WO2011103633A1 - Treatment or prevention of infection - Google Patents
Treatment or prevention of infection Download PDFInfo
- Publication number
- WO2011103633A1 WO2011103633A1 PCT/AU2011/000206 AU2011000206W WO2011103633A1 WO 2011103633 A1 WO2011103633 A1 WO 2011103633A1 AU 2011000206 W AU2011000206 W AU 2011000206W WO 2011103633 A1 WO2011103633 A1 WO 2011103633A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- sequence
- individual
- oral
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0208—Specific bacteria not otherwise provided for
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0216—Bacteriodetes, e.g. Bacteroides, Ornithobacter, Porphyromonas
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/542—Mucosal route oral/gastrointestinal
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2121/00—Preparations for use in therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
Definitions
- the invention relates to the treatment or prevention of diseases or conditions in a subject, said diseases or conditions being associated with the presence of a microbial pathogen in an oral tissue of a subject, and in particular, but not exclusively, to the treatment or prevention of P. gingivalis-related diseases or conditions.
- the mouth constitutes one of the major sites of infection. Infection can lead to debilitating disease of oral tissue and a clear association has also been observed between infection of oral tissue and disease or condition in other anatomical compartments.
- Chronic periodontitis is one example of a disease of oral tissue. This is an inflammatory disease of the supporting tissues of the teeth leading to resorption of alveolar bone and eventual tooth loss. The disease is a major public health problem in all societies and is estimated to affect up to 15% of the adult population with severe forms affecting 5-6%.
- microbial pathogens including other bacteria, fungi, virus and protozoa have been associated with disease of oral tissue and some of these pathogens also cause disease in other anatomical compartments via infection of oral tissue. Examples of the former include T. denticola and T. forsythia.
- Group A Streptococcus infection is an aetiological agent of rheumatic fever and rheumatic heart disease.
- a method of reducing the incidence or severity of a disease or condition in a subject, said disease or condition being one associated with the presence of a microbial pathogen in an oral tissue of a subject including:
- the antibody is provided in said subject by administering an immunogen to said subject, said immunogen for protecting said subject against a microbial pathogen.
- a method of reducing the incidence or severity of a P. gingivalis - related disease or condition in a subject including:
- a chimeric or fusion protein for inducing an immune response to P. gingivalis to the subject, the protein including a first peptide joined directly or through a linker to a second peptide, wherein:
- said first peptide includes:
- composition or kit including:
- composition or kit for use in a method described above.
- a method of reducing the incidence or severity of a disease or condition in a subject, said disease or condition being one associated with the presence of a microbial pathogen in an oral tissue of a subject including:
- the surgical procedure is a dental procedure.
- dental procedures include debridement, scaling and/or root planning.
- the present invention provides a composition for reducing the incidence or severity of a disease or condition in a subject, said disease or condition being one associated with the presence of a microbial pathogen in an oral tissue of a subject, the composition including an anti -microbial agent as described herein and an immunogen as described herein.
- the invention provides a use of a composition of the invention in the preparation of a medicament for reducing the incidence or severity of a disease or condition in a subject, said disease or condition being one associated with the presence of a microbial pathogen in an oral tissue of a subject.
- diseases include dental plaque, gingivitis, periodontitis, chronic periodontitis, dental caries, bone loss, alveolar bone loss and coronary artery disease.
- the invention provides a composition for the treatment or prevention of periodontal disease (and/or the other conditions identified herein as suitable for treatment) consisting of an active ingredient of anti -microbial agent as described herein and an immunogen as described herein.
- the invention provides a composition comprising anti -microbial agent as described herein and an immunogen as described herein for use in for reducing the incidence or severity of a disease or condition in a subject, said disease or condition being one associated with the presence of a microbial pathogen in an oral tissue of a subject.
- the invention provides a composition as described herein for use as a medicament.
- the invention provides a pharmaceutical composition comprising an effective amount of a composition of the invention as a main ingredient.
- a method for forming an antibody response or for forming a Th2 response to an oral pathogen in an individual including the steps of:
- an immunisation regime for the formation of an antibody response or the formation of a Th2 response to an oral pathogen in an individual having inflamed oral tissue the step of administering an anti-inflammatory agent to the individual, thereby minimising inflammation of, or removing inflammation from the oral tissue, prior to an immunisation of the individual for the formation of an antibody response or Th2 response to an oral pathogen.
- a method for conditioning an individual having an inflamed oral tissue to form an antibody response or to form a Th2 response to an oral pathogen upon immunisation with the pathogen including the step of administering an anti-inflammatory agent to the individual, thereby minimising inflammation of, or removing inflammation from the oral tissue, prior to an immunisation of the individual with a pathogen for the formation of an antibody response or the formation of a Th2 response to an oral pathogen.
- a method of forming an antibody response or forming a Th2 response to an oral pathogen in an individual having inflamed oral tissue including the steps of:
- an immunisation is to be provided at a time when oral tissue is not inflamed, or when inflammation is subclinical or asymptomatic.
- an immune response formed upon immunisation is predominantly a Th2 response, although it may contain detectable components of a Th1 response.
- the relevant inflammation is chronic periodontitis, especially periodontitis associated with P. gingivalis infection.
- an immunogen for immunisation is a P. gingivalis cell, fragment, metabolite, or recombinant product derived therefrom, such as the chimeric peptides (especially KAS1-KsA1, KAS2-KLA1) described herein.
- the anti-inflammatory agent or anti-microbial agent as defined herein includes or consists of one or more of an anti- inflammatory compound, an anti-biotic and an anti-biofilm agent, examples of which are described in more detail herein.
- Figure 1 shows a Coomassie blue stain of the SDS-PAGE gel of recombinant Kgp Proteins.
- Lane 1 KAS2-KLA1
- Lane 2 KLA1
- Lane 3 KsA1
- Lane 4 KAS1-KsA1.
- Molecular weight markers are indicated as kDa.
- Figure 2 shows antibody recognition of KAS2 peptide and formalin killed P. gingivalis W50 cells.
- KAS2 peptide was probed with antisera raised to formalin killed P. gingivalis W50 cells (FK-W50), recombinant proteins KAS1-KsA1 , KAS2-KLA1 , and synthetic KAS2-DT conjugate and PBS in an ELISA.
- formalin killed P. gingivalis W50 cells were probed with antisera raised to formalin killed P. gingivalis W50 cells (FK-W50), recombinant proteins KAS1-KsA1 , KAS2-KLA1 , KLA1 and PBS in an ELISA.
- Antibody responses are expressed as the ELISA titre OD415 obtained minus double the background level, with each titre representing the mean ⁇ standard deviation of three values.
- Figure 3 shows P. g/ng/Va/Zs-induced horizontal bone loss of maxillae molars of mice immunised with the recombinant proteins and recombinant chimera proteins, formalin- killed P. gingivalis and adjuvant alone (PBS, IFA) or non-orally infected (non- challenged) mice.
- KAS2-KLA1 is shown as AS2-LA1
- KLA1 is shown as LA1
- KAS1-KsA1 is shown as AS1-sA1
- KsA1 is shown as sA1.
- Figure 4 shows serum antibody subclass responses of immunised mice in the periodontitis model.
- Sera from mice; A (pre-oral inoculation) and B (post-oral inoculation) immunised with recombinant proteins KsA1 , KLA1 , KAS1-KsA1 and KAS2- KLA1 and formalin killed P. gingivalis strain W50 were used in the ELISA with the formalin killed P. gingivalis strain W50 as the adsorbed antigen.
- Antibody responses IgG black bars
- lgG1 grey bars
- lgG2a white bars
- lgG2b horizontal striped bars
- lgG3 diagonal striped bars
- Figure 5 shows a PEPSCAN analysis of peptide-specific antibody reactivity to overlapping peptides representing the KAS2 peptide sequence 433-468.
- KAS2 overlapping peptides (offset 1 , overlap 7) probed with KAS1-KsA1 (white bars), KAS2- KLA1 (black bars) antisera.
- KAS2 overlapping peptides (offset , overlap 7) probed with KAS2-DT conjugate antisera. Each bar displays the antibody reactivity (optical density [OD] at 415 nm).
- Chimera AS2-LA1 induces an antibody response in outbred mice that recognises P. gingivalis whole cells and the RgpA-Kgp complex.
- CD1 outbred mice were immunised with chimera AS2-LA1 (50mg/mouse) and the collected sera used in ELISA with AS2-LA1 (A), formalin killed P. gingivalis strain W50 (B) and RgpA-Kgp complex (C) as the absorbed antigens.
- KAS2-KLA1 is shown as AS2-LA1.
- the titre for each immunoglobulin isotype to each antigen was determined and the data expressed as the ELISA titre ( ⁇ 00) obtained minus double the background level, with each titre representing the mean ⁇ standard deviation of three values.
- FIG. 7 Protein model of the Kgp proteinase.
- KAS2 [Asn433-Lys468].
- A KAS4 [Asp388-Val395]
- B KAS5 [Asn510-Asp516]
- C KAS6 [Ne570-Tyr580]
- D KAS6 [Ne570-Tyr580]
- an improved response to infection especially, an improved antibody response can be obtained by removing substantially all inflammatory stimuli from oral tissue, prior to, providing adoptive transfer of immunity in the tissue, or at the time of invoking an immune response in the tissue.
- the finding is particularly useful insofar as it provides for the prevention and/or treatment of disease in oral tissue and by extension, for the prevention and/or treatment of disease that arises in other anatomical compartments as a consequence of infection of oral tissue by a microbial pathogen.
- a method of reducing the incidence or severity of a disease or condition in a subject said disease or condition being one associated with the presence of a microbial pathogen in an oral tissue of a subject, the method including: - treating a subject, thereby providing conditions for removal of substantially all microorganisms and fragments thereof from oral tissue of said subject; thereafter
- the antibody is provided in said subject by administering an immunogen to said subject, said immunogen for protecting said subject against a microbial pathogen.
- an anti -microbial composition for treating a subject thereby providing conditions for removal of substantially all micro-organisms and fragments thereof from oral tissue of said subject and immunogen are provided in synergistically effective amounts.
- the subject referred to herein is an animal, especially a mammal.
- the mammal is human.
- the mammal may be a domesticated or farmed animal. Examples of domesticated or farmed animals include horses, goats, pigs and livestock such as cattle and sheep.
- the animal is a companion animal such as a dog, cat, rabbit or guinea pig.
- the phrase 'removal of substantially all micro-organisms and fragments thereof from oral tissue' generally refers to providing conditions in which micro-organisms or fragments or metabolites thereof are depleted from the tissue in a quantity sufficient to deplete inflammatory stimuli from the tissue, thereby substantially reducing or minimising one or more symptoms of inflammation in said tissue.
