WO2011115366A2 - 대한민국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트 - Google Patents

대한민국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트 Download PDF

Info

Publication number
WO2011115366A2
WO2011115366A2 PCT/KR2011/000592 KR2011000592W WO2011115366A2 WO 2011115366 A2 WO2011115366 A2 WO 2011115366A2 KR 2011000592 W KR2011000592 W KR 2011000592W WO 2011115366 A2 WO2011115366 A2 WO 2011115366A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
species
dna sequence
diatoms
dna
Prior art date
Application number
PCT/KR2011/000592
Other languages
English (en)
French (fr)
Other versions
WO2011115366A3 (ko
Inventor
이택견
박소윤
황진익
이윤호
장만
이건섭
Original Assignee
한국해양연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국해양연구원 filed Critical 한국해양연구원
Priority to US13/635,887 priority Critical patent/US20130123125A1/en
Publication of WO2011115366A2 publication Critical patent/WO2011115366A2/ko
Publication of WO2011115366A3 publication Critical patent/WO2011115366A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention is to determine the species of 36 major diatoms inhabiting the coast of Korea, in particular based on single nucleotide polymorphism (SNPs) of various diatom species,
  • SNPs single nucleotide polymorphism
  • the present invention relates to a species identification method of diatoms and a polynucleotide probe, a DNA chip, and a kit for species identification, which can analyze genotypes thereof, and determine species thereof simply, quickly and accurately.
  • the present invention is to accurately determine the difference between the nucleotide sequence of 36 species of diatoms inhabiting the coast of the Republic of Korea, and to produce a polynucleotide probe to be different for each species based on this, DNA chip or kit comprising the same
  • the purpose of this study is to provide a method for rapid and accurate analysis of sequence differences between species.
  • Another object of the present invention is to provide a probe comprising 15 to 30 contiguous nucleotides containing a region having a nucleotide sequence difference between species, a DNA chip comprising the same, and a kit including the same.
  • the present invention it is intended to provide a method for simple, rapid and accurate screening of genotyping for multiple species of interest on one slide.
  • the present inventors intend to produce an optimal polynucleotide probe that can specifically bind to each species based on the single nucleotide polymorphism (SNPs) sites of COI genes in various species of mitochondrial DNA.
  • SNPs single nucleotide polymorphism
  • a method for discriminating species of diatoms includes: obtaining a PCR product by performing a polymerase chain reaction (PCR) on DNA extracted from diatoms; Binding the PCR product to a probe each comprising a base sequence identical to or complementary to each DNA sequence of at least one of SEQ ID NO: 3 to SEQ ID NO: 51; And determining the species of the diatoms according to the coupling.
  • PCR polymerase chain reaction
  • a species of diatoms consisting of at least one polynucleotide each comprising a base sequence identical to or complementary to each of at least one DNA sequence selected from SEQ ID NO: 3 to SEQ ID NO: 51 (species) may be a probe for determining.
  • another embodiment of the present invention is a species of diatoms comprising at least one probe each comprising a base sequence identical to or complementary to each DNA sequence selected from SEQ ID NO: 3 to SEQ ID NO: 51 It may also be a DNA chip for discrimination.
  • another embodiment of the present invention binds to the mononucleotide polymorphism (SNP) site DNA sequence of the COI gene in mitochondrial DNA of diatoms, and is identical or complementary to the DNA sequence of any one of SEQ ID NOs: 3 to 51.
  • a polynucleotide probe comprising complementary 15-30 contiguous sequences; It may be a kit for discriminating species of diatoms, comprising a primer for amplifying the mitochondrial DNA of the diatoms by a polymerase chain reaction (PCR).
  • genotypes of various species of diatoms inhabiting the coast of the Republic of Korea based on the single nucleotide polymorphism (SNPs) of the diatoms, the effect of simple and quick and accurate species identification There is.
  • SNPs single nucleotide polymorphism
  • the present invention selected the COI gene from the mitochondrial DNA as the most suitable gene group to be distinguished by the genotype of diatoms, and found specific monobasic polymorphism (SNPs) sites therein, based on which DNA sequences distinguished between species were made randomly to facilitate species identification of diatoms.
  • SNPs monobasic polymorphism
  • the present invention is made of a diatom species discrimination probe, or a DNA chip or kit including the probe, and the sample is placed on one slide for larvae, seasoned products, or powdered powder, which are difficult to discriminate with the naked eye.
  • the species can be determined simply by placing it.
  • the time for analyzing a sample is greatly shortened compared to the conventional method, and a large amount of samples can be inspected within a short time.
  • 1 to 36 are schematic views sequentially showing a base sequence including a single nucleotide polymorphism site of the cytochrome oxidase subunit I (COI) gene in the mitochondrial DNA of diatoms according to a preferred embodiment of the present invention
  • FIG. 37 is a schematic diagram illustrating the structure of a DNA chip for diatom species discrimination according to an embodiment of the present invention, including an oligonucleotide probe prepared based on the monobasic polymorphism shown in FIGS. 1 to 36.
  • FIG. 38 to 54 are photographs showing the reaction results after combining the PCR amplification products of specific diatoms including the oligonucleotide probe and Achanathes longipes according to the present invention using the DNA chip of FIG. 37, respectively.
  • DNA is first extracted from various marine organisms belonging to the diatoms, and then, a polymerase chain reaction (PCR) is performed on the extracted DNA to obtain a PCR product.
  • PCR polymerase chain reaction
  • Extracting DNA from the sample may extract DNA from various tissues or various processed materials of the sample by various methods, and since DNA is extracted to analyze the extracted DNA, the DNA may be extracted at any part of the sample. Whether or not to extract is not particularly limited.
  • amplifying the DNA thus extracted by PCR is also used to extend the test sample, and the method of obtaining the amplified product is not particularly limited. It is obvious that other DNA extraction methods or amplification methods known to those skilled in the art also belong to the scope of the present invention.
  • the inventors selected the COI gene from the mitochondrial DNA as the most suitable gene group to distinguish the diatom genotype, and found a specific single nucleotide polymorphism (SNPs) site therein.
  • SNPs single nucleotide polymorphism
  • Polynucleotide probes that can specifically bind to each species can be made. Since the polynucleotide probe is manufactured based on the mononucleotide polymorphism (SNP) site of the species, it binds to the DNA of the intended species but does not bind to other species.
  • DNA sequences corresponding to SEQ ID NO: 3 to SEQ ID NO: 51 in the mitochondrial DNA of 36 major marine organisms inhabiting the coast of Korea have been optimized to distinguish each species after numerous studies and efforts.
  • the polynucleotide probe having the same or complementary nucleotide sequence as the DNA sequence of SEQ ID NO: 3 to SEQ ID NO: 51 it is possible to distinguish each of the corresponding species remarkably superior to any other conventional method I could see that.
  • the diatoms that are the subject of the present invention are not particularly limited, but are preferably fish species inhabiting the coast of the Republic of Korea, more preferably including the South Sea region of the Republic of Korea.
  • the term "South Korea” or “South Korea coast” is a sea adjacent to the territory of the Republic of Korea, and includes a sea which is generally considered as close to the boundary of the amphibious line and generally considered with respect to the line (coastline, shoreline, etc.). do.
  • the term “South Sea” or “Namhae Sea Area” refers to the sea in the south of Korea, which generally connects Tsushima Island to the east, Heuksan Island to the west, and Jeju Island to the south.
  • the present invention specifically uses mononucleotide polymorphism (SNPs) sites present in the COI gene region on mitochondrial DNA, and accordingly, the DNA extracted from the diatoms includes monobasic polymorphisms (SNPs) of the COI gene region in the mitochondrial DNA of diatoms. It is preferable.
  • SNPs mononucleotide polymorphism
  • polymorphism refers to the occurrence of two or more alternative sequences or alleles within a genetically determined population.
  • the polymorphic marker or site is the location where divergence occurs.
  • Preferred markers have two or more alleles which exhibit a frequency of occurrence of at least 1%, more preferably at least 10% or 20% in the selected population.
  • the polymorphic site may be a single base pair.
  • 1 to 36 sequentially show base sequences including a single nucleotide polymorphism site of a cytochrome oxidase subunit I (COI) gene in 36 mitochondrial DNAs of major diatoms inhabiting the coast of Korea according to a preferred embodiment of the present invention. It is a schematic diagram.
  • COI cytochrome oxidase subunit I
  • the inventors have found that, after numerous studies and efforts, using the nucleotide sequence belonging to the mononucleotide polymorphism (SNPs) site as a probe among the COI genes of cutlass DNA is most suitable for distinguishing the species of diatoms.
  • SNPs mononucleotide polymorphism
  • the present invention uses a nucleotide sequence belonging to the mononucleotide polymorphism (SNPs) site, that is, a nucleotide sequence identical or complementary to each DNA sequence of one or more of SEQ ID NOs: 3 to 51 described below as a probe.
  • SNPs mononucleotide polymorphism
  • these probes were constructed based on mononucleotide polymorphism (SNP) sites that differ depending on the species belonging to the diatoms, they bind to PCR sample products belonging to the intended diatoms but not to those of diatoms belonging to other species. desirable.
  • DNA sequences of SEQ ID NO: 3 to SEQ ID NO: 51 according to the present invention are as shown in Table 1 below.
