WO2011062615A1 - Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells - Google Patents

Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells Download PDF

Info

Publication number
WO2011062615A1
WO2011062615A1 PCT/US2010/002980 US2010002980W WO2011062615A1 WO 2011062615 A1 WO2011062615 A1 WO 2011062615A1 US 2010002980 W US2010002980 W US 2010002980W WO 2011062615 A1 WO2011062615 A1 WO 2011062615A1
Authority
WO
WIPO (PCT)
Prior art keywords
polysaccharide
galnac
oligo
coli
und
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/002980
Other languages
English (en)
French (fr)
Inventor
Michael Wacker
Charles Waechter
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Glycovaxyn AG
Original Assignee
Glycovaxyn AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US13/510,859 priority Critical patent/US8846342B2/en
Priority to ES10831896.5T priority patent/ES2660227T3/es
Priority to EP10831896.5A priority patent/EP2501406B8/en
Priority to HRP20180338TT priority patent/HRP20180338T1/hr
Priority to CN201080061239.XA priority patent/CN102724997B/zh
Priority to CA2780487A priority patent/CA2780487C/en
Priority to SI201031641T priority patent/SI2501406T1/en
Priority to NO10831896A priority patent/NO2501406T3/no
Priority to LTEP10831896.5T priority patent/LT2501406T/lt
Priority to JP2012539870A priority patent/JP5968784B2/ja
Priority to PL10831896T priority patent/PL2501406T3/pl
Priority to AU2010322454A priority patent/AU2010322454B2/en
Application filed by Glycovaxyn AG filed Critical Glycovaxyn AG
Priority to DK10831896.5T priority patent/DK2501406T3/en
Priority to KR1020127015728A priority patent/KR101855380B1/ko
Publication of WO2011062615A1 publication Critical patent/WO2011062615A1/en
Priority to IL219733A priority patent/IL219733A/en
Anticipated expiration legal-status Critical
Priority to US14/462,261 priority patent/US9764018B2/en
Priority to CY20181100264T priority patent/CY1119995T1/el
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/025Enterobacteriales, e.g. Enterobacter
    • A61K39/0258Escherichia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/025Enterobacteriales, e.g. Enterobacter
    • A61K39/0283Shigella
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/385Haptens or antigens, bound to carriers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/646Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the entire peptide or protein drug conjugate elicits an immune response, e.g. conjugate vaccines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031Proteins
    • A61K2039/6068Other bacterial proteins, e.g. OMP
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the use of a biosynthetic system and proteins for preparing a vaccine.
  • the invention relates to a recombinant prokaryotic biosynthetic system having an epimerase that initiates the synthesis of an oligo- or polysaccharide with a specified monosaccharide at the reducing terminus.
  • the invention further relates to N-glycosylated proteins produced with glycans in an expression system and bioconjugate vaccines made from said N- glycosylated proteins comprising immunogenic glycans, and provides methods for producing N-glycosylated proteins.
  • Glycoproteins are proteins that have one or more covalently attached sugar polymers. N-linked protein glycosylation is an essential and conserved process occurring in the endoplasmic reticulum of eukaryotic organisms. It is important for protein folding, oligomerization, stability, quality control, sorting and transport of secretory and membrane proteins (Helenius, A., and Aebi, M. (2004). Roles of ⁇ -linked glycans in the endoplasmic reticulum. Annu. Rev. Biochem. 73, 1019-1049).
  • glycosylation can assist the purification of proteins by chromatography, e.g. affinity
  • N-glycans have a glycan attached to a consensus sequence in a protein.
  • the known N-glycosylation consensus sequence in a protein allows for the N-glycosylation of recombinant target proteins in prokaryotic organisms.
  • Such organisms comprise an oligosaccharyl transferase ("OT"; "OTase”), such as, for example, an oligosaccharyl transferase of C. jejuni, which is an enzyme that transfers the glycan to the consensus sequence of the protein.
  • WO 2003/07467 (Aebi et al.) teaches a prokaryotic organism into which is introduced a nucleic acid encoding for (i) specific glycosyltransferases for the assembly of an oligosaccharide on a lipid carrier, (ii) a recombinant target protein comprising a consensus sequence " ⁇ - X - S/T", wherein X can be any amino acid except proline, and (iii) an oligosaccharyl transferase, such as, for example, an oligosaccharyl transferase of C. jejuni that covalently links said oligosaccharide to the consensus sequence of the target protein.
  • Said prokaryotic organism produces N- gl yeans with a specific structure which is defined by the type of the specific glycosyltransferases.
  • N-glycans into recombinant proteins for modifying immunogenicity, stability, biological, prophylactic and/or therapeutic activity of said proteins, and the provision of a host cell that efficiently displays recombinant N-glycosylated proteins of the present invention on its surface.
  • a recombinant N- glycosylated protein comprising one or more of the following N-glycosylated optimized amino acid sequence(s):
  • D/E - X - N - Z - S/T (optimized consensus sequence), wherein X and Z may be any natural amino acid except Pro, and wherein at least one of said N-glycosylated partial amino acid sequence(s) is introduced.
  • the introduction of specific partial amino acid sequence(s) (optimized consensus sequence(s)) into proteins leads to proteins that are efficiently N- glycosylated by an oligosaccharyl transferase in these introduced positions.
  • LPS Lipopolysaccharides
  • LPS lipid undecaprenyl phosphate
  • Und-P-P carrier lipid undecaprenyl phosphate
  • the antigen is built up by sequential addition of monosaccharides from activated sugar nucleotides by different glycosyltransferases, and the lipid-linked polysaccharide is flipped through the membrane by a flippase.
  • the antigen-repeating unit is polymerized by an enzymatic reaction.
  • the polysaccharide is then transferred to the Lipid A by the Ligase WaaL forming the LPS that is exported to the surface, whereas the capsular polysaccharide is released from the carrier lipid after polymerization and exported to the surface.
  • the biosynthetic pathway of these polysaccharides enables the production of LPS bioconjugates in vivo, capturing the polysaccharides in the periplasm to a protein carrier.
  • Such synthesized complexes of oligo- or polysaccharides (i.e., sugar residues) and proteins (i.e., protein carriers) can be used as conjugate vaccines to protect against a number of bacterial infections.
  • Conjugate vaccines have been successfully used to protect against bacterial infections.
  • the conjugation of an antigenic polysaccharide to a protein carrier is required for protective memory response, as polysaccharides are T-cell independent immunogens.
  • Polysaccharides have been conjugated to protein carriers by different chemical methods, using activation reactive groups in the polysaccharide as well as the protein carrier.
  • Conjugate vaccines can be administered to children to protect against bacterial infections and also can provide a long lasting immune response to adults.
  • Constructs of WO 2009/104074 (Fernandez, et al.) have been found to generate an IgG response in animals. It has been found that an IgG response to a Shigella O-specific polysaccharide-protein conjugate vaccine in humans correlates with immune protection in humans. (Passwell, J.H. et al., "Safety and
  • E. coli 0157 is an enterohemorrhagic strain responsible for approximately two-thirds of all recent cases of hemolytic-uremic syndrome and poses serious human health concerns (Law, D. (2000) J. App. Microbiol., 88, 729-745; Wang, L., and Reeves, P. R. (1998) Infect. Immun. 66, 3545-3551).
  • Escherichia coli strain 0157 produces an O-antigen containing the repeating tetrasaccharide unit (4-N-acetyl perosamine->fucose- glucose->GalNAc) (a-D-PerNAc-cc-L-Fuc-P-D-Glc-cc-D-GalNAc) (Perry, M. B., MacLean, L. and Griffith, D. W. ( 1986) Biochem. Cell. Biol., 64, 21 -28). The tetrasaccharide is preassembled on undecaprenyl pyrophosphate. The E.
  • coli cell envelope contains an inner plasma membrane, a stress-bearing peptidoglycan layer and an asymmetric outer membrane consisting of a phospholipid inner monolayer and an outer monolayer composed of bacterial LPS.
  • LPS contains three components, the lipid A anchor, the 3-deoxy-D-manno-oct-2-ulosonic acid-containing core, and the O-antigen region (see: Raetz, C. R. H. and Whitfield, C. (2002) Annu. Rev. Biochem., 71 , 635- 700; Whitfield, C. (2006) Ann. Rev. Biochem. 75, 39-68; Samuel, G. and Reeves, P. R. (2003) Carbohydrate Research, 338, 2503-2519; and refs. therein for reviews on the assembly of O-antigens of bacterial LPS).
  • the O-antigen components of bacterial LPS are large, extremely diverse polysaccharides that can be either homopolymeric, composed of a single repeating monosaccharide, or heteropolymeric, containing 10-30 repeats of 3-6 sugar units (Reeves, P. R., Hobbs, M.., Valvano, M. A., Skurnik, M., Whitfield, C, Coplin, D., ido, N., lena, J., Maskell, D., Raetz, C. R. H., and Rick, P. D. (1996) Trends Microbiol., 4, 495-503).
  • O-antigens are, thus, the dominant feature of the bacterial cell surface and constitute important determinants of virulence and pathogenicity (Law, D. (2000) J. App. Microbiol, 88, 729-745; Spears, K. J., Roe, A. J. and Gaily, D. L. (2006) FEMS Microbiol. Lett., 255, 187-202; Liu, B., Knirel, Y. A., Feng, L., Perepelov, A. V., Senchenkova, S. N., Wang, Q., Reeves, P. R. and Wang, L (2008) FEMS Microbiol. Rev. 32, 627-653; Stenutz, R., Weintraub, A.
  • O-antigen repeat units are pre-assembled on the cytosolic face of the inner membrane attached to undecaprenyl pyrophosphate.
  • the lipid-linked repeat units diffuse transversely (flip-flop) to the periplasmic surface of the inner membrane and are polymerized before transport to the outer membrane and ligation to LPS.
  • Most heteropolymeric O-antigen repeat units have either N-acetylglucosamine (“GlcNAc”) or N-acetylgalactosamine (“GalNAc”) at the reducing terminus.
  • E. coli 055 gne and gnel genes were previously proposed to encode a UDP-GlcNAc 4-epimerase (Wang, L., Huskic, S., Cisterne, A., Rothemund, D. and Reeves, P.R. (2002) J. Bacterid. 184, 2620-2625; Guo, H., Yi, W., Li, L. and Wang, P. G. (2007) Biochem. Biophys. Res. Commun., 356, 604-609).
  • Previous reports identified two genes from E. coli 055 (Wang, L., Huskic, S., Cisterne, A., Rothemund, D. and Reeves, P.R.
  • the present invention relates to a recombinant prokaryotic biosynthetic system that produces all or a portion of a polysaccharide comprising an epimerase that synthesizes GalNAc on undecaprenyl pyrophosphate.
  • the invention further includes glycosyltransferases that synthesize all or a portion of a polysaccharide having GalNAc at the reducing terminus, and still further includes glycosyltransferases that synthesize all or a portion of an antigenic polysaccharide having GalNAc at the reducing terminus.
  • the invention is directed to an epimerase to produce GalNAc on undecaprenyl pyrophosphate, and, in a further aspect, the epimerase is encoded by the Z3206 gene.
  • the present invention is directed to an expression system for producing an /V-glycosylated protein comprising: a nucleotide sequence encoding an oligosaccharyl transferase; a nucleotide sequence encoding a protein carrier; at least one oligo- or polysaccharide gene cluster from at least one bacterium, wherein the polysaccharide contains GalNAc at the reducing terminus; and a nucleic acid sequence encoding an epimerase.
  • the instant invention is directed to a recombinant prokaryotic biosynthetic system comprising Z3206 gene which encodes an epimerase that converts GlcNAc-P-P-Und to GalNAc -P-P-Und.
  • the present invention is directed to a recombinant prokaryotic biosynthetic system comprising E. coli 055 gne gene or E. coli 086 gne J gene which encodes an epimerase that converts GlcNAc-P-P-Und to GalNAc-P-P-Und.
  • the present invention relates to an N- glycosylated protein comprising at least one introduced consensus sequence, D/E - X - N - Z - S/T, wherein X and Z can be any natural amino acid except proline, and a glycan having ⁇ -acetylgalactosamine at the reducing terminus.
  • the present invention is directed to a bioconjugate vaccine comprising an N-glycosylated protein having at least one introduced consensus sequence, D/E - X - N - Z - S/T, wherein X and Z can be any natural amino acid except proline; an immunogenic glycan having N- acetylgalactosamine at the reducing terminus; and an adjuvant.
  • the invention relates to method for producing an N-linked glycosylated protein in a host cell comprising nucleic acids encoding: glycosyltransferases that assemble at least one oligo- or polysaccharide from at least one bacterium containing GalNAc at the reducing terminus; a protein carrier; an oligosaccharyl transferase; and an epimerase.
  • the present invention relates to the use of a biosynthetic system and proteins for preparing a bioconjugate vaccine.
  • the present invention is directed to methods for producing mono-, oligo- and polysaccharides, and in a still further aspect the invention directed to methods for producing antigenic glycans and N-glycosylated proteins.
  • FIG. 1 shows the time course of [ 3 H]GlcNAc/GalNAc-P-P-Und synthesis by membrane fractions from E. coli 0157.
  • the membrane fraction from E. coli strain 0157 was incubated with UDP-[ 3 H]GlcNAc for the indicated times at 37°C.
  • the [ 3 H]lipid products were extracted and the incorporation of [ 3 H]GlcNAc into [ 3 H]GlcNAc-P-P-Und (O) and [ 3 H]GalNAc-P-P-Und ( ⁇ ) was assayed as described in Example 2.
  • FIG. 2 shows the proposed biosynthetic pathway for the formation of GalNAc-P-P-Und from GlcNAc-P-P-Und.
  • FIG. 3 shows purification and characterization of [ 3 H]GalNAc-P- P-Und synthesized by membrane fractions from E. coli strain 0157.
  • Membrane fractions from E. coli 0157 were incubated with UDP-[ 3 H]GlcNAc, and the
  • FIG. 3A preparative thin layer chromatogram of [ H]HexNAc lipids on borate-impregnated silica gel G (Quantum 1) after purification on DEAE-cellulose is shown.
  • FIG. 3B thin layer chromatography of purified [ 3 H]GalNAc-P-P-Und on borate-impregnated silica gel G (Baker, Si250) after recovery from the preparative plate in panel A is shown.
  • FIG. 3C descending paper chromatogram (borate-impregnated Whatman No.
  • FIG. 4 shows metabolic labeling of E. coli 21546 cells and E. coli 21546 cells after transformation with pMLBAD:Z3206.
  • E. coli 21546 (FIG. 4A) and E. coli 21546:pMLBAD/Z3206 (FIG. 4B) were labeled metabolically with
  • [ 3 H]GlcNAc/GalNAc-P-P-Und were extracted, freed of water soluble contaminants and separated by thin layer chromatography on borate- impregnated silica gel plates (Baker Si250) as described in Example 3. Radioactive lipids were detected using a Bioscan chromatoscanner. The chromatographic positions of GalNAc-P-P-Und and GlcNAc-P-P-Und are indicated by arrows.