- This is particularly the case where the relevant subject has chronic inflammation of tissue stemming from chronic infection.
- the focus is on minimising inflammation of tissue. Accordingly it will be understood that some micro-organisms, fragments and metabolites thereof may remain after the relevant treatment step.
- the phrase 'removal of substantially all micro-organisms and fragments thereof from oral tissue' refers to providing conditions which substantially prevent the accumulation of microorganisms, fragments and metabolites thereof to a quantity that would cause inflammation.
- This is particularly the case where the subject for treatment is normal or otherwise asymptomatic for a disease or condition.
- surgical or dental intervention has removed micro-organisms and the objective is to ensure that conditions are provided which substantially prevent the accumulation of microorganisms in amounts that would cause inflammation.
- the focus is to prevent accumulation of amounts of micro-organisms that might cause inflammation, it will be understood that some micro-organisms, fragments or metabolites therefrom might accumulate after the relevant treatment step.
- the phrase 'reducing the incidence of disease or a condition' generally refers to minimising the likelihood of a subject - be it a normal or asymptomatic individual, or a subjecting having an early form of a disease or condition - from progressing to a complete active form of the disease or condition. In certain embodiments the phrase refers to preventing a given subject from progressing to a complete active form of a disease or condition.
- the phrase 'reducing the seventy of disease or a condition' generally refers to minimising one or more symptoms or manifestations or a disease or condition. In certain embodiments the phrase refers to treating an individual having a disease or condition.
- An 'immunogen' generally refers to a molecule that is capable of invoking or eliciting an immune response to antigen, preferably a humoral or antibody response, for example, a Th2 response.
- immunogens include peptides and related proteins.
- synergistically effective amounts generally refers to amounts of an antimicrobial composition and immunogen that provide a treatment or preventive or protective effect that is greater than the effect that can be achieved by the composition or immunogen when each is used alone.
- synergistically effective amounts of the anti-microbial composition and immunogen underpin a novel working interrelationship between said composition and immunogen whereby the protective or therapeutic effective of said immunogen is much greater than can be achieved when the immunogen alone is applied to inflamed tissue.
- a synergistically effective amounts of microbial composition and immunogen provide for a higher titre and/or higher affinity antibody response to microbial pathogens than can be realised when the immunogen is used alone.
- the phrase 'therapeutically effective amount generally refers to an amount of a compound of the present invention that (i) treats the particular disease, condition, or disorder, (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein.
- beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
- 'Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment. Treatment may not necessarily result in the complete clearance of an infection but may reduce or minimise complications and side effects of infection and the progression of infection. The success or otherwise of treatment may be monitored by physical examination of the individual, cytopathological, serological DNA, or mRNA detection techniques.
- the words 'prevent and 'prevention' generally refer to prophylactic or preventative measures for protecting or precluding an individual not having a given infection related complication from progressing to that complication. Individuals in which prevention is required include those who have an infection.
- phrases 'pharmaceutically acceptable' indicates that the substance or composition must be compatible chemically and/or toxicologically, with the other ingredients comprising a formulation, and/or the mammal being treated therewith.
- the term 'package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products.
- a Th1 response generally refers to a response involving cytokines such as interferon gamma and TNF.
- a Th2 response generally refers to a response involving cytokines such as interleukin-4, interleukin-5, interleukin-6, interleukin-10, interleukin-13 etc.
- the methods of the invention are applicable to a wide range of subjects including those who are asymptomatic for said disease or condition. These individuals may have no symptoms of disease in oral or other tissue. Specifically, these individuals may not present with inflammation of mucosal or other oral tissue. In one embodiment, these individuals may have, in the context of a randomly selected cohort of subjects, a normal relative abundance of microbial pathogens in the oral cavity.
- the subject manifests sub clinical or clinical symptoms of a disease or condition of oral tissue or other anatomical compartment.
- the symptoms of said disease or condition may be manifested in oral tissue of said subject.
- the hallmarks of acute inflammation may be present including an increased movement of plasma and leukocytes from the blood into the injured tissues.
- Clinical signs of acute infection of the gingiva may also be present including rubor (redness), calor (increased heat), tumor (swelling), dolor (pain), and functio laesa (loss of function).
- Chronic inflammation may be characterised by leukocyte cell (monocytes, macrophages, lymphocytes, plasma cells) infiltration. Tissue and bone loss may be observed. Examples of inflammation include cheilits, gingivitis, glossitis and stomatitis.
- the subject may have inflamed mucosal or other oral tissue.
- the subject may present with acute inflammation of oral tissue.
- these subjects include those who have been subjected to dental or oral surgery including debridement, scaling and root planing.
- the subject may present with chronic inflammation of oral tissue.
- the subject may present with gingivitis, resorption of alveolar bone and eventual tooth loss stemming from progressive loss of collagen attachment of the tooth to alveolar bone.
- Other lesions of mucosal or related oral tissue are possible.
- the disease or condition is a disease or condition of oral tissue.
- Chronic periodontitis is a particularly important example.
- Others include diseases and conditions characterised by damage to oral mucosa as in Scarlet Fever, Aphthous Stomatitis, Pyogenic Granuloma, Diphtheria, Tuberculosis, Syphilis, Actinomycosis, Candidiasis, Herpetic Stomatitis.
- the disease or condition may be a disease or condition of a tissue other than the oral tissue such as an organ or system, for example, the cardiovascular system.
- the disease or condition is cardiovascular disease.
- the invention is applicable to a range of microbial pathogen, especially those that infect the tissues of the oral cavity.
- the pathogen is selected from the group consisting of bacteria, virus and fungi.
- Particularly preferred bacteria are selected from the group consisting of: Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia.
- Organism Exemplary family / Exemplary species
- a composition forming an anti-microbial agent is administered to the subject, thereby removing substantially all micro-organisms or fragments thereof from oral tissue of said subject. Examples are discussed further below.
- providing in the subject an antibody occurs one to two weeks after treatment of an infected site by mechanical debridement and/or the application of one or more of the antimicrobial agents as defined herein.
- the level of or presence of micro-organisms, fragments or metabolites thereof can be determined by detecting or measuring a protein or fragment thereof from a microorganism.
- the level of or presence of micro-organisms, fragments or metabolites thereof in an oral tissue can be determined by taking a sample from the individual and determining the presence of a given protein, or level of expression of a given protein in the sample.
- the presence of or level of a protein can be detected by any number of assays. Examples include immunoassays, chromatography and mass spectrometry. One example of an immunoassay that is particular preferred is FACS.
- ELISA Enzyme linked immunosorbent assay
- a sample for example saliva or oral tissue, containing a target protein, peptide or fragment thereof to a surface such as a well of a microtiter plate.
- a target protein specific antibody coupled to an enzyme is applied and allowed to bind to the target protein, peptide or fragment thereof. Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody.
- Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of target protein, peptide or fragment thereof present in the sample is proportional to the amount of color produced.
- a target protein, peptide or fragment thereof standard is generally employed to improve quantitative accuracy.
- Western blot This method involves separation of a target protein, peptide or fragment thereof from other protein by means of an acrylamide gel followed by transfer of the protein, peptide or fragment thereof to a membrane (e.g., nylon or PVDF). Presence of the target protein, peptide or fragment thereof is then detected by antibodies specific to the target protein, peptide or fragment thereof, which are in turn detected by antibody binding reagents.
- Antibody binding reagents may be, for example, protein A, or other antibodies.
- Antibody binding reagents may be radiolabeled or enzyme linked as described hereinabove. Detection may be by autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of target protein, peptide or fragment thereof and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.
- Radio-immunoassay In one version, this method involves precipitation of the desired target protein, peptide or fragment thereof with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labelled with I 125 ) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of target protein, peptide or fragment thereof.
- a specific antibody and radiolabeled antibody binding protein e.g., protein A labelled with I 125
- a labelled target protein, peptide or fragment thereof and an unlabelled antibody binding protein are employed.
- a sample containing an unknown amount of a target protein, peptide or fragment thereof is added in varying amounts.
- the decrease in precipitated counts from the labelled target protein, peptide or fragment thereof is proportional to the amount of target protein, peptide or fragment thereof in the added sample.
- Fluorescence activated cell sorting This method involves detection of a target protein, peptide or fragment thereof in situ in cells by target protein, peptide or fragment thereof specific antibodies.
- the target protein, peptide or fragment thereof specific antibodies are linked to fluorophores. Detection is by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.
- Immunohistochemical analysis This method involves detection of a target protein, peptide or fragment thereof in situ in fixed cells by target protein, peptide or fragment thereof specific antibodies.
- the target protein, peptide or fragment thereof specific antibodies may be enzyme linked or linked to fluorophores. Detection is by microscopy and subjective or automatic evaluation. If enzyme linked antibodies are employed, a colorimetric reaction may be required. It will be appreciated that immunohistochemistry is often followed by counterstaining of the cell nuclei using for example Hematoxyline or Giemsa stain.
- In situ activity assay According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.
- In vitro activity assays In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non- denaturing acrylamide gel (i.e., activity gel). Following electrophoresis the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of colour produced. An enzyme standard is generally employed to improve quantitative accuracy.
- the amount of bacterial DNA may be determined by quantitative PCR as an indicator of the presence of or level of micro-organisms in an oral tissue.
- the presence of or level of a protein or DNA from Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia may be determined and indicative that substantially all micro-organisms or fragments thereof have been removed from an oral tissue of a subject.
- the anti -microbial agent and/or immunogen may be administered systemically, or directly to oral tissue, especially directly to oral mucosa.
- the treatment of the subject removes substantially all microorganisms or fragments thereof from oral tissue of said subject, thereby minimising inflammation in the oral tissue of the subject. In another embodiment, the treatment of the subject removes substantially all micro -organisms or fragments thereof from oral tissue of said subject, thereby minimising immune responses in the oral tissue of the subject.
- the immunogen may be administered to said subject after treatment of said subject to remove substantially all micro-organisms and fragments thereof from oral tissue of said subject.
- the relevant oral tissue is not inflamed, or inflammation, if present at all is asymptomatic or sub clinical at the time of immunisation.
- compositions After immunisation the subject exhibits a predominance of a Th2 response which is largely a humoral response and the individual has detectable levels of protective antibodies. 3.
- the anti-microbial agent may be any agent that, the effect of which on administration is to deplete inflammatory stimuli.
- These agents used alone or in combination have utility in the short term inhibition of inflammation, periodontal pathogen re-emergence, for example biofilm formation, and/or periodontal bone resorption.
- These agents alone or combination can be applied, for example, topically in a slow-release, periodontal gel formulation at a periodontal site, that may have undergone surgical intervention, to prepare the patient's immune system for vaccination against the periodontal pathogens.
- an anti-microbial agent as defined herein for example in a periodontal gel formulation, at the time of mechanical debridement and cleaning of the infected periodontal site, helps prepare the immune system to allow the development of a Th2-biased response.
