WO2011049207A1 - Gène associé à la maladie de moya-moya et son utilisation - Google Patents

Gène associé à la maladie de moya-moya et son utilisation Download PDF

Info

Publication number
WO2011049207A1
WO2011049207A1 PCT/JP2010/068737 JP2010068737W WO2011049207A1 WO 2011049207 A1 WO2011049207 A1 WO 2011049207A1 JP 2010068737 W JP2010068737 W JP 2010068737W WO 2011049207 A1 WO2011049207 A1 WO 2011049207A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
polypeptide
mysterin
snp
Prior art date
Application number
PCT/JP2010/068737
Other languages
English (en)
Japanese (ja)
Inventor
昭夫 小泉
永田　和宏
大介 森戸
信夫 橋本
高島　成二
悟 山崎
範夫 松浦
敏明 人見
Original Assignee
国立大学法人京都大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人京都大学 filed Critical 国立大学法人京都大学
Priority to JP2011537321A priority Critical patent/JP5854423B2/ja
Publication of WO2011049207A1 publication Critical patent/WO2011049207A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to novel genes and SNPs that are useful for diagnosis before the onset of moyamoya disease. Furthermore, the present invention relates to a non-human animal having a functional defect of the gene, a cell having a functional defect of the gene, a method for determining the risk of developing familial moyamoya disease using the gene, the onset of ischemic heart disease The present invention relates to a method for determining risk, a method for determining the possibility of birth of identical twins, and a reagent useful for carrying out these determination methods.
  • Moyamoya disease also called Willis artery occlusion, is a stenotic lesion at the terminal end of the internal carotid artery that develops in childhood and adulthood.
  • Moyamoya disease is a disease that develops all over the world (Non-Patent Document 1), but the incidence of Moyamoya disease is particularly high in East Asia such as Japan, Korea, and China (Non-Patent Documents 2 and 3). In Japan, the latest morbidity and annual incidence are reported to be 10.5 and 0.94 per 100,000 (Non-patent Document 2). In Europe, the incidence is estimated to be about 1/10 of the incidence in Japan (Non-patent Documents 2 and 3). In the United States, the incidence is approximately 0.086 per 100,000, and is higher in Asian Americans and African Americans than in Caucasian Americans (Non-patent Documents 2 and 3).
  • Non-patent Document 4 chromosomal region 17q25.3 is linked to the onset of moyamoya disease.
  • the nucleotide sequence of the human chromosome has basically been determined by the comprehensive sequence of the human genome. From the sequence, a large number including CARD14, Raptor, AATK, KIAA1618, C17orf27, etc. in the chromosomal region 17q25.3. The presence of genes is expected.
  • Raptor [regulatory associated protein of mammalian target of rapamycin (mTOR)] is a 150 kDa mTOR cofactor essential for TOR signaling (Non-patent Document 6). Raptor is associated with tissue hypertrophy (Non-patent document 7), is a regulator of hypoxia-inducible factor (Non-patent document 8), and is involved in vascular endothelial cell proliferation mediated by HLA class I antibodies (Non-patent document 7). Reference 9).
  • Non-patent Document 10 Apoptosis is one of the phenomena observed in stenotic lesions in patients with MMD (Non-patent Document 11).
  • amino acid sequences of KIAA1618 and C17orf27 are registered as accession numbers NP_066005.2 and NP_065965.3, respectively, and are published on the NCBI Internet homepage.
  • these genes are “predicted genes” predicted to be structural genes based on nucleotide sequence analysis by a computer, and are disclosed as two independent genes, but functional analysis is not performed at all. Not.
  • Patent Document 1 discloses a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4.
  • the polypeptide is a membrane protein having a transmembrane domain, and is described to have a Zn finger domain and an ATP binding motif A (P loop).
  • the purpose of the present invention is to identify SNPs that correlate with the onset of moyamoya disease, and to establish a pre-onset diagnosis method for moyamoya disease based on this. Furthermore, the present invention obtains a gene that may be related to the onset of moyamoya disease from the information of the SNPs, creates a non-human animal or animal cell containing a functional defect of the gene, and functions of the gene The purpose is to clarify. Moreover, this invention aims at providing the further use of this gene and SNPs.