  • FIG. 5 shows thin layer chromatography of [ 3 H]GlcNAc/GalNAc- P-P-Und formed by incubation of membrane fractions from E. coli strains with UDP- [ 3 H]GlcNAc.
  • Membrane fractions from E. coli strains K12 (FIG. 5A), 0157 (FIG. 5B), 21546 (FIG. 5C), and 21546:pMLBAD/Z3206 (FIG.
  • FIG. 6 shows discharge of GlcNAc-P by incubation with UMP.
  • Membrane fractions from E. coli 21546:Z3206 were preincubated with UDP- [ 3 H]GlcNAc to enzymatically label GlcNAc-P-P-Und for 10 min (FIG. 6A) at 37°C followed by a second incubation period with 1 mM UMP included for either 1 min (FIG. 6B) or 2 min (FIG. 6C). After the indicated incubation periods
  • FIG. 7 shows conversion of exogenous [ 3 H]GlcNAc-P-P-Und and [ 3 H]GalNAc-P-P-Und to the pertinent [ 3 H]HexNAc-P-P-Und product catalyzed by membranes from strain 21546 expressing Z3206.
  • Membrane fractions from E. coli strain 21546 (FIG. 7B and FIG. 7E) and 21546:pMLBAD/Z3206 (FIG. 7C and FIG. 7F) were incubated with purified [ 3 H]GlcNAc-P-P-Und (FIG. 7A, FIG. 7B, and FIG.
  • FIG. 8 shows SDS-PAGE analysis of unglycosylated and glycosylated AcrA protein.
  • Periplasmic extracts prepared from E. coli DH5a cells carrying the AcrA expression plasmid and the pgl operon Agne complemented with pMLBAD:Z3206 (lane 1), pMLBAD:gne (lane 2) or the vector control pMLBAD (lane 3) were separated by 10% SDS-PAGE and transferred to nitrocellulose membranes.
  • AcrA and its glycosylated forms were detected with anti AcrA antisera.
  • the position of bands corresponding to unglycosylated (AcrA) and glycosylated AcrA (gAcrA) is indicated.
  • FIG. 9 shows the genes that have been identified by Liu B et al. ⁇ Structure and genetics of Shigella O antigens FEMS Microbiology Review, 2008. 32: p. 27).
  • FIG. 10 is a scheme showing the DNA region containing the genes required to synthesize the S. flexneri 6 O antigen.
  • FIG. 11 shows expression of the S. flexneri 6 O antigen in E. coli. LPS was visualized by either silver staining or by transfer to nitrocellulose membranes and detection by antibodies directed against S. flexneri 6.
  • FIG. 12 shows HPLC of O antigen. LLO analysis of E. coli cells (SCM3) containing S. flexneri - Z3206, E. coli cells (SCM3) containing S. flexneri + Z3206 or empty E. coli (SCM3) cells.
  • FIG. 13 shows Western blot of Nickel purified proteins from E. coli cells expressing EPA, pglB and S. flexneri 6 O-antigen +/- Z3206 DETAILED DESCRIPTION OF THE INVENTION
  • the present invention encompasses a recombinant prokaryotic biosynthetic system comprising nucleic acids encoding an epimerase that synthesizes an oligo- or polysaccharide having N-acetylgalactosamine at the reducing terminus, and N-glycosylated proteins having N-acetylgalactosamine at the reducing terminus of the glycan.
  • partial amino acid sequence(s) is also referred to as “optimized consensus sequence(s)” or “consensus sequence(s).”
  • the optimized consensus sequence is N-glycosylated by an oligosaccharyl transferase ("OST,” “OTase”), much more efficiently than the regular consensus sequence " ⁇ - X - S/T.”
  • the term "recombinant N-gl cosylated protein” refers to any poly- or oligopeptide produced in a host cell that does not naturally comprise the nucleic acid encoding said protein.
  • this term refers to a protein produced recombinantly in a prokaryotic host cell, for example, Escherichia spp., Campylobacter spp., Salmonella spp., Shigella spp., Helicobacter spp., Pseudomonas spp., Bacillus spp., and in further embodiments Escherichia coli, Campylobacter jejuni, Salmonella typhimurium etc., wherein the nucleic acid encoding said protein has been introduced into said host cell and wherein the encoded protein is N-glycosylated by the OTase, said transferase enzyme naturally occurring in or being introduced recombinantly into said host cell.
  • Proteins according to the invention comprise one or more of an optimized consensus sequence(s) D/E - X - ⁇ - Z - S/T that is/are introduced into the protein and N-glycosylated.
  • the proteins of the present invention differ from the naturally occurring C. jejuni N-glycoproteins which also contain the optimized consensus sequence but do not comprise any additional (introduced) optimized consensus sequences.
  • the introduction of the optimized consensus sequence can be accomplished by the addition, deletion and/or substitution of one or more amino acids.
  • the addition, deletion and/or substitution of one or more amino acids for the purpose of introducing the optimized consensus sequence can be accomplished by chemical synthetic strategies, which, in view of the instant invention, would be well known to those skilled in the art such as solid phase-assisted chemical peptide synthesis.
  • the proteins of the present invention can be prepared by recombinant techniques that would be art- standard techniques in light of the invention.
  • the proteins of the present invention have the advantage that they may be produced with high efficiency and in any host.
  • the host comprises a functional pgl operon from Campylobacter spp., for example, from C. jejuni.
  • oligosaccharyl transferases from Campylobacter spp. for practicing the invention are from Campylobacter coli or Campylobacter lari.
  • oligosaccharyl transferases would be apparent to one of skill in the art.
  • oligosaccharyl transferases are disclosed in references such as Szymanski, CM. and Wren, B.W. (2005) Protein glycosylation in bacterial mucosal pathogens, Nat. Rev. Microbiol. 3:225-237.
  • the functional pgl operon may be present naturally when said prokaryotic host is
  • Campylobacter spp. or, for example, C. jejuni.
  • the pgl operon can be transferred into cells and remain functional in said new cellular environment.
  • the term "functional pgl operon from Campylobacter spp., preferably C. jejuni” is meant to refer to the cluster of nucleic acids encoding the functional oligosaccharyl transferase (OTase) of Campylobacter spp., for example, C. jejuni, and one or more specific glycosyltransferases capable of assembling an oligosaccharide on a lipid carrier, and wherein said oligosaccharide can be transferred from the lipid carrier to the target protein having one or more optimized amino acid sequence(s): D/E - X N - Z - S/T by the OTase.
  • OTase functional oligosaccharyl transferase
  • the term "functional pgl operon from Campylobacter spp., preferably C. jejuni' in the context of this invention does not necessarily refer to an operon as a singular transcriptional unit.
  • the term merely requires the presence of the functional components for N- glycosylation of the recombinant protein in one host cell. These components may be transcribed as one or more separate mRNAs and may be regulated together or separately.
  • the term also encompasses functional components positioned in genomic DNA and plasmid(s) in one host cell. For the purpose of efficiency, in one embodiment all components of the functional pgl operon are regulated and expressed simultaneously.
  • the oligosaccharyl transferase can originate, in some
  • the oligosaccharyl transferase can originate from other organisms which are known to those of skill in the art as having an oligosaccharyl transferase, such as, for example, Wolinella spp. and eukaryotic organisms.
  • the one or more specific glycosyltransferases capable of assembling an oligosaccharide on a lipid carrier may originate from the host cell or be introduced recombinantly into said host cell, the only functional limitation being that the oligosaccharide assembled by said glycosyltransferases can be transferred from the lipid carrier to the target protein having one or more optimized consensus sequences by the OTase.
  • glycosyltransferases will enable those skilled in the art to vary the N-glycans bound to the optimized N-glycosylation consensus site in the proteins of the present invention.
  • the present invention provides for the individual design of N-glycan-patterns on the proteins of the present invention.
  • the proteins can therefore be individualized in their N-glycan pattern to suit biological, pharmaceutical and purification needs.
  • the proteins may comprise one but also more than one, such as at least two, at least 3 or at least 5 of said N-glycosylated optimized amino acid sequences.
  • N-glycosylated optimized amino acid sequence(s) in the proteins of the present invention can be of advantage for increasing their immunogenicity, increasing their stability, affecting their biological activity, prolonging their biological half-life and/or simplifying their purification.
  • the optimized consensus sequence may include any amino acid except proline in position(s) X and Z.
  • the term "any amino acids” is meant to encompass common and rare natural amino acids as well as synthetic amino acid derivatives and analogs that will still allow the optimized consensus sequence to be N- glycosylated by the OTase. Naturally occurring common and rare amino acids are preferred for X and Z. X and Z may be the same or different.
  • X and Z may differ for each optimized consensus sequence in a protein according to the present invention.
  • the N-glycan bound to the optimized consensus sequence will be determined by the specific glycosyltransferases and their interaction when assembling the oligosaccharide on a lipid carrier for transfer by the OTase.
  • those skilled in the art would be able to design the N-glycan by varying the type(s) and amount of the specific glycosyltransferases present in the desired host cell.
  • Oligo- and polysaccharide refer to two or more sugar residues.
  • the term "glycans” as used herein refers to mono-, oligo- or polysaccharides.
  • “/V-glycans” are defined herein as mono-, oligo- or polysaccharides of variable compositions that are linked to an ⁇ -amide nitrogen of an asparagine residue in a protein via an N-glycosidic linkage.
  • the N-glycans transferred by the OTase are assembled on an undecaprenol pyrophosphate ("Und-P-P") lipid-anchor that is present in the cytoplasmic membrane of gram-negative or positive bacteria.
  • perosamine->fucose->glucose- GalNAc was initiated by the formation of GalNAc- P-P-Und by WecA.
  • membrane fractions from E. coli strains K12, 0157, and PR4019, a WecA-overexpressing strain were incubated with UDP-[ 3 H]GalNAc, neither the enzymatic synthesis of [ 3 H]GlcNAc-P-P-Und nor [ 3 H]GalNAc-P-P-Und was detected.
  • strain 0157 contained an epimerase capable of
  • [ 3 H]GlcNAc-P-P-Und and [ 3 H]GalNAc-P-P-Und were detected. Transformation of E. coli strain 21546 with the Z3206 gene enabled these cells to synthesize GalNAc-P- P-Und in vivo and in vitro. The reversibility of the epimerase reaction was demonstrated by showing that [ 3 H]GlcNAc-P-P-Und was reformed when membranes from strain 0157 were incubated with exogenous [ H]GalNAc-P-P-Und. The inability of Z3206 to complement the loss of the gne gene in the expression of the
  • Campylobacter jejuni N-glycosylation system in E. coli indicated that it does not function as a UDP-GlcNAc/UDP-GalNAc epimerase. Based on these results, it was confirmed that GalNAc-P-P-Und is synthesized reversibly by a GlcNAc-P-P-Und epimerase following the formation of GlcNAc-P-P-Und by WecA in E. coli 0157.
  • the invention encompasses a novel biosynthetic pathway for the assembly of an important bacterial cell surface component as well as a new biosynthetic route for the synthesis of GalNAc-P-P-Und.
  • embodiment of the invention includes the bacterial epimerase as a new target for antimicrobial agents.
  • E. coli 0157 synthesizes an O-antigen with the repeating tetrasaccharide structure (4-N-acetyl perosamine- fucose->glucose->GalNAc). It is shown herein that the biosynthesis of the lipid-linked tetrasaccharide intermediate was not initiated by the enzymatic transfer of GalNAc-P from UDP-GalNAc to Und-P catalyzed by WecA, contrary to earlier genetic studies (Wang, L. and Reeves, P. R. (1998) Infect. Immun. 66, 3545-3551).
  • the invention described herein obtained by homology searches and then confirmed by results from genetic, enzymology, and metabolic labeling experiments, demonstrates that WecA does not utilize UDP- GalNAc as a substrate, but that WecA is required to synthesize GlcNAc-P-P-Und which is then reversibly converted to GalNAc-P-P-Und by an epimerase encoded by the Z3206 gene in strain 0157.
  • the Z3206 gene of the present invention belongs to a family of genes present in several strains that produce surface O-antigen repeat units containing GalNAc residues at their reducing termini (Table 1).
  • the Z3206 gene sequence is shown in SEQ ID NO: 1.
  • Previous reports identified two genes from E. coli 055 (Wang, L., Huskic, S., Cisterne, A., Rothemund, D. and Reeves, P.R. (2002) J.
  • E. coli 055 gne E. coli 086 gnel, respectively, that are 100% identical to a Z3206 gene (Table 1).
  • the E. coli 055 gne gene sequence is shown as SEQ ID NO: 3
  • E. coli 086 gnel gene sequence is shown as SEQ ID NO: 5.
  • E. coli 055 gne and E. coli 086 gnel also encode epimerases capable of converting GlcNAc-P-P-Und to GalNAc-P- P-Und in strains 055 and ⁇ 86, respectively, which also produce O-antigen repeat units with GalNAc at the reducing termini (Table 1 ).
  • E. coli ⁇ 55 gne gene from strain 055 was also assayed for epimerase activity by incubating crude extracts with UDP- GalNAc and indirectly assaying the conversion to UDP-GlcNAc by measuring an increase in reactivity with p-dimethylaminobenzaldehyde after acid hydrolysis.
  • an embodiment of the invention is directed to a recombinant prokaryotic biosynthetic system containing Z3206 gene, E. coli ⁇ 55 gne gene or E. coli 086 gnel gene that converts GlcNAc-P-P-Und to GalNAc-P-P-Und.
  • E. coli 086 which synthesizes an O-antigen containing two GalNAc residues, which would presumably require UDP-GalNAc as the glycosyl donor for the additional, non-reducing terminal GalNAc, also possesses an additional GlcNAc 4-epimerase gene, termed gne2, within the O-antigen gene cluster (Guo, H., Yi, W., Li, L. and Wang, P. G. (2007) Biochem. Biophys. Res.
  • This additional epimerase gene has high homology with the galE gene of the colanic acid gene cluster and appears to be a UDP-GlcNAc 4- epimerase capable of synthesizing UDP-GalNAc.
  • the Z3206 gene appears to be highly conserved in E. coli O- serotypes initiated with GalNAc.
  • GalNAc GalNAc
  • a similar screen of the 22 GalNAc-containing strains with primers designed to detect an alternative epimerase with UDP-GlcNAc 4-epimerase activity detected no strains carrying this gene, indicating that Z3206 is the GlcNAc 4- epimerase gene most commonly associated with the presence of a reducing-terminal GalNAc in O-antigen repeat units of E. coli.
  • E. coli 0157 Z3206 has significant sequence homology with the short-chain dehydrogenase/reductase family of oxido-reductases including the GXXGXXG motif (Rossman fold), consistent with the NAD(P) binding pocket (Allard, S. T. M., Giraud, M. F., and Naismith, J. H. (2001) Cell. Mol. Life Sci. 58, 1650-1655) and the conserved S 3 ⁇ 4 4 Y3 ⁇ 4 sequence, involved in proton abstraction and donation (Field, R. A. and Naismith, J. H. (2003) Biochemistry 42, 7637-7647).