- This Th2-biased response results in the production of protective antibodies and the prevention of the re-emergence of the periodontal pathogens and prevention of disease progression.
- anti-microbial agents an antibiotic, an immunosuppressant and an antiseptic.
- the agent may be an anti-inflammatory agent.
- Anti-inflammatory agents include Nonsteroidal Antiinflammatory Drugs (NSAIDs). Examples of NSAIDs include compounds than inhibit a cyclooxygenase. Specific examples of NSAIDs include aspirin, ibuprofen and naproxen.
- NSAIDs Nonsteroidal Antiinflammatory Drugs
- Other examples of ant-inflammatory agents include antagonists of PAR-2 which include, but are not limited to, antibodies and antibody fragments that bind PAR-2, other polypeptides that bind to PAR-2 and inhibit its activity, other compounds that inhibit PAR-2 activity or expression including small organic compounds and inhibitory nucleic acids that interact with PAR-2 encoding nucleic acids.
- Exemplary antagonists that may block or displace an endogenous ligand from binding PAR-2 and/or signalling via PAR-2 include those described in WO 2004/002418 and WO 2006/023844 (e.g. peptides having the amino acid sequence LIGK or LIGKV).
- Antagonists that bind to PAR-2 and prevent proteolytic cleavage of the region of PAR-2 that acts as a tethered ligand are exemplified in WO 2007/092640.
- Antagonists that inhibit, reduce or block expression of PAR-2 include inhibitory nucleic acids, including, but not limited to, ribozymes, triplex-forming oligonucleotides (TFOs), external guide sequences (EGSs) that promote cleavage by RNase P, peptide nucleic acids, antisense DNA, siRNA, and microRNA specific for nucleic acids encoding PAR-2.
- inhibitory nucleic acids including, but not limited to, ribozymes, triplex-forming oligonucleotides (TFOs), external guide sequences (EGSs) that promote cleavage by RNase P, peptide nucleic acids, antisense DNA, siRNA, and microRNA specific for nucleic acids encoding PAR-2.
- PAR-2 may be inhibited indirectly by "indirect antagonists" that antagonise the activity of proteases which under normal circumstances cleave PAR-2 resulting in its activation.
- Proteases which can cleave PAR-2 include gingipains, trypsins, tryptases and neutrophil proteinase-3.
- indirect antagonists that are useful in a method of the invention or that can be used in a composition of the invention include trypsin inhibitors disclosed in WO 93/14779 and tryptase inhibitors disclosed in WO 02/47762.
- the anti-microbial agent is an antibiotic.
- antibiotics selected from the group consisting of macrolides, tetracyclines, penicillins, fumarate reductase inhibitors and anti-microbial peptides, as shown in TABLE B below.
- Roximycin (Alphapharm) Roxithromycin-RL (Real-RL) Rulide and Rulie D (Sanofi- Aventis)
- Cilicaine VK Cilicaine V (Fawns & McAllen)
- Cephalosporins Cephalexin Cefalexin Sandoz (Sandoz) lalex (Lennon)
- the anti-microbial agent is selected from one or more of inhibiting agents of fumarate reductase.
- Suitable inhibiting agents include natural products, that include but are not limited to decursin, verticipyrone, paecilaminol, 5-alkenyl-3,3(2H)- furanones from Streptomyces spp., nafuredin, mesaconic acid, rotenone, and natural, semi-synthetic and synthetic analogues thereof.
- inhibiting agents may be synthetic compounds that include but are not limited to; 2-substituted 4,6- dinitrophenols; mercaptopyridine N-oxide; L-092,201 (Merck Sharpe and Dohme); nitro- imidazoles such as fexindazole megazol benznidazole, MK-436, L-634,549, misonidazole; or benzimidazoles such as albendazole, cambendazole mebendazole, oxfendazole, parebendazole and thiabendazole; or oxantel or morantel.
- Preferred inhibiting agents are oxantel, morantel or thiabendazole.
- a particularly preferred inhibiting agent is oxantel.
- the selection of the inhibiting agent will be dependent upon number of clinical factors which determine whether the inhibiting agent is appropriate for use in a clinical setting.
- the antibiotic may be directly cytotoxic to the microbial pathogen.
- the antibiotic is indirectly cytotoxic, for example, the antibiotic may be an inhibitor of microbial biofilm production or some other metabolism.
- the antibiotic is an anti-microbial peptide. Examples are shown in Table C below.
- the anti-microbial agent is an inhibitor of microbial biofilm production.
- Other preferred agents are fumarate reductase inhibitors.
- the anti-microbial agent may be an antibody.
- the antibody may be a polyclonal or monoclonal antibody.
- Exemplary monoclonal antibodies that may be used are directed to molecules of the periodontal pathogens (e.g proteases and adhesins) or host to dampen inflammation [e.g. antibodies, singly or in combination, against tumor necrosis factor (TNFa), interleukin-1 (IL-1), urokinase-type plasminogen activator (u-PA), granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF) and RANK ligand (RANKL)].
- TNFa tumor necrosis factor
- IL-1 interleukin-1
- u-PA urokinase-type plasminogen activator
- GM-CSF granulocyte macrophage colony stimulating factor
- M-CSF macrophage colony stimulating factor
- RNKL RANK ligand
- the antibody is a mixture of monoclonal antibodies directed against different pathogen antigens and host inflammatory mediators.
- the preferred monoclonal antibodies to be used targeting Porphyromonas gingivalis are those directed to the active site of the Kgp and RgpA proteinases and those directed to binding motifs in the A1 adhesin of the Kgp and RgpA proteinases.
- the anti-microbial is an antibody mimetic.
- the antibody mimetic may or may not have the tertiary structure of an immunoglobulin domain (e.g. Dimitrov, 2009, MAbs 1 26-28).
- An antibody mimetic may have specificity for binding to a specific molecule.
- One example of an antibody mimetic is the family of molecules related to human lipocalins, known as anticalins (e.g. Skerra, 2007 Current Opinions in Biotechnology, 18 295-304).
- an anticalin is directed to, or binds specifically to, a protein from Porphyromonas gingivalis.
- the anticalin is directed to, or binds specifically to, an active site of a Lys-X-proteinase or Arg-X- proteinase, such as Kgp and RgpA proteinases.
- Anticalins can be used in lieu of monoclonal antibodies, but are about eight times smaller with a size of about 180 amino acids and a mass of about 20 kDa.
- Anticalins have better tissue penetration than antibodies and are stable at temperatures up to 70 °C. Unlike antibodies, they can be produced in bacterial cells like E. coli in large amounts.
- the anti-microbial agent may also be an anti-biofilm agent that can inhibit, reduce or prevent bacterial biofilm formation or development.
- An anti-biofilm agent may have biofilm disrupting activitiy and may cause biofilm dispersion.
- Biofilm disrupting activity is used herein to describe the property of a composition or agent that causes the release of bacteria from the biofilm.
- the composition or agent may also but not necessarily, reduce the viability of a bacterium in a biofilm.
- "Release" of bacteria from the biofilm includes increasing the number of bacteria from a biofilm to adopt a planktonic state thereby increasing the susceptibility of a bacterium from a biofilm to bactericidal agents.
- a bactericidal agent is used herein to describe the property of a composition, agent, compound, peptidomimetic or peptide that directly reduces the viability of a bacterium.
- compositions or agents that exhibit biofilm disrupting activity do not necessarily reduce the viability of bacteria in a biofiim but instead cause or induce the bacterial cells to be released from the biofiim.
- these compositions or agents may cause or induce more of the bacteria in a biofiim to adopt a planktonic state.
- the compositions or agents may inhibit or reduce the formation of a biofiim.
- the compositions or agents may inhibit or reduce biofiim growth.
- the anti-microbial agents of the invention may inhibit or reduce any characteristic that a biofiim exhibits which initiates or promotes a disease or condition in a subject.
- the peptides or compositions may inhibit or reduce any characteristic that a biofiim exhibits which initiates or promotes a disease or condition in a subject, without killing the bacteria in the biofiim.
- an anti-microbial composition or agent refers to the ability to prevent, inhibit or reduce a measurable parameter of a biofiim.
- measurable parameters of a biofiim may be total biomass, average thickness, surface to biovolume ratio, roughness coefficient or bacterial composition and their viability of the biofiim.
- the immunogen is selected to invoke an immune response, preferably a protective antibody response to the microbial pathogen of concern.
- the immunogen is provided in the form of a peptide, for example a recombinant peptide.
- the recombinant peptide may be a chimeric or fusion protein for inducing an immune response to P. gingivalis, the protein including a first peptide joined directly or through a linker to a second peptide, wherein:
- said first peptide includes:
- peptide is used to refer to an amino acid sequence of up to about 40 amino acid residues, preferably from 5 to 40 amino acid residues.
- polypeptide is used in place of or in other words instead of the "second peptide".
- polypeptide is used to refer to an amino acid sequence of at least about 40 amino acid residues.
- a chimeric or fusion protein for inducing an immune response to P. gingivalis, the protein including a peptide joined directly or through a linker to a polypeptide, wherein:
- polypeptide includes:
- the invention provides a peptide for inducing an immune response to P. gingivalis selected from the group consisting of:
- the peptide may be provided in the form of a chimeric or fusion protein in which the peptide is joined directly or through a linker to a second peptide.
- the second peptide of the chimeric or fusion protein includes:
- a polypeptide is used in place of, or in other words instead of the second peptide.
- a chimeric or fusion protein for inducing an immune response to P. gingivalis the protein including a peptide joined directly or through a linker to a polypeptide, wherein:
- polypeptide includes:
- a reference to a "homologue" of a peptide or polypeptide is a reference to a peptide or polypeptide having an amino acid sequence that shares homology or that is homologous to, or that has identity with the amino acid sequence of the first- mentioned peptide or polypeptide, preferably at least 90% sequence identity, more preferably at least 95% and even more preferably at least 98% sequence identity when the comparison is performed by a BLAST algorithm wherein the parameters of the algorithm are selected to give the largest match between the respective sequences over the entire length of the respective reference sequences.
- Sequence identity refers to exact matches between the amino acids of two sequences which are being compared.
- Such a homologue may derive from a naturally occurring variant or isolate of the Lys-X- proteinase or Arg-X-proteinase of P. gingivalis.
- it may be a "conservative- substitution" variant of a peptide or polypeptide from the Lys-X-proteinase or Arg-X- proteinase of P. gingivalis in which one or more amino acid residues have been changed without altering the overall conformation and function of the peptide or polypeptide; including, but by no means limited to, replacement of an amino acid with one having similar properties.
- Amino acids with similar properties are well known in the art.