  • schroeteri 706-729 B14 (SEQ ID NO: 16) GTATGAGTATGCATAGACTACCT Chlorella ellipsoidea, C. schroeteri 551-574 B15 (SEQ ID NO: 17) CCCAGTCTTGTTCCAGCACAT Chlorophyta UF 709-730 B16 (SEQ ID NO: 18) TGCTGATGGACATCCACTTCG Chlorophyta UF 654-675 B17 (SEQ ID NO: 19) CAGGTGCTATCACAATGCTTTTA Coscinodiscus perforatus, C.
  • rothii 635-658 B18 (SEQ ID NO: 20) TATCGGGAGCTGCTTCTATTTTA Coscinodiscus perforatus, C. rothii 482-505 B19 (SEQ ID NO: 21) CCAGAAATGGCTTGGCATAAATT Cylindrotheca closterium 547-570 B20 (SEQ ID NO: 22) AAATATGCGAAGTCCAGAAATGG Cylindrotheca closterium 534-557 B21 (SEQ ID NO: 23) GGAGGTGATCCAATACTTTATCA Cylindrotheca fusiformi 700-723 B22 (SEQ ID NO: 24) CTTTAGTGCAACGGGTGGTGGTG Cymatosira lorenziana 684-704 B23 (SEQ ID NO: 25) GCTTTTGACAGATCGTTTTTACG Cymatosira lorenziana 651-674 B24 (SEQ ID NO: 26) CATCTTTCTGGTGCTTCTTCTAT Ditylum brightwellii
  • the present invention can be produced a plurality of probes each comprising a base sequence identical to or complementary to each DNA sequence of at least one of SEQ ID NO: 3 to SEQ ID NO: 51, at least one of the probes obtained above
  • a plurality of probes each comprising a base sequence identical to or complementary to each DNA sequence of at least one of SEQ ID NO: 3 to SEQ ID NO: 51, at least one of the probes obtained above
  • the diatoms are Achnanthes longipes , Amphora sp. , Asterionella glacialis, Chaetoceros atlanticus, Chaetoceros didymus, Chaetoceros septentrionalis, Chaetoceros vistulae, Chlorella ellipsoidea, C. schroeteri, Chlorella ellipsoidea, C. schroeteri, Chlorophyta UF, Coscinodiscus perforatus, C.
  • At least one may be selected from the group consisting of T. decepiens, T.
  • SEQ ID NO: 4 and / or SEQ ID NO: 5 Amphora sp. Can be determined to be a species.
  • Other diatom species can also be distinguished according to their association with probes comprising the nucleotide sequences of the respective SEQ ID NOs listed in Table 1 above.
  • the probe according to the present invention binds to the monobasic polymorphism site of the COI gene region in the mitochondrial DNA of diatoms, and the binding is preferably made differently depending on the species of the diatoms.
  • the binding is made differently depending on the species of diatoms, the probe comprising the nucleotide sequence of SEQ ID NO: 3 Achnanthes longipes Specifically binding to the 26-49th DNA sequence of the COI gene region in the mitochondrial DNA of the species, the probe of SEQ ID NO: Amphora sp. The 544-567th DNA sequence of the species, Amphora sp.
  • SEQ ID NO: 6 Asterionella glacialis For the 55-78th DNA sequence of the species, SEQ ID NO: 6 Asterionella glacialis For the 706-729th DNA sequence of the species, SEQ ID NO: 7 Asterionella glacialis The DNA sequence of species 485-508, SEQ ID NO: 8 Chaetoceros atlanticus 58-81 th DNA sequence of the species, In the case of SEQ ID NO: 9 Chaetoceros atlanticus The 39-62th DNA sequence of the species, Chaetoceros didymus For DNA sequence 638-706, SEQ ID NO: 11 Chaetoceros didymus In the 625-648th DNA sequence of the species, Chaetoceros septentrionalis For DNA sequence 639-662, SEQ ID NO: 13 Chaetoceros vistulae The 585-608th DNA sequence of the species, Chaetoceros vistulae For the 447-470th DNA sequence of the species, SEQ ID NO: 15 Chlorella ellipsoidea Wow
  • SEQ ID NO: 42 Thalassiosira allenii For the 678-699th DNA sequence of the species, SEQ ID NO.
  • Thalassiosira allenii For the 651-674th DNA sequence of SEQ ID NO: 44 Thalassiosira baltica. T. decepiens Wow T. puntigera
  • SEQ ID 45 Thalassiosira conferta
  • SEQ ID NO: 46 Thalassiosira nordenskioldi
  • SEQ ID NO: 47 Thalassiosira nordenskioldi
  • SEQ ID NO 48 Thalassiosira nordenskioldi Wow T.
  • Thalassiosira ostupii For DNA sequence 584-607, SEQ ID 50 Thalassiosira rotula
  • SEQ ID NO: 242-265, SEQ ID NO: 51, Thalassiosira rotula May specifically bind to the 448-471 th DNA sequence of the species.
  • the step of binding the PCR product to the probe is preferably carried out at least two times, so before the step of confirming the binding, the binding of the extracted DNA and the probe according to the present invention If the process is performed repeatedly, the binding can be further ensured, thereby further strengthening the binding of the probe to the DNA product of interest.
  • PCR polymerase chain reaction
  • a specific base sequence suitable for the diatom species is used as a primer for the amplification.
  • Such specific primers conform to the mononucleotide polymorphism (SNP) region DNA sequence of the COI gene in the mitochondrial DNA of diatoms, thereby further amplifying the extracted DNA.
  • the DNA extracted from blood, cells or tissues as described above preferably comprises a monobasic polymorphism (SNP) site of the COI gene.
  • a primer comprising the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 shown in Table 2 as the forward primer and the reverse primer.
  • the present invention is characterized by using a probe each comprising a base sequence identical to or complementary to each DNA sequence of at least one of SEQ ID NO: 3 to SEQ ID NO: 51, according to another embodiment of the present invention
  • the form can be the probes described above, DNA chips and kits comprising such probes.
  • the DNA chip and kit may further be fixed with a separate position marker represented by a specific base sequence.
  • the present invention can simultaneously discriminate multiple species of diatoms on one slide according to DNA microarray technology.
  • DNA chip and kit according to the present invention including the probe described above, by determining the species-specific monobasic polymorphism according to the hybridization of DNA, to quickly determine the genotype and the species of the diatoms to be analyzed without analyzing the nucleotide sequence It has the utility to do it.
  • primers for amplifying DNA extracted from diatoms were synthesized.
  • the diatoms and thus primers used in this example were the same as those listed in Table 1 above.
  • Reverse (antisense) primers used for symmetric or asymmetric PCR were prepared by attaching rhodamine, cy3, cy5 to the ends or biotin to the end of the hybridization reaction to confirm the fluorescence, and after the hybridization reaction with Syreptavidin-Cyanine It was made to use to combine.
  • reaction composition Sterile Distilled Water 10X PCR buffer 2.5mM dNTP 10 uM forward 10 uM reverse 1unit Hot start Taq Purified DNA 9.5 ul 2 ul 2 ul 1 ul 1 ul 0.5 ul 4 ul 94 °C, 5 minutes 1 cycle 94 ° C, 30 seconds 49 ° C, 30 seconds 72 ° C, 1 minute 40 cycle 72 ° C., 7 minutes 1 cycle
  • PCR products were electrophoresed on agarose gel containing EtBr and confirmed by using an image analyzer attached with a UV transillunimator.
  • probes for 36 diatoms were synthesized. Sequence information of the probe for the hybridization reaction is as shown in Table 1 above. Through multiple comparisons of mitochondrial COI gene sequences of each species of diatoms, the base sequence of a species-specific probe was determined based on the lowest homologous sequence region.
  • Example 3 50 ⁇ M of the diatom species identification probe modified with amino link prepared in Example 3 was mixed with the same amount of 3X SSC, and reacted at room temperature for 16 hours. After completion of the reaction, the slides were washed twice with 0.1% SDS for 5 minutes, and then reacted with sodium borohydride solution (1.3 g NaBH4, 375ml PBS, 125ml EtOH) for 5 minutes, washed with distilled water, and then washed at 800 rpm in a vacuum centrifuge. Rotate for 10 minutes to dry and stored at room temperature. A schematic diagram of the DNA chip structure thus prepared is shown in FIG. 37.
  • sodium borohydride solution 1.3 g NaBH4, 375ml PBS, 125ml EtOH
  • FIG. 37 is a schematic diagram illustrating the structure of a DNA chip for diatom species discrimination according to an embodiment of the present invention, including an oligonucleotide probe prepared based on the monobasic polymorphism shown in FIGS. 1 to 36.
  • the present invention integrates so that only one probe is contained in each dot on the slide used as the substrate of the chip to manufacture a DNA chip, and a probe of a position marker is integrated in the upper left and lower right dots. It was configured to be used for comparative analysis with the fluorescence scan results.
  • FIG. 38 to 54 are photographs showing the reaction results after combining the PCR amplification products of specific diatoms including the oligonucleotide probe and Achanathes longipes according to the present invention using the DNA chip of FIG. 37, respectively.
  • Figure 38 is Achnanthes longipes
  • 39 is a Chaetoceros atlanticus
  • 40 is a Chaetoceros septentrionalis
  • Figure 41 is a Chaetoceros vistulae
  • 42 is Coscinodiscus rothii
  • 43 is Cylindrotheca fusiformi
  • Figure 44 is Cymatosira lorenziana
  • Figure 45 is Melosira nummuloides
  • 46 shows Navicula sp.
  • Figure 47 is Nitzschia ponnes
  • 48 is Nitzschia subpacifica
  • 49 is Skeletonema costatum
  • 50 is Stephanopyxis turris
  • Figure 51 is Thalassiosira allenii
  • 52 is Thalassiosira baltica
  • 53 is Thalassiosira conferta
  • 54 is about Thalassiosira ostupii The result is.
  • the fluorescent label is different depending on the species, it was confirmed that the species can be determined accordingly.
  • genotyping of a large number of marine species on one slide has the effect of simple, rapid and accurate determination.
  • using the mitochondrial COI region of 30 marine organisms as a genetic marker can solve the problem of low resolution, which has been conventionally used to determine the species by conventional morphological distinction.
  • using the DNA chip method based on monobasic polymorphism according to the present invention rather than discriminating on the basis of morphological differences, it provides a more advanced type of genetic analysis method than the prior art, more effectively marine Species can be discriminated and resolution can be significantly increased.
  • the microarray method using the polynucleotide probe according to the present invention can be used to quickly determine genotype of each species without analyzing the sequence by discriminating species-specific monobasic polymorphism according to hybridization of DNA. Has applicability.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 한국 연안에 서식하는 규조류의 종(species)을 판별하는 방법과, 이를 위한 규조류의 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트에 대한 것으로, 규조류에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계; 상기 PCR 산물을, 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및, 상기 결합 여부에 따라 상기 규조류가 속하는 종을 판별하는 단계;를 포함하는 것이 특징이다. 이러한 본 발명은 다양한 규조류 종의 단염기다형성(single nucleotide polymorphism, SNPs)을 기반으로, 한국 연안에 서식하는 규조류에 대한 유전자형을 분석하고, 간단하고 신속, 정확하게 그것의 종을 판별할 수 있는 효과가 있다.

