WO2011104023A1 - Genetic marker for the diagnosis of dementia with lewy bodies - Google Patents

Genetic marker for the diagnosis of dementia with lewy bodies Download PDF

Info

Publication number
WO2011104023A1
WO2011104023A1 PCT/EP2011/000903 EP2011000903W WO2011104023A1 WO 2011104023 A1 WO2011104023 A1 WO 2011104023A1 EP 2011000903 W EP2011000903 W EP 2011000903W WO 2011104023 A1 WO2011104023 A1 WO 2011104023A1
Authority
WO
WIPO (PCT)
Prior art keywords
genotype
positions
bche
dlb
allele
Prior art date
Application number
PCT/EP2011/000903
Other languages
English (en)
French (fr)
Inventor
Katrin Beyer
Montserrat DOMINGO SÀBAT
Aurelio Ariza Fernández
Original Assignee
Universitat Autònoma De Barcelona
Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US13/578,987 priority Critical patent/US20130101997A1/en
Priority to BR112012021260A priority patent/BR112012021260A2/pt
Application filed by Universitat Autònoma De Barcelona, Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol filed Critical Universitat Autònoma De Barcelona
Priority to SG2012062063A priority patent/SG183437A1/en
Priority to CN201180011143.7A priority patent/CN102869786B/zh
Priority to NZ602551A priority patent/NZ602551A/en
Priority to KR1020127024833A priority patent/KR20130049771A/ko
Priority to MX2012009506A priority patent/MX2012009506A/es
Priority to EP11708400.4A priority patent/EP2539461B1/en
Priority to CA2789054A priority patent/CA2789054A1/en
Priority to KR1020127029377A priority patent/KR20130043107A/ko
Priority to RU2012140458/10A priority patent/RU2012140458A/ru
Priority to AU2011220065A priority patent/AU2011220065A1/en
Priority to JP2012554248A priority patent/JP2013520185A/ja
Publication of WO2011104023A1 publication Critical patent/WO2011104023A1/en
Priority to IL221313A priority patent/IL221313A0/en
Priority to ZA2012/06975A priority patent/ZA201206975B/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • the present invention relates to the field of medicine, and particularly to neurodegenerative disorders. It specifically relates to markers for the diagnosis of dementia with Lewy bodies.
  • Lewy body diseases comprise a group of disorders characterized by the presence of proteinaceous neuronal inclusions called Lewy bodies (LB).
  • LB Lewy bodies
  • Parkinson disease PD
  • dementia with Lewy bodies DLB
  • AD Alzheimer disease
  • DLB dementia with Lewy bodies
  • AD and DLB patients may differ in terms of response to medication and prognosis, it is important to improve accuracy in diagnosing DLB.
  • the main cause of low diagnostic sensitivity for DLB comes from the elevated percentage of cases that show in addition to LB related pathology AD characteristic changes.
  • the third DLB consortium proposed a model to place AD-related pathology into the context of LB pathology.
  • a recent report confirmed that the misdiagnosis of DLB increases with increasing AD associated pathology, but even so, only around 52% of patients had received the correct diagnosis of DLB at low AD-pathology stages.
  • DLB cholinesterase inhibitors
  • neuroleptic drugs are used to diminish psychotic symptoms normally present during the disease course.
  • the use of neuroleptics may cause adverse reaction in about 50% of DLB patients and may cause death.
  • AD and DLB the ability to differentially diagnose between AD and DLB will be a major advantage not only for the individual patient being treated, but also with respect to the economic strains of public health systems.
  • precise differentiation of AD and DLB is only possible by post-mortem analysis of brain tissue.
  • Butyrylcholinesterase (BChE) is a glycoprotein enzyme synthesized in the liver. In the human brain it is found principally in glia, particularly in cortical and subcortical structures, but it is also found in neurons above all, those implicated in cognitive functions. In AD patients BChE is found in amyloid plaques, as well as, in neurofibrillary tangles. This enzyme acts as a detoxification enzyme of organophosphorus and carbamate compounds and hydrolyzes succinylcholine, aspirin and cocaine. BChE function in the human brain is not well known, but it is known that hydrolyzes acetylcholine (ACh) when acetylcholinesterase (AChE) is reduced or absent.
  • ACh acetylcholine
  • K variant in honor of Werner Kalow.
  • the K-variant is associated with a DNA transition from guanine to adenine at nucleotide 1615 in the mRNA corresponding to position 68974 in the DNA sequence (NCBI Accession Number NG_009031), which causes an amino acid change from alanine 539 to threonine.
  • the K-variant is situated at the C-terminal of the protein, responsible for its tetramerization on one hand, and for the attenuation of beta-amyloid fibril formation, on the other.
  • the BChE K variant is responsible for a one third reduction of serum BChE activity levels.
  • main BChE functions in brain remain unknown, the K-variant seems to diminish the rate of attenuation of beta-amyloid fibril formation, accelerating AD progression.
  • tau protein is less phosphorylated in AD patients that carry at least one K-allele, representing a protective mechanism for AD.
  • the inventors have found specific alterations in BChE gene which allow determining whether a patient suffers from dementia with Lewy bodies, and distinguishing it from Alzheimer disease.
  • a combination of genotypes gives rise to identify a group of patients suffering from DLB, and distinguishing from AD.
  • This combination is formed by the genotypes of the polymorphic sites at positions 3687, 4206, and 4443, the polythymine region at positions 4780 to 4786 in NCBI Accession Number NG_009031 (i.e. positions 3687, 4206, 4443 and 4780-4786 respectively in SEQ ID NO: 1 ), and the polymorphic site at position 68974 in NCBI Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 28).