  • Arabinosyl-P-decaprenol is formed via a two-step oxidation/reduction reaction requiring two mycobacterial proteins, Rv3790 and Rv3791. Although epimerization was modestly stimulated by the addition of NAD and NADP, neither Rv3790 nor Rv3791 contain either the Rossman fold or the S 24 YXXXK motif, characteristic of the short-chain dehydrogenase/reductase family (Allard, S. T. M., Giraud, M.-F. and Naismith, J. H. (2001) Cell. Mol. Life Sci. 58, 1650-1655; Field, R. A. and Naismith, J. H. (2003) Biochemistry 42, 7637-7647).
  • GlcNAc-P-P-Und Several antibiotics have been shown to inhibit the synthesis of GlcNAc-P-P-Und, but are limited in their utility because they also block the synthesis of GlcNAc-P-P-dolichol, the initiating dolichol-linked intermediate of the protein N- glycosylation pathway.
  • GlcNAc-P-P-dolichol is a structurally related mammalian counterpart of the bacterial glycolipid intermediate, GlcNAc-P-P-Und, there is no evidence for a similar epimerization reaction converting GlcNAc-P-P- dolichol to GalNAc-P-P-dolichol in eukaryotic cells.
  • An embodiment of the present invention involves an epimerase that converts GlcNAc-P-P-Und (N-acetylglucosaminylpyrophosphorylundecaprenol) to GalNAc-P-P-Und (N-acetylgalactosaminylpyrophosphorylundecaprenol) in E. coli 0157.
  • a still further exemplary aspect of the invention involves the initiation of synthesis of lipid-bound repeating tetrasaccharide having GalNAc at the reducing terminus.
  • Campylobacter jejuni contains a general N-linked protein glycosylation system.
  • Various proteins of C. jejuni have been shown to be modified by a heptasaccharide.
  • This heptasaccharide is assembled on undecaprenyl pyrophosphate, the carrier lipid, at the cytoplasmic side of the inner membrane by the stepwise addition of nucleotide activated monosaccharides catalyzed by specific glycosyltransferases.
  • the lipid- linked oligosaccharide then flip-flops (diffuses transversely) into the periplasmic space by a flipppase, e.g., PglK.
  • the oligosaccharyltransferase catalyzes the transfer of the oligosaccharide from the carrier lipid to asparagine (Asn) residues within the consensus sequence D/E - X - N - Z - S/T, where the X and Z can be any amino acid except Pro.
  • the glycosylation cluster for the heptasaccharide had been successfully transferred into E. coli and /V-linked glycoproteins of Campylobacter had been produced.
  • PglB does not have a strict specificity for the lipid-linked sugar substrate.
  • the antigenic polysaccharides assembled on undecaprenyl pyrophosphate are captured by PglB in the periplasm and transferred to a protein carrier (Feldman, 2005; Wacker, M., et al., Substrate specificity of bacterial oligosaccharyltransferase suggests a common transfer mechanism for the bacterial and eukaryotic systems. Proc Natl Acad Sci U S A, 2006. 103(18): p.
  • the enzyme will also transfer a diverse array of undecaprenyl pyrophosphate (UPP) linked oligosaccharides if they contain an /V-acetylated hexosamine at the reducing terminus.
  • UPP undecaprenyl pyrophosphate
  • the nucleotide sequence for pglB and the amino acid sequence for PglB are published at WO2009/ 104074.
  • one embodiment of the invention involves a recombinant N-glycosylated protein comprising: one or more of an introduced consensus sequence, D/E - X - N - Z - S/T, wherein X and Z can be any natural amino acid except proline; and an oligo- or polysaccharide having N- acetylgalactosamine at the reducing terminus and N-linked to each of said one or more introduced consensus sequences by an N-glycosidic linkage.
  • the present invention is directed to a recombinant prokaryotic biosynthetic system for producing all or a portion of a polysaccharide comprising an epimerase that synthesizes ⁇ -acetylgalactosamine ("GalNAc”) on undecaprenyl pyrophosphate.
  • GalNAc ⁇ -acetylgalactosamine
  • all or a portion of the polysaccharide is antigenic.
  • the present invention is directed to a recombinant prokaryotic biosynthetic system comprising: an epimerase that synthesizes GalNAc on undecaprenyl pyrophosphate; and glycosyltransferases that synthesize a polysaccharide having GalNAc at the reducing terminus.
  • An embodiment of the invention further comprises a recombinant prokaryotic biosynthetic system comprising an epimerase that synthesizes GalNAc on undecaprenyl pyrophosphate and glycosyltransferases that synthesize a
  • polysaccharide wherein said polysaccharide has the following structure: a-D- PerNAc-a-L-Fuc- -D-Glc-a-D-GalNAc; and wherein GalNAc is at the reducing terminus of said polysaccharide.
  • the recombinant prokaryotic biosynthetic system can produce mono-, oligo- or polysaccharides of various origins.
  • Embodiments of the invention are directed to oligo- and polysaccharides of various origins.
  • Such oligo- and polysaccharides can be of prokaryotic or eukaryotic origin.
  • Oligo- or polysaccharides of prokaryotic origin may be from gram-negative or gram-positive bacteria.
  • the oligo- or polysaccharide is from E. coli.
  • said oligo- or polysaccharide is from E. coli 0157.
  • said oligo- or polysaccharide comprises the following structure: oc-D- PerNAc-a-L-Fuc- -D-Glc-a-D-GalNAc.
  • the oligo- or polysaccharide is from Shigella flexneri.
  • the oligo- or polysaccharide is from Shigella flexneri 6.
  • said oligo- or polysaccharide comprises the following structure:
  • Embodiments of the invention further include proteins of various origins. Such proteins include proteins native to prokaryotic and eukaryotic organisms.
  • the protein carrier can be, for example, AcrA or a protein carrier that has been modified to contain the consensus sequence for protein glycosylation, i.e., D/E - X - N - Z - S/T, wherein X and Z can be any amino acid except proline (e.g., a modified Exotoxin Pseudomonas aeruginosa ("EPA”)).
  • the protein is Pseudomonas aeruginosa EPA.
  • a further aspect of the invention involves novel bioconjugate vaccines having GalNAc at the reducing terminus of the N-glycan.
  • An additional embodiment of the invention involves a novel approach for producing such
  • bioconjugate vaccines that uses recombinant bacterial cells that contain an epimerase which produces GalNAc on undecaprenyl pyrophosphate.
  • bioconjugate vaccines can be used to treat or prevent bacterial diseases.
  • bioconjugate vaccines may have therapeutic and/or prophylactic potential for cancer or other diseases.
  • a typical vaccination dosage for humans is about 1 to 25 ⁇ g, preferably about 1 ⁇ g to about 10 ⁇ g, most preferably about 10 ⁇ g.
  • a vaccine such as a bioconjugate vaccine of the present invention, includes an adjuvant.
  • the present invention is directed to an expression system for producing a bioconjugate vaccine against at least one bacterium comprising: a nucleotide sequence encoding an oligosaccharyl transferase; a nucleotide sequence encoding a protein carrier; at least one polysaccharide gene cluster from the at least one bacterium, wherein the polysaccharide contains GalNAc at the reducing terminus; and a nucleic acid sequence encoding an epimerase.
  • the polysaccharide gene cluster encodes an antigenic
  • the present invention is directed to an expression system for producing a bioconjugate vaccine against at least one bacterium comprising: a nucleotide sequence encoding an oligosaccharyl transferase; a nucleotide sequence encoding a protein carrier comprising at least one inserted consensus sequence, D/E - X - N - Z - S/T, wherein X and Z may be any natural amino acid except proline; at least one polysaccharide gene cluster from the at least one bacterium, wherein the polysaccharide contains GalNAc at the reducing terminus; and the Z3206 gene.
  • the polysaccharide gene cluster encodes an antigenic polysaccharide.
  • the present invention is directed to a bioconjugate vaccine comprising: a protein carrier; at least one immunogenic polysaccharide chain linked to the protein carrier, wherein said polysaccharide has GalNAc at the reducing terminus, and further wherein said GalNAc is directly linked to the protein carrier; and an adjuvant.
  • the present invention is directed to a bioconjugate vaccine comprising: a protein carrier comprising at least one inserted consensus sequence, D/E - X - N - Z - S T, wherein X and Z may be any natural amino acid except proline; at least one immunogenic polysaccharide from at least one bacterium, linked to the protein carrier, wherein the at least one
  • immunogenic polysaccharide contains GalNAc at the reducing terminus directly linked to the protein carrier; and, optionally, an adjuvant.
  • Another embodiment of the invention is directed to a method of producing a bioconjugate vaccine, said method comprising: assembling a
  • the present invention is directed to a method of producing a bioconjugate vaccine, said method comprising: introducing genetic information encoding for a metabolic apparatus that carries out N- glycosylation of a target protein into a prokaryotic organism to produce a modified prokaryotic organism; wherein the genetic information required for the expression of one or more recombinant target proteins is introduced into said prokaryotic organism; wherein the genetic information required for the expression of E.
  • the metabolic apparatus comprises glycosyltransferases of a type that assembles a polysaccharide having GalNAc at the reducing terminus on a lipid carrier, and an oligosaccharyltransferase, the oligosaccharyltransferase covalently linking GalNAc of the polysaccharide to an asparagine residue of the target protein, and the target protein containing at least one T-cell epitope; producing a culture of the modified prokaryotic organism; and obtaining glycosylated proteins from the culture medium.
  • a further aspect of the present invention relates to a pharmaceutical composition.
  • An additional aspect of the invention involves a pharmaceutical composition comprising at least one N-glycosylated protein according to the invention.
  • the preparation of medicaments comprising proteins would be well known in the art.
  • a still further aspect of the invention relates to a pharmaceutical composition comprising an antibiotic that inhibits an epimerase that converts GlcNAc-P-P-Und to GalNAc-P-P-Und.
  • the pharmaceutical composition of the invention comprises a pharmaceutically acceptable excipient, diluent and/or adjuvant.
  • excipients Suitable excipients, diluents and/or adjuvants are well-known in the art .
  • An excipient or diluent may be a solid, semi-solid or liquid material which may serve as a vehicle or medium for the active ingredient.
  • An excipient or diluent may be a solid, semi-solid or liquid material which may serve as a vehicle or medium for the active ingredient.
  • One of ordinary skill in the art in the field of preparing compositions can readily select the proper form and mode of administration depending upon the particular characteristics of the product selected, the disease or condition to be treated, the stage of the disease or condition, and other relevant circumstances (Remington's Pharmaceutical Sciences, Mack Publishing Co. (1990)).
  • the proportion and nature of the pharmaceutically acceptable diluent or excipient are determined by the solubility and chemical properties of the pharmaceutically active compound selected, the chosen route of administration, and standard pharmaceutical practice.
  • the pharmaceutical preparation may be adapted for oral, parenteral or topical use and may be
  • pharmaceutically active compounds of the present invention while effective themselves, can be formulated and administered in the form of their pharmaceutically acceptable salts, such as acid addition salts or base addition salts, for purposes of stability, convenience of crystallization, increased solubility, and the like.
  • sequences are at least 85% homologous. In another embodiment, such sequences are at least 90% homologous. In still further embodiments, such sequences are at least 95% homologous.
  • embodiments of the invention include variants of nucleic acids.
  • a variant of a nucleic acid e.g., a codon-optimized nucleic acid
  • Nucleic acid variants of a sequence that contains SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 1 1, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29 include nucleic acids with a substitution, variation, modification, replacement, deletion, and/or addition of one or more nucleotides (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175 or 200
  • nucleotides from a sequence that contains SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 1 1, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29, or parts thereof.
  • such variants include nucleic acids that encode an epimerase which converts GlcNAc-P-P-Und to GalNAc-P-P-Und and that i) are expressed in a host cell, such as, for example, E. coli and ii) are substantially identical to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9, or parts thereof.
  • Nucleic acids described herein include recombinant DNA and synthetic (e.g., chemically synthesized) DNA. Nucleic acids can be double-stranded or single-stranded. In the case of single-stranded nucleic acids, the nucleic acid can be a sense strand or antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives.
  • Plasmids that include a nucleic acid described herein can be transfected or transformed into host cells for expression. Techniques for transfection and transformation are known to those of skill in the art.
  • Bacterial Strains and Plasmids- E. coli strains PR4019 (Rush, J. S., Rick, P. D. and Waechter, C. J. (1997) Glycobiology, 7, 315-322) and PR21546 (Meier-Dieter, U., Starman, R., Barr, K., Mayer, H. and Rick, P. D. (1990) J. Biol. Chem., 265, 13490-13497) were generous gifts from Dr. Paul Rick, Bethesda, MD, and E. coli 0157:H45 (Stephan, R., Borel, N., Zweifel, C, Blanco, M., and Blanco, J.E.
  • E. coli strain DH5a was used for DNA cloning experiments and constructed plasmids were verified by DNA sequencing.
  • the Z3206 gene was amplified from E. coli 0157:H45 by PCR with oligonucleotides Z3206-Fw and Z3206-RvHA (AAACCCGGGATGAACGATAACG TTTTGCTC (SEQ ID NO: 17) and
  • the gne gene was amplified from pACYCpgl (Wacker, M., Linton, D., Hitchen, P.G., Nita-Lazar, M., Haslam, S.M., North, S.J., Panico, M., Morris, H.R., Dell, A., Wrenn, B.W., Aebi, M. (2002) Science 298, 1790-1793), encoding
  • Campylobacter jejuni pgl cluster with oligonucleotides gne-Fw and gne-RV
  • AAATCTAGATTAAGCGTAATCTGGAACATCGTATGGGTAGCACTGTTTTTC CCAATC (SEQ ID NO: 20); restriction sites are underlined).
  • the PCR product was digested with Ncol and Xbal and ligated into the same sites of pMLBAD to generate plasmid pMLBAD: gne (SEQ ID NO: 24) which encodes Gne with a C-terminal hemagglutinin tag (Table 2).
  • E. coli strains were cultured in Luria-Bertani medium (1 % yeast extract, 2% Bacto-peptone, 0.6% NaCl) at 37°C with vigorous shaking. Arabinose inducible expression was achieved by adding arabinose at a final concentration of 0.02-0.2% (w/v) to E. coli cells grown up to an A 6 oo of 0.05-0.4. The same amount of arabinose was added again 5 h post-induction, and incubation continued for 4-15 h.
  • Example 1 Identification of an E. coli 0157 Gene Encoding GlcNAc-P-P-Und 4- Epimerase
  • Genomic sequences of different bacteria encoding O antigen repeating units having a GalNAc at the reducing terminus were screened.
  • One group with a repeating unit containing a GalNAc at the reducing terminus, and a second group lacking a terminal GalNAc in the repeating unit were compared to identify potential epimerases.