Description

대한민국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, ＤＮＡ 칩 및 키트
본 발명은 대한민국 연안에 서식하는 36종의 주요 규조류의 종(species)을 판별하기 위한 것으로, 특히 다양한 규조류 종의 단염기다형성(single nucleotide polymorphism, SNPs)을 기반으로, 대한민국 연안에 서식하는 규조류에 대한 유전자형을 분석하고, 간단하고 신속, 정확하게 그것의 종을 판별할 수 있는 규조류의 종 판별 방법과 이에 따른 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트에 대한 것이다.
국내외 종래의 생물종 분류연구는 형태의 계측형질, 계수형질을 바탕으로 하고 있다.
그러나, 해양 미세조류는 환경 조건에 따라 형태적 특징이 변화하여 형태학적 분류의 한계점이 보고되고 있으며, 연구자들에 따라 해양 미세 조류의 분류 체계도 일부 차이를 보이고 있어 생태계 다양성 모니터링에 있어 일부 문제점이 제시되고 있다. 이러한 문제점을 해결하기 위해 분자마커를 이용한 DNA 바코드 정보 분석 및 DNA 칩 개발을 이용한 정확한 동정이 필요하다. DNA 바코드 정보 분석 및 DNA 칩을 통한 해양 생물 다양성 분석 등은 향후 해양 환경 모니터링 및 보전 연구에 활용할 수 있다.
하지만, 우리나라 생물다양성과 관련하여 중요 어장으로 꼽히는 대한민국 연안의 다양한 규조류에 대하여, 생물다양성 조사를 위한 다양한 생물종을 한번에, 그리고 신속 정확하게 판별할 수 있는 분자 생물학적인 연구는 국내외에서 그 사례를 찾기 어려운 실정이다.
본 발명은 대한민국 연안에 서식하는 주요 규조류에 대하여 유전자형을 분석하여, 간단하고 신속, 정확하게 상기 규조류의 종을 판별할 수 있는 방법을 제공하는 것이 목적이다.
해당하는 종을 구분하는 데 있어서, 염기서열의 차이가 밝혀졌다고 하더라도 이를 신속 정확하게 분석할 수 있는 표준화된 방법이 있으면 많은 시간과 인적 자원, 비용이 줄어들 수 있다. 본 발명에서는 대한민국 연안에 서식하는 규조류의 주요 어종 36종 염기서열의 차이를 정확히 파악하고, 이를 근거로 하여 각 종마다 차이가 나도록 폴리뉴클레오티드 프로브를 제작하기 위한 것이며, 이를 포함하는 DNA칩 또는 키트를 이용하여 해당 종에 따른 염기서열 차이를 신속, 정확하게 분석할 수 있는 방법을 제공하고자 한다.
또한, 본 발명의 다른 목적은 종간에 염기서열 차이가 있는 부위를 포함하는 15개 내지 30개의 연속적인 뉴클레오티드로 구성된 프로브와, 이것으로 구성된 DNA칩 그리고 이것들을 포함하는 키트를 제공하는 것이다. 이러한 본 발명에 의해, 하나의 슬라이드 위에서 다수의 해당 생물종에 대한 유전자형 분석을 간단하고 신속, 정확하게 검사하는 방법을 제공하기 위한 것이다.
본 발명자들은 다양한 종의 미토콘드리아 DNA 중 COI유전자의 단염기다형성(single nucleotide polymorphism, SNPs) 부위를 근거로 하여, 각 종 마다 특이적으로 결합할 수 있는 최적의 폴리뉴클레오티드 프로브를 제작하고자 한다.
상기한 목적을 달성하기 위한 본 발명에 따른 규조류의 종(species) 판별 방법은, 규조류에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계; 상기 PCR 산물을, 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및, 상기 결합 여부에 따라 상기 규조류의 종(species)을 판별하는 단계;를 포함하여 이루어지는 것이 특징이다.
그리고, 본 발명의 다른 실시형태는, 서열번호 3 내지 서열번호 51 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 폴리뉴클레오티드로 이루어진 규조류의 종(species) 판별용 프로브일 수 있다.
또한, 본 발명의 또 다른 실시형태는 서열번호 3 내지 서열번호 51 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 프로브를 포함하는 규조류의 종(species) 판별용 DNA 칩인 것도 가능하다.
이와 함께, 본 발명의 또 다른 실시형태는 규조류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열과 결합하는 것으로, 서열번호 3 내지 서열번호 51 중 어느 하나의 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열로 이루어진 것을 특징으로 하는 폴리뉴클레오티드 프로브와; 상기 규조류의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 규조류의 종(species) 판별용 키트일 수도 있다.
기타 본 발명의 다른 실시형태는 후술하는 본 발명의 실시를 위한 구체적인 내용 및 첨부된 도면에 널리 기재되어 있다.
상기한 본 발명은 대한민국 연안에 서식하는 규조류의 다양한 종에 대한 유전자형을 분석하여, 상기 규조류의 단염기다형성(single nucleotide polymorphism, SNPs)을 기반으로, 간단하고 신속, 정확하게 종을 판별할 수 있는 효과가 있다.
즉, 본 발명은 규조류의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 특정한 단염기다형성(SNPs) 부위를 찾아내었으며, 이를 바탕으로 다양한 규조류의 종 간에 구별되는 DNA 서열을 임의의 만들어, 규조류의 종 판별을 간단하고 용이하게 하였다.
또한, 본 발명은 규조류 종 판별용 프로브, 또는 상기 프로브를 포함하는 DNA 칩이나 키트로 제작되어, 육안으로는 종을 분별하기 힘든 유생, 조미 가공물 또는 분말가루 등에 대해서도, 하나의 슬라이드 위에 시료를 올려놓는 것만으로도 그 종을 판별할 수 있는 것이다.
또한, 본 발명에 따른 프로브를 사용하여 마이크로어레이 방법을 활용하면, 종래의 방법에 비해 시료를 분석하는 시간이 크게 단축되어, 다량의 시료를 짧은 시간 내에 검사할 수 있다.
도 1 내지 도 36은 각각 본 발명의 바람직한 실시예에 따른 규조류의 미토콘드리아 DNA 중 COI(Cytochrome oxidase subunit I)유전자의 단일염기다형성 부위가 포함된 염기서열을 연속적으로 도시한 모식도이고,
도 37은 상기 도 1 내지 36에 나타난 단염기다형성에 근거하여 제작된 올리고뉴클레오티드 프로브를 포함하는, 본 발명의 일 실시예에 따른 규조류 종 판별용 DNA칩의 구조를 도식화한 모식도이고,
도 38 내지 도 54는 각각 상기 도 37의 DNA칩을 이용하여 본 발명에 따른 올리고뉴클레오티드 프로브와 Achanathes longipes 를 비롯한 특정 규조류의 PCR 증폭산물을 결합시킨 후의 반응 결과를 나타내는 사진이다.
이하에서는 본 발명의 바람직한 하나의 실시형태를 첨부된 도면을 참조하여 상세하게 설명하기로 한다.
본 발명에 따른 규조류의 종(species) 판별 방법은, 먼저 규조류에 속하는 다양한 해양생물 시료에서 DNA를 추출하고, 이렇게 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계를 거친다.
상기 시료에서 DNA를 추출하는 것은 시료의 각 조직 혹은 다양한 가공물 등으로부터 다양한 방법에 의해 DNA를 추출할 수 있고, 이는 추출된 DNA를 분석하여 종을 판별하기 위한 것이기 때문에, 상기 시료의 어느 부위에서 DNA를 추출하는지 또는 어떠한 방법으로 추출하는지는 특별히 제한되지 않는다.
그리고, 이렇게 추출한 DNA를 PCR로 증폭하는 것 또한 검사 표본을 늘이기 위한 것으로, 증폭산물을 얻는 방법은 특별히 제한되지 않는다. 본 발명이 속하는 기술분야의 당업자에게 알려진 다른 DNA 추출방법이나 증폭방법 또한 본 발명의 범주에 속한다는 것은 명백하다.
본 발명자들은 규조류의 유전자형으로 구별하기에 가장 적합한 유전자군으로서, 미토콘드리아 DNA 중 COI 유전자를 선택하였고, 거기에 존재하는 특정한 단염기다형성(single nucleotide polymorphism, SNPs) 부위를 찾아내었으며, 이를 바탕으로 해당 종마다 특이적으로 결합할 수 있는 폴리뉴클레오티드 프로브를 제작할 수 있게 되었다. 이러한 폴리뉴클레오티드 프로브는 해당 생물종의 단염기다형성(SNP) 부위를 근거로 제작되었기 때문에, 의도한 종의 DNA와는 결합하지만 이외에 다른 종에는 결합하지 않는 것이 특징이다.
특히, 본 발명자들은 수많은 연구와 노력 끝에, 대한민국 연안에 서식하는 주요 해양생물 36종의 미토콘드리아 DNA 중 COI 유전자에서 서열번호 3 내지 서열번호 51에 해당하는 DNA서열이 각 생물종을 구별하기에 최적으로 적합하다는 것을 확인하였고, 상기 서열번호 3 내지 서열번호 51의 DNA서열과 동일하거나 상보적인 염기서열을 가진 폴리뉴클레오티드 프로브를 사용하면, 종래의 다른 어떤 방법보다 현저히 우수하게 각 해당 생물종을 판별할 수 있음을 알 수 있었다.
이에 따라, 본 발명의 대상이 되는 규조류는 특별히 제한되는 것은 아니지만, 대한민국 연안에 서식하는 어종인 것이 바람직하고, 더욱 바람직하게는 대한민국의 남해 해역을 포함하는 것이 적합하다. 본 명세서에 있어서, “대한민국”또는 “대한민국 연안”이라 함은 대한민국 국토에 인접한 바다로서, 대체로 수륙의 경계를 이루고 선(해안선이나 호안선 등)을 기준으로 일반적으로 여겨지는 정도의 근접한 바다를 포함한다. 또한,“남해”또는“남해 해역”이라 함은 한국 남쪽에 있는 바다로서, 대체로 동쪽은 쓰시마섬[對馬島], 서쪽은 흑산도, 남쪽은 제주도를 연결하는 해역을 뜻한다.