  • Positions of the alterations in BChE nucleotide sequence are given from the nucleotide sequence of NCBI Accession Number NG_009031 which corresponds to the promoter and the gene. This sequence was published on 31 January 2010. The polymorphic sites 3687, 4206, 4443 and the polythymine region at positions 4780 to 4786 are in the promoter region. For these sites, reference is made also to the SEQ ID NO: 1 , which corresponds to the sequence from nucleotide 1 to nucleotide 5040 of the complete sequence of BChE at NCBI. A possible numbering of the nucleotides sometimes used takes the transcription start as position 1 and consequently, the nucleotides upstream this position as negative positions. Transcription start position 1 corresponds to position 5001 in NGJD090031. The correspondence between the numbering used in this description and the "negative" one, is given herein:
  • A3687G corresponds to A-1314G
  • A4206G corresponds to A-795G
  • polythymine from 4780 to 4786 corresponds to -215 to -221
  • the polymorphic site at position 68974 is in the codifying region of
  • NG_009031 The region from position 68041 to 7020 of NG_009031 is included as SEQ ID NO: 28. Taking this region alone, the nucleotides are renumbered, so consequently, the position 68974 in the complete gene sequence becomes the position 934 in SEQ ID NO: 28.
  • This polymorphism is associated to the change of amino acid in exon 4 of BChE resulting in the K variant.
  • the position also used in the literature for this polymorphism is 1615 due to a different sequence numbering (with reference to the mRNA sequence which codifies for the mature BChE protein, without the signal peptide).
  • an aspect of the invention provides an in vitro method for the diagnosis of DLB comprising determining in a biological sample from a subject, the genotype of the following alterations in butyrylcholinesterase (BChE) gene, or of polymorphisms in linkage disequilibrium thereof: the polymorphic site at position 68974 and the poly-thymine region at positions 4780 to 4786.
  • the method further comprises determining the genotype of the following alterations in BChE gene, or of polymorphisms in linkage disequilibrium thereof: the polymorphic sites at position 3687, 4206, and 4443.
  • Another embodiment of the invention relates to a second genetic marker which is a genotype combination, AAAGCC8+K+. It is constituted by the specific genotypes of the polymorphic sites at positions 3687 (both alleles contain an adenine at this position), 4206 (one allele contains an adenine and the other a guanine), 4443 (both alleles contain a cytosine), 4780 to 4786 (at least one of the two alleles is constituted by 8 thymines) and 68974 (at least one of the two alleles contains an adenine).
  • the determination of this genotype combination in demented patients serves as differential diagnostic marker providing the clinical diagnosis of DLB, but it may also serve as early diagnostic marker for DLB in asymptomatic individuals.
  • Another embodiment of the invention relates to a third genetic marker which is a genotype combination, AAAAC+77KW. It is constituted by the specific genotypes of the polymorphic sites at position 3687 (both alleles contain adenine at this position), 4206 (both alleles contain adenine at this position), 4443 (at least one of the two alleles contains a cytosine at this position), 4780 to 4786 (both alleles are constituted by 7 thymines) and 68974 (one allele contains an adenine and the other guanine).
  • the determination of this genotype combination in demented patients serves as differential diagnostic marker providing the clinical diagnosis of DLB, but it may also serve as early diagnostic marker for DLB in asymptomatic individuals.
  • the method of the invention allows to differentially detect the 45- 60% of DLB cases, which otherwise would be diagnosed as AD. This percentage of patients, difficult to diagnose in the clinical practice, will receive the correct diagnostic from the beginning of the disease. The specificity for the disease is of 99%. This represents the first specific marker for DLB.
  • diagnosis in medicine it is meant the act or process of recognition of a disease or condition by its outward signs, symptoms, and underlying physiological/biochemical cause(s).
  • alteration in the BChE gene means any structural change in the nucleotide sequence considered as wild-type.
  • alterations can include a single nucleotide polymorphism, a deletion, an insertion, a substitution or a duplication of one or more
  • nucleotides and a chemical modification on a nucleotide (e.g. methylation).
  • determining the genotype in this description it is meant identifying the nucleotide in a given position.
  • a given nucleotide in one allele means that the subject is heterozygote for that nucleotide in that gene, and “in both alleles", which is homozygote for that nucleotide.
  • the method includes determining the alterations indicated on BChE gene, but also determining polymorphisms in linkage disequilibrium with said alterations which would give the same information. In population genetics, linkage disequilibrium is the non-random association of alleles at two or more loci, not necessarily on the same chromosome.
  • the analysis of DLB would be as follows: a patient with suspected onset of dementia and/or with a non-definitive clinical-familial evaluation would be diagnosed by a genetic test determining the alterations of the BChE gene described above. In the case of detecting the DLB specific genotypes, no additional tests or trial will be needed to diagnose correctly DLB. The direct application of genotyping represents an important save of money in the daily clinical practice.