  • Z3206 was identified as a candidate GlcNAc-P-P-Und 4-epimerase (Table 1).
  • the GlcNAc 4-epimerase genes present in E. coli strains with O- antigen repeat units containing GalNAc can be separated into two homology groups as shown in Table 1. It was surprisingly discovered that one homology group
  • Example 2 UDP-GalNAc Is Not a Substrate for E. coli WecA (GlcNAc- phosphotransferase)
  • E. coli membrane Bacterial cells were collected by centrifugation at 1,000 X g for 10 min, washed once in ice-cold phosphate-buffered saline, once with cold water, and once with 10 mM Tris-HCl, pH 7.4, 0.25 M sucrose. The cells were resuspended to a density of ⁇ 200 A 6 oo units/ml in 10 mM Tris-HCl, pH 7.4, 0.25 M sucrose, 10 mM EDTA containing 0.2 mg/ml lysozyme, and incubated at 30°C for 30 min.
  • Bacterial cells were recovered by centrifugation at 1,000 X g for 10 min, quickly resuspended in 40 volumes of ice-cold 10 mM Tris-HCl, pH 7.4, and placed on ice. After 10 min the cells were homogenized with 15 strokes with a tight- fitting Dounce homogenizer and supplemented with 0.1 mM phenylmethylsulfonyl fluoride and sucrose to a final concentration of 0.25 M. Unbroken cells were removed by centrifugation at 1,000 X g for 10 min, and cell envelopes were recovered by centrifugation at 40,000 X g for 20 min.
  • the membrane fraction was resuspended in 10 mM Tris-HCl, pH 7.4, 0.25 M sucrose, 1 mM EDTA and again sedimented at 40,000 X g and resuspended in the same buffer to a protein concentration of ⁇ 20 mg/ml. Membrane fractions were stored at -20°C until needed.
  • [ 3 H]GalNAc-P-P-Und the lipid extract was dried under a stream of nitrogen, redissolved in a small volume of CHC1 3 /CH 3 0H (2: 1), and spotted on a 10 X 20-cm borate-impregnated Baker Si250 silica gel plate, and the plate was developed with CHCI3, CH3OH, H 2 0, 0.2 M sodium borate (65:25:2:2).
  • Individual glycolipids were detected with a Bioscan AR2000 Imaging Scanner (Bioscan, Washington, D.C). The biosynthetic rates for each glycolipid were calculated by multiplying the total amount of radioactivity in [ 3 H]GlcNAc/GalNAc-P-P-Und by the percentage of the individual [ 3 H] glycolipids.
  • Glycan products were converted to their corresponding alditols by reduction with 0.1 M NaBtt t in 0.1 M NaOH (final volume 0.1 ml) following mild acid hydrolysis as described above. After incubation at room temperature overnight, the reactions were quenched with several drops of glacial acetic acid and dried under a stream of nitrogen out of methanol containing 1 drop of acetic acid, several times.
  • the alditols were dissolved in water, desalted by passage over 0.5 ml columns of AG50WX8 (H+) and AG 1X8 (acetate), dried under nitrogen, and spotted on 30-cm strips of Whatman No. 3MM paper. The Whatman No. 3 MM strips were developed overnight in descending mode with ethyl acetate, pyridine, 0.1 M boric acid
  • MS Mass Spectrometry
  • Purified glycolipids were analyzed using an ABI/MDS Sciex 4000 Q-Trap hybrid triple quadrupole linear ion trap mass spectrometer with an ABI Turbo V electrospray ionsource (ABI/MDS- Sciex, Toronto, Canada).
  • samples were infused at 10 ⁇ /min with ion source settings determined empirically, and MS/MS (mass spectroscopy in a second dimension) information was obtained by fragmentation of the molecular ion in linear ion trap mode.
  • E. coli 0157 Z3206 gene enabled cells to synthesize GalNAc-P-P-Und
  • E. coli strain 21546 (Meier-Dieter, U., Starman, R., Barr, K., Mayer, H. and Rick, P. D. (1990) J. Biol. Chem., 265, 13490- 13497) expressing the Z3206 gene was labeled metabolically with [ 3 H]GlcNAc and analyzed for [ 3 H]GlcNAc/GalNAc-P-P-Und formation.
  • [ 3 H]GlcNAc was added to a final concentration of 1 and the incubation was continued for 5 min at 37°C.
  • the incorporation of radiolabel into glycolipids was terminated by the addition of 0.5 gm/ml crushed ice, and the cultures were thoroughly mixed.
  • the bacterial cells were recovered by centrifugation at 4000 X g for 10 min, and the supernatant was discarded.
  • the cells were washed with ice-cold phosphate- buffered saline two times, resuspended by vigorous vortex mixing in 10 volumes (cell pellet) of methanol, and sonicated briefly with a probe sonicator at 40% full power.
  • GlcNAc/GalNAc-P-P-Und was extracted with CHC1 3 /CH 3 0H (2: 1) and freed of water-soluble material by partitioning as described elsewhere (Waechter, C. J., Kennedy, J. L. and Harford, J. B. (1976) Arch. Biochem. Biophys. 174, 726-737). The organic extract was then dried under a stream of nitrogen, and the bulk
  • glycerophospholipids were destroyed by deacylation in toluene/methanol (1:3) containing 0.1 N KOH at 0°C for 60 min.
  • the deacylation reaction was neutralized with acetic acid, diluted with 4 volumes of CHCi CH ⁇ H (2: 1), and washed with 1/5 volume of 0.9% NaCl.
  • the organic (lower) phase was washed with 1/3 volume of CHC1 3 , CH 3 OH, 0.9 % NaCl (3:48:47), and the aqueous phase was discarded.
  • the organic phase was diluted with sufficient methanol to accommodate the residual aqueous phase in the organic phase and applied to a DEAE-cellulose column (5 ml) equilibrated with CHC1 3 /CH 3 0H (2: 1 ).
  • the column was washed with 20 column volumes of CHC1 3 /CH 3 0H H 2 0 (10: 10:3) and then eluted with CHC1 3 /CH 3 0H/H 2 0 (10: 10:3) containing 20 mM ammonium acetate.
  • Fractions (2 ml) were collected and monitored for either radioactivity, or GlcNAc/GalNAc-P-P-Und using an
  • anisaldehyde spray reagent (Dunphy, P. J., Kerr, J. D., Pennock, J. F., Whittle, K. J., and Feeney, J. (1967) Biochim. Biophys. Acta 136, 136-147) after resolution by thin layer chromatography on borate-impregnated silica plates (as described earlier).
  • E. coli strain 21546 was selected as the host for the Z3206 expression studies because a mutation in UDP-ManNAcA synthesis results in a block in the utilization of GlcNAc-P-P-Und for the synthesis of the enterobacterial common antigen. Because E. coli 21546 is derived from E. coli K12 it does not synthesize an O-antigen repeat as well (Stevenson, G., Neal, B., Liu, D., Hobbs, M., Packer, N. H., Batley, M., Redmond, J. W., Lindquist, L. and Reeves, P. (1994) J.
  • Example 5 Membrane Fractions from E. coli Cells Expressing the Z3206 Gene Synthesize GalNAc-P-P-Und in Vitro
  • Example 7 In tercon version of Exogenous, Purified [ 3 H]GlcNAc-P-P-Und and
  • [0137] Purified [ 3 H]GlcNAc-P-P-Und/[ 3 H]GalNAc-P-P-Und were prepared as in Example 4 (Metabolic Labeling of Bacterial Cells and Purification of GlcNAc-P-P- Und and GalNAc-P-P-Und).
  • [ 3 H]HexNAc-P-P-undecaprenols 2000 dpm/pmol, dispersed in 1 % Triton X-100, final concentration 0.1%) were incubated with E. coli membranes as in Example 2 in Assay For the Biosynthesis of [ 3 H]GlcNAc-P-P-Und and [ 3 H] GalNAc-P-P-Und in E.
  • FIG. 7A and FIG. 7D [ 3 H]GalNAc-P-P-Und before incubation with membrane fractions is shown in FIG. 7A and FIG. 7D.
  • the glycolipids are unaffected by incubation with membrane fractions from E. coli 21546.
  • incubation of the purified glycolipids with membrane fractions from E. coli 21546 expressing Z3206 catalyzes the conversion of exogenous [ 3 H]GlcNAc-P-P-Und to [ 3 H]GalNAc-P-P- Und (FIG. 7C) and the conversion of [ 3 H]GalNAc-P-P-Und to [ 3 H]GlcNAc-P-P-Und (FIG. 7F).
  • E. coli cell extracts were prepared for immunodetection analysis using cells at a concentration equivalent to 1 A 60 o unit that were resuspended in 100 ⁇ of SDS loading buffer (Laemmli, U. (1970) Nature 227, 680-685). Aliquots of 10 ⁇ were loaded on 10% SDS-PAGE. Periplasmic extracts of E. coli cells were prepared by lysozyme treatment (Feldman, M.F., Wacker, M., Hernandez, M., Hitchen, P.G., Marolda, C.L., Kowarik, M., Morris, H.R., Dell, A., Valvano, M.A., Aebi, M. (2005) Proc Natl Acad Sci USA 102, 3016-3021), and 10 ⁇ of the final sample
  • Anti-AcrA (Wacker, M., Linton, D., Hitchen, P.G., Nita- Lazar, M., Haslam, S.M., North, S.J., Panico, M., Morris, H.R., Dell, A., Wrenn, B.W., Aebi, M. (2002) Science 298, 1790-1793) antibodies were used.
  • Anti-rabbit IgG-HRP Bio-Rad
  • Detection was carried out with ECLTM Western blotting detection reagents (Amersham Biosciences).
  • the glycosylated protein which migrates slower than the unglycosylated form, was formed only when cells expressing pgl locus Agne were complemented by Gne ⁇ lane 2).
  • Z3206 was unable to restore glycosylation of the reporter glycoprotein (FIG. 8, lane 1). Accordingly, Z3206 does not complement glycosylation of AcrA in a Gne dependent glycosylation system. Expression of Gne and membrane-associated Z3206 were confirmed by immunodetection.
  • Fig. 9 are depicted some of the genes required for the biosynthesis of the Shigella flexneri 6 O-antigen: genes encoding enzymes for biosynthesis of nucleotide sugar precursors; genes encoding glycosyltransferases; genes encoding O antigen processing proteins; and genes encoding proteins responsible for the O- acetylation.
  • the structure of the O antigen has been elucidated by Dmitriev, B.A. et al (Dmitriev, B.A., et al Somatic Antigens of Shigella Eur JBiochem, 1979. 98: p. 8; Liu B et al Structure and genetics of Shigella O antigens FEMS Microbiology Review, 2008. 32: p. 27).
  • S. flexneri 6 genomic DNA was isolated using a Macherey-Nagel NucleoSpin® Tissue Kit following the protocol for DNA isolation from bacteria. DNA was isolated from five S. flexneri 6 overnight cultures at 2 ml each and final elution was done with 100 ⁇ elution buffer (5 mM Tris/HCl, pH 8.5). The eluted fractions were pooled, precipitated by isopropanol and the final pellet was resuspended in 52 ⁇ TE buffer of which the total volume was subjected to end-repair according to the protocol given by CopyControlTM Fosmid Library Production Kit (EPICENTRE).
  • EPICENTRE CopyControlTM Fosmid Library Production Kit
  • End-repaired DNA was purified on a 1 % low melting point agarose gel run with 1 X TAE buffer, recovered and precipitated by ethanol as described in the kit protocol. Resuspension of the precipitated DNA was done in 7 ⁇ TE buffer of which 0.15 ⁇ DNA was ligated into pCClFOS (SEQ ID NO: 27) according to the EPICENTRE protocol. Packaging of the ligation product into phage was performed according to protocol and the packaged phage was diluted 1 : 1 in phage dilution buffer of which 10 ⁇ were used to infect 100 ⁇ EPI300-T1 cells that were previous grown as described by EPICENTRE. Cells (1 10 ⁇ ) were plated six times with approximately 100 colonies per plate such that the six plates contain the entire S. flexneri 6 genomic library. Plates were developed by colony blotting and positive/negative colonies were western blotted and silver stained.
  • Colony blotting_ For colony blots a nitrocellulose membrane was laid over the solid agar plate, removed, washed three times in 1 X PBST and treated in the same manner. The membrane was first blocked in 10 % milk for one hour at room temperature after which it was incubated for one hour at room temperature in 2 ml 1 % milk (in PBST) with the anti-type VI antiserum (primary antibody). After three washes in PBST at 10 minutes each, the membrane was incubated for another hour at room temperature in the secondary antibody, 1 :20000 peroxidase conjugated goat- anti-rabbit IgG (BioRad) in 2 ml 1 % milk (in PBST).
  • the membrane was developed in a UVP Chemi Doc Imaging System with a 1 : 1 mix of luminol and peroxide buffer provided by the SuperSignal® West Dura Extended Duration Substrate Kit (Thermo Scientific).
  • flexneri 6 genomic library was sequenced by primer walking out of the region previously sequenced by Liu et al. (Liu et al., 2008) reaching from rmlB to wfbZ (FIG. 9).
  • Primers rmlB_rev and wfbZ_fwd (S. flexneri - Z3206) annealed in rmlB and wfbZ and were used to sequence the insert of the clone until wcaM and hisI/F were reached (S. flexneri + Z3206), respectively (FIG. 10).
  • LPS is produced in E. coli cells + or - Z3206.
  • the O antigen can be produced without Z3206 however with lower production yield, which indicates that the efficiency of polysaccharide production without the epimerase (Z3206) is lower.
  • Phases were separated by centrifugation and the upper aqueous phases were loaded each on a C18 Sep-Pak cartridge conditioned with 10 ml methanol and equilibrated with 10 ml 3:48:47 (C:M:W). Following loading, the cartridges were washed with 10 ml 3:48:47 (C:M:W) and eluted with 5 ml 10: 10:3 (C:M:W). 20 OD samples of the loads, flow-throughs, washes and elutions of the C 18 column were dried in an
  • glycolipid hydrolysis The glycolipid samples from the wash of the CI 8 column were hydrolysed by dissolving the dried samples in 2 ml n-propanol:2 M trifluoroacetic acid (1 : 1), heating to 50°C for 15 minutes and evaporating to dryness under N2.
  • the plasmids expressing the S. flexneri O antigen with (SEQ ID NO: 29) or without (SEQ ID NO: 28) Z3206 were transformed into SCM3 cells (FIG. 10). Traces at late elution volumes shows a difference between the curves of the two samples containing the S. flexneri O antigen +/- Z3206 (FIG. 12). This difference in the elution pattern can be explained by a different oligosaccharide structure carrying a different monosaccharide at the reducing end: GlcNAc or GalNAc depending on the presence of the epimerase (Z3206).
  • Example 11 Analysis of pglB specificity by production and characterization of bioconjugate produced from 5. flexneri 6 +/- Z3206
  • Organism E. coli 0157
  • Organism E coli 0157
  • Organism E. coli 055
  • GTTAAAAATA TCATCTTTAC CAGTTCCGTT GCTGTTTATG GTTTGAACAA
  • Organism E. coli 055
  • Organism E. coli 086
  • GTTAAAAATA TCATCTTTAC CAGTTCCGTT GCTGTTTATG GTTTGAACAA
  • Organism E. coli ⁇ 86
  • Organism Shigella boydii O18
  • Organism Shigella boydii 018
  • Organism Salmonella enterica O30
  • GTTGCGCCAT ACACCTTATC TCAGGGGTTG GATCGTACAC TGCAATATGA
  • Organism Salmonella enterica O30
  • Organism C. jejuni
  • Organism C. jejuni
  • Organism E. coli K12
  • Organism E. coli 12
  • Organism E. coli ⁇ 86
  • Organism E. coli 086
  • SEQ ID NO: 18 Nucleotide Sequence for synthetic oligonucleotide Z3206- RvHA (primer) encoding an end of Z3206 with a hemoaglutinin tag (HA tag); restriction sites underlined
  • Organism [0299] Sequence: AAATCTAGATTAAGCGTAATCTGGAAC
  • SEQ ID NO: 22 Nucleotide Sequence for oligonucleotide containing restriction sites for Ascl restriction enzyme
  • SEQ ID NO: 23 Nucleotide Sequence for plasmid pMLBAD:Z3206 (E. coli 0157 insert in plasmid) encoding Z3206 with a C-terminal hemagglutinin tag
  • Type DNA circular UNA [0317] Sequence: 1 TCTACGGGGT CTGACGCTCA GTGGAACGAA ATCGATGAGC TCGCACGAAC CCAGTTGACA
  • AAATAAAACG AAAGGCTCAG TCGAAAGACT GGGCCTTTCG TTTTATCTGT TGTTTGTCGG
  • SEQ ID NO: 24 Nucleotide Sequence for pMLBADrgne (E. coli 0157 insert in plasmid) which encodes Gne with a C-terminal hemagglutinin tag
  • Gly Lys lie Tyr Arg Val Leu Ala Gly Asn Pro Ala Lys His Asp Leu
  • Ala lie Arg Glu Gin Pro Glu Gin Ala Arg Leu Ala Leu Thr Leu Ala 355 360 365
  • Organism Campylobacter jejuni
  • Met lie lie Ser Asn Asp Gly Tyr Ala Phe Ala Glu Gly Ala Arg Asp 50 55 60
  • Phe Glu Ser lie lie Leu Tyr Met Ser Thr Phe Leu Ser Ser Leu Val
  • Lys Phe Tyr lie Phe Arg Ser Asp Glu Ser Ala Leu Thr Gin Gly 290 295