본 발명은 특별히 미토콘드리아 DNA상의 COI 유전자 부위에 존재하는 단염기다형성(SNPs) 부위를 이용한 것이며, 이에 따라 상기 규조류에서 추출한 DNA는 규조류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성(SNPs)을 포함하는 것이 바람직하다.
본 명세서에서 ‘다형성(polymorphism)’이란 유전학적으로 결정된 집단 내에서 2 이상의 대체적 서열 또는 대립형질의 발생을 의미한다. 다형 마커 또는 부위는 발산이 일어나는 위치(locus)이다. 바람직한 마커는 선택된 집단에서 1% 이상, 더욱 바람직하기로는 10% 또는 20% 이상의 발생 빈도를 나타내는 두개 이상의 대립 형질을 가진다. 다형성 부위는 단일 염기쌍일 수도 있다.
도 1 내지 도 36은 각각 본 발명의 바람직한 실시예에 따른 대한민국 연안에 서식하는 주요 규조류 36종의 미토콘드리아 DNA 중 COI(Cytochrome oxidase subunit I)유전자의 단일염기다형성 부위가 포함된 염기서열을 연속적으로 도시한 모식도이다.
본 발명자들은 수많은 연구와 노력 끝에 갈치 DNA의 COI 유전자 중에서, 상기 단염기다형성(SNPs) 부위에 속하는 염기서열을 프로브로 이용하면, 상기 규조류의 종을 구별하기에 가장 적합하다는 것을 확인하였다.
이에 따라, 본 발명은 상기 단염기다형성(SNPs) 부위에 속하는 염기서열, 즉 후술하는 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 프로브로 이용한 것이다. 이러한 프로브는 규조류가 속하는 종에 따라 다른 단염기다형성(SNP) 부위를 근거로 제작되었기 때문에, 의도한 규조류에 속하는 PCR 시료 산물과는 결합하지만 이외에 다른 종에 속하는 규조류의 그것과는 결합하지 않는 것이 바람직하다.
본 발명에 따른 서열번호 3 내지 서열번호 51의 DNA 서열은 하기의 표 1에 나타낸 바와 같다.
표 1 [대한민국 연안에 서식하는 주요 규조류의 종 판별을 위한 DNA 서열]
프로브 명칭 DNA서열 반응 미세조류 종명 DNA 서열 위치
B1(서열번호3) CACTGCAAAAATCAGATAGAGCG Achnanthes longipes 26-49
B2(서열번호4) GCTCCAGGCTTTTTTATGCATAA Amphora sp. 544-567
B3(서열번호5) GAAACTACAGTTCCAATAACACC Amphora sp. 55-78
B4(서열번호6) GATCCTGTCTTATACCAGCATTT Asterionella glacialis 706-729
B5(서열번호7) CTGGTGCTTCATCAATATTAGGT Asterionella glacialis 485-508
B6(서열번호8) AAAGATAGAGCAGTCCCAGCTAC Chaetoceros atlanticus 58-81
B7(서열번호9) CTACTCCAGATATTGCACCAAAA Chaetoceros atlanticus 39-62
B8(서열번호10) TTTTTGACCCTGCAGGGGGTGGA Chaetoceros didymus 638-706
B9(서열번호11) CCAGTGCTTGCGGGAGCTATTAC Chaetoceros didymus 625-648
B10(서열번호12) GGCAATTACCATGCTTTTAACTG Chaetoceros septentrionalis 639-662
B11(서열번호13) GGCTGTCTTAATAACAGCTTTCT Chaetoceros vistulae 585-608
B12(서열번호14) TGGCGCAGTGGATTTAGCTATTT Chaetoceros vistulae 447-470
B13(서열번호15) GATCCCGTATTGTACCAACATTT Chlorella ellipsoidea, C. schroeteri 706-729
B14(서열번호16) GTATGAGTATGCATAGACTACCT Chlorella ellipsoidea, C. schroeteri 551-574
B15(서열번호17) CCCAGTCTTGTTCCAGCACAT Chlorophyta UF 709-730
B16(서열번호18) TGCTGATGGACATCCACTTCG Chlorophyta UF 654-675
B17(서열번호19) CAGGTGCTATCACAATGCTTTTA Coscinodiscus perforatus, C. rothii 635-658
B18(서열번호20) TATCGGGAGCTGCTTCTATTTTA Coscinodiscus perforatus, C. rothii 482-505
B19(서열번호21) CCAGAAATGGCTTGGCATAAATT Cylindrotheca closterium 547-570
B20(서열번호22) AAATATGCGAAGTCCAGAAATGG Cylindrotheca closterium 534-557
B21(서열번호23) GGAGGTGATCCAATACTTTATCA Cylindrotheca fusiformi 700-723
B22(서열번호24) CTTTAGTGCAACGGGTGGTGGTG Cymatosira lorenziana 684-704
B23(서열번호25) GCTTTTGACAGATCGTTTTTACG Cymatosira lorenziana 651-674
B24(서열번호26) CATCTTTCTGGTGCTTCTTCTAT Ditylum brightwellii 478-501
B25(서열번호27) GAGAGCAATAGGAATGACATTTC Gloeocystis gigas 540-563
B26(서열번호28) CTACCTTTTACGATCCGGCAGGA Gyrodimium impudicum 677-700
B27(서열번호29) TCCTTGGGCTATCCTTATCAC Heterosigma akashiwo 580-601
B28(서열번호30) GATCCCGTTCTTTATCAACATCT Melosira nummuloides 707-729
B29(서열번호31) TTTTTTTGACCCCGCAGGAGGCG Melosira nummuloides 681-704
B30(서열번호32) CTGTTCTTGCTGGAGCTATTACT Melosira nummuloides 626-649
B31(서열번호33) GATCCAGTTTTATACCAGCACTT Navicula sp. 706-729
B32(서열번호34) GTGTGGTCAGTATTTTTAACAGC Navicula sp. 580-603
B33(서열번호35) GGAGGAGACCCTATATTATATCA Nitzschia pungens 100-723
B34(서열번호36) GCAGCAGGTATAACTATGTTGTT Nitzschia pungens 634-657
B35(서열번호37) CTGTGTTATTCCAGCACTTATTC Nitzschia subpacifica 710-733
B36(서열번호38) CAAAAATGAGATAAAGCGTGCCA Prorocentrum minimum 21-44
B37(서열번호39) GTCTTGTTTCAGCATCTTTTCTG Skeletonema costatum 712-734
B38(서열번호40) CTGTTTTAGCTGGAGCTATTACA Skeletonema costatum 626-649
B39(서열번호41) CCTTTATTTGCCTGGTCAGTTTT Stephanopyxis turris 571-594
B40(서열번호42) CAGCGTTCTTTAATGCTGCTG Thalassiosira allenii 678-699
B41(서열번호43) GTTGATTACTGATCGTCACTTTG Thalassiosira allenii 651-674
B42(서열번호44) CATCTTCTRTTCTAGGTGCTATT Thalassiosira baltica. T. decepiens, T. puntigera 491-514
B43(서열번호45) GGAGCGATTACAATGCTATTAAC Thalassiosira conferta 637-660
B44(서열번호46) CTTCTTCTATTCTAGGGGCAATC Thalassiosira nordenskioldi, T. weissflogii 491-514
B45(서열번호47) CTATCTTTAGTTTGCACGTGTCT Thalassiosira nordenskioldi, T. weissflogii 464-487
B46(서열번호48) CTTCTTCTATTCTAGGGGCAATC Thalassiosira nordenskioldi, T. weissflogii 491-514
B47(서열번호49) GGGCAACATTAATTACAGCATTC Thalassiosira ostupii 584-607
B48(서열번호50) TTAACGGGACAAATCAGTTACCA Thalassiosira rotula 242-265
B49(서열번호51) GGTTCTGTAGACTTAGCGATATT Thalassiosira rotula 448-471
본 발명은 상기 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하도록 다수의 프로브를 제작할 수 있고, 이러한 프로브 중 적어도 하나 이상을 상기에서 얻은 PCR 산물과 결합시킴으로서, 그 결합 여부에 따라 규조류의 종을 판별할 수 있는 것이다.