- polar/hydrophilic amino acids which may be interchangeable include asparagine, glutamine, serine, cysteine, threonine, lysine, arginine, histidine, aspartic acid and glutamic acid; nonpolar/hydrophobic amino acids which may be interchangeable include glycine, alanine, valine, leucine, isoleucine, proline, tyrosine, phenylalanine, tryptophan and methionine; acidic amino acids which may be interchangeable include aspartic acid and glutamic acid and basic amino acids which may be interchangeable include histidine, lysine and arginine.
- conservative-substitution variants have less than 20, more preferably less than 15, more preferably less than 10, and most preferably less than 5 amino acid changes.
- a region of a P. gingivalis trypsin-like enzyme - especially a Lys-X-proteinase (Kgp) or Arg-X-proteinase (RgpA) - that defines a site in an enzyme for cleavage of a peptide bond can be determined following the teaching of the specification herein, particularly in relation to Figure 7 and Example 9, which exemplify the process for predicting three- dimensional conformation of the catalytic site as it appears on P. gingivalis for Lys-X- proteinase.
- Example 10 provides methodology for modelling of the Arg-X-proteinase three-dimensional conformation.
- the chimeric or fusion protein, or first or second peptide components thereof may be formed from a peptidomimetic.
- a peptidomimetic is a molecule that mimics one or more characteristics of a given peptide, for example conformation, and that consists of amino acid residues, some of which may not be naturally occurring.
- the inventors have determined the sequence of various peptide immunogens against which a humoral response can be raised.
- 'six' regions that flank or otherwise define the catalytic site have been defined as follows: KAS1/RAS1 , KAS2/RAS2, KAS3/RAS3, KAS4/RAS4, KAS5/RAS5 and KAS6 (see Table 1).
- the inventors have been able to interrogate protein sequence databases to determine peptides that share homology with amino acid sequences that form regions that flank a catalytic site and hence that represent immunogenic epitopes found on P. gingivalis.
- the sequence of these peptides are identified by the following structural formula: Table 1. Sequences that flank the active site of Kgp and RgpA.
- chimeric proteins including these peptides have a number of utilities. For example, as described herein, some produce a humoral response that is highly protective for treatment or prevention of bone loss as observed in chronic periodonitis.
- the peptides may also be used in a diagnostic assay wherein they can detect or monitor specificities in an individual's serum, thereby indicating whether or not the individual is infected and if so, whether treatments are required or if provided, whether they have been effective. It will be understood that the region of a P.
- gingivalis trypsin-like enzyme that defines a site in the enzyme for cleavage of a peptide bond located C - terminal to Lys or Arg, does not comprise a complete sequence of the Lys-X-proteinase or Arg-X-proteinase.
- heterologous protein or “chimeric or fusion protein” are used to refer to a protein that is composed of functional units, domains, sequences or regions of amino acids derived from different sources or that are derived from the same source and that have been assembled so as to have an organisation that is distinguished from that observed in a molecule from which the unit, domain, sequence or region is derived or related to.
- a common feature of the chimeric or fusion proteins of the invention is that they contain at least one peptide having an amino acid sequence that is the same as or that shares homology with a sequence of a P. gingivalis trypsin-like enzyme that defines a catalytic site for cleavage of a peptide bond.
- the first peptide comprises a peptide from the Kgp[432-468] region
- it is preferably (i) a peptide which comprises a sequence selected from VSFANYT and VGFANYT, more preferably a sequence selected from GVSFANYT, G VGFANYT, VSFANYTA and VGFANYTA; or (ii) a peptide which comprises a sequence selected from ETAWAD, ETSWAD, TAWADP and TSWADP, preferably a sequence selected from SETAWAD, SETSWAD, ETAWAD P, ETSWADP, TAWADPL and TSWADPL, more preferably a sequence selected from GS ETAWAD, GSETSWAD, SETAWADP, SETSWADP, ETAWADPL, ETSWADPL, TAWADPLL and TSWADPLL.
- this peptide is selected from the KAS1 [432-454], KAS2[433-468] and KAS3[436-455] peptides shown in Table 1.
- the first peptide may be the PAS1 K[432-453] peptide, also known as PAS1 (K48), disclosed in International Patent Application No. PCT/AU98/00311 (WO 98/049192).
- the sequence identifiers corresponding to these peptides are shown in Table 3.
- the first peptide comprises a peptide from the RgpA[426-462] region
- this peptide is preferably selected from the RAS1 [426- 448], RAS2[427-462] and RAS3[430-449] peptides shown in Table 1.
- the first peptide may be the PAS1 R[426-446] peptide, also known as PAS1 (R45), disclosed in International Patent Application No. PCT/AU98/00311 (WO 98/049192).
- the second peptide may be a peptide from an adhesin domain of a P.
- gingivalis trypsin like enzyme, such as Lys-X- proteinase (Kgp) or Arg-X-proteinase (RgpA) or HagA (see Table 2). These domains are sometimes also known as hemagglutinins.
- Lys-X-proteinase the preferred domains are KA1 , KA2, KA3, KA4, KA5 as identified in Table 2.
- Arg-X-proteinase the preferred domains are RA1 , RA2, RA3 and RA4 as identified in Table 2.
- HagA the preferred domains are HagA1 , HagA1 * and HagA1 ** .
- Kgp Lys-X KA1 (738- KsA1 (759- KLA1 (751- KA2 (1157- KA3 (1292 KA4 KA5 proteinase 1099) 989) 1056) SEQ 1275) -1424) (1427 - (1548-
- the adhesin domain In addition to improving the humoral response to a peptide of the invention such as KAS1 , KAS2, KAS3, KAS4, KAS5 and KAS6 or RAS1 , RAS2 and RAS3, RAS4 and RAS5 when included with such a peptide in a chimeric or fusion protein, the adhesin domain also contains immunogenic epitopes, hence leading to the production of multiple specificities to elicit a protective immunogenic response. The finding that the immunogenic epitopes of the adhesin domain are retained in a form approaching that in a P. gingivalis trypsin -like enzyme when provided in the chimeric or fusion protein of the invention is unanticipated.
- the chimeric or fusion protein may contain any one or more of the peptides selected from KAS1/RAS1 , KAS2/RAS2, KAS3/RAS3, KAS4/RAS4, KAS5/RAS5 and KAS6/RAS6 together with any one or more adhesin domains of a P.
- gingivalis trypsin-like enzyme in particular with any one or more of Lys-X-proteinase adhesin domains (KA1 , KA2, KA3, KA4 and KA5) or Arg-X-proteinase adhesin domains (RA1 , RA2, RA3 and RA4) or HagA domains HagA1 , HagA1* and HagA1 * *.
- the adhesin domain may be a fragment of such a domain, in particular, preferred fragments are the KsA1 and KLA1 domain fragments of the Lys-X-proteinase A1 domain (see Table 2). Where the domain is a fragment of an adhesin domain it generally contains one or more adhesin domain specific epitopes.
- the second peptide or polypeptide includes a sequence shown in one or more of SEQ ID No: 69 to 79 or one or more of 83 to 85.
- the chimeric or fusion protein of the present invention may also include one or more additional peptides selected from the Kgp[432-468] region of the Lys-X-proteinase and/or one or more additional peptides selected from the RgpA[426-462] region of the Arg-X-proteinase.
- the chimeric or fusion protein includes one or more of KAS1 , KAS2, KAS3, KAS4, KAS5 and KAS6, or one or more of RAS1 , RAS2, RAS3, RAS4 and RAS5, together with KsA1 or KLA1.
- the chimeric or fusion protein may include at least one further peptide wherein said further peptide includes:
- domains, units, sequences or regions that may be included in a chimeric or fusion protein as described herein include domains for binding to receptors or ligands such as Fc binding regions or Fc receptors, domains for improving half-life such as albumin or domains for facilitating expression or purification of the chimeric or fusion protein.
- the invention provides a peptide for inducing an immune response to P. gingivalis including the sequence shown in one of SEQ ID No: 17, 18, 25 and 26.
- the peptide has a sequence that is homologous to one of SEQ ID No: 17, 18, 25 and 26.
- the peptide may have a length of 5 to 40 amino acids.
- the invention provides a nucleic acid encoding a peptide having a sequence shown in one of SEQ ID No: 17, 18, 25 and 26.
- the invention provides a use of a peptide having a sequence shown in one of SEQ ID No: 17, 18, 25 and 26, or a nucleic acid encoding a peptide having a sequence shown in one of SEQ ID No: 17, 18, 25 and 26, for the manufacture of a chimeric or fusion protein for inducing an immune response to P. gingivalis.
- the invention provides a use of a peptide having a sequence shown in one of SEQ ID No: 17, 18, 25 and 26, or a nucleic acid encoding a peptide having a sequence shown in one of SEQ ID No: 17, 18, 25 and 26, for inducing an immune response to P. gingivalis.
- the peptide is administered simultaneously or sequentially with a second peptide including:
- the C-terminal residue of the first peptide may be covalently linked to the N-terminal residue of an adhesin domain polypeptide, or the N-terminal residue of the first peptide may be covalently linked to the C-terminal residue of an adhesin domain polypeptide.
- the first peptide and adhesin domain polypeptide are said to be "directly linked” or "adjacent”.
- the chimeric or fusion protein includes a linker for linking the first peptide to an adhesin domain polypeptide.
- the linker may be any linker able to join a peptide to a polypeptide, including both amino acid and non-amino acid linkers.
- the linker is non-immunogenic. Suitable linkers may be up to 15 amino acids in length, although less than five amino acids is preferred.
- the linker may function to bring the first peptide and adhesin domain polypeptide into a closer spatial arrangement than normally observed in a P. gingivalis trypsin-like enzyme. Alternatively, it may space the first peptide and adhesin domain polypeptide apart.
- the chimeric or fusion proteins of the invention may be produced by recombinant expression systems (such as recombinant DNA technology) or by chemical synthesis (such as solid phase peptide synthesis). These techniques are well known in the art.
- the heterologous or chimeric protein is particularly advantageous because it improves the humoral response obtained over that obtained using the first or second peptide components of the chimeric or fusion protein alone.
- chimeric proteins including these peptides have a number of utilities. For example, as described herein, some produce a humoral response that is highly protective for treatment or prevention of bone loss as observed in chronic periodontitis.
- the peptides may also be used in a diagnostic assay wherein they can detect or monitor specificities in an individual's serum, thereby indicating whether or not the individual is infected and if so, whether treatments are required or if provided, whether they have been effective.
- the chimeric or fusion protein induces a protective immune response, typically a response that at least minimises or limits connective tissue damage otherwise associated with P. gingivalis infection.
- the protective response at least minimises or limits P.gingivalis induced bone loss.
- a model system for measuring bone loss mediated by P. gingivalis infection is discussed herein.