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Polysaccharides And Polysaccharide Derivatives (AREA)
PCT/US2010/002980 2009-11-19 2010-11-16 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells Ceased WO2011062615A1 (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
PL10831896T PL2501406T3 (pl) 2009-11-19 2010-11-16 Biosyntetyczny układ wytwarzający immunogenne polisacharydy w komórkach prokariotycznych
EP10831896.5A EP2501406B8 (en) 2009-11-19 2010-11-16 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
HRP20180338TT HRP20180338T1 (hr) 2009-11-19 2010-11-16 Biosintetski sustav koji proizvodi imunogene polisaharide u prokariotskim stanicama
CN201080061239.XA CN102724997B (zh) 2009-11-19 2010-11-16 在原核细胞中产生免疫原性多糖的生物合成系统
CA2780487A CA2780487C (en) 2009-11-19 2010-11-16 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
SI201031641T SI2501406T1 (en) 2009-11-19 2010-11-16 A biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
NO10831896A NO2501406T3 (enExample) 2009-11-19 2010-11-16
LTEP10831896.5T LT2501406T (lt) 2009-11-19 2010-11-16 Biosintetinė sistema sukurianti imunogeninius polisacharidus prokariotinėse gardelėse
JP2012539870A JP5968784B2 (ja) 2009-11-19 2010-11-16 原核細胞における免疫原性多糖体生成の生合成システム
US13/510,859 US8846342B2 (en) 2009-11-19 2010-11-16 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
ES10831896.5T ES2660227T3 (es) 2009-11-19 2010-11-16 Sistema biosintético que produce polisacáridos inmunogénicos en células procariotas
AU2010322454A AU2010322454B2 (en) 2009-11-19 2010-11-16 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
DK10831896.5T DK2501406T3 (en) 2009-11-19 2010-11-16 BIOSYNTHESE SYSTEM PRODUCING IMMUNOGENIC POLYSACCHARIDES IN PROCARYOTIC CELLS
KR1020127015728A KR101855380B1 (ko) 2009-11-19 2010-11-16 원핵세포에서 면역원성 폴리사카라이드를 제조하는 생합성 시스템
IL219733A IL219733A (en) 2009-11-19 2012-05-10 Immunogenic polysaccharide biosynthetic system in prokaryotic cells
US14/462,261 US9764018B2 (en) 2009-11-19 2014-08-18 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
CY20181100264T CY1119995T1 (el) 2009-11-19 2018-03-02 Βιοσυνθετικο συστημα που παραγει ανοσογονους πολυσακχαριτες σε προκαρυωτικα κυτταρα