  • the method of the invention is useful in the following suspected diagnosis: probable AD vs possible DLB; possible AD vs probable DLB; possible AD vs possible DLB; probable AD vs probable DLB; probable AD vs possible AD; possible DLB; and probable DLB.
  • AD Alzheimer's a next step beyond possible Alzheimer's and means that a doctor is "relatively certain" that a patient has the disease.
  • the method of the invention allows a diagnosis of DLB without the need of obtaining samples by aggressive methods like a biopsy; and in this case a brain tissue microbiopsy.
  • the method of the invention being a genetic test, is performed on any biological sample removed from the subject, as blood, since it is applicable to any cell type of the body.
  • the determination of the genotype is carried out by one of the techniques selected from the group consisting of primer-specific PCR multiplex followed by detection, multiplex allele specific primer extension, a microarray-based method, and dynamic allele-specific hybridization. In a particular embodiment, it is carried out by primer-specific PCR multiplex followed by detection.
  • the polymerase chain reaction is the most widely used method for the in vitro amplification of nucleic acids.
  • the PCR can be a real-time PCR, wherein the detection by labeled probes of the presence of the target genotypes is almost instantaneous to the amplification.
  • the amplification of the target polymorphisms can be performed by primer- specific PCR multiplex with following detection by polyacrylamide
  • ASPE Allele Specific Primer Extension
  • detection may be carried out by DNA biochips/microarrays made with oligonucleotides deposited by any mechanism, by DNA biochips made, with oligonucleotides synthesized in situ by photolithography or any other mechanism.
  • a microarray-based method that allow multiplex SNP genotyping in total human genomic DNA without the need for target amplification or complexity reduction can also be used for the genotyping of the BChE alterations. This direct SNP genotyping methodology requires no enzymes and relies on the high sensitivity of the gold nanoparticle probes.
  • Specificity is derived from two sequential oligonucleotide hybridizations to the target by allele-specific surface-immobilized capture probes and gene-specific oligonucleotide-functionalized gold nanoparticle probes.
  • the assay format is simple, rapid and robust pointing to its suitability for multiplex SNP profiling at the 'point of care'.
  • determination of the genotype can be performed by dynamic allele-specific hybridization (DASH), which represents the basis for throughput SNP genotyping in some laboratories.
  • DASH dynamic allele-specific hybridization
  • the core reaction principal of DASH is real-time (dynamic) tracking of allele-specific differences in the process of DNA denaturation.
  • an oligonucleotide probe is first hybridized to the target DNA, a necessary component of essentially all genotyping methods.
  • the target DNA comprises one strand of a PCR product immobilized onto a solid surface, and a single probe is used that is complementary to one of the target alleles. This assay concept was shown to
  • the present invention provides a kit for carrying out the method as defined above, which comprises adequate means for determining the genotype of the alterations in BChE gene.
  • the kit comprises adequate means for carrying out amplification by primer-specific PCR multiplex.
  • the kit provided by the present invention can be used in a routine clinical practice to identify patients that suffer from DLB, thus differentiating said patients from other patients that suffer from AD.
  • the clinicians will be able to apply more individualized and risk-adapted treatment strategies to patients suffering from DLB.
  • the invention relates to the use of a kit as defined above, for the diagnosis of DLB.
  • the present invention also refers to the use of the polymorphic site at position 68974, in combination with one or more alterations in BChE gene selected from the group consisting of the poly-thymine region at positions 4780 to 4786, the polymorphic site at position 3687; the polymorphic site at position 4206; and the polymorphic site at position 4443, as marker for the diagnosis of dementia with Lewy bodies.
  • the polymorphic site at position 68974 is used in combination with the poly-thymine region at positions 4780 to 4786.
  • the polymorphic site at position 68974 is used in combination with the poly-thymine region at positions 4780 to 4786, and with the polymorphic sites at positions 3687, 4206, and 4443.
  • the invention also refers to a method of determining whether a subject will respond to treatment with neuroleptics, by analyzing the genotype of the above mentioned alterations in BChE gene. As the method allows determining whether a patient suffers from DLB or AD, is it possible to give the adequate treatment.
  • FIG. 1 shows the correspondence obtained for the four groups. Circles indicate the position of the different genotype combinations within the four- dimension-graph. Stars show the correspondent, genotype-combination- dependent localization of the disease and control groups. Their position clearly revealed significant differences between cDLB and controls, AD and controls, but also AD and cDLB. Whereas the control group was situated within the both dimension's negative quadrants, cLBD was situated within the first dimensions positive and second dimension negative quadrants and AD within the positive quadrant of the first and second dimensions. These results strongly indicate that the three groups presented significant differences respective to BChE genetics. That means that the disease-specific genotype combination may represent useful disease markers.