- the protective immune response is predominantly a humoral response.
- the protective immune response also includes a cellular response.
- the present invention also provides a composition including a chimeric or fusion protein as broadly described above.
- the composition is antigenic or immunogenic.
- the invention provides a composition suitable for eliciting a protective or therapeutic immune response against P. gingivalis infection, including the chimeric or fusion protein, optionally in association with an adjuvant.
- Such a composition may also include another component for modulating or potentiating the immune response.
- the composition takes the form of a vaccine.
- a preferred composition includes immunogens that generate an immune response to the periodontal pathogens Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia.
- Immunogens may be attenuated whole cell vaccine, or a purified antigen vaccine or more preferably a recombinant antigen vaccine where the composition contains antigens against one or more of the three periodontal pathogens.
- suitable peptides capable of forming immunogens relevant to P. gingivalis, T. denticola and T. forsythia infection are shown in Tables D to F.
- Porphryomonas gingivalis Proteinases or fragments US 6,017,532 see, thereof for example,
- PrtR17, PrtK15 and PrtR15 or fragments thereof
- PrtR-PrtK proteinase- US 6,962,706 see, adhesin complex and for example, Table 1 fragments thereof or sequence listing
- r-RgpA44 and r-Kgp39 and PCT/AUOO/01588 fragments thereof see, for example, sequence listing
- Adhesins and fragments US 2005/0288866 thereof see, for example,
- TDE0046 formiminotransferase-cyclodeaminase family protein
- TDE0102 cyclic nucleotide-binding protein
- TDE0231 DNA polymerase III, beta subunit (dnaN)
- TDE0340 fructose-bisphosphate aldolase, class-l
- TDE0386 ABC transporter periplasmic substrate-binding protein
- TDE0405 major outer sheath protein
- TDE0463 purine nucleoside phosphorylase (deoD)
- TDE0576 glutamyl-tRNA(Gln) amidotransferase, A subunit (gatA)
- TDE0665 pyruvate ferredoxin/flavodoxin oxidoreductase family protein
- cfpA cytoplasmic filament protein A
- TDE0845 conserved hypothetical protein TIGR00266
- TDE0855 DNA-binding response regulator TDE0911 type II restriction endonuclease Tdelll (tdelllR)
- TDE1041 polyribonucleotide nucleotidyltransferase (pnp)
- TDE1273 oligopeptide/dipeptide ABC transporter, peptide-binding protein
- TDE1408 flagellar filament outer layer protein FlaA, putative
- TDE1415 nucleotidyl transferase/aminotransferase, class V
- TDE1520 hydro-lyase, tartrate/fumarate family, alpha subunit
- TDE1624 glycine cleavage system P protein, subunit 2 (gcvP2)
- TDE1625 glycine cleavage system P protein, subunit 1 (gcvP1)
- TDE1631 citrate lyase, alpha subunit (citF)
- TDE1632 citrate lyase, beta subunit (citE)
- TDE1642 conserved hypothetical protein
- TDE1754 desulfoferrodoxin/neelaredoxin
- TDE2049 bacterial extracellular solute-binding proteins, family 5
- TDE2056 outer membrane hemin-binding protein A
- TDE2058 conserved hypothetical protein
- TDE2315 conserved hypothetical protein TIGR00044
- TDE2601 surface antigen
- TDE2779 hypothetical protein 1. Accessions and definitions from TIGR (now JCVI, www.tiqr.org). Definitions are from lGR's automated annotation of the genome.
- Hyphenated accession numbers are where two adjacent genes in the database correspond to a single protein as indicated by both proteomics and homology data.
- adjuvants are known for use in conjunction with vaccine compositions.
- the adjuvants aid by modulating the immune response and in attaining a more durable and higher level of immunity using smaller amounts of vaccine antigen or fewer doses than if the vaccine antigen were administered alone.
- adjuvants examples include incomplete Freund's adjuvant (I FA), Adjuvant 65 (containing peanut oil, mannide monooleate and aluminium monostearate), oil emulsions, Ribi adjuvant, the pluronic polyols, polyamines, Avridine, Quil A, saponin, MPL, QS-21 , mineral gels such as aluminium salts and calcium salts, nanoparticles such as hydroxyapatite, calcium phosphate, aluminium salts, sugar oligomers and polymers such as mannan, chitosan.
- I FA incomplete Freund's adjuvant
- Adjuvant 65 containing peanut oil, mannide monooleate and aluminium monostearate
- oil emulsions examples include oil emulsions, Ribi adjuvant, the pluronic polyols, polyamines, Avridine, Quil A, saponin, MPL, QS-21 , mineral gels such as aluminium salts and calcium salts, nanop
- the vaccine composition may include conventional pharmaceutically acceptable carriers, excipients, fillers, buffers or diluents as appropriate.
- One or more doses of the vaccine composition containing adjuvant may be administered prophylactically to prevent periodontitis or therapeutically to treat already present periodontitis.
- the adjuvant used would be selected to facilitate the production of a Th-2 biased response.
- An example would be Alum.
- the chimeric or fusion protein is combined with a mucosal adjuvant and administered via the oral, buccal or nasal route.
- mucosal adjuvants are nanoparticles, cholera toxin and heat labile E. coli toxin, the non-toxic B subunits of these toxins, genetic mutants of these toxins which have a reduced toxicity.
- Other methods which may be utilised to deliver the antigenic protein orally/buccally/nasally include incorporation or absorption of the protein into or onto particles of biodegradable polymer (such as acrylates or polyesters) or nanoparticles (such as hydroxyapatite) by microencapsulation to aid uptake of the microspheres from the gastrointestinal tract or other mucosal surfaces and to protect degradation of the proteins.
- biodegradable polymer such as acrylates or polyesters
- nanoparticles such as hydroxyapatite
- Liposomes, ISCOMsTM, hydrogels are examples of other potential methods which may be further enhanced by the incorporation of targeting molecules such as LTB, CTB or lectins for delivery of the antigenic protein to the mucosal immune system.
- the vaccine composition may include conventional pharmaceutically acceptable carriers, excipients, fillers, coatings, dispersion media, antibacterial or antifungal agents, and buffers or diluents as appropriate.
- a vaccine composition to a subject, including but not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, sub-lingual, buccal and oral administration. These routes of administration are particularly useful for vaccination.
- the present invention provides a nucleic acid molecule including a nucleotide sequence encoding a chimeric or fusion protein as broadly described above, optionally operatively linked to at least one regulatory element.
- the nucleic acid is provided in isolated or substantially purified form.
- the nucleic acid molecule may, for example, be inserted into a suitable expression vector for production of the chimeric protein as a recombinant protein by insertion of the expression vector into a prokaryotic or eukaryotic host cell.
- Successful expression of the recombinant protein requires that the expression vector contains the necessary regulatory elements for transcription and translation which are compatible with, and recognised by the particular host cell system used for expression.
- a variety of host cell systems may be utilized to express the recombinant protein, which include, but are not limited to bacteria transformed with a bacteriophage vector, plasmid vector, or cosmid DNA; yeast containing yeast vectors; fungi containing fungal vectors; insect cell lines infected with virus (e.g.
- baculovirus and mammalian cell lines transfected with plasmid or viral expression vectors, or infected with recombinant virus (e.g. vaccinia virus, adenovirus, adeno-associated virus, retrovirus, etc).
- recombinant virus e.g. vaccinia virus, adenovirus, adeno-associated virus, retrovirus, etc.
- various promoters and enhancers can be incorporated into the expression vector, to increase the expression of the recombinant protein, provided that the increased expression of the amino acid sequences is compatible with (for example, non-toxic to) the particular host cell system used.
- promoter will depend on the expression system used. Promoters vary in strength, i.e. ability to facilitate transcription. Generally, it is desirable to use a strong promoter in order to obtain a high level of transcription of the coding nucleotide sequence and expression into recombinant protein. For example, bacterial, phage, or plasmid promoters known in the art from which a high level of transcription have been observed in a host cell system including E.
- coli include the lac promoter, trp promoter, recA promoter, ribosomal RNA promoter, the PR and P
- Enhancer sequences are DNA elements that appear to increase transcriptional efficiency in a manner relatively independent of their position and orientation with respect to a nearby coding nucleotide sequence. Thus, depending on the host cell expression vector system used, an enhancer may be placed either upstream or downstream from the inserted coding sequences to increase transcriptional efficiency.
- Other regulatory sites such as transcription or translation initiation signals, can be used to regulate the expression of the coding sequence.
- the vector may be a viral or bacterial vaccine vector, and used to provide a recombinant viral vaccine, a recombinant bacterial vaccine, a recombinant attenuated bacterial vaccine, or an inactivated recombinant viral vaccine.
- Vaccinia virus is the best known example, in the art, of an infectious virus that is engineered to express vaccine antigens derived from other organisms.
- the recombinant live vaccinia virus which is attenuated or otherwise treated so that it does not cause disease by itself, is used to immunize the host. Subsequent replication of the recombinant virus within the host provides a continual stimulation of the immune system with the vaccine antigens thereby providing long lasting immunity.
- live vaccine vectors include: adenovirus, cytomegalovirus, and preferably the poxviruses such as vaccinia [Paoletti and Panicali, U.S. Patent No. 4,603,112] and attenuated Salmonella strains [Stocker et al., U.S. Patent No. 5,210,035; 4,837,151 ; and 4,735,801; and Curtiss et al., 1988, Vaccine 6:155-160].
- Live vaccines are particularly advantageous because they continually stimulate the immune system which can confer substantially long-lasting immunity. When the immune response is protective against subsequent P. gingivalis infection, the live vaccine itself may be used in a preventive vaccine against P. gingivalis.
- the live vaccine can be based on a bacterium that is a commensal inhabitant of the oral cavity.
- This bacterium can be transformed with a vector carrying a recombinant chimeric protein and then used to colonise the oral cavity, in particular the oral mucosa. Once colonised in the oral mucosa, the expression of the recombinant protein will stimulate the mucosal associated lymphoid tissue to produce neutralising antibodies.
- nucleotide sequences encoding the chimeric proteins of this invention may be inserted into the vaccinia virus genomic DNA at a site which allows for expression of epitopes but does not negatively affect the growth or replication of the vaccinia virus vector.
- the resultant recombinant virus can be used as the immunogen in a vaccine formulation.
- the same methods can be used to construct an inactivated recombinant viral vaccine formulation except that the recombinant virus is inactivated, such as by chemical means known in the art, prior to use as an immunogen and without substantially affecting the
- the inactivated recombinant-vaccine may be formulated with a suitable adjuvant in order to enhance the immunological response to the vaccine antigens.
- the invention also provides for the use of a nucleic acid molecule including a nucleotide sequence encoding a chimeric or fusion protein of this invention directly as the vaccine formulation.