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US27293109P 2009-11-19 2009-11-19
US61/272,931 2009-11-19

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/510,859 A-371-Of-International US8846342B2 (en) 2009-11-19 2010-11-16 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
US14/462,261 Continuation US9764018B2 (en) 2009-11-19 2014-08-18 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells

Publications (1)

Publication Number Publication Date
WO2011062615A1 true WO2011062615A1 (en) 2011-05-26

Family

ID=44059888

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/002980 Ceased WO2011062615A1 (en) 2009-11-19 2010-11-16 Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells

Country Status (20)

Country Link
US (2) US8846342B2 (enExample)
EP (1) EP2501406B8 (enExample)
JP (2) JP5968784B2 (enExample)
KR (1) KR101855380B1 (enExample)
CN (1) CN102724997B (enExample)
AU (1) AU2010322454B2 (enExample)
CA (1) CA2780487C (enExample)
CY (1) CY1119995T1 (enExample)
DK (1) DK2501406T3 (enExample)
ES (1) ES2660227T3 (enExample)
HR (1) HRP20180338T1 (enExample)
HU (1) HUE038456T2 (enExample)
IL (1) IL219733A (enExample)
LT (1) LT2501406T (enExample)
NO (1) NO2501406T3 (enExample)
PL (1) PL2501406T3 (enExample)
PT (1) PT2501406T (enExample)
SI (1) SI2501406T1 (enExample)
TR (1) TR201803015T4 (enExample)
WO (1) WO2011062615A1 (enExample)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013023296A1 (en) 2011-08-12 2013-02-21 The Governors Of The University Of Alberta Method of diagnosing bacterial infections using bacterial glycoproteins
WO2014067970A1 (en) * 2012-10-29 2014-05-08 Institut Pasteur Glycoconjugates and their use as potential vaccines against infection by shigella flexneri
WO2015052344A1 (en) * 2013-10-11 2015-04-16 Glycovaxyn Ag Methods of host cell modification
WO2015158403A1 (en) * 2014-04-17 2015-10-22 Glycovaxyn Ag Modified host cells and uses thereof
EP2948172A1 (en) * 2013-01-22 2015-12-02 London School of Hygiene and Tropical Medicine Glycoconjugate vaccines
WO2016107819A1 (en) * 2014-12-30 2016-07-07 Glycovaxyn Ag Compositions and methods for protein glycosylation
WO2016205570A1 (en) * 2015-06-16 2016-12-22 Absci, Llc Vectors for use in an inducible coexpression system
WO2017067964A1 (en) 2015-10-21 2017-04-27 Glaxosmithkline Biologicals S.A. P. aeruginosa pcrv-linked antigen vaccines
WO2017093291A1 (en) 2015-11-30 2017-06-08 Limmatech Biologics Ag Methods of producing glycosylated proteins
US9700612B2 (en) 2014-02-24 2017-07-11 Glycovaxyn Ag Polysaccharide and uses thereof
US9777076B2 (en) 2012-07-16 2017-10-03 Pfizer Inc. Saccharides and uses thereof
WO2017216286A1 (en) 2016-06-17 2017-12-21 Glaxosmithkline Biologicals S.A. Immunogenic composition
US10159751B2 (en) 2016-10-24 2018-12-25 Janssen Pharmaceuticals, Inc. ExPEC glycoconjugate vaccine formulations
WO2019121924A1 (en) 2017-12-21 2019-06-27 Glaxosmithkline Biologicals Sa Immunogenic composition
WO2019121926A1 (en) 2017-12-21 2019-06-27 Glaxosmithkline Biologicals Sa Immunogenic composition
US10583185B2 (en) 2015-08-24 2020-03-10 Glaxosmithkline Biological S.A. Methods and compositions for immune protection against extra-intestinal pathogenic E. coli
EP3770269A1 (en) 2019-07-23 2021-01-27 GlaxoSmithKline Biologicals S.A. Quantification of bioconjugate glycosylation
WO2021259742A1 (en) 2020-06-25 2021-12-30 Glaxosmithkline Biologicals Sa Modified exotoxin a proteins
US11446370B2 (en) 2019-03-18 2022-09-20 Janssen Pharmaceuticals, Inc. Bioconjugates of E. coli o-antigen polysaccharides, methods of production thereof, and methods of use thereof
US11491220B2 (en) 2019-03-18 2022-11-08 Janssen Pharmaceuticals, Inc. Methods of producing bioconjugates of E. coli o-antigen polysaccharides, compositions thereof, and methods of use thereof
US11529405B2 (en) 2013-01-17 2022-12-20 Janssen Pharmaceuticals, Inc. MDR E. coli immunogen
WO2023118033A1 (en) 2021-12-22 2023-06-29 Glaxosmithkline Biologicals Sa Vaccine
WO2024175620A1 (en) 2023-02-23 2024-08-29 Glaxosmithkline Biologicals Sa Immunogenic composition
US12233118B2 (en) 2020-09-17 2025-02-25 Janssen Pharmaceuticals, Inc. Multivalent vaccine compositions and uses thereof
WO2025172892A1 (en) 2024-02-16 2025-08-21 Glaxosmithkline Biologicals Sa Modified proteins and methods
EP4717778A2 (en) 2017-07-19 2026-04-01 GlaxoSmithKline Biologicals SA Immunogenic composition

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL163806A0 (en) * 2002-03-07 2005-12-18 Eidgenoess Tech Hochschule System and method for the production of recombinant glycosylated proteins in a prokaryotic host
NO2501406T3 (enExample) * 2009-11-19 2018-05-19
KR101629656B1 (ko) * 2014-10-24 2016-06-14 충남대학교산학협력단 면역증강효과를 갖는 수용성 다당체 및 이를 함유하는 조성물
CN113227125A (zh) 2018-12-12 2021-08-06 葛兰素史密丝克莱恩生物有限公司 用于o-连接的糖基化的修饰的载体蛋白
WO2021255684A1 (en) 2020-06-18 2021-12-23 Glaxosmithkline Biologicals Sa Shigella-tetravalent (shigella4v) bioconjugate
CN112877246B (zh) * 2021-02-23 2022-01-18 山东省滨州畜牧兽医研究院 一种高效制备霍乱弧菌菌影的方法
CN115747239A (zh) * 2021-09-03 2023-03-07 上海交通大学 用于表达黏蛋白型o-糖基化蛋白的原核载体和系统、黏蛋白型o-糖基化蛋白的制备方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003007467A1 (en) 2001-07-09 2003-01-23 Tyco Electronics Corporation Microprocessor for controlling the speed and frequency of a motor shaft in a power tool
US20030023075A1 (en) * 1998-12-04 2003-01-30 Blattner Frederick R. Novel sequences of E. coli O157
US20040265954A1 (en) * 2002-03-07 2004-12-30 Markus Aebi System and method for the production of recombinant proteins
WO2006119987A2 (en) 2005-05-11 2006-11-16 ETH Zürich Recombinant n-glycosylated proteins from procaryotic cells
WO2009089396A2 (en) * 2008-01-08 2009-07-16 Neose Technologies, Inc. Glycoconjugation of polypeptides using oligosaccharyltransferases
WO2009104074A2 (en) 2008-02-20 2009-08-27 Glycovaxyn Ag Bioconjugates made from recombinant n-glycosylated proteins from procaryotic cells

Family Cites Families (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS60142915A (ja) * 1983-12-28 1985-07-29 Lion Corp 口腔用組成物
ATE67786T1 (de) 1984-08-01 1991-10-15 Boehringer Ingelheim Int Neue genetische sequenzen, die durch sie codierten interferon-peptide vom typ i und diese sie produzierende organismen.
US5242809A (en) * 1986-02-28 1993-09-07 Smithkline Beecham Corporation Gal operon of streptomyces
US5643758A (en) 1987-03-10 1997-07-01 New England Biolabs, Inc. Production and purification of a protein fused to a binding protein
US5665559A (en) * 1989-05-18 1997-09-09 The United States Of America As Represented By The Secretary Of The Navy Production of monoclonal antibodies to bacteroides gingivalis by hybridoma BGII, VF9/2D
US5280113A (en) * 1989-08-16 1994-01-18 Monsanto Company Method for producing synthetic N-linked glycoconjugates
JPH09501044A (ja) 1993-05-14 1997-02-04 ジ・アップジョン・カンパニー UDP−GALNAc:ポリペプチド、N−アセチルガラクトサミニルトランスフェラーゼをコードするクローン化されたDNA
US6503744B1 (en) 1999-02-01 2003-01-07 National Research Council Of Canada Campylobacter glycosyltransferases for biosynthesis of gangliosides and ganglioside mimics
EP1399538A4 (en) 1999-03-02 2004-03-24 Human Genome Sciences Inc TECHOLOGICAL MANIPULATION OF INTRACELLULAR SIALIZATION PATHS
JP2004528001A (ja) 2000-05-12 2004-09-16 ネオーズ テクノロジーズ, インコーポレイテッド インビトロにおけるフコシル化組換えグリコペプチド
EP1294910B1 (en) 2000-06-30 2008-11-19 VIB vzw Protein glycosylation modification in pichia pastoris
US20040067557A1 (en) * 2000-12-21 2004-04-08 Tetsuo Endo Process for producing udp-n-acetylgalactosamine and sacciiaride containing n-acetylgalactosamine
US20020132320A1 (en) * 2001-01-10 2002-09-19 Wang Peng George Glycoconjugate synthesis using a pathway-engineered organism
US20020150968A1 (en) * 2001-01-10 2002-10-17 Wang Peng G. Glycoconjugate and sugar nucleotide synthesis using solid supports
US7265085B2 (en) * 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycoconjugation methods and proteins/peptides produced by the methods
US7541043B2 (en) * 2002-01-16 2009-06-02 The United States Of America As Represented By The Department Of Health And Human Services Vaccine for protection against Shigella sonnei disease
IL163806A0 (en) 2002-03-07 2005-12-18 Eidgenoess Tech Hochschule System and method for the production of recombinant glycosylated proteins in a prokaryotic host
WO2004013151A2 (en) 2002-08-01 2004-02-12 National Research Council Of Canada Campylobacter glycans and glycopeptides
EP1756149B1 (en) 2004-05-24 2013-09-04 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Live, oral vaccine for protection against shigella dysenteriae serotype 1
US20100143969A1 (en) * 2005-03-24 2010-06-10 Neose Technologies, Inc. Expression of soluble, active eukaryotic glycosyltransferases in prokaryotic organisms
US20070202578A1 (en) * 2005-08-26 2007-08-30 Centre National De La Recherche Scientifique (Cnrs) Production of globosides oligosaccharides using metabolically engineered microorganisms
CN107119095B (zh) * 2008-01-03 2022-07-05 康乃尔研究基金会有限公司 原核生物中的糖基化蛋白表达
PL2411503T3 (pl) * 2009-03-27 2018-01-31 Eidgenoessische Technische Hochschule Zuerich Salmonella enterica prezentująca n-glikan z c. jejuni lub jego pochodne
GB0915403D0 (en) * 2009-09-04 2009-10-07 London School Hygiene & Tropical Medicine Protein glycosylation
NO2501406T3 (enExample) * 2009-11-19 2018-05-19
PT2545081E (pt) * 2010-02-11 2015-05-18 Univ Alberta Compostos de glicano ligados por n
EP3281639B1 (en) * 2010-05-06 2020-11-11 GlaxoSmithKline Biologicals S.A. Capsular gram-positive bacteria bioconjugate vaccines
US20130266604A1 (en) * 2010-09-03 2013-10-10 The Governors of the University of Alberta a non-profit educational institution Peptide containing multiple n-linked glycosylation sequons
US8846373B2 (en) * 2011-07-29 2014-09-30 The University Of Wyoming Methods of using a bacterial GlcNAc-6-P 2′- epimerase to promote sialylation of glycoconjugates
US20140336366A1 (en) * 2011-09-06 2014-11-13 Glycovaxyn Ag Bioconjugate vaccines made in prokaryotic cells
EP3508579B1 (en) * 2012-11-07 2021-06-30 GlaxoSmithKline Biologicals SA Production of recombinant vaccine in e. coli by enzymatic conjugation
GB201301085D0 (en) * 2013-01-22 2013-03-06 London School Hygiene & Tropical Medicine Glycoconjugate Vaccine