본 발명에 있어서, 상기 상기 규조류는 Achnanthes longipes, Amphora sp., Asterionella glacialis, Chaetoceros atlanticus, Chaetoceros didymus, Chaetoceros septentrionalis, Chaetoceros vistulae, Chlorella ellipsoidea, C. schroeteri, Chlorella ellipsoidea, C. schroeteri, Chlorophyta UF, Coscinodiscus perforatus, C. rothii, Cylindrotheca closterium, Cylindrotheca fusiformi, Cymatosira lorenziana, Ditylum brightwellii, Gloeocystis gigas, Gyrodimium impudicum, Heterosigma akashiwo, Melosira nummuloides, Navicula sp., Nitzschia pungens, Nitzschia subpacifica, Prorocentrum minimum, Skeletonema costatum, Stephanopyxis turris, Thalassiosira allenii, Thalassiosira baltica. T. decepiens, T. puntigera, Thalassiosira conferta, Thalassiosira nordenskioldi, T. weissflogii, Thalassiosira ostupii 및 Thalassiosira rotula 로 이루어진 군에서 적어도 하나 이상이 선택된 것일 수 있다.
그래서, 상기 결합 여부에 따라 규조류가 속하는 종을 판별하는 것은, 상기 결합되는 서열번호를 근거로 하여, 서열번호 3의 프로브와 결합하면 Achnanthes longipes 종, 서열번호 4 또는/및 서열번호 5와 결합하면 Amphora sp. 종인 것으로 판별할 수 있다. 기타 규조류 종에 대해서도 상기 표 1에 기재된 각 서열번호의 염기서열을 포함하는 프로브와의 결합에 따라 그에 맞는 종 판별이 가능하다.
또한, 본 발명에 따른 상기 프로브는 규조류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성 부위와 결합하고, 상기 결합은 상기 규조류의 종에 따라 다르게 이루어지는 것이 바람직하다.
예를 들어, 상기 결합이 상기 규조류의 종에 따라 다르게 이루어진다는 것은, 서열번호 3의 염기서열을 포함하는 프로브는 Achnanthes longipes 종의 미토콘드리아 DNA 중 COI 유전자 부위의 26-49번째 DNA 서열과 특이적으로 결합하고, 서열번호 4의 프로브는 Amphora sp. 종의 544-567번째 DNA 서열, 서열번호 5의 경우는 Amphora sp.종의 55-78번째 DNA 서열, 서열번호 6의 경우는 Asterionella glacialis 종의 706-729번째 DNA 서열, 서열번호 7의 경우는 Asterionella glacialis 종의 485-508번째 DNA 서열, 서열번호 8의 경우는 Chaetoceros atlanticus 종의 58-81번째 DNA 서열, 서열번호 9의 경우는 Chaetoceros atlanticus 종의 39-62번째 DNA 서열, 서열번호 10의 경우는 Chaetoceros didymus 종의 638-706번째 DNA 서열, 서열번호 11의 경우는 Chaetoceros didymus 종의 625-648번째 DNA 서열, 서열번호 12의 경우는 Chaetoceros septentrionalis 종의 639-662번째 DNA 서열, 서열번호 13의 경우는 Chaetoceros vistulae 종의 585-608번째 DNA 서열, 서열번호 14의 경우는 Chaetoceros vistulae 종의 447-470번째 DNA 서열, 서열번호 15의 경우는 Chlorella ellipsoidea 와 C. schroeteri 종의 706-729번째 DNA 서열, 서열번호 16의 경우는 Chlorella ellipsoidea 와 C. schroeteri 종의 551-574 번째 DNA 서열, 서열번호 17의 경우는 Chlorophyta UF 종의 709-730 번째 DNA 서열, 서열번호 18의 경우는 Chlorophyta UF 종의 654-675 번째 DNA 서열, 서열번호 19의 경우는 Coscinodiscus perforatus 와 C. rothii 종의 635-658 번째 DNA 서열, 서열번호 20의 경우는 Coscinodiscus perforatus 와 C. rothii 종의 482-505 번째 DNA 서열, 서열번호 21의 경우는 Cylindrotheca closterium 종의 547-570 번째 DNA 서열, 서열번호 의 22경우는 Cylindrotheca closterium 종의 534-557 번째 DNA 서열, 서열번호 23의 경우는 Cylindrotheca fusiformi 종의 700-723 번째 DNA 서열, 서열번호 24의 경우는 Cymatosira lorenziana 종의 684-704 번째 DNA 서열, 서열번호 25의 경우는 Cymatosira lorenziana 종의 651-674 번째 DNA 서열, 서열번호 26의 경우는 Ditylum brightwellii 종의 478-501 번째 DNA 서열, 서열번호 27의 경우는 Gloeocystis gigas 종의 540-563 번째 DNA 서열, 서열번호 28의 경우는 Gyrodimium impudicum 종의 677-700 번째 DNA 서열, 서열번호 29의 경우는 Heterosigma akashiwo 종의 580-601 번째 DNA 서열, 서열번호 30의 경우는 Melosira nummuloides 종의 707-729 번째 DNA 서열, 서열번호 31의 경우는 Melosira nummuloides 종의 681-704 번째 DNA 서열, 서열번호 32의 경우는 Melosira nummuloides 종의 626-649 번째 DNA 서열, 서열번호 33의 경우는 Navicula sp. 종의 706-729 번째 DNA 서열, 서열번호 34의 경우는 Navicula sp. 종의 580-603 번째 DNA 서열, 서열번호 35의 경우는 Nitzschia pungens 종의 100-723 번째 DNA 서열, 서열번호 36의 경우는 Nitzschia pungens 종의 634-657 번째 DNA 서열, 서열번호 37의 경우는 Nitzschia subpacifica 종의 710-733 번째 DNA 서열, 서열번호 38의 경우는 Prorocentrum minimum 종의 21-44 번째 DNA 서열, 서열번호 39의 경우는 Skeletonema costatum 종의 712-734 번째 DNA 서열, 서열번호 40의 경우는 Skeletonema costatum 종의 626-649 번째 DNA 서열, 서열번호 41의 경우는 Stephanopyxis turris 종의 571-594 번째 DNA 서열, 서열번호 42의 경우는 Thalassiosira allenii 종의 678-699 번째 DNA 서열, 서열번호 43의 경우는 Thalassiosira allenii 종의 651-674 번째 DNA 서열, 서열번호 44의 경우는 Thalassiosira baltica. T. decepiens 와 T. puntigera 종의 491-514 번째 DNA 서열, 서열번호 45의 경우는 Thalassiosira conferta 종의 637-660 번째 DNA 서열, 서열번호 46의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 491-514 번째 DNA 서열, 서열번호 47의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 464-487 번째 DNA 서열, 서열번호 48의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 491-514 번째 DNA 서열, 서열번호 49의 경우는 Thalassiosira ostupii 종의 584-607 번째 DNA 서열, 서열번호 50의 경우는 Thalassiosira rotula 종의 242-265 번째 DNA 서열, 서열번호 51의 경우는 Thalassiosira rotula 종의 448-471 번째 DNA 서열과 특이적으로 결합하는 것일 수 있다.
나아가, 상술한 본 발명에서, 상기 PCR 산물을 프로브에 결합시키는 단계는 적어도 2회 이상 수행되는 것이 바람직한데, 이와 같이 상기 결합을 확인하는 단계 이전에, 추출된 DNA와 본 발명에 따른 프로브의 결합 과정을 반복적으로 수행한다면, 상기 결합을 더욱 확실히 하여 프로브와 대상 DNA 산물의 결합을 더욱 견고히 할 수 있기 때문이다.
한편, 본 발명의 다른 실시형태는, 상술한 규조류의 종 판별 방법에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 또는 서열번호 2의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 할 수 있다.
즉, 본 발명에 따른 36종의 규조류에서 DNA 시료를 채취하고, 이를 증폭시켜서 PCR 산물을 증폭시키는데 있어서, 상기 규조류의 종에 적합한 특별한 염기서열을 상기 증폭을 위한 프라이머로 사용하는 것이다. 이러한 특정한 프라이머는 규조류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열에 부합하는 것으로써, 상기 추출한 DNA를 더욱 우수하게 증폭시킬 수 있다. 이를 위해 상기와 같이 혈액, 세포 또는 조직으로부터 추출된 DNA는 COI 유전자의 단염기다형성(SNP) 부위를 포함하는 것이 바람직하다.
예를 들어, 상기 규조류에 속하는 종에 대해서는, 하기 표 2에 기재된 서열번호 1과 서열번호 2의 염기서열을 포함하는 프라이머를 정방향 프라이머와 역방향 프라이머로 이용하는 것이 바람직하다.
표 2 [규조류의 판별을 위한 프라이머 서열]
프 라 이 머 염 기 서 열
전위 프라이머(서열번호1) TCAACAAATCATAAAGATATTGG
역위 프라이머 (서열번호2) ACTTCTGGATGTCCAAAAAAYCA