  • the results are represented as relative expression changes obtained by the deltadeltaCt method in comparison with the rest of DLB patients, where BChE expression was assumed as 1. Error bars represent the variance estimates. * Significant expression change between 1.5 and 2 times lower than the reference group, ** more than 2 times lower than the reference group.
  • AD Lewy body disease
  • pDLB Alzheimer's disease with Lewy bodies
  • AD brains AD Braak and Braak stage VI.
  • Braak and Braak is a staging to evaluate/quantify AD in brain. It is used by neuropathologists to evaluate density of amyloid plaques and neurofibrillary tangles.
  • RNA from frozen brain samples was extracted by the use of the TRI Reagent following manufacturer's instructions.
  • TRI Reagent solution combines phenol and guanidine thiocyanate in a monophasic solution and it is used for the consecutive extraction of RNA, DNA and proteins from the same sample. After spectrophotometric determination of purity and concentration, DNA samples were stored at 4 °C until use. DNA extraction from blood was carried out by standard procedures based on DNA-binding on glass-filter membranes.
  • PCR1 primers BChEproml UA and BChEpromI L; Table 1
  • PCR2 primers BChEprom2UA and BChEpromS6; Table 1
  • PCR3 primers BChEprom2UB and
  • primer name primer sequence (5'-» 3') SEQ ID NO
  • PCR products were purifed by the use of the ExoSap-IT kit (GE Healthcare). Sequencing reactions were carried out with BigDye (BigDyeTM Terminator vs 1.1 Cycle Sequencing Kit, Perkin Elmer), 10 pmol/ ⁇ of the respective primer and 3.5 ⁇ of the purified PCR product. After cycle sequencing and DNA precipitation, the sequences were obtained on the ABI PRISMTM3100 (Perkin Elmer).
  • the obtained PCR fragments were separated on high resolution agarose gels.
  • the A-allele of the BChE A3687G polymorphism was represented by a 153 bp and the G-allele by a 133 bp fragment.
  • the K-allele was represented by a 149 bp fragment and the wild- type corresponding allele from the K-variant polymorphism, by a 169 bp band.
  • A-allele of the BChE A4206G polymorphism was of 124 bp of length and the G-allele of 104 bp.
  • the T- allele corresponded to a 145 bp fragment and the C-allele to a 125 bp
  • the polyT polymorphism was constituted on different fragment sizes differing by only one nucleotide. Its genotyping was achieved by capillary
  • Polymorp 1 polymorphism name ; 2 [FAM] : 5'primer modification with the fluorochrome Fam.
  • AD patients coincided in their clinical and neuropathological diagnoses and 42% of pDLB patients received the diagnosis of DLB, only 17% of cLBD patients received the clinical diagnosis of DLB. Instead, 62% of them had been diagnosed as AD and 21% corresponded to other dementia related disorders. This observation fully correlates with the lack of diagnostic criteria for cLBD.
  • the BChE K-variant consist of a single nucleotide substitution from g to a at position 68974, where the g-allele is named W (wild type) and the a-allele K (mutated).
  • W wild type
  • a-allele K mutant
  • BChE promoter sequencing revealed the presence of four polymorphisms previously not described. Three of them were single nucleotide changes: at position 3687, A was changed by G; A was substituted by G at position 4206 and C to T at position 4443.
  • the fourth polymorphism corresponded to a polyT sequence of variable length and was located between positions 4780 and 4786. Of the two identified alleles, one was constituted by 7 Ts and the other by 8 Ts. Interestingly, the 8T-allele segregated with the K-allele of the common exon 4 polymorphism.
  • allelic and genotypic frequencies for all four promoter polymorphisms were determined in neuropathologically diagnosed brain samples including cLBD, pDLB, AD and controls.
  • the polymorphisms were analyzed independently and then, the existence of genotype combination was also tested.
  • G-allele carrying genotypes were determined in neuropathologically diagnosed brain samples including cLBD, pDLB, AD and controls.
  • GenComb constituted by the four promoter and the K-variant polymorphisms were studied.
  • the correspondence analysis of these GenComb revealed BChE-based genetic differences between cLBD, AD and controls as well as between cLBD and AD. These differences could be clearly represented in a four-quadrant diagram (FIG. 1 ). Whereas the control group was situated within the first and second dimension's negative quadrant, cLBD was situated within the first dimension negative and the second dimensions positive quadrant and AD within the positive quadrant of both dimensions.
  • GenComb (N° 20), constituted by the homozygous wild-type genotypes of all polymorphisms, represented 17.6% of the whole sample and was present at similar frequencies in all groups. The other two most frequent GenComb (N°18 and 20) were also unspecific because of their presence in all four groups.
  • both types of LB dementia were the most heterogeneous diseases respective to BChE genetics (Table 5).
  • AD was characterized by more disease-specific GenComb than both DLBs and controls (Table 5).
  • Table 5 Correspondence table obtained for the neuropathological sample
  • GenComb AAAATT77WW was only present in AD samples and at the relative high frequency of 0.29.
  • GenComb AAAATT77KK was also found in an AD sample, underlining disease- specificity (Table 6).
  • This GenComb was the most frequent (16.7%) disease-specific GenComb found in cLBD (Table 6).
  • the three unrelated pDLB specific GenComb (N° 3, 5 and 30) had the low frequency of 0.08 (present each of them in one patient only).
  • Four GenComb were found specifically in controls. Although two of them (N° 14 and 15) were related, their frequency did not overcome 0.1.