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030023075A1 (en) * 1998-12-04 2003-01-30 Blattner Frederick R. Novel sequences of E. coli O157
WO2003007467A1 (en) 2001-07-09 2003-01-23 Tyco Electronics Corporation Microprocessor for controlling the speed and frequency of a motor shaft in a power tool
US20040265954A1 (en) * 2002-03-07 2004-12-30 Markus Aebi System and method for the production of recombinant proteins
WO2006119987A2 (en) 2005-05-11 2006-11-16 ETH Zürich Recombinant n-glycosylated proteins from procaryotic cells
WO2009089396A2 (en) * 2008-01-08 2009-07-16 Neose Technologies, Inc. Glycoconjugation of polypeptides using oligosaccharyltransferases
WO2009104074A2 (en) 2008-02-20 2009-08-27 Glycovaxyn Ag Bioconjugates made from recombinant n-glycosylated proteins from procaryotic cells

Non-Patent Citations (62)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING CO.
AEBI, M.; GASSENHUBER, J.; DOMDEY, H.; TE HEESEN, S., GLYCOBIOLOGY, vol. 6, 1996, pages 439 - 444
ALEXANDER, D. C.; VALVANO, M. A., J. BACTERIOL, vol. 176, 1994, pages 7079 - 7084
ALLARD, S. T. M.; GIRAUD, M. F.; NAISMITH, J. H., CELL. MOL. LIFE SCI., vol. 58, 2001, pages 1650 - 1655
ALLARD, S. T. M.; GIRAUD, M.-F.; NAISMITH, J. H., CELL. MOL. LIFE SCI, vol. 58, 2001, pages 1650 - 1655
AMOR, P. A.; WHITFIELD, C., MOL. MICROBIOL., vol. 26, 1997, pages 145 - 161
BERNATCHEZ, S.; SZYMANSKI, CM.; ISHIYAMA, N.; LI, J.; JARRELL, H.C.; LAU, P.C.; BERGHUIS, A.M.; YOUNG, N.M.; WAKARCHUK, W.W., J. BIOL. CHEM., vol. 280, 2005, pages 4792 - 4802
BUGG, T. D.; BRANDISH, P. E.: "From peptidoglycan to glycoproteins: common features of lipid-linked oligosaccharide biosynthesis.", FEMS MICROBIOL LETT, vol. 119, 1994, pages 255 - 262, XP025423766, DOI: doi:10.1111/j.1574-6968.1994.tb06898.x
BURDA P.; M. AEBI: "The dolichol pathway of N-linked glycosylation", BIOCHEM BIOPHYS ACTA, vol. 1426, no. 2, 1999, pages 239 - 57, XP004276254, DOI: doi:10.1016/S0304-4165(98)00127-5
CARDINI, C. E.; LELOIR, L. F., J. BIOL. CHEM., vol. 225, 1957, pages 317 - 324
DMITRIEV ET AL.: "Somatic antigens of Shigella. The structure of the specific polysaccharide of Shigella newcastle (Sh. flexneri type 6) lipopolysaccharide.", EUR. J. BIOCHEM., vol. 98, no. 1, 1979, pages 309 - 316, XP008159041 *
DMITRIEV, B.A. ET AL., SOMATIC ANTIGENS OF SHIGELLA EUR JBIOCHEM, vol. 98, 1979, pages 8
DUNPHY, P. J.; KERR, J. D.; PENNOCK, J. F.; WHITTLE, K. J.; FEENEY, J., BIOCHIM. BIOPHYS. ACTA, vol. 136, 1967, pages 136 - 147
FELDMAN ET AL., PROC. NATL. ACAD. SCI US, vol. 1 02, no. 8, 2005, pages 3016 - 3021
FELDMAN, M.F.; WACKER, M.; HERNANDEZ, M.; HITCHEN, P.G.; MAROLDA, C.L.; KOWARIK, M.; MORRIS, H.R.; DELL, A.; VALVANO, M.A.; AEBI,, PROC NATL ACAD SCI USA, vol. 102, 2005, pages 3016 - 3021
FIELD, R. A.; NAISMITH, J. H., BIOCHEMISTRY, vol. 42, 2003, pages 7637 - 7647
GORDON, H. T.; THORNBURG, W.; WERUM, L. N., ANAL. CHEM., vol. 28, 1956, pages 849 - 855
GUAN, Z.; BREAZEALE, S. D.; RAETZ, C. R., ANAL. BIOCHEM., vol. 345, 2005, pages 336 - 339
GUO, H.; YI, W.; LI, L.; WANG, P. G., BIOCHEM. BIOPHYS. RES. COMM., vol. 356, 2007, pages 604 - 609
GUO, H.; YI, W.; LI, L.; WANG, P. G., BIOCHEM. BIOPHYS. RES. COMMUN, vol. 356, 2007, pages 604 - 609
GUO, H.; YI, W.; LI, L.; WANG, P. G., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 356, 2007, pages 604 - 609
HELENIUS, A.; AEBI, M.: "Roles of N-linked glycans in the endoplasmic reticulum.", ANNU. REV. BIOCHEM., vol. 73, 2004, pages 1019 - 1049
HOFMANN, K.; STOFFEL, W., BIOL. CHEM. HOPPE-SEYLER, vol. 374, 1993, pages 166
KEAN, E. L., J. LIPID RES., vol. 7, 1966, pages 449 - 452
LAEMMLI, U., NATURE, vol. 227, 1970, pages 680 - 685
LAW, D., J. APP. MICROBIOL, vol. 88, 2000, pages 729 - 745
LAW, D., J. APP. MICROBIOL., vol. 88, 2000, pages 729 - 745
LEFEBRE, M. D.; VALVANO M. A., APPL ENVIRON MICROBIOL, vol. 68, 2002, pages 5956 - 5964
LINTON, D.; DORRELL, N.; HITCHEN, P.G.; AMBER, S.; KARLYSHEV, A.V.; MORRIS, H.R.; DELL, A.; VALVANO, M.A.; AEBI, M.; WREN, B.W., MOL MICROBIOL, vol. 55, 2005, pages 1695 - 1703
LIU B ET AL.: "Structure and genetics of Shigella O antigens", FEMS MICROBIOLOGY REVIEW, vol. 32, 2008, pages 27
LIU, B.; KNIREL, Y. A.; FENG, L.; PEREPELOV, A. V.; SENCHENKOVA, S. N.; WANG, Q.; REEVES, P. R.; WANG, L, FEMS MICROBIOL. REV., vol. 32, 2008, pages 627 - 653
MEIER-DIETER, U.; STARMAN, R.; BARR, K.; MAYER, H.; RICK, P. D., J. BIOL. CHEM., vol. 265, 1990, pages 13490 - 13497
MIKUSOVA, K.; HUANG, H.; YAGI, T.; HOLSTERS, M.; VEREECKE, D.; D'HAEZE, W.; SCHERMAN, M. S.; BRENNAN, P. J.; MCNEIL, M. R.; CRICK,, J. BACTERIOL., vol. 187, 2005, pages 8020 - 8025
PASSWELL, J.H. ET AL.: "Safety and Imrnunogenicity of Improved Shigella O-Specific Polysaccharide-Protein Conjugate Vaccines in Adults in Israel", INFECTION AND IMMUNITY, vol. 69, no. 3, March 2001 (2001-03-01), pages 1351 - 1357, XP002305349, DOI: doi:10.1128/IAI.69.3.1351-1357.2001
PERRY, M. B.; MACLEAN, L.; GRIFFITH, D. W., BIOCHEM. CELL. BIOL., vol. 64, 1986, pages 21 - 28
RAETZ, C. R. H.; WHITFIELD, C., ANNU. REV. BIOCHEM., vol. 71, 2002, pages 635 - 700
REEVES, P. R.; HOBBS, M..; VALVANO, M. A.; SKURNIK, M; WHITFIELD, C; COPLIN, D.; IDO, N.; LENA, J.; MASKELL, D.; RAETZ, C. R. H., TRENDS MICROBIOL., vol. 4, 1996, pages 495 - 503
RUSH ET AL., J. BIOL. CHEM., vol. 285, no. 3, 2009, pages 1671 - 1680
RUSH ET AL.: "A novel epimerase that converts GIcNAc-P-P-undecaprenol to GaINAc-P-P- undecaprenol in Escherichia coli 0157.", J. BIOL. CHEM., vol. 285, no. 3, 18 November 2009 (2009-11-18), pages 1671 - 1680, XP008159043 *
RUSH, J. S.; RICK, P. D.; WAECHTER, C. J., GLYCOBIOLOGY, vol. 7, 1997, pages 315 - 322
SAMUEL, G.; REEVES, P. R., CARBOHYDRATE RESEARCH, vol. 338, 2003, pages 2503 - 2519
SCHWIMMER, S.; BENVENUE, A., SCIENCE, vol. 123, 1956, pages 543 - 544
See also references of EP2501406A4
SPEARS, K. J.; ROE, A. J.; GAILY, D. L., FEMS MICROBIOL. LETT., vol. 255, 2006, pages 187 - 202
STENUTZ, R.; WEINTRAUB, A.; WIDMALM, G., FEMS MICROBIOL. REV., vol. 30, 2006, pages 382 - 403
STEPHAN, R.; BOREL, N.; ZWEIFEL, C; BLANCO, M.; BLANCO, J.E., BMC MICROBIOL, vol. 4, 2004, pages 10
STEVENSON, G.; NEAL, B.; LIU, D.; HOBBS, M.; PACKER, N. H.; BATLEY, M.; REDMOND, J. W.; LINDQUIST, L.; REEVES, P., J. BACTERIOL., vol. 176, 1994, pages 4144 - 4156
SZYMANSKI, CM.; WREN, B.W.: "Protein glycosylation in bacterial mucosal pathogens", NAT. REV. MICROBIOL, vol. 3, 2005, pages 225 - 237
VALVANO, M. A.: "Export of O-specific lipopolysaccharide", FRONT BIOSCI, vol. 8, 2003, pages 452 - 471
WACKER ET AL.: "N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli", SCIENCE, vol. 298, 2002, pages 1790 - 1793, XP002225920, DOI: doi:10.1126/science.298.5599.1790
WACKER, M. ET AL.: "Substrate specificity of bacterial oligosaccharyltransferase suggests a common transfer mechanism for the bacterial and eukaryotic systems", PROC NATL ACAD SCI USA, vol. 103, no. 18, 2006, pages 7088 - 93
WACKER, M.; LINTON, D.; HITCHEN, P.G.; NITA-LAZAR, M.; HASLAM, S.M.; NORTH, S.J.; PANICO, M.; MORRIS, H.R.; DELL, A.; WRENN, B.W., SCIENCE, vol. 298, 2002, pages 1790 - 1793
WACKER, M.; LINTON, D.; HITCHEN, P.G; NITA-LAZAR, M.; HASLAM, S.M.; NORTH, S.J.; PANICO, M.; MORRIS, H.R.; DELL, A.; WRENN, B.W., SCIENCE, vol. 298, 2002, pages 1790 - 1793
WAECHTER, C. J.; HARFORD, J. B., ARCH. BIOCHEM. BIOPHYS, vol. 181, 1977, pages 185 - 198
WAECHTER, C. J.; KENNEDY, J. L.; HARFORD, J. B., ARCH. BIOCHEM. BIOPHYS, vol. 174, 1976, pages 726 - 737
WANG, L.; HUSKIC, S.; CISTERNE, A.; ROTHEMUND, D.; REEVES, P.R., J. BACTERID., vol. 184, 2002, pages 2620 - 2625
WANG, L.; HUSKIC, S.; CISTERNE, A.; ROTHEMUND, D.; REEVES, P.R., J. BACTERIOL, vol. 184, 2002, pages 2620 - 2625
WANG, L.; HUSKIC, S.; CISTERNE, A.; ROTHEMUND, D.; REEVES, P.R., J. BACTERIOL., vol. 184, 2002, pages 2620 - 2625
WANG, L.; REEVES, P. R., INFECT. IMMUN, vol. 66, 1998, pages 3545 - 3551
WANG, L.; REEVES, P. R., INFECT. IMMUN., vol. 66, 1998, pages 3545 - 3551
WHITFIELD, C., ANN. REV. BIOCHEM., vol. 75, 2006, pages 39 - 68
ZHANG, L.; RADZIEJEWSKA-LEBRECHT, J.; KRAJEWSKA-PIETRASIK, D.; TOLVANEN, P.; SKURKIK, M., MOL. MICROBIOL., vol. 23, 1997, pages 63 - 76