- Nucleotide sequences encoding the chimeric proteins, operatively linked to one or more regulatory elements, can be introduced directly to vaccinate an individual ("direct gene transfer") against pathogenic strains of P. gingivalis.
- Direct gene transfer into a vaccinated individual, resulting in expression of the genetic material by the vaccinated individual's cells such as vascular endothelial cells as well as the tissue of the major organs, has been demonstrated by techniques in the art such as by injecting intravenously an expression plasmid ationic liposome complex [Zhu er a/., 1993, Science 261 :209-211].
- Other effective methods for delivering vector DNA into a target cell are known in the art.
- purified recombinant plasmid DNA containing viral genes has been used to inoculate (whether parenterally, mucosally, or via gene- gun immunization) vaccines to induce a protective immune response [Fynan et al.
- cells removed from an individual can be transfected or electroporated by standard procedures known in the art, resulting in the introduction of the recombinant vector DNA intro the target cell.
- Cells containing the recombinant vector DNA may then be selected for using methods known in the art, such as by use of a selection marker expressed in the vector, and the selected cells may then be re-introduced into the individual to express the recombinant protein.
- compositions including an antimicrobial agent and immunogen as described above.
- the composition may further include diluent, excipient, or carrier or chemotherapeutic agent for treatment of a condition or disease associated with oral infection and may be adapted for oral administration.
- the compositions of this invention may be incorporated in lozenges, or in chewing gum or other products, e.g. by stirring into a warm gum base or coating the outer surface of a gum base, illustrative of which are jelutong, rubber latex, vinylite resins, etc., desirably with conventional plasticizers or softeners, sugar or other sweeteners or such as glucose, sorbitol and the like.
- An oral composition of this invention which contains the above-mentioned pharmaceutical composition may be prepared and used in various forms applicable to the mouth such as dentifrice including toothpastes, toothpowders and liquid dentifrices, mouthwashes, troches, chewing gums, dental pastes, gingival massage creams, gargle tablets, dairy products and other foodstuffs.
- An oral composition according to this invention may further include additional well known ingredients depending on the type and form of a particular oral composition.
- the oral composition may be substantially liquid in character, such as a mouthwash or rinse.
- the vehicle is typically a water-alcohol mixture desirably including a humectant as described below.
- the weight ratio of water to alcohol is in the range of from about 1 :1 to about 20:1.
- the total amount of water-alcohol mixture in this type of preparation is typically in the range of from about 70 to about 99.9% by weight of the preparation.
- the alcohol is typically ethanol or isopropanol. Ethanol is preferred.
- the pH of such liquid and other preparations of the invention is generally in the range of from about 5 to about 9 and typically from about 5.0 to 7.0.
- the pH can be controlled with acid (e.g. citric acid or benzoic acid) or base (e.g. sodium hydroxide) or buffered (as with sodium citrate, benzoate, carbonate, or bicarbonate, disodium hydrogen phosphate, sodium dihydrogen phosphate, etc).
- acid e.g. citric acid or benzoic acid
- base e.g. sodium hydroxide
- buffered as with sodium citrate, benzoate, carbonate, or bicarbonate, disodium hydrogen phosphate, sodium dihydrogen phosphate, etc.
- the pharmaceutical composition may be substantially solid or pasty in character, such as toothpowder, a dental tablet or a toothpaste (dental cream) or gel dentifrice.
- the vehicle of such solid or pasty oral preparations generally contains dentally acceptable polishing material.
- the liquid vehicle may comprise water and humectant typically in an amount ranging from about 10% to about 80% by weight of the preparation.
- humectant typically in an amount ranging from about 10% to about 80% by weight of the preparation.
- Glycerine, propylene glycol, sorbitol and polypropylene glycol exemplify suitable humectants/carriers.
- liquid mixtures of water, glycerine and sorbitol are particularly advantageous. In clear gels where the refractive index is an important consideration, about 2.5 - 30% w/w of water, 0 to about 70% w/w of glycerine and about 20-80% w/w of sorbitol are preferably employed.
- Toothpaste, creams and gels typically contain a natural or synthetic thickener or gelling agent in proportions of about 0.1 to about 10, preferably about 0.5 to about 5% w/w.
- a suitable thickener is synthetic hectorite, a synthetic colloidal magnesium alkali metal silicate complex clay available for example as Laponite (e.g. CP, SP 2002, D) marketed by Laporte Industries Limited.
- Laponite D is, approximately by weight 58.00% Si0 2 , 25.40% MgO, 3.05% Na 2 0, 0.98% Li 2 0, and some water and trace metals. Its true specific gravity is 2.53 and it has an apparent bulk density of 1.0 g/ml at 8% moisture.
- thickeners include Irish moss, iota carrageenan, gum tragacanth, starch, polyvinylpyrrolidone, hydroxyethylpropylcellulose, hydroxybutyl methyl cellulose, hydroxypropyl methyl cellulose, hydroxyethyl cellulose (e.g. available as Natrosol), sodium carboxymethyl cellulose, and colloidal silica such as finely ground Syloid (e.g. 244).
- Irish moss iota carrageenan
- gum tragacanth starch
- polyvinylpyrrolidone hydroxyethylpropylcellulose
- hydroxybutyl methyl cellulose hydroxypropyl methyl cellulose
- sodium carboxymethyl cellulose hydroxyethyl cellulose
- colloidal silica such as finely ground Syloid (e.g. 244).
- Solubilizing agents may also be included such as humectant polyols such propylene glycol, dipropylene glycol and hexylene glycol, cellosolves such as methyl cellosolve and ethyl cellosolve, vegetable oils and waxes containing at least about 12 carbons in a straight chain such as olive oil, castor oil and petrolatum and esters such as amyl acetate, ethyl acetate and benzyl benzoate.
- humectant polyols such propylene glycol, dipropylene glycol and hexylene glycol
- cellosolves such as methyl cellosolve and ethyl cellosolve
- vegetable oils and waxes containing at least about 12 carbons in a straight chain such as olive oil, castor oil and petrolatum and esters such as amyl acetate, ethyl acetate and benzyl benzoate.
- a bottle of mouth rinse will have a label describing it, in substance, as a mouth rinse or mouthwash and having directions for its use; and a toothpaste, cream or gel will usually be in a collapsible tube, typically aluminium, lined lead or plastic, or other squeeze, pump or pressurized dispenser for metering out the contents, having a label describing it, in substance, as a toothpaste, gel or dental cream.
- Organic surface-active agents may be used in the compositions of the present invention to achieve increased prophylactic action, assist in achieving thorough and complete dispersion of the active agent throughout the oral cavity, and render the instant compositions more cosmetically acceptable.
- the organic surface-active material is preferably anionic, non-ionic or ampholytic in nature and preferably does not interact with the active agent. It is preferred to employ as the surface-active agent a detersive material which imparts to the composition detersive and foaming properties.
- anionic surfactants are water-soluble salts of higher fatty acid monoglyceride monosulfates, such as the sodium salt of the monosulfated monoglyceride of hydrogenated coconut oil fatty acids, higher alkyl sulfates such as sodium lauryl sulfate, alkyl aryl sulfonates such as sodium dodecyl benzene sulfonate, higher alkylsulfo-acetates, higher fatty acid esters of 1 ,2-dihydroxy propane sulfonate, and the substantially saturated higher aliphatic acyl amides of lower aliphatic amino carboxylic acid compounds, such as those having 12 to 16 carbons in the fatty acid, alkyl or acyl radicals, and the like.
- Examples of the last mentioned amides are N-lauroyl sarcosine, and the sodium, potassium, and ethanolamine salts of N-lauroyl, N-myristoyl, or N-palmitoyl sarcosine which should be substantially free from soap or similar higher fatty acid material.
- Examples of water-soluble non-ionic surfactants suitable for use are condensation products of ethylene oxide with various reactive hydrogen-containing compounds reactive therewith having long hydrophobic chains (e.g.
- condensation products contain hydrophilic polyoxyethylene moieties, such as condensation products of poly (ethylene oxide) with fatty acids, fatty alcohols, fatty amides, polyhydric alcohols (e.g. sorbitan monostearate) and polypropyleneoxide (e.g. Pluronic materials).
- the surface active agent is typically present in amount of about 0.1-5% by weight. It is noteworthy, that the surface active agent may assist in the dissolving of the active agent of the invention and thereby diminish the amount of solubilizing humectant needed.
- Various other materials may be incorporated in the oral preparations of this invention such as whitening agents, preservatives, silicones, chlorophyll compounds and/or ammoniated material such as urea, diammonium phosphate, and mixtures thereof.
- whitening agents such as whitening agents, preservatives, silicones, chlorophyll compounds and/or ammoniated material such as urea, diammonium phosphate, and mixtures thereof.
- flavouring or sweetening material may also be employed.
- suitable flavouring constituents are flavouring oils, e.g. oil of spearmint, peppermint, wintergreen, sassafras, clove, sage, eucalyptus, marjoram, cinnamon, lemon, and orange, and methyl salicylate.
- suitable sweetening agents include sucrose, lactose, maltose, sorbitol, xylitol, sodium cyclamate, perillartine, AMP (aspartyl phenyl alanine, methyl ester), saccharine, and the like.
- flavour and sweetening agents may each or together comprise from about 0.1% to 5% more of the preparation.
- compositions intended for oral use may be prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavouring agents, colouring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
- Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
- excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example magnesium stearate, stearic acid or talc.
- the tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract or periodontal pocket and thereby provide a sustained action over a longer period.
- a time delay material such as glyceryl monostearate or glyceryl distearate may be employed.
- Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
- an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
- water or an oil medium for example peanut oil, liquid paraffin or olive oil.
- Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions.
- excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monoole
- the aqueous suspensions may also contain one or more preservatives or antimicrobial agents, for example benzoates, such as ethyl, or n-propyl p-hydroxybenzoate another example is chlorhexidine gluconate, one or more colouring agents, one or more flavouring agents, and one or more sweetening agents, such as sucrose or saccharin.
- preservatives or antimicrobial agents for example benzoates, such as ethyl, or n-propyl p-hydroxybenzoate another example is chlorhexidine gluconate, one or more colouring agents, one or more flavouring agents, and one or more sweetening agents, such as sucrose or saccharin.
- Oily suspensions may be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
- the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavouring agents may be added to provide palatable oral preparations. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
- kits for immunising said subject against a microbial pathogen, the presence of which in oral tissue is associated with a disease or condition; said kit being adapted for use in the above described methods.
- the kit may include:
- kits when used in a method or use described herein.
- the kit may contain one or more further active principles or ingredients for treatment of a disease or condition.
- the kit may comprise a container and a label or package insert on or associated with the container.
- Suitable containers include, for example, bottles, vials, syringes, blister pack, etc.