  • AD and DLB genetically distinguish AD and DLB.
  • the disease-specific frequency of KW/77 genotypes would increase up to more than 50%.
  • the five most frequent genotype combinations were: combination 25 with a frequency of 0.34 (0.34 in AD and 0.35 in controls), combination 19 with a frequency of 0.16 (0.14 in AD and 0.22 in controls), 15 with a frequency of 0.10 (0.1 1 in AD and 0.08 in controls), combination 16 with a frequency of 0.10 (0.1 1 in AD and 0.07 in controls) and, finally, combination 21 with a frequency of 0.08 (0.08 in AD and 0.07 in controls; Table 8).
  • the most frequent genotype combination was the same in both: the neuropathological and the clinical samples. Moreover, other two genotype combinations coincided as most frequent in both samples (Tables 5 and 8).
  • GenComb AAAATT77WW was only present in 2% of AD samples but, on the other hand it was also detected in 3.3% of the control group.
  • GenComb AAAATT77KK was only found in one AD sample (0.4%) (Table 9).
  • GenComb 9-1 1 coincided with GenComb of the neuropathological sample and were also defined as the common GenComb AAAGCC8+K+. This GenComb was present with a frequency of 0.06 (6%) only in the AD group (Table 9).
  • Table 9 Disease dependent distribution and frequencies of BChE-K variant and polyT genotype combinations in clinically diagnosed patients
  • AAAGCC8+K+ increases and would range between 15-28%.
  • Table 10 Correspondence table obtained for the clinical sample (160 control individuals)
  • genotype combinations of Table 10 The five most frequent genotype combinations were: combination 29 with a frequency of 0.33 (0.34 in AD and 0.31 in controls), combination 22 with a frequency of 0.15 (0.14 in AD and 0.16 in controls), 18 with a frequency of 0.12 (0.11 in AD and 0.14 in controls), combination 19 with a frequency of 0.11 (0.11 in AD and 0.12 in controls) and, finally, combination 25 with a frequency of 0.07 (0.08 in AD and 0.05 in controls; Table 10).
  • the most frequent genotype combination was the same in both: the neuropathological and the clinical samples. Moreover, other two genotype combinations coincided as most frequent in all samples (Tables 5, 8 and 10). Disease-specific genotype combinations
  • GenComb AAAATT77KK was only found in one AD sample (0.4%) (Table 11).
  • GenComb 9-12 coincided with GenComb of the neuropathological sample and were also defined as the common GenComb AAAGCC8+K+. This GenComb was present with a frequency of 0.06 (6%) in the AD group and of 0.01 in controls (Table 1 1 ).
  • Tablel 1 Disease dependent distribution and frequencies of BChE-K variant and polyT genotype combinations in clinically diagnosed patients
  • AAAGCC8+K+ increases and would range between 15-28%.
  • TRI -Reagent (MRC, Cincinnati, USA) was used for RNA isolation according to the manufacturer's protocol. Briefly, 100 mg tissue samples were
  • RNA integrity was ascertained by the use of the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, USA). Only samples with RIN values higher than 6 were stored at -80 °C until use.
  • First-strand cDNA synthesis was carried out using Ready-to-goTM You-Prime First-Strand Beads (Amersham Pharmacia Biotech, Uppsala, Sweden). Two mg of RNA were incubated with random hexamers and the First-Strand Beads at 37 °C during 1 hour. The resulting cDNA was either immediately used for PCR or stored at -20 °C until use. Real time PCR
  • BChE mRNA The relative expression of BChE mRNA was determined using a Rotor-Gene 6000 (Corbett Life Science, Sydney, Australia). A QuantiTect SYBR Green PCR Kit (QiaGen, Hilden, Germany) was used to minimize the primer-dimer content. Fifteen ml reactions further contained 16 pmol of each primer (BChE 2U GAGTAGATCCATAGTGAAACGG, SEQ ID NO: 22, and BChE 6LRNA CAGCGATGGAATCCTGCTTT, SEQ ID NO: 23) and 1 ml of cDNA.
  • beta- actin primary genes: beta-actin U2 TCTACAATGAGCTGCGTGTG, SEQ ID NO: 24, and beta-actin L3 TAGATGGGCACAGTGTGGGT, SEQ ID NO: 25
  • beta- glucuronidase GUS; primers: GUS-U1 ATGTGGTTGGAGAGCTCATT, SEQ ID NO: 26 and GUS-L2 TGTCTCTGCCGAGTGAAGAT, SEQ ID NO: 27
  • GUS beta- glucuronidase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/EP2011/000903 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies WO2011104023A1 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
CA2789054A CA2789054A1 (en) 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies
EP11708400.4A EP2539461B1 (en) 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies
SG2012062063A SG183437A1 (en) 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies
BR112012021260A BR112012021260A2 (pt) 2010-02-24 2011-02-24 marcador genético para o diagnóstico de demência com corpos de lewy.
NZ602551A NZ602551A (en) 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies
KR1020127024833A KR20130049771A (ko) 2010-02-24 2011-02-24 루이 소체 치매 진단용 유전자 마커
KR1020127029377A KR20130043107A (ko) 2010-02-24 2011-02-24 루이 소체 치매 진단용 유전자 마커
US13/578,987 US20130101997A1 (en) 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies
CN201180011143.7A CN102869786B (zh) 2010-02-24 2011-02-24 用于诊断路易体痴呆的遗传标记
MX2012009506A MX2012009506A (es) 2010-02-24 2011-02-24 Marcador genetico para el diagnostico de demencia con cuerpos del lewy.
RU2012140458/10A RU2012140458A (ru) 2010-02-24 2011-02-24 Генетический маркер для диагностики деменции с тельцами леви
AU2011220065A AU2011220065A1 (en) 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies
JP2012554248A JP2013520185A (ja) 2010-02-24 2011-02-24 レビー小体認知症診断の遺伝子マーカー
IL221313A IL221313A0 (en) 2010-02-24 2012-08-05 Genetic marker for the diagnosis of dementia with lewy bodies
ZA2012/06975A ZA201206975B (en) 2010-02-24 2012-09-17 Genetic marker for the diagnosis of dementia with lewy bodies