  • the present inventors conducted detailed linkage analysis on 17 Moyamoya disease families and succeeded in identifying a core region of about 2.1 Mb linked to the onset of Moyamoya disease from among the chromosome region 17q25.3. .
  • the core region contained about 38 genes.
  • SNP1 C17orf27
  • SNP2 C17orf27
  • SNP3 FLJ3520
  • SNP4 NPTX1
  • SNP5 KIAA1303
  • zebrafish mysterin 1 antisense morpholino homologous to human mysterin is injected into a zebrafish fertilized egg to suppress the protein expression of mysterin 1.
  • mysterin 1 is injected into a zebrafish fertilized egg to suppress the protein expression of mysterin 1.
  • embryos injected with antisense morpholino of mysterin 1 early angiogenesis progressed normally, but subsequent angiogenesis was abnormal.
  • characteristic abnormal angiogenesis was observed around the eyes.
  • SNP2 has been shown to be associated with the frequency of ischemic heart disease and the frequency of delivery of identical twins.
  • new SNPs that correlate with the onset of moyamoya disease were also found in Caucasian families. Based on the above findings, the present invention has been completed.
  • a polynucleotide comprising a nucleotide sequence encoding the polypeptide according to [1].
  • An expression vector comprising the polynucleotide according to [2].
  • a transformant transformed with the expression vector according to [3].
  • a non-human animal comprising a functional defect of a gene encoding the polypeptide according to [1].
  • a screening method for a candidate substance for angiogenesis regulating agent comprising evaluating whether or not a test substance can regulate the expression or function of a gene encoding the polypeptide of [1].
  • a polynucleotide comprising a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof, wherein the partial sequence is 4766 T> C (SNP1), 73097 G> A (SNP2), 120764 G> A (SNP3), 152917 G> A (SNP4) and 232102 G> A (SNP5) are included, and the allele of the SNP included in the partial sequence is a minor allele
  • the partial sequence or its complementary sequence has a length of at least 12 nucleotides.
  • a method for determining the risk of developing ischemic heart disease comprising detecting an SNP of 73097 G> A (SNP2) in the nucleotide sequence represented by SEQ ID NO: 5.
  • An imaginary comprising a nucleic acid probe capable of specifically detecting SNP of 73097 G> A (SNP2) in the nucleotide sequence represented by SEQ ID NO: 5 or a primer capable of specifically amplifying a region containing the SNP A diagnostic agent for the risk of developing blood heart disease.
  • a method for determining the possibility of delivery of identical twins comprising detecting an SNP of 73097 G> A (SNP2) in the nucleotide sequence represented by SEQ ID NO: 5.
  • a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (wherein 4062 arginine in the amino acid sequence represented by SEQ ID NO: 2 may be substituted with glutamine); and (7) A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (wherein the amino acid sequence represented by SEQ ID NO: 2 is selected from the group consisting of R4810K, D4013N, N3962D and R4062Q, May include substitution). [19] A polynucleotide comprising a nucleotide sequence encoding the polypeptide of [18].
  • a polynucleotide comprising a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof, wherein the partial sequence is 4766 T> C (SNP1), 73097 G> A (SNP2), 120764 G> A (SNP3), 152917 G> A (SNP4), 232102 G> A (SNP5), 55977 G> A (SNP6), 55712 A> G (SNP7) and 57483 G> A (SNP8) A polynucleotide comprising at least one SNP selected from wherein the allele of the SNP contained in the partial sequence is a minor allele and the partial sequence or its complementary sequence has a length of at least 12 nucleotides.
  • SNP6 The diagnostic agent according to [25], wherein the SNP is 55977 G> A (SNP6).
  • the SNP is selected from the group consisting of 4766 T> C (SNP1), 73097 G> A (SNP2), 120764 G> A (SNP3), 152917 G> A (SNP4) and 232102 G> A (SNP5)
  • the nucleic acid probe or primer according to [27] which is at least one of [29]
  • the nucleic acid probe or primer according to [27] wherein the SNP is 55977 G> A (SNP6).
  • a polypeptide of a novel gene mysterin a polynucleotide encoding the polypeptide, an expression vector, an animal containing a mysterin functional defect, and the like are provided.