- the containers may be formed from a variety of materials such as glass or plastic.
- the container holds a therapeutic composition which is effective for treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- the label or package insert indicates that the therapeutic composition is used for treating the condition of choice.
- the label or package insert includes instructions for use and indicates that the therapeutic composition can be used for treatment of the given disease or condition.
- the kit may comprise (a) a therapeutic composition; and (b) a second container with a second active principle or ingredient contained therein.
- the kit in this embodiment of the invention may further comprise a package insert indicating that the and other active principle can be used to treat a disorder or prevent a complication stemming from a given infection.
- the kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
- BWFI bacteriostatic water for injection
- Cells were harvested during exponential growth phase by centrifugation (7500 g, 30 min, 4°C) and washed twice with PG buffer (50 mM Tris-HCI, 150 mM NaCI, 5 mM CaCI 2 , and 5 mM cysteine-HCI, pH 8.0) in the anaerobic workstation. Growth of batch cultures was monitored at 650 nm using a spectrophotometer (model 295E, Perkin-Elmer). Culture purity was checked routinely by Gram stain, microscopic examination and using a variety of biochemical tests according to Slots (2).
- Kgp residues representing peptides and chimeric peptides of the active site (AS) and KgpA1 adhesin (A1) domains were over-expressed in E. coli as recombinant (r) proteins with hexa-His tags using pET expression vectors (Novagen).
- the r-proteins expressed were rKAS2, and rKLA1 and the r-chimeric proteins were rKAS2-KLA1 , rKAS1-KsA1 and rKAS4- KAS3-KAS5-KAS6-KLA1 (also referred to as multiKAS-KLA1).
- the amino acid sequences representing the various A1 and AS domains are described in Tables 1 and 2.
- the various KAS and KA1 domains of the kgp gene were amplified from pNS1 (3.5 kb BamHI lys fragment in pUC18) or P. gingivalis genomic DNA respectively using primers listed in Table 4, Taq DNA polymerase (Invitrogen) and a PC-960 thermal cycler (Corbett Research Technologies).
- Primer pairs KAS2-FOR and KAS2-REV and KLA1- FOR and KLA1-REV were used to generate PCR fragments encoding KAS2 and KLA1 respectively using the following reaction conditions: 94°C, 3 minutes, followed by 28 cycles of 94°C, 45 sec (denaturing); 62°C, 40 seconds (annealing) and 72°C, 20 seconds (extension) followed by a final cycle of 72°C, 5 min.
- the KAS2-KLA1 chimeric PCR product was produced by gene splicing by overlap extension (SOEing) as follows: PCR products were produced using primer pairs KAS2- FOR and KAS2-KLA1 -chimera-REV and KAS2-KLA1 -chimera-FOR and KLA1-REV using the conditions described above. The PCR products were then annealed and a final PCR was performed with primers KAS2-FOR and KLA1-REV (94°C, 2 minutes, followed by 28 cycles of 94°C, 30 sec; 50°C, 30 seconds and 72°C, 40 seconds followed by a final cycle of 72°C, 5 min.
- SOEing overlap extension
- KAS1-KsA1 PCR product For the preparation of the KAS1-KsA1 PCR product, two successive PCRs were conducted using the KAS1-KsA1-REV primer with each of the KAS1-KsA1-FOR primers 1 and, 2 in succession (reaction conditions 94°C for 2 minutes followed by 35 cycles of 94°C, 15 seconds ; 63°C, 30 seconds and 72°C, 2 minutes) to produce the KAS1-KsA1 PCR product.
- the KAS1-KsA1-FOR1 and KAS1-KsA1-FOR2 primers contain an 3'extension overlapping the 5' of the previous PCR product.
- each of the multi-FOR primers 1 , 2, 3 and 4 was conducted using the multi-REV primer with each of the multi-FOR primers 1 , 2, 3 and 4 in succession (reaction conditions were 95°C, 2 minutes followed by 35 cycles of 95°C, 20 seconds; 68°C, 1.5 minutes) to produce the multiKAS-KLA1 PCR product.
- Each multi-FOR primer contains a 3'extension overlapping the 5' of the previous PCR product.
- the recombinant pET28 constructs were purified and transformed into the E. coli expression host, BL21 (DE3) [HMS174(DE3)] (Novagen) and selected on LB containing 50 ⁇ g kanamycin following the manufacturer's instructions. The integrity of each insert was confirmed by DNA sequence analysis.
- the oligonucleotide primers (Table 4) have been designed to incorporate restriction enzyme sites, stop codons and hexa-His Tags where necessary.
- the primers used for the rKAS2, rKLA1 and rKAS2-KLA1 were designed to limit the inclusion of extraneous coding sequence to no more than three amino acids plus the hexa-his tag in r-proteins.
- the rKAS1 and the rKLA1 were designed to contain a hexa-His tag at the N-terminal and C-terminal ends respectively, so that they may be directly compared to the rKAS2- KLA1 which has a hexa-his tag at both N- and C-termini.
- the His Tags are found at the C-termini.
- CTATACA SEQ ID NO: 56
- multi- C I I I GCAAACTATACAGCGCATG KAS3 (nt 2006-2057) FOR2 GATCTGAGACCGCATGGGCTGAT
- CCACTT (SEQ ID NO: 57) multi- ATGGGCTGATCCACTTCTGAATT KAS3 (nt 2042-2060)-KAS5 (nt FOR3 CTTATTGGGGCGAGATCGGCAAT 2223-2240)-KAS6 (nt 2403- ATTACC (SEQ ID NO: 58) 2417) multi- GATCGGCAATATTACCCATATTG G-KAS6 (nt 2403-2435)-GCT FOR4 GTGCTCATTACGCTTGGGGAGAC (Ala spacer)-A1(nt 2946-2960)
- Recombinant proteins were expressed from pET28::KLA1(KAS2, KAS2-LA1 , KAS1-SA1 , multiKAS-KLA1) constructs by induction with isopropyl ⁇ -D-thiogalactosidase (IPTG). All recombinant proteins were produced as 6-His Tag fusion proteins and purified with NI-NTA purification system (Invitrogen) under denaturing conditions. Briefly, E. coli (DE3) single colony transformants were used to inoculate 20 ml_ of Luria-Bertani (LB) broth containing 50 ⁇ g/ml kanamycin at 37°C on an orbital shaker overnight.
- LB Luria-Bertani
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2012136724A RU2617399C2 (ru) | 2010-02-26 | 2011-02-25 | Лечение или профилактика инфекции |
| MX2012009730A MX342832B (es) | 2010-02-26 | 2011-02-25 | Tratamiento o prevencion de una infeccion. |
| BR112012021383A BR112012021383A2 (pt) | 2010-02-26 | 2011-02-25 | tratamento ou prevencao de infeccao |
| NZ601890A NZ601890A (en) | 2010-02-26 | 2011-02-25 | Treatment or prevention of infection |
| AU2011220335A AU2011220335B2 (en) | 2010-02-26 | 2011-02-25 | Treatment or prevention of infection |
| KR1020177026249A KR20170109685A (ko) | 2010-02-26 | 2011-02-25 | 감염 치료 또는 예방 |
| US13/580,090 US9125853B2 (en) | 2010-02-26 | 2011-02-25 | Treatment or prevention of infection |
| EP11746760.5A EP2538970A4 (en) | 2010-02-26 | 2011-02-25 | TREATMENT OR PREVENTION OF INFECTION |
| CN2011800183736A CN102883744A (zh) | 2010-02-26 | 2011-02-25 | 感染的治疗和预防 |
| SG2012061099A SG183376A1 (en) | 2010-02-26 | 2011-02-25 | Treatment or prevention of infection |
| KR1020127022892A KR20130036185A (ko) | 2010-02-26 | 2011-02-25 | 감염 치료 또는 예방 |
| JP2012554168A JP5977677B2 (ja) | 2010-02-26 | 2011-02-25 | 感染の処置又は防止 |
| CA2790219A CA2790219C (en) | 2010-02-26 | 2011-02-25 | Treatment or prevention of infection |
| ZA2012/06204A ZA201206204B (en) | 2010-02-26 | 2012-08-17 | Treatment or prevention of infection |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2010900846 | 2010-02-26 | ||
| AU2010900846A AU2010900846A0 (en) | 2010-02-26 | Treatment or prevention of infection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011103633A1 true WO2011103633A1 (en) | 2011-09-01 |
Family
ID=44506081
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2011/000206 Ceased WO2011103633A1 (en) | 2010-02-26 | 2011-02-25 | Treatment or prevention of infection |
Country Status (17)
| Country | Link |
|---|---|
| US (1) | US9125853B2 (enExample) |
| EP (2) | EP3260135A1 (enExample) |
| JP (1) | JP5977677B2 (enExample) |
| KR (2) | KR20170109685A (enExample) |
| CN (2) | CN102883744A (enExample) |
| AU (1) | AU2011220335B2 (enExample) |
| BR (1) | BR112012021383A2 (enExample) |
| CA (1) | CA2790219C (enExample) |
| HK (1) | HK1248535A1 (enExample) |
| MX (1) | MX342832B (enExample) |
| MY (1) | MY162557A (enExample) |
| NZ (1) | NZ601890A (enExample) |
| RU (1) | RU2617399C2 (enExample) |
| SG (2) | SG10201500976XA (enExample) |
| TW (1) | TWI583392B (enExample) |
| WO (1) | WO2011103633A1 (enExample) |
| ZA (1) | ZA201206204B (enExample) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2443143A4 (en) * | 2009-06-19 | 2013-09-11 | Oral Health Australia Pty Ltd | CASEIN-DERIVED PROTEASE-INHIBITING FIBERS |
| WO2016061264A1 (en) * | 2014-10-14 | 2016-04-21 | The Forsyth Institute | Conjugates for delivery to mitochondria |
| WO2017102927A1 (en) * | 2015-12-15 | 2017-06-22 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Vaccination against diabetes, obesity and complications thereof |
| US10851138B2 (en) | 2008-08-29 | 2020-12-01 | Oral Health Australia Pty Ltd | Methods of preparing P. gingivalis antibodies |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8513305B2 (en) | 2007-05-14 | 2013-08-20 | Research Foundation Of State University Of New York | Induction of a physiological dispersion response in bacterial cells in a biofilm |
| KR101587113B1 (ko) * | 2014-10-29 | 2016-01-20 | 경북대학교 산학협력단 | 치주염 유발 장알균(Enterococcus faecalis)을 특이적으로 사멸시키는 신규한 박테리오파지 |
| US11541105B2 (en) | 2018-06-01 | 2023-01-03 | The Research Foundation For The State University Of New York | Compositions and methods for disrupting biofilm formation and maintenance |