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP10382042A EP2360280A1 (en) 2010-02-24 2010-02-24 Genetic marker for the diagnosis of dementia with Lewy bodies
EP10382042.9 2010-02-24

Publications (1)

Publication Number Publication Date
WO2011104023A1 true WO2011104023A1 (en) 2011-09-01

Family

ID=42077915

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/000903 WO2011104023A1 (en) 2010-02-24 2011-02-24 Genetic marker for the diagnosis of dementia with lewy bodies

Country Status (16)

Country Link
US (1) US20130101997A1 (zh)
EP (2) EP2360280A1 (zh)
JP (1) JP2013520185A (zh)
KR (2) KR20130049771A (zh)
CN (1) CN102869786B (zh)
AU (1) AU2011220065A1 (zh)
BR (1) BR112012021260A2 (zh)
CA (1) CA2789054A1 (zh)
CL (1) CL2012002347A1 (zh)
IL (1) IL221313A0 (zh)
MX (1) MX2012009506A (zh)
NZ (1) NZ602551A (zh)
RU (1) RU2012140458A (zh)
SG (1) SG183437A1 (zh)
WO (1) WO2011104023A1 (zh)
ZA (1) ZA201206975B (zh)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013017561A1 (en) * 2011-07-29 2013-02-07 Universitat Autònoma De Barcelona Genetic marker for the diagnosis of dementia with lewy bodies
WO2016164474A1 (en) * 2015-04-06 2016-10-13 The Trustees Of Columbia University In The City Of New York Predictive value of combined genetic enzymatic and lipidomic data in disease risk for lewy body disease
WO2020016437A1 (en) 2018-07-19 2020-01-23 Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol In vitro method for the diagnosis of synucleinopathies