  • Comprehensive analysis of the human genome gene sequence predicted the existence of two independent structural genes, C17orf27 and KIAA1618, at the mysterin locus, but C17orf27 and KIAA1618 are not complete structural genes, respectively. It became clear that KIAA1618 was connected to one to constitute the mysterin locus. From the analysis of zebrafish in which expression of the mysterin gene was suppressed, it became clear that mysterin has a function of regulating angiogenesis.
  • the present invention also provides new SNPs that exist at or near the mysterin locus.
  • the SNPs correlate with the frequency of moyamoya disease, ischemic heart disease, and the frequency of delivery of identical twins. By analyzing this SNPs, the risk of developing moyamoya disease and ischemic heart disease, the delivery of identical twins It is possible to determine the possibility.
  • FIG. 1 Schematic diagram of the structure of human mysterin. Expression of human mysterin protein in HEK293 cells. Intracellular distribution of human mysterin protein in Hela cells. Self-ubiquitination of human mysterin in HEK293 cells. The sequence of amino acid positions 2359 to 2613 of human mysterin. The underline indicated by ⁇ indicates a region predicted to constitute an alpha helix, and the underline indicated by ⁇ indicates a region predicted to constitute a beta sheet. ATPase activity of the Walker domain of human mysterin. Amplification of mysterin MO target region by RT-PCR. 1: Wild-type embryo, 2: Embryo injected with mysterin MO. Each arrow indicates the following information.
  • Genome DNA, WT allele: wild-type PCR product, spMO allele: PCR product with exons skipped.
  • Multiple alignment of sequences around mysterin AAA Sequences corresponding to the following vertebrate AAA domain peripheral sequences (amino acids 2412 to 2910 in human mysterin) were extracted and subjected to multiple alignment. “*” Indicates an invariant site.
  • Mysterin polypeptide provides any polypeptide selected from the following (1) to (3): (1) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (here, the 4810th arginine in the amino acid sequence represented by SEQ ID NO: 2 may be substituted with lysine); (2) a polypeptide comprising an amino acid sequence having 45% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having ubiquitin ligase activity and ATPase activity; and (3) the amino acid represented by SEQ ID NO: 2 A polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, substituted, inserted or added in the sequence, and having ubiquitin ligase activity and ATPase activity.
  • the present invention also provides the following polypeptides (4) to (7): (4) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (here, aspartic acid at position 4013 in the amino acid sequence represented by SEQ ID NO: 2 may be substituted with asparagine); (5) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (here, the asparagine of No.
  • amino acid sequence represented by SEQ ID NO: 2 3962 in the amino acid sequence represented by SEQ ID NO: 2 may be substituted with aspartic acid); (6) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (wherein 4062 arginine in the amino acid sequence represented by SEQ ID NO: 2 may be substituted with glutamine); and (7) A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (wherein the amino acid sequence represented by SEQ ID NO: 2 is selected from the group consisting of R4810K, D4013N, N3962D and R4062Q, May include substitution).
  • polypeptides of the above (1) to (3) in a further aspect, the above (1) to (7)
  • the gene encoding the polypeptide are collectively referred to as “Mysterin”. To do.
  • the polypeptide of (1) above is a typical human mysterin polypeptide. Because of a newly found SNP within the mysterin locus with amino acid substitution (SNP2 will be described in detail below), the 4810th arginine in the amino acid sequence represented by SEQ ID NO: 2 may be substituted with lysine. Good.
  • amino acid represented by SEQ ID NO: 2 is newly found in the mysterin locus and is an SNP with amino acid substitution (detailed below as SNP6). Aspartic acid at position 4013 in the sequence may be substituted with asparagine.
  • the amino acid represented by SEQ ID NO: 2 is newly found in the mysterin locus and is a SNP with amino acid substitution (detailed below as SNP7). Asparagine at position 3962 in the sequence may be substituted with aspartic acid.
  • the amino acid represented by SEQ ID NO: 2 is newly found in the mysterin locus and is a SNP with amino acid substitution (detailed below as SNP8). Arginine of No. 4062 in the sequence may be substituted with glutamine.
  • amino acid sequence represented by SEQ ID NO: 2 may contain 2, 3 or 4 substitutions selected from the group consisting of R4810K, D4013N, N3962D and R4062Q.
  • Mysterin polypeptide has ubiquitin ligase activity and ATPase activity.