| BR112021018010A2 (pt) | 2019-03-13 | 2021-11-23 | Univ Melbourne | Composições e métodos para promover mineralização |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040005276A1 (en) * | 1997-04-30 | 2004-01-08 | Reynolds Eric Charles | Synthetic peptide constructs for the diagnosis and treatment of periodontitis associated with porphyromonas gingivalis |
| WO2005019249A2 (en) * | 2003-08-15 | 2005-03-03 | University Of Florida | Identification of porphyromonas gingivalis virulence polynucleotides for diagnosis, treatment, and monitoring of periodontal diseases |
| WO2006032104A1 (en) * | 2004-09-23 | 2006-03-30 | The University Of Melbourne | Antigenic complex for the diagnosis and treatment of porphyromonas gingivalis infection |
Family Cites Families (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4837151A (en) | 1980-05-19 | 1989-06-06 | The Board Of Trustees Of The Leland Stanford Junior University, Stanford University | Live vaccines comprising two mutations and foreign antigen |
| US4735801A (en) | 1982-09-07 | 1988-04-05 | Board Of Trustees Of Leland Stanford Jr. University | Novel non-reverting salmonella live vaccines |
| US5210035A (en) | 1980-05-19 | 1993-05-11 | Board Of Trustees Of Leland Stanford Jr. University | Non-reventing live vaccines |
| US4603112A (en) | 1981-12-24 | 1986-07-29 | Health Research, Incorporated | Modified vaccinia virus |
| JPH07503715A (ja) | 1992-01-30 | 1995-04-20 | コルバス・インターナショナル、インコーポレイテッド | トリプシンインヒビター |
| JPH0797395A (ja) | 1993-09-28 | 1995-04-11 | Kyowa Medex Co Ltd | ポルフイロモナス・ジンジバリス線毛蛋白質の配列を含有するペプチド類及びその用途 |
| AUPN627595A0 (en) | 1995-10-30 | 1995-11-23 | University Of Melbourne, The | Diagnostics and treatments of periodontal disease |
| AUPP893999A0 (en) | 1999-03-01 | 1999-03-25 | Csl Limited | Synthetic peptides containing protective epitopes for the treatment and prevention of periodontitis associated with porphyromonas gingivalis |
| AUPQ485999A0 (en) | 1999-12-24 | 2000-02-03 | Csl Limited | P. gingivalis antigenic composition |
| US8283135B2 (en) * | 2000-06-30 | 2012-10-09 | The Procter & Gamble Company | Oral care compositions containing combinations of anti-bacterial and host-response modulating agents |
| GB0114185D0 (en) | 2001-06-12 | 2001-08-01 | Protherics Molecular Design Lt | Compounds |
| GB2370838A (en) | 2001-01-06 | 2002-07-10 | Benedikt Timmerman | Immunogenic complex |
| CA2490129A1 (en) | 2002-06-26 | 2004-01-08 | Entremed, Inc. | Compositions and methods comprising protein activated receptor antagonists |
| US20070036734A1 (en) | 2003-03-17 | 2007-02-15 | Kirin Beer Kabushiki Kaisha | Therapeutic agent for periodontal disease |
| WO2005016249A2 (en) * | 2003-07-11 | 2005-02-24 | Pharmacia Corporation | Compositions of a chromene or phenyl acetic acid cyclooxygenase-2 selective inhibitor and an ace inhibitor for the treatment of central nervous system damage |
| GB0411150D0 (en) | 2004-05-19 | 2004-06-23 | Queen Mary & Westfield College | Vaccine |
| JP2008510726A (ja) | 2004-08-20 | 2008-04-10 | エントレメッド インコーポレイテッド | プロテイナーゼ活性化受容体アンタゴニストを含む組成物および方法 |
| US7888482B2 (en) | 2006-02-10 | 2011-02-15 | Amgen Inc. | Antibodies that bind PAR-2 |
| EP2038297A4 (en) | 2006-06-27 | 2010-03-03 | Oral Health Australia Pty Ltd | PORPHYROMONAS GINGIVALIS POLYPEPTIDES SUITABLE FOR PREVENTION OF PERIODONTITIS |
| WO2009006699A1 (en) | 2007-07-12 | 2009-01-15 | Oral Health Australia Pty Ltd | Biofilm treatment |
| RU2366378C1 (ru) * | 2008-04-07 | 2009-09-10 | Сергей Владимирович Сирак | Способ костной пластики при непосредственной дентальной имплантации |
| RU2012107993A (ru) | 2009-08-02 | 2013-09-10 | Санофи Пастер Лимитид | Полипептиды porhyromonas gingivalis |
-
2011
- 2011-02-23 MY MYPI2012003796A patent/MY162557A/en unknown
- 2011-02-25 MX MX2012009730A patent/MX342832B/es active IP Right Grant
- 2011-02-25 SG SG10201500976XA patent/SG10201500976XA/en unknown
- 2011-02-25 RU RU2012136724A patent/RU2617399C2/ru not_active IP Right Cessation
- 2011-02-25 AU AU2011220335A patent/AU2011220335B2/en active Active
- 2011-02-25 CN CN2011800183736A patent/CN102883744A/zh active Pending
- 2011-02-25 CN CN201510084917.9A patent/CN104689308B/zh active Active
- 2011-02-25 BR BR112012021383A patent/BR112012021383A2/pt not_active Application Discontinuation
- 2011-02-25 SG SG2012061099A patent/SG183376A1/en unknown
- 2011-02-25 JP JP2012554168A patent/JP5977677B2/ja active Active
- 2011-02-25 KR KR1020177026249A patent/KR20170109685A/ko not_active Ceased
- 2011-02-25 KR KR1020127022892A patent/KR20130036185A/ko not_active Ceased
- 2011-02-25 TW TW100106637A patent/TWI583392B/zh not_active IP Right Cessation
- 2011-02-25 EP EP17167876.6A patent/EP3260135A1/en not_active Withdrawn
- 2011-02-25 WO PCT/AU2011/000206 patent/WO2011103633A1/en not_active Ceased
- 2011-02-25 NZ NZ601890A patent/NZ601890A/en not_active IP Right Cessation
- 2011-02-25 EP EP11746760.5A patent/EP2538970A4/en not_active Withdrawn
- 2011-02-25 US US13/580,090 patent/US9125853B2/en active Active
- 2011-02-25 CA CA2790219A patent/CA2790219C/en active Active
-
2012
- 2012-08-17 ZA ZA2012/06204A patent/ZA201206204B/en unknown
-
2018
- 2018-06-26 HK HK18108159.0A patent/HK1248535A1/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040005276A1 (en) * | 1997-04-30 | 2004-01-08 | Reynolds Eric Charles | Synthetic peptide constructs for the diagnosis and treatment of periodontitis associated with porphyromonas gingivalis |
| WO2005019249A2 (en) * | 2003-08-15 | 2005-03-03 | University Of Florida | Identification of porphyromonas gingivalis virulence polynucleotides for diagnosis, treatment, and monitoring of periodontal diseases |
| WO2006032104A1 (en) * | 2004-09-23 | 2006-03-30 | The University Of Melbourne | Antigenic complex for the diagnosis and treatment of porphyromonas gingivalis infection |
Non-Patent Citations (5)
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10851138B2 (en) | 2008-08-29 | 2020-12-01 | Oral Health Australia Pty Ltd | Methods of preparing P. gingivalis antibodies |
| US11572391B2 (en) | 2008-08-29 | 2023-02-07 | Oral Health Australia Pty Ltd | Antibodies for prevention, treatment and diagnosis of P. gingivalis infection |
| EP2443143A4 (en) * | 2009-06-19 | 2013-09-11 | Oral Health Australia Pty Ltd | CASEIN-DERIVED PROTEASE-INHIBITING FIBERS |
| EP2821414A1 (en) * | 2009-06-19 | 2015-01-07 | Oral Health Australia Pty Ltd | Kappa casein fragments inhibiting gingipains |
| WO2016061264A1 (en) * | 2014-10-14 | 2016-04-21 | The Forsyth Institute | Conjugates for delivery to mitochondria |
| WO2017102927A1 (en) * | 2015-12-15 | 2017-06-22 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Vaccination against diabetes, obesity and complications thereof |
| US10925951B2 (en) | 2015-12-15 | 2021-02-23 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Vaccination against diabetes, obesity and complications thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2011220335A1 (en) | 2012-09-06 |
| AU2011220335B2 (en) | 2015-04-02 |
| JP2013520448A (ja) | 2013-06-06 |
| MY162557A (en) | 2017-06-15 |
| JP5977677B2 (ja) | 2016-08-24 |
| TWI583392B (zh) | 2017-05-21 |
| HK1248535A1 (en) | 2018-10-19 |
| NZ601890A (en) | 2015-01-30 |
| MX342832B (es) | 2016-10-14 |
| RU2012136724A (ru) | 2014-04-10 |
| US9125853B2 (en) | 2015-09-08 |
| US20130129768A1 (en) | 2013-05-23 |
| CA2790219A1 (en) | 2011-09-01 |
| SG10201500976XA (en) | 2015-04-29 |
| EP2538970A4 (en) | 2013-12-18 |
| MX2012009730A (es) | 2013-02-07 |
| CA2790219C (en) | 2020-06-30 |
| SG183376A1 (en) | 2012-09-27 |
| RU2617399C2 (ru) | 2017-04-24 |
| CN104689308B (zh) | 2020-10-20 |
| ZA201206204B (en) | 2013-05-29 |
| CN104689308A (zh) | 2015-06-10 |
| KR20130036185A (ko) | 2013-04-11 |
| BR112012021383A2 (pt) | 2017-07-25 |
| CN102883744A (zh) | 2013-01-16 |
| EP3260135A1 (en) | 2017-12-27 |
| TW201138813A (en) | 2011-11-16 |
| KR20170109685A (ko) | 2017-09-29 |
| EP2538970A1 (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11572391B2 (en) | Antibodies for prevention, treatment and diagnosis of P. gingivalis infection | |
| HK1248535A1 (en) | Treatment or prevention of infection | |
| AU2011220335A2 (en) | Treatment or prevention of infection | |
| HK1157357A (en) | Prevention, treatment and diagnosis of p.gingivalis infection | |
| HK1157357B (en) | Prevention, treatment and diagnosis of p.gingivalis infection | |
| AU2013203249A1 (en) | Prevention, treatment and diagnosis of P.gingivalis infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201180018373.6 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11746760 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011220335 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2790219 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13580090 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2012/009730 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012554168 Country of ref document: JP Ref document number: 221599 Country of ref document: IL |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20127022892 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2011220335 Country of ref document: AU Date of ref document: 20110225 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2011746760 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012136724 Country of ref document: RU Ref document number: 2011746760 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012021383 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112012021383 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112012021383 Country of ref document: BR Kind code of ref document: A2 Effective date: 20120824 |