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2360280A1 (en) * 2010-02-24 2011-08-24 Fundació Institut d'Investigació en Ciències de la Salut Germans Trias i Pujol Genetic marker for the diagnosis of dementia with Lewy bodies
EP2990800A1 (en) * 2014-08-29 2016-03-02 Fundació Institut d'Investigació en Ciències de la Salut Germans Trias i Pujol Neprilysin as heartfailure (HF) prognostic marker
WO2016180725A1 (en) 2015-05-08 2016-11-17 Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol Diagnosis of dementia with lewy bodies
EP3091087A1 (en) 2015-05-08 2016-11-09 Fundació Institut d'Investigació en Ciències de la Salut Germans Trias i Pujol Method for in vitro diagnosis of synucleinopathies using alpha-synuclein gene transcripts
EP3385393A1 (de) * 2017-04-05 2018-10-10 Eckart Schnakenberg In-vitro-verfahren zur diagnose des risikos einer person zur ausbildung eines aerotoxischen syndroms und kit zur durchführung des verfahrens

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998027226A2 (en) * 1996-12-16 1998-06-25 Nova Molecular, Inc. Method for determining the prognosis of a patient with a neurological disease

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0323703D0 (en) * 2003-10-09 2003-11-12 Medical Res Council Method
PT2650379E (pt) * 2007-07-31 2016-01-13 Accera Inc Utilização de testagem genómica e compostos cetogénicos para o tratamento de função cognitiva reduzida
EP2360280A1 (en) * 2010-02-24 2011-08-24 Fundació Institut d'Investigació en Ciències de la Salut Germans Trias i Pujol Genetic marker for the diagnosis of dementia with Lewy bodies

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998027226A2 (en) * 1996-12-16 1998-06-25 Nova Molecular, Inc. Method for determining the prognosis of a patient with a neurological disease

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
A.B. SINGLETON ET AL.: "Butyrylcholinesterase K: an association with dementia with Lewy bodies", LANCET, vol. 351, 1998, pages 1818, XP004834745, DOI: doi:10.1016/S0140-6736(05)78788-2
F. PARMO-FOLLONI ET AL.: "Two new mutations of the human BCHE gene (IVS3-14T>C and L574fsX576)", CHEMICO-BIOLOGICAL INTERACTIONS, vol. 175, 2008, pages 135 - 7, XP024530519, DOI: doi:10.1016/j.cbi.2008.04.038
I.G. MCKEITH: "Consensus guidelines for the clinical and pathologic diagnosis of dementia with Lewy bodies (DLB): report of the Consortium on DLB International Workshop", J. ALZHEIMER'S DIS., vol. 9, 2006, pages 417 - 23
LANE ROGER ET AL: "BuChE-K and APOE epsilon4 allele frequencies in Lewy body dementias, and influence of genotype and hyperhomocysteinemia on cognitive decline.", MOVEMENT DISORDERS : OFFICIAL JOURNAL OF THE MOVEMENT DISORDER SOCIETY 15 FEB 2009 LNKD- PUBMED:19006190, vol. 24, no. 3, 15 February 2009 (2009-02-15), pages 392 - 400, XP002577525, ISSN: 1531-8257 *
M. BARRACHINA ET AL.: "TaqMan PCR assay in the control of RNA normalization in human post-mortem brain tissue", NEUROCHEM INT, vol. 49, 2006, pages 276 - 84, XP025067966, DOI: doi:10.1016/j.neuint.2006.01.018
MAETZLER W ET AL: "No differences of butyrylcholinesterase protein activity and allele frequency in Lewy body diseases", NEUROBIOLOGY OF DISEASE, BLACKWELL SCIENTIFIC PUBLICATIONS, OXFORD, GB LNKD- DOI:10.1016/J.NBD.2009.05.014, vol. 35, no. 2, 1 August 2009 (2009-08-01), pages 296 - 301, XP026265790, ISSN: 0969-9961, [retrieved on 20090527] *
PRIMO-PARMO S L ET AL: "Characterization of 12 silent alleles of the human butyrylcholinesterase (BCHE) gene", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 58, no. 1, 1996, pages 52 - 64, XP002577524, ISSN: 0002-9297 *
R. LANE ET AL.: "BuChE-K and APOE epsilon4 allele frequencies in Lewy body dementias, and influence of genotype and hyperhomocysteinemia on cognitive decline", MOV. DISORD., vol. 24, 2009, pages 392 - 400, XP002577525, DOI: doi:10.1002/MDS.22357
SINGLETON A ET AL: "Butyrylcholinesterase K: an association with dementia with Lewy bodies", LANCET THE, LANCET LIMITED. LONDON, GB LNKD- DOI:10.1016/S0140-6736(05)78788-2, vol. 351, no. 9118, 13 June 1998 (1998-06-13), pages 1818, XP004834745, ISSN: 0140-6736 *
T.D. SCHMITTGEN ET AL.: "Analyzing real-time PCR data by the comparative C(T) method", NAT PROTOC, vol. 3, 2008, pages 1101 - 8, XP055137608, DOI: doi:10.1038/nprot.2008.73
W. MAETZLER ET AL.: "No differences of butyrylcholinesterase protein activity and allele frequency in Lewy body diseases", NEUROBIOL. DIS., vol. 35, 2009, pages 296 - 301, XP026932774, DOI: doi:10.1016/j.nbd.2009.05.014