Cited By (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2012297533B2 (en) * 2011-08-12 2016-02-25 Instituto De Investigaciones Biotecnologicas-Instituto Tecnologico De Chascomus Consejo De Investigaciones Cientificas Y Tecnicas, Universidad Nacional De San Martin Method of diagnosing bacterial infections using bacterial glycoproteins
WO2013023296A1 (en) 2011-08-12 2013-02-21 The Governors Of The University Of Alberta Method of diagnosing bacterial infections using bacterial glycoproteins
EP2742355A4 (en) * 2011-08-12 2014-12-31 Univ Alberta METHOD FOR DIAGNOSING BACTERIAL INFECTIONS USING BACTERIAL GLYCOPROTEINS
US9777076B2 (en) 2012-07-16 2017-10-03 Pfizer Inc. Saccharides and uses thereof
US11371048B2 (en) 2012-08-05 2022-06-28 Absci Llc Vectors for use in an inducible coexpression system
US10376593B2 (en) 2012-10-29 2019-08-13 Institut Pasteur Glycoconjugates and their use as potential vaccines against infection by Shigella flexneri
WO2014067970A1 (en) * 2012-10-29 2014-05-08 Institut Pasteur Glycoconjugates and their use as potential vaccines against infection by shigella flexneri
US11529405B2 (en) 2013-01-17 2022-12-20 Janssen Pharmaceuticals, Inc. MDR E. coli immunogen
US12274742B2 (en) 2013-01-17 2025-04-15 Janssen Pharmaceuticals, Inc. MDR E. coli immunogen
EP2948172A1 (en) * 2013-01-22 2015-12-02 London School of Hygiene and Tropical Medicine Glycoconjugate vaccines
US20220186196A1 (en) * 2013-10-11 2022-06-16 Glaxosmithkline Biologicals S.A. Methods of Host Cell Modification
US11220676B2 (en) 2013-10-11 2022-01-11 Glaxosmithkline Biological Sa Methods of host cell modification
WO2015052344A1 (en) * 2013-10-11 2015-04-16 Glycovaxyn Ag Methods of host cell modification
US12398380B2 (en) * 2013-10-11 2025-08-26 Glaxosmithkline Biologicals Sa Methods of host cell modification
US10441647B2 (en) 2014-02-24 2019-10-15 Glaxosmithkline Ciologicals S.A. Polysaccharide and uses thereof
US9700612B2 (en) 2014-02-24 2017-07-11 Glycovaxyn Ag Polysaccharide and uses thereof
US12214029B2 (en) 2014-02-24 2025-02-04 Glaxosmithkline Biologicals S.A. Polysaccharide and uses thereof
US11738076B2 (en) 2014-02-24 2023-08-29 Glaxosmithkline Biologicals S.A. Polysaccharide and uses thereof
US10940192B2 (en) 2014-02-24 2021-03-09 Glaxosmithkline Biologicals S.A. Polysaccharide and uses thereof
JP2020114232A (ja) * 2014-04-17 2020-07-30 グラクソスミスクライン バイオロジカルズ ソシエテ アノニム 改変型宿主細胞およびその使用
EP3711776A1 (en) 2014-04-17 2020-09-23 GlaxoSmithKline Biologicals SA Modified host cells and uses thereof
WO2015158403A1 (en) * 2014-04-17 2015-10-22 Glycovaxyn Ag Modified host cells and uses thereof
JP2017513480A (ja) * 2014-04-17 2017-06-01 グリコヴァキシン アーゲー 改変型宿主細胞およびその使用
BE1022998B1 (fr) * 2014-12-30 2016-10-28 Glycovaxyn Ag Compositions et procédés de glycosylation de protéines
US11015177B2 (en) 2014-12-30 2021-05-25 Glaxosmithkline Biologicals Sa Compositions and methods for protein glycosylation
EP4043561A1 (en) * 2014-12-30 2022-08-17 GlaxoSmithKline Biologicals SA Compositions and methods for protein glycosylation
WO2016107818A1 (en) * 2014-12-30 2016-07-07 Glycovaxyn Ag Compositions and methods for protein glycosylation
WO2016107819A1 (en) * 2014-12-30 2016-07-07 Glycovaxyn Ag Compositions and methods for protein glycosylation
WO2016205570A1 (en) * 2015-06-16 2016-12-22 Absci, Llc Vectors for use in an inducible coexpression system
US11484582B2 (en) 2015-08-24 2022-11-01 Janssen Pharmaceuticals, Inc. Methods and compositions for immune protection against extra-intestinal pathogenic E. coli
US10583185B2 (en) 2015-08-24 2020-03-10 Glaxosmithkline Biological S.A. Methods and compositions for immune protection against extra-intestinal pathogenic E. coli
US12076385B2 (en) 2015-08-24 2024-09-03 Janssen Pharmaceuticals, Inc. Methods and compositions for immune protection against extra-intestinal pathogenic E. coli
WO2017067964A1 (en) 2015-10-21 2017-04-27 Glaxosmithkline Biologicals S.A. P. aeruginosa pcrv-linked antigen vaccines
WO2017093291A1 (en) 2015-11-30 2017-06-08 Limmatech Biologics Ag Methods of producing glycosylated proteins
WO2017216286A1 (en) 2016-06-17 2017-12-21 Glaxosmithkline Biologicals S.A. Immunogenic composition
US10159751B2 (en) 2016-10-24 2018-12-25 Janssen Pharmaceuticals, Inc. ExPEC glycoconjugate vaccine formulations
US11033633B2 (en) 2016-10-24 2021-06-15 Janssen Pharmaceuticals, Inc. ExPEC glycoconjugate vaccine formulations
US10525145B2 (en) 2016-10-24 2020-01-07 Janssen Pharmaceuticals, Inc. ExPEC glycoconjugate vaccine formulations
US11844766B2 (en) 2016-10-24 2023-12-19 Janssen Pharmaceuticals, Inc. ExPEC glycoconjugate vaccine formulations
EP4717778A2 (en) 2017-07-19 2026-04-01 GlaxoSmithKline Biologicals SA Immunogenic composition
WO2019121926A1 (en) 2017-12-21 2019-06-27 Glaxosmithkline Biologicals Sa Immunogenic composition
WO2019121924A1 (en) 2017-12-21 2019-06-27 Glaxosmithkline Biologicals Sa Immunogenic composition
US11931405B2 (en) 2019-03-18 2024-03-19 Janssen Pharmaceuticals, Inc. Bioconjugates of E. coli O-antigen polysaccharides, methods of production thereof, and methods of use thereof
US11491220B2 (en) 2019-03-18 2022-11-08 Janssen Pharmaceuticals, Inc. Methods of producing bioconjugates of E. coli o-antigen polysaccharides, compositions thereof, and methods of use thereof
US12233121B2 (en) 2019-03-18 2025-02-25 Janssen Pharmaceuticals, Inc. Methods of producing bioconjugates of E. coli O-antigen polysaccharides, compositions thereof, and methods of use thereof
US11446370B2 (en) 2019-03-18 2022-09-20 Janssen Pharmaceuticals, Inc. Bioconjugates of E. coli o-antigen polysaccharides, methods of production thereof, and methods of use thereof
EP3770269A1 (en) 2019-07-23 2021-01-27 GlaxoSmithKline Biologicals S.A. Quantification of bioconjugate glycosylation
WO2021013854A1 (en) 2019-07-23 2021-01-28 Glaxosmithkline Biologicals Sa Quantification of bioconjugate glycosylation
WO2021259743A2 (en) 2020-06-25 2021-12-30 Glaxosmithkline Biologicals Sa Vaccine
WO2021259742A1 (en) 2020-06-25 2021-12-30 Glaxosmithkline Biologicals Sa Modified exotoxin a proteins
US12233118B2 (en) 2020-09-17 2025-02-25 Janssen Pharmaceuticals, Inc. Multivalent vaccine compositions and uses thereof
WO2023118033A1 (en) 2021-12-22 2023-06-29 Glaxosmithkline Biologicals Sa Vaccine
WO2024175620A1 (en) 2023-02-23 2024-08-29 Glaxosmithkline Biologicals Sa Immunogenic composition
WO2025172892A1 (en) 2024-02-16 2025-08-21 Glaxosmithkline Biologicals Sa Modified proteins and methods

Also Published As

Publication number Publication date
JP2017018098A (ja) 2017-01-26
KR101855380B1 (ko) 2018-05-08
PL2501406T3 (pl) 2018-05-30
CN102724997A (zh) 2012-10-10
EP2501406B1 (en) 2017-12-20
IL219733A (en) 2017-08-31
HUE038456T2 (hu) 2018-10-29
EP2501406A1 (en) 2012-09-26
PT2501406T (pt) 2018-02-21
EP2501406B8 (en) 2018-01-24
KR20120102086A (ko) 2012-09-17
ES2660227T3 (es) 2018-03-21
CN102724997B (zh) 2016-09-21
EP2501406A4 (en) 2013-04-24
DK2501406T3 (en) 2018-02-26
CY1119995T1 (el) 2018-12-12
IL219733A0 (en) 2012-07-31
JP5968784B2 (ja) 2016-08-10
US8846342B2 (en) 2014-09-30
US20150190492A1 (en) 2015-07-09
AU2010322454A1 (en) 2012-06-07
AU2010322454B2 (en) 2016-05-19
NO2501406T3 (enExample) 2018-05-19
CA2780487C (en) 2019-05-21
CA2780487A1 (en) 2011-05-26
HRP20180338T1 (hr) 2018-04-06
TR201803015T4 (tr) 2018-03-21
SI2501406T1 (en) 2018-03-30
US20130028926A1 (en) 2013-01-31
JP2013511520A (ja) 2013-04-04
US9764018B2 (en) 2017-09-19
LT2501406T (lt) 2018-03-26

Similar Documents

Publication Publication Date Title
US9764018B2 (en) Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells
Price et al. Glycoengineered outer membrane vesicles: a novel platform for bacterial vaccines
CN103079591B (zh) 荚膜革兰氏阳性细菌生物缀合物疫苗
US20150238596A1 (en) Bioconjugates comprising modified antigens and uses thereof
US9011871B2 (en) Broad spectrum vaccine against typhoidal and non-typhoidal Salmonella disease
KR20230043157A (ko) 다가 백신 조성물 및 이의 용도
JP2022541911A (ja) バイオコンジュゲートグリコシル化の定量化
EP1747262B1 (en) Conserved inner core lipopolysaccharide epitopes as multi-species vaccine candidates
CN101014698A (zh) 作为多种疫苗候选物的保守性内核脂多糖表位
Compostella et al. Antibacterial Carbohydrate Vaccines
US20250381257A1 (en) Vaccine
Palmieri Investigazione di tecnologie alternative per lo sviluppo di vaccini basati su polisaccaridi
WO2024175620A1 (en) Immunogenic composition
Chen Glycoengineered vesicle vaccines against bacterial pathogens
Stevenson Engineering Bacterial Glycobiology for the Creation of Glycoconjugate Vaccines
Chen GLYCOENGINEERED VESICLE VACCINES AGAINST BACTERIAL PATHOGENS
Omari Synthesis of Campylobacter and Shigella glycoconjugate Vaccines

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080061239.X

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10831896

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2780487

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 219733

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2010322454

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 4379/CHENP/2012

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2012539870

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2010322454

Country of ref document: AU

Date of ref document: 20101116

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20127015728

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010831896

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13510859

Country of ref document: US