상기한 바와 같이, 본 발명은 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브를 이용하는 것이 특징이고, 이에 따라 본 발명의 다른 실시형태는 상기한 프로브, 이러한 프로브를 포함하는 DNA 칩 및 키트일 수 있다. 상기 DNA 칩 및 키트에는 프로브와의 결합 및 검출의 정확성을 높이기 위하여, 특정한 염기서열로 표시되는 별도의 위치마커(position marker)가 추가로 고정되어 있는 것도 가능하다.
이러한 본 발명은 DNA 마이크로어레이 기술에 따라 하나의 슬라이드 위에서 다수 규조류의 종을 동시에 판별할 수 있다. 본 발명에 따른 DNA 칩 및 키트는 상기한 프로브를 포함하여, 종 특이적 단염기다형성을 DNA의 혼성화 가부에 따라 판별함으로서, 염기서열을 분석하기 않고도 분석하고자 하는 규조류의 유전자형과 그 종을 신속히 판정할 수 있는 효용성을 가지고 있다. 또한 상기 규조류에 속하는 어종을 한 번의 실험으로 정확한 유전자형을 분석할 수 있어, 상기 규조류의 유전자형과 종을 판별하는 방법을 표준화 및 자동화하는 것도 가능하다.
본 발명은 하기의 실시예에 의하여 보다 더 잘 이해 될 수 있으며, 하기의 실시예는 본 발명의 예시 목적을 위한 것이며, 첨부된 특허청구범위에 의하여 한정되는 보호범위를 제한하고자 하는 것은 아니다.
실시예 1: 프라이머의 합성
먼저, 규조류에서 추출한 DNA를 증폭시키기 위한 프라이머를 합성하였다. 본 실시예에서 사용한 규조류와 이에 따른 프라이머는 상기 표 1에 기재된 것과 같은 것을 사용하였다.
대칭 또는 비대칭 PCR에 사용하는 역방향(앤티센스) 프라이머는 교잡화 반응 후에 형광을 확인하기 위하여, 말단에 로다민, cy3, cy5를 부착시켜서 제작하거나 바이오틴을 부착시켰고, 교잡화 반응 후 Syreptavidin-Cyanine과 결합하도록 제작하여 사용하였다.
실시예 2: 규조류의 DNA 추출과 PCR 반응
대한민국 연안에 서식하는 주요 규조류 36종, 즉 Achnanthes longipies, Chaetoceros atlanticus, Chaetoceros septentrionalis, Chaetoceros vistulae, Coscinodiscus rothii, Cylindrotheca fusiformis, Cymatosira lorenziana, Melosira nummuloides, Naviclua sp., Nitzschia pungens, Nitzschia subpacifica, Skeletonema costatum, Stephanopysxis turris, Thalassiosira allenii, Thalassiosira baltica, Thalassiosira conferta, Thalassiosira ostupii 종 등의 DNA는 독일 QIAGEN사의 DNeasy tissue kit을 사용하여 추출하였다.
하기의 표 3과 같은 조건의 방법으로 PCR 반응을 DNA Engine(MJ Research사, 미국)으로 PCR 반응을 시행하였다.
표 3 [프라이머 정상 증폭 확인 조건]
반응조성 반응 조건
멸균증류수 10X PCR buffer 2.5mM dNTP 10 uM forward 10 uM reverse 1unit Hot start Taq 정제 DNA 9.5 ul 2 ul 2 ul 1 ul 1 ul 0.5 ul 4 ul 94℃, 5분 1 cycle
94℃, 30초49℃, 30초72℃, 1분 40 cycle
72℃, 7분 1 cycle
PCR 산물은 EtBr이 함유된 아가로스젤에 전기영동하고 UV transillunimator가 부착된 Image analyzer를 이용하여 확인하였다.
실시예 3: 서열번호 3 내지 51의 프로브 제작
본 실시예에서는 36종 각각의 규조류에 대한 프로브를 합성하였다. 교잡화 반응을 위한 프로브의 서열정보는 상기 표 1에 나타낸 것과 같다. 규조류 각 종의 미토콘드리아 COI 유전자 염기서열의 다중 비교를 통해 가장 상동성이 낮은 염기서열 부위를 바탕으로 종 특이적인 프로브의 염기서열을 결정하였다.
먼저, 알데히드 작용기가 처리되어 있는 글라스 위에, 상기한 서열정보를 가지는 폴리뉴클레오티드의 5'말단에 아미노 링크를 수식하고, 교잡화 반응시 슬라이드 글라스 위에 집적되어 있는 프로브 간의 공간적인 방해를 최소화시키기 위하여, 10-20 개의 올리고(dT)를 부가하여 본 발명에 따른 프로브를 완성하였다. 본 발명에서 사용한 프로브는 독일의 Metabion 사에 의뢰하여 합성하였다.
실시예 4: DNA 칩 제작
실시예 3에서 제조된 아미노 링크가 수식되어 있는 규조류 종 판별용 프로브 50 μM을 동일한 양의 3X SSC와 혼합하여 집적하였고, 이를 16시간 동안 실온에서 반응시켰다. 반응이 완료된 슬라이드는 0.1 % SDS로 5분간 2회 세척한 다음 소디움 보로하이드리드 용액 (1.3g NaBH4, 375ml PBS, 125ml EtOH)에 5분간 반응시키고 증류수로 세척한 후 진공 원심분기기에서 800 rpm 속도로 10분간 회전시켜 건조하고 상온에 보관하였다. 이렇게 제작된 DNA 칩 구조의 모식도는 도 37에 도식화하였다.
도 37은 상기 도 1 내지 36에 나타난 단염기다형성에 근거하여 제작된 올리고뉴클레오티드 프로브를 포함하는, 본 발명의 일 실시예에 따른 규조류 종 판별용 DNA칩의 구조를 도식화한 모식도이고, 여기에 도시된 바와 같이, 본 발명은 DNA 칩을 제작하기 위해 칩의 기판으로 사용된 슬라이드 상의 각 도트에 하나의 프로브만이 함유되도록 집적하고, 왼쪽 위와 오른쪽 아래 도트에는 위치 마커 (position marker)의 프로브를 집적하여 형광스캔 결과와 비교분석하는데 사용할 수 있도록 구성하였다.
실시예 5: 교잡화 반응
상기 실시예 2에서 얻은 PCR 산물 10 ㎕를 99℃에서 3분간 변성시키고 90 ㎕의 혼성화용액과 혼합하여 실시예 4에서 제작된 DNA 칩에 도포하고, 55℃ 습윤 반응기에서 1시간 동안 반응시켰다. 혼성화 반응 후 1X SSC와 0.1 % sarcosyl 혼합용액에 5분, 1X SSC 용액에 5분, 0.1X SSC 용액에서 1분간 교반 세척하고 진공 원심분기기에서 800 rpm 속도로 5분간 회전시켜 건조하였다.
그런다음, GenePix 4000B 스캐너 (Molecular Device, 미국)를 이용하여 혼성화 결과를 분석하여 규조류 종에 따란 칩 상에 나타난 형광의 분포가 다르게 나타나며, 종 사이의 판별력이 있음을 확인하였다. 그 결과는 도 38 내지 도 54에 나타낸 바와 같다.
도 38 내지 도 54는 각각 상기 도 37의 DNA칩을 이용하여 본 발명에 따른 올리고뉴클레오티드 프로브와 Achanathes longipes 를 비롯한 특정 규조류의 PCR 증폭산물을 결합시킨 후의 반응 결과를 나타내는 사진이다.
여기서, 도 38은 Achnanthes longipes, 도 39는 Chaetoceros atlanticus, 도 40은 Chaetoceros septentrionalis, 도 41는 Chaetoceros vistulae, 도 42는 Coscinodiscus rothii, 도 43은 Cylindrotheca fusiformi, 도 44은 Cymatosira lorenziana, 도 45은 Melosira nummuloides, 도 46은 Navicula sp., 도 47은 Nitzschia pungens, 도 48은 Nitzschia subpacifica, 도 49는 Skeletonema costatum, 도 50은 Stephanopyxis turris, 도 51는 Thalassiosira allenii, 도 52는 Thalassiosira baltica, 도 53은 Thalassiosira conferta, 도 54은 Thalassiosira ostupii에 대한 결과이다.
여기에 도시된 것과 같이, 본 발명에 의하는 경우 해당 생물 종에 따라 형광 표지가 다르게 나타나므로, 이에 따라 해당 종을 판별할 수 있음을 확인하였다.
한편, 상기에서는 본 발명을 특정의 바람직한 실시예에 관련하여 도시하고 설명하였지만, 이하의 특허청구범위에 의해 마련되는 본 발명의 기술적 특징이나 분야를 이탈하지 않는 한도 내에서 본 발명이 다양하게 개조 및 변화될 수 있다는 것은 당업계에서 통상의 지식을 가진 자에게 명백한 것이다.
본 발명에 의하는 경우, 하나의 슬라이드 위에서 다수의 해양 생물 종에 대한 유전자형 분석을 간단하고 신속, 정확하게 판별할 수 있는 효과가 있다. 본 발명에 따라 해양 생물 30종의 미토콘드리아 COI지역을 유전자 표지로 사용하면, 종래의 형태학적 구별법으로 해당 종을 판별하는 지금까지의 방법이 가졌던 낮은 분해능의 문제점을 해결 할 수 있다. 종래와 같이, 형태학적인 차이점을 기초로 판별하는 것 보다 본 발명에 따라 단염기다형성을 근거로한 DNA칩 방법을 이용하면, 종래기술보다 한 단계 진보된 형태의 유전자 분석법을 제공하여, 더욱 효과적으로 해양 생물종을 판별할 수 있고, 분해능도 현저히 증가시킬 수 있다.
그리고 본 발명에 따라 상기한 폴리뉴클레오티드 프로브를 사용하여 마이크로어레이 방법을 활용하면, 종 특이적 단염기다형성을 DNA의 혼성화 가부에 따라 판별함으로써, 염기서열을 분석하지 않고도 각 생물종의 유전자형을 신속히 판정할 수 있는 적용성을 갖고 있다. 또한 다수의 생물종을 한 번의 실험으로 정확한 유전자형을 분석할 수 있어, 해당 생물종의 유전자형을 표준화, 자동화할 수 있도록 기술 개발의 적용성을 극대화시켰다. 즉, 본 발명은 종래의 방법에 비해 시료를 분석하는 데 걸리는 시간을 크게 단축시켰으며, 다량의 시료를 짧은 시간 내에 처리할 수 있는 효과가 있다.