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013017561A1 (en) * 2011-07-29 2013-02-07 Universitat Autònoma De Barcelona Genetic marker for the diagnosis of dementia with lewy bodies
WO2016164474A1 (en) * 2015-04-06 2016-10-13 The Trustees Of Columbia University In The City Of New York Predictive value of combined genetic enzymatic and lipidomic data in disease risk for lewy body disease
WO2020016437A1 (en) 2018-07-19 2020-01-23 Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol In vitro method for the diagnosis of synucleinopathies
US12065701B2 (en) 2018-07-19 2024-08-20 Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol In vitro method for the diagnosis of synucleinopathies

Also Published As

Publication number Publication date
CA2789054A1 (en) 2011-09-01
MX2012009506A (es) 2012-09-12
EP2360280A1 (en) 2011-08-24
SG183437A1 (en) 2012-09-27
NZ602551A (en) 2014-03-28
BR112012021260A2 (pt) 2017-11-14
EP2539461B1 (en) 2015-01-07
ZA201206975B (en) 2015-08-26
CL2012002347A1 (es) 2013-12-13
CN102869786B (zh) 2014-12-24
CN102869786A (zh) 2013-01-09
US20130101997A1 (en) 2013-04-25
KR20130043107A (ko) 2013-04-29
JP2013520185A (ja) 2013-06-06
AU2011220065A1 (en) 2012-10-11
IL221313A0 (en) 2012-10-31
EP2539461A1 (en) 2013-01-02
RU2012140458A (ru) 2014-03-27
KR20130049771A (ko) 2013-05-14

Similar Documents

Publication Publication Date Title
EP2539461B1 (en) Genetic marker for the diagnosis of dementia with lewy bodies
Prince et al. Lack of replication of association findings in complex disease: an analysis of 15 polymorphisms in prior candidate genes for sporadic Alzheimer's disease
US8835111B2 (en) Genotyping tool for improving the prognostic and clinical management of MS patients
CN111560428B (zh) 检测线粒体DNA rs3937033单核苷酸多态性的物质的用途
JP2017511138A (ja) 神経変性疾患のミトコンドリアマーカー
WO2010060189A1 (en) Allele-allele interactions of mthfr gene variants, and uses thereof in predicting disease risk
JP2010508029A (ja) 抗うつ薬による治療時に有害事象を発現する危険性のある患者の識別方法
WO2008010082A2 (en) Diagnostic method for fibromyalgia (fms) or chronic fatigue syndrome (cfs)
AU2021231683A1 (en) Compositions and methods for assessing the efficacy of inhibitors of neurotransmitter transporters
US20140249047A1 (en) Genetic marker for the diagnosis of dementia with lewy bodies
KR102063486B1 (ko) Rnf213 단일염기다형성과 한국인 모야모야병 발병 위험도의 연관성
US20060183117A1 (en) Screening for alzheimer's disease
JP5643933B2 (ja) Ｚｎｆ５１２ｂ遺伝子の一塩基多型に基づく筋萎縮性側索硬化症の検査方法
WO2016180725A1 (en) Diagnosis of dementia with lewy bodies
WO2011113004A2 (en) Markers associated with alzheimer's disease
KR102110883B1 (ko) 정신 질환 진단용 kmt2c 다형성 마커
WO2015037681A1 (ja) 抗甲状腺薬誘発性無顆粒球症リスクを判定するための検査方法及び判定用キット
RU2650867C1 (ru) Способ определения генетической предрасположенности к развитию панического расстройства
Park et al. Inclusion of Double Helix Structural Oligonucleotide (STexS) Results in an Enhance of SNP Specificity in PCR
KR20230036504A (ko) 근감소증 진단용 마커 및 이의 용도
JP5594655B2 (ja) 網膜色素線条症の原因変異を判定するための方法及びこれに使用されるオリゴヌクレオチド
WO2009137475A2 (en) Compositions and methods for diagnosing late-onset alzheimer's disease
Berlin Genetics/transcriptomics

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180011143.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11708400

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2789054

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 221313

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: MX/A/2012/009506

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2012002347

Country of ref document: CL

Ref document number: 2012554248

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011220065

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2011708400

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 8238/DELNP/2012

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20127024833

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012140458

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 2011220065

Country of ref document: AU

Date of ref document: 20110224

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13578987

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012021260

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012021260

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120823