003 (2003-01-01), pages 253 - 261, XP008031617, ISSN: 1367-6733 *
VISENTIN BARBARA ET AL: "Validation of an anti-sphingosine-1-phosphate antibody as a potential therapeutic in reducing growth, invasion, and angiogenesis in multiple tumor lineages", CANCER CELL, CELL PRESS, US, vol. 9, no. 3, 1 March 2006 (2006-03-01), pages 225 - 238, XP002455666, ISSN: 1535-6108, DOI: DOI:10.1016/J.CCR.2006.02.023 *
VISENTIN ET AL., CANCER CELL, vol. 9, no. 3, 2006, pages 225 - 38
VISENTIN, CANCER CELL, vol. 9, 2006, pages 1 - 14
VISENTIN, CANCER CELL, vol. 9, no. 3, March 2006 (2006-03-01), pages 225 - 38
VISENTIN, CANCER CELL., vol. 9, no. 3, March 2006 (2006-03-01), pages 225 - 38
VLASENKO, J IMMUNOL, vol. 174, 2005, pages 6456 - 6461
WANG, MICROVASC RES., vol. 77, no. 1, January 2009 (2009-01-01), pages 39 - 45
XIE, J CELL PHYSIOL, vol. 218, 2009, pages 192 - 198
XIN, J BIOL CHEM, vol. 279, 2004, pages 35255 - 35262
ZHANG ET AL., TRANSPLANTATION, vol. 76, 2003, pages 1511 - 3
ZHANG, SCAND J IMMUNOL., 15 February 2011 (2011-02-15)
ZHOU, MURTHY, AM J PHYSIOL CELL PHYSIOL., vol. 286, 2004, pages C1130 - C1138

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012095303A1 (en) * 2011-01-10 2012-07-19 Noxxon Pharma Ag Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
WO2018001565A1 (en) 2016-07-01 2018-01-04 Centogene Ag Use of lyso-gb1 as druggable target
WO2020005325A1 (en) * 2018-06-29 2020-01-02 The Procter & Gamble Company Aptamers for hair care applications
CN112384622A (zh) * 2018-06-29 2021-02-19 宝洁公司 用于毛发护理应用的适配体

Also Published As

Publication number Publication date
AU2011244628A1 (en) 2012-11-08
AU2011244628B2 (en) 2016-01-07
JP5941904B2 (ja) 2016-06-29
AU2011244628A2 (en) 2012-11-08
CN102906265B (zh) 2016-08-24
JP2013524792A (ja) 2013-06-20
US8871920B2 (en) 2014-10-28
CN102906265A (zh) 2013-01-30
EP2561079A1 (en) 2013-02-27
US20130165501A1 (en) 2013-06-27

Similar Documents

Publication Publication Date Title
US8871920B2 (en) Lipid binding nucleic acids
RU2633510C2 (ru) Аптамер против ngf и его применение
CA2981308C (en) Compositions and methods related to protein displacement therapy for myotonic dystrophy
JP5798549B2 (ja) ヘプシジン結合核酸
KR101356935B1 (ko) 지질, 지질 복합체 및 이들의 용도
US9976145B2 (en) Nucleic acid molecule having binding affinity to a target molecule and a method for generating the same
KR20120102642A (ko) 축삭 변성의 조절
US11479772B2 (en) Thiomorpholino oligonucleotides for the treatment of muscular dystrophy
JP2007513608A (ja) 生物活性グレリンに特異的に結合する核酸
CN115175685A (zh) 用于治疗血管生成素样4(angptl4)相关疾病的寡核苷酸
TWI500425B (zh) 對ngf之適體及其用途
JP2014533098A (ja) グルカゴン結合核酸
AU2011244628B9 (en) Lipid binding nucleic acids
JP2010502640A (ja) mTORシグナル伝達を調節する組成物および方法
AU2015268717A1 (en) Lipid binding nucleic acids
US20230193266A1 (en) Thiomorpholino Oligonucleotides For The Treatment of Muscular Dystrophy
EP2613789B1 (en) Sdf-1 binding nucleic acids and the use thereof in cancer treatment
WO2020163974A1 (zh) 针对骨硬化蛋白的适体的诊断用途
KR102929968B1 (ko) Cxcl8 결합 핵산
US8580493B2 (en) Screening for compounds that modulate GPR3-mediated beta-arrestin signaling and amyloid beta peptide generation
US20040254131A1 (en) Method for prevention or treatment of diseases or disorders related to excessive formation of vascular tissue or blood vessels
HK1146296A (en) C5a binding nucleic acids

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180024560.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11716838

Country of ref document: EP

Kind code of ref document: A1

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 8978/CHENP/2012

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2013505367

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2011244628

Country of ref document: AU

Date of ref document: 20110421

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2011716838

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011716838

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13642555

Country of ref document: US