Claims (13)

  1. 규조류(diatom)에서 추출한 DNA에 대해 중합효소연쇄반응(PCR)을 수행하여 PCR 산물을 얻는 단계;
    상기 PCR 산물을, 서열번호 3 내지 서열번호 51 중 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 프로브에 결합시키는 단계; 및,
    상기 결합 여부에 따라 상기 규조류의 종(species)을 판별하는 단계;를 포함하는 규조류의 종(species) 판별 방법.
  2. 제1항에 있어서, 상기 규조류는 대한민국 연안에 서식하는 것을 특징으로 하는 규조류의 종 판별 방법.
  3. 제1항에 있어서, 상기 규조류는 Achnanthes longipes, Amphora sp., Asterionella glacialis, Chaetoceros atlanticus, Chaetoceros didymus, Chaetoceros septentrionalis, Chaetoceros vistulae, Chlorella ellipsoidea, C. schroeteri, Chlorella ellipsoidea, C. schroeteri, Chlorophyta UF, Coscinodiscus perforatus, C. rothii, Cylindrotheca closterium, Cylindrotheca fusiformi, Cymatosira lorenziana, Ditylum brightwellii, Gloeocystis gigas, Gyrodimium impudicum, Heterosigma akashiwo, Melosira nummuloides, Navicula sp., Nitzschia pungens, Nitzschia subpacifica, Prorocentrum minimum, Skeletonema costatum, Stephanopyxis turris, Thalassiosira allenii, Thalassiosira baltica. T. decepiens, T. puntigera, Thalassiosira conferta, Thalassiosira nordenskioldi, T. weissflogii, Thalassiosira ostupii 및 Thalassiosira rotula 로 이루어진 군에서 적어도 하나 이상이 선택된 것을 특징으로 하는 규조류의 종 판별 방법.
  4. 제1항에 있어서, 상기 추출한 DNA는 상기 규조류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성(single nucleotide polymorphism, SNPs)을 포함하는 것을 특징으로 하는 규조류의 종 판별 방법.
  5. 제1항에 있어서, 상기 프로브는 상기 규조류의 미토콘드리아 DNA 중 COI 유전자 부위의 단염기다형성 부위와 결합하고, 상기 결합은 상기 규조류의 종에 따라 다르게 이루어지는 것을 특징으로 하는 규조류의 종 판별 방법.
  6. 제5항에 있어서, 상기 결합이 상기 규조류의 종에 따라 다르게 이루어진다는 것은, 서열번호 3의 염기서열을 포함하는 프로브는 Achnanthes longipes 종의 미토콘드리아 DNA 중 COI 유전자 부위의 26-49번째 DNA 서열과 특이적으로 결합하고, 서열번호 4의 프로브는 Amphora sp. 종의 544-567번째 DNA 서열, 서열번호 5의 경우는 Amphora sp.종의 55-78번째 DNA 서열, 서열번호 6의 경우는 Asterionella glacialis 종의 706-729번째 DNA 서열, 서열번호 7의 경우는 Asterionella glacialis 종의 485-508번째 DNA 서열, 서열번호 8의 경우는 Chaetoceros atlanticus 종의 58-81번째 DNA 서열, 서열번호 9의 경우는 Chaetoceros atlanticus 종의 39-62번째 DNA 서열, 서열번호 10의 경우는 Chaetoceros didymus 종의 638-706번째 DNA 서열, 서열번호 11의 경우는 Chaetoceros didymus 종의 625-648번째 DNA 서열, 서열번호 12의 경우는 Chaetoceros septentrionalis 종의 639-662번째 DNA 서열, 서열번호 13의 경우는 Chaetoceros vistulae 종의 585-608번째 DNA 서열, 서열번호 14의 경우는 Chaetoceros vistulae 종의 447-470번째 DNA 서열, 서열번호 15의 경우는 Chlorella ellipsoidea 와 C. schroeteri 종의 706-729번째 DNA 서열, 서열번호 16의 경우는 Chlorella ellipsoidea 와 C. schroeteri 종의 551-574 번째 DNA 서열, 서열번호 17의 경우는 Chlorophyta UF 종의 709-730 번째 DNA 서열, 서열번호 18의 경우는 Chlorophyta UF 종의 654-675 번째 DNA 서열, 서열번호 19의 경우는 Coscinodiscus perforatus 와 C. rothii 종의 635-658 번째 DNA 서열, 서열번호 20의 경우는 Coscinodiscus perforatus 와 C. rothii 종의 482-505 번째 DNA 서열, 서열번호 21의 경우는 Cylindrotheca closterium 종의 547-570 번째 DNA 서열, 서열번호 의 22경우는 Cylindrotheca closterium 종의 534-557 번째 DNA 서열, 서열번호 23의 경우는 Cylindrotheca fusiformi 종의 700-723 번째 DNA 서열, 서열번호 24의 경우는 Cymatosira lorenziana 종의 684-704 번째 DNA 서열, 서열번호 25의 경우는 Cymatosira lorenziana 종의 651-674 번째 DNA 서열, 서열번호 26의 경우는 Ditylum brightwellii 종의 478-501 번째 DNA 서열, 서열번호 27의 경우는 Gloeocystis gigas 종의 540-563 번째 DNA 서열, 서열번호 28의 경우는 Gyrodimium impudicum 종의 677-700 번째 DNA 서열, 서열번호 29의 경우는 Heterosigma akashiwo 종의 580-601 번째 DNA 서열, 서열번호 30의 경우는 Melosira nummuloides 종의 707-729 번째 DNA 서열, 서열번호 31의 경우는 Melosira nummuloides 종의 681-704 번째 DNA 서열, 서열번호 32의 경우는 Melosira nummuloides 종의 626-649 번째 DNA 서열, 서열번호 33의 경우는 Navicula sp. 종의 706-729 번째 DNA 서열, 서열번호 34의 경우는 Navicula sp. 종의 580-603 번째 DNA 서열, 서열번호 35의 경우는 Nitzschia pungens 종의 100-723 번째 DNA 서열, 서열번호 36의 경우는 Nitzschia pungens 종의 634-657 번째 DNA 서열, 서열번호 37의 경우는 Nitzschia subpacifica 종의 710-733 번째 DNA 서열, 서열번호 38의 경우는 Prorocentrum minimum 종의 21-44 번째 DNA 서열, 서열번호 39의 경우는 Skeletonema costatum 종의 712-734 번째 DNA 서열, 서열번호 40의 경우는 Skeletonema costatum 종의 626-649 번째 DNA 서열, 서열번호 41의 경우는 Stephanopyxis turris 종의 571-594 번째 DNA 서열, 서열번호 42의 경우는 Thalassiosira allenii 종의 678-699 번째 DNA 서열, 서열번호 43의 경우는 Thalassiosira allenii 종의 651-674 번째 DNA 서열, 서열번호 44의 경우는 Thalassiosira baltica. T. decepiens 와 T. puntigera 종의 491-514 번째 DNA 서열, 서열번호 45의 경우는 Thalassiosira conferta 종의 637-660 번째 DNA 서열, 서열번호 46의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 491-514 번째 DNA 서열, 서열번호 47의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 464-487 번째 DNA 서열, 서열번호 48의 경우는 Thalassiosira nordenskioldi 와 T. weissflogii 종의 491-514 번째 DNA 서열, 서열번호 49의 경우는 Thalassiosira ostupii 종의 584-607 번째 DNA 서열, 서열번호 50의 경우는 Thalassiosira rotula 종의 242-265 번째 DNA 서열, 서열번호 51의 경우는 Thalassiosira rotula 종의 448-471 번째 DNA 서열과 특이적으로 결합하는 것을 특징으로 하는 규조류의 종 판별 방법.
  7. 제1항에 있어서, 상기 PCR 산물을 프로브에 결합시키는 단계는 적어도 2회 이상 수행되는 것을 특징으로 하는 규조류의 종 판별 방법.
  8. 제1항에 있어서, 상기 중합효소연쇄반응(PCR)을 수행하는 것은, 서열번호 1 또는 서열번호 2의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 폴리뉴클레오티드를 정방향 프라이머 또는 역방향 프라이머로 사용하는 것을 특징으로 하는 규조류의 종 판별 방법.
  9. 서열번호 3 내지 서열번호 51 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 폴리뉴클레오티드로 이루어진 규조류의 종(species) 판별용 프로브.
  10. 서열번호 3 내지 서열번호 51 중에서 선택된 적어도 하나 이상의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 적어도 하나 이상의 프로브를 포함하는 규조류의 종(species) 판별용 DNA 칩.
  11. 제10항에 있어서, 위치 마커(position marker)를 더 포함하는 것을 특징으로 하는 규조류의 종(species) 판별용 DNA 칩.
  12. 규조류의 미토콘드리아 DNA 중 COI 유전자의 단염기다형성(SNP) 부위 DNA 서열과 결합하는 것으로, 서열번호 3 내지 서열번호 51 중 어느 하나의 DNA 서열과 동일하거나 상보적인(complementary) 15-30개의 연속 염기서열로 이루어진 것을 특징으로 하는 폴리뉴클레오티드 프로브와;
    상기 규조류의 미토콘드리아 DNA를 중합효소연쇄반응(PCR)으로 증폭시키기 위한 프라이머를 포함하는 것을 특징으로 하는 규조류의 종(species) 판별용 키트.
  13. 제12항에 있어서, 상기 프라이머는 서열번호 1 또는 서열번호 2의 각 DNA 서열과 동일하거나 그에 상보적인(complementary) 염기서열을 각각 포함하는 정방향 프라이머 또는 역방향 프라이머인 것을 특징으로 하는 규조류의 종(species) 판별용 키트.
PCT/KR2011/000592 2010-03-19 2011-01-28 대한민국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트 WO2011115366A2 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/635,887 US20130123125A1 (en) 2010-03-19 2011-01-28 Identification Method of Species of Diatoms in Coast of Korea, and Polynucleotide Probe, DNA Chip and Kit for Identification of Species of Diatoms According to Same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2010-0024939 2010-03-19
KR1020100024939A KR101403351B1 (ko) 2010-03-19 2010-03-19 대한민국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트

Publications (2)

Publication Number Publication Date
WO2011115366A2 true WO2011115366A2 (ko) 2011-09-22
WO2011115366A3 WO2011115366A3 (ko) 2012-03-29

Family

ID=44649684

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/000592 WO2011115366A2 (ko) 2010-03-19 2011-01-28 대한민국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트

Country Status (3)

Country Link
US (1) US20130123125A1 (ko)
KR (1) KR101403351B1 (ko)
WO (1) WO2011115366A2 (ko)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102433390A (zh) * 2012-01-09 2012-05-02 上海海洋大学 一种检测利玛原甲藻的方法
KR20160000036A (ko) * 2014-06-23 2016-01-04 한국해양과학기술원 대한민국 연안 미세조류인 디틸럼 브라이트웰리의 종 판별 방법과 이에 따른 디틸럼 브라이트웰리의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR20160000035A (ko) * 2014-06-23 2016-01-04 한국해양과학기술원 대한민국 연안 미세조류인 니츠치아 임프로비사의 종 판별 방법과 이에 따른 니츠치아 임프로비사의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR20160000039A (ko) * 2014-06-23 2016-01-04 한국해양과학기술원 대한민국 연안 미세조류인 아카쉬요 산구이니아의 종 판별 방법과 이에 따른아카쉬요 산구이니아의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR101603755B1 (ko) * 2014-06-23 2016-03-18 한국해양과학기술원 대한민국 연안 미세조류인 헤테로시그마 아카쉬요의 종 판별 방법과 이에 따른 헤테로시그마 아카쉬요의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101602346B1 (ko) * 2014-06-23 2016-03-14 한국해양과학기술원 대한민국 연안 미세조류인 프로로센트럼 미니멈의 종 판별 방법과 이에 따른 프로로센트럼 미니멈의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR101706771B1 (ko) 2015-06-12 2017-02-17 한국해양과학기술원 인시츄 혼성화를 사용하는 코클로디니움 폴리클리코이데스 검출방법 및 검출용 키트
CN106701927B (zh) * 2016-12-09 2020-09-29 国投生物科技投资有限公司 一种环介导等温扩增快速检测金藻的方法及试剂盒

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5958689A (en) * 1996-05-22 1999-09-28 Monterey Bay Aquarium Research Institute Detection of toxigenic marine diatoms of the genus Pseudo-nitzschia

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100774367B1 (ko) * 2005-08-31 2007-11-08 인하대학교 산학협력단 섬모충류 특이적 프라이머 및 이를 이용한 섬모충류 검출방법

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5958689A (en) * 1996-05-22 1999-09-28 Monterey Bay Aquarium Research Institute Detection of toxigenic marine diatoms of the genus Pseudo-nitzschia

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
EHARA, M. ET AL.: 'Distribution of cognates of group II introns detected in mitochondria coxl genes of a diatom and a haptophyte' GENE vol. 256, 03 October 2000, pages 157 - 167 *
LIN, S. ET AL.: 'High-level diversity of dinoflagellates in the Natural environment, revealed by assessment of mitochondrial coxl and cob genes for dinoflagellate DNA barcoding' APPLIED AND ENVIRONMENTAL MICROBIOLOGY. vol. 75, no. 5, March 2009, pages 1279 - 1290 *
MONIZ, M. B. J. ET AL.: 'Barcoding diatoms: Is there a good marker?' MOLECULAR ECOLOGY RESOURCES vol. 9, no. SUPPL., 09 May 2009, pages 65 - 74 *
WALKER, C. E. ET AL.: 'A direct immunoassay for detecting diatoms in groundwater as an indicator of the direct influence of surface water' JOURNAL OF APPLIED PHYCOLOGY. vol. 17, January 2005, pages 81 - 90 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102433390A (zh) * 2012-01-09 2012-05-02 上海海洋大学 一种检测利玛原甲藻的方法
CN102433390B (zh) * 2012-01-09 2013-08-07 上海海洋大学 一种检测利玛原甲藻的方法
KR20160000036A (ko) * 2014-06-23 2016-01-04 한국해양과학기술원 대한민국 연안 미세조류인 디틸럼 브라이트웰리의 종 판별 방법과 이에 따른 디틸럼 브라이트웰리의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR20160000035A (ko) * 2014-06-23 2016-01-04 한국해양과학기술원 대한민국 연안 미세조류인 니츠치아 임프로비사의 종 판별 방법과 이에 따른 니츠치아 임프로비사의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR20160000039A (ko) * 2014-06-23 2016-01-04 한국해양과학기술원 대한민국 연안 미세조류인 아카쉬요 산구이니아의 종 판별 방법과 이에 따른아카쉬요 산구이니아의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR101599427B1 (ko) 2014-06-23 2016-03-04 한국해양과학기술원 대한민국 연안 미세조류인 니츠치아 임프로비사의 종 판별 방법과 이에 따른 니츠치아 임프로비사의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR101602349B1 (ko) 2014-06-23 2016-03-14 한국해양과학기술원 대한민국 연안 미세조류인 아카쉬요 산구이니아의 종 판별 방법과 이에 따른아카쉬요 산구이니아의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR101603755B1 (ko) * 2014-06-23 2016-03-18 한국해양과학기술원 대한민국 연안 미세조류인 헤테로시그마 아카쉬요의 종 판별 방법과 이에 따른 헤테로시그마 아카쉬요의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR101687268B1 (ko) * 2014-06-23 2016-12-19 한국해양과학기술원 대한민국 연안 미세조류인 디틸럼 브라이트웰리의 종 판별 방법과 이에 따른 디틸럼 브라이트웰리의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트

Also Published As

Publication number Publication date
KR101403351B1 (ko) 2014-06-09
US20130123125A1 (en) 2013-05-16
KR20110105669A (ko) 2011-09-27
WO2011115366A3 (ko) 2012-03-29

Similar Documents

Publication Publication Date Title
WO2011115366A2 (ko) 대한민국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
AU783278C (en) Genomic profiling: a rapid method for testing a complex biological sample for the presence of many types of organisms
Bonin et al. Use of amplified fragment length polymorphism (AFLP) markers in surveys of vertebrate diversity
CN110438242B (zh) 一种三疣梭子蟹微卫星标记的引物及其应用
CN107746896B (zh) 与桃果皮绒毛性状相关的snp标记及其应用
KR20090035303A (ko) 벼 품종을 식별하기 위한 다중 실시간 ｐｃｒ 방법
KR101248425B1 (ko) 고래목에 속하는 동물의 분류체계 결정을 위한 프로브 조성물, 이를 포함하는 ｄｎａ 칩 및 키트 그리고 이를 이용한 고래목에 속하는 동물의 분류체계 결정방법
KR20110092892A (ko) 담수어류 종 판별용 프로브 및 디엔에이 칩
Tang et al. Molecular identification and genetic-polymorphism analysis of Fasciola flukes in Dali Prefecture, Yunnan Province, China
CN110373479B (zh) 柳莺属鸟类通用微卫星分子标记、引物及应用
KR20110105670A (ko) 대한한국 연안 해파리류의 종 판별 방법과 이에 따른 해파리류의 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
KR101196640B1 (ko) 오징어류의 종 판별 방법과 이를 위한 오징어 종 판별용 폴리뉴클레오티드 프로브, ｄｎａ 칩 및 키트
WO2013065957A1 (ko) 가루이류 분류를 위한 프로브 조성물, ｄｎａ 칩 및 키트 그리고 이를 이용한 가루이류 분류방법
Techaprasan et al. Genetic relationships and species authentication of Boesenbergia (Zingiberaceae) in Thailand based on AFLP and SSCP analyses
WO2022215976A1 (ko) 벚나무 품종 판별용 프라이머 세트 및 이의 용도
KR101403359B1 (ko) 대한한국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, dna 칩 및 키트
CN111269994A (zh) 一种利用普通牛y染色体单核苷酸遗传标记鉴定公牛品种的方法
CN113151503A (zh) 凡纳滨对虾微卫星标记的引物组合及应用
KR101403352B1 (ko) 대한한국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, dna 칩 및 키트
KR101403362B1 (ko) 대한한국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, dna 칩 및 키트
KR101403353B1 (ko) 대한한국 연안 규조류의 종 판별 방법과 이에 따른 규조류의 종 판별용 폴리뉴클레오티드 프로브, dna 칩 및 키트
Martin Molecular identification of Phytophthora
Divis et al. Molecular epidemiology and population genomics of Plasmodium knowlesi
CN114836549B (zh) 一种蒙古野驴微卫星分子标记组合及其引物和应用
KR102284051B1 (ko) 백미꽃 속 식물의 종 구별용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11756497

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 13635887

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11756497

Country of ref document: EP

Kind code of ref document: A2