  • the presence or absence of ubiquitin ligase activity is determined by combining an expression vector capable of expressing the target polypeptide tagged with HA or the like with an expression vector capable of expressing ubiquitin (for example, mammalian ubiquitin) and appropriate animal cells (for example, HEK293 cells) and immunoprecipitation using an antibody specifically recognizing the tag for the lysate of the cell, followed by Western blotting using an antibody specifically recognizing ubiquitin. It can be determined by evaluating whether or not the obtained polypeptide is self-ubiquitinated.
  • ubiquitin for example, mammalian ubiquitin
  • appropriate animal cells for example, HEK293 cells
  • the presence or absence of ATPase activity can be determined by the following method, for example.
  • the polypeptide of interest is added to a physiological buffer (eg, PBS) containing magnesium ions (eg, 1 mM) and ATP (eg, 5 mM) and incubated at 37 ° C. for 30 minutes to a final concentration of 1%
  • the reaction is stopped by adding PCA.
  • the coloration due to the binding of free phosphate and malachite green is measured by absorbance at 620 nm. If the tested polypeptide has ATPase activity, a significant color reaction due to the release of phosphate accompanying the hydrolysis of ATP is observed.
  • the polypeptide of (2) above is 45% or more, preferably 70% or more, more preferably 95% or more, still more preferably 99.5% or more, and even more preferably 99% with the amino acid sequence represented by SEQ ID NO: 2. Amino acid sequences having 9% or more (for example, 99.96% or more) identity are included.
  • identity refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm uses a sequence of sequences for optimal alignment). The ratio of the same amino acid residue to the total overlapping amino acid residues (in which one or both of the gaps can be considered).
  • amino acid sequence identity in this specification is determined by using the homology calculation algorithm Blastp (http://blast.ncbi.nlm.nih.gov/Blast.cgi) published on the Internet website of NCBI as the default condition. Can be calculated.
  • Blastp http://blast.ncbi.nlm.nih.gov/Blast.cgi
  • the algorithm for determining amino acid sequence identity for example, the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. USA, 90: 5873-5877 (1993) [the algorithm is NBLAST and XBLAST (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997))], Needleman et al., J. Mol.
  • the amino acid sequence contained in the polypeptide of (3) above is an amino acid sequence in which one or more amino acids are deleted, substituted, inserted or added in the amino acid sequence represented by SEQ ID NO: 2, for example, (1) SEQ ID NO: 1 or more (preferably 1 to 500, more preferably 1 to 100, still more preferably 1 to 30, even more preferably 1 to 10, most preferably 1 to a number in the amino acid sequence shown in FIG.
  • (2-5) amino acid deleted amino acid sequence (2) one or more (preferably 1-500, more preferably 1-100, more preferably 1) amino acid sequence shown in SEQ ID NO: 2 An amino acid sequence to which 1 to 30, even more preferably 1 to 10, most preferably 1 to several (2 to 5) amino acids are added; (3) one or more amino acid sequences shown in SEQ ID NO: 2 A plurality of amino acids (preferably 1 to 500, more preferably 1 to 100, still more preferably 1 to 30, even more preferably 1 to 10, most preferably 1 to several (2 to 5)) amino acids Inserted amino acid sequence, (4) one or more (preferably 1 to 500, more preferably 1 to 100, still more preferably 1 to 30, and even more preferably) in the amino acid sequence shown in SEQ ID NO: 2 An amino acid sequence in which 1 to 10 amino acids, most preferably 1 to several (2 to 5) amino acids are substituted with other amino acids, or (5) amino acids in which the mutations (1) to (4) above are combined
  • the total number of amino acids added is preferably 1-500, more preferably 1-100, more
  • the RING finger domain (corresponding to amino acids 3997 to 4035 of SEQ ID NO: 2) important for the activity is conserved in the polypeptides (2) and (3) above. Is preferred. The degree of conservation is usually 50% or more, preferably 54% or more, more preferably 69% or more, still more preferably 90% or more (eg 97% or more), and most preferably 100% as amino acid sequence identity. .
  • the introduction is preferably performed so that the amino acid “*” shown in FIG. 10 is completely retained.
  • amino acids with similar chemical properties include, for example, aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn), basic amino acids ( Amino acids that fall into the same group such as Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids with hydroxyl groups (Ser, Thr), amino acids with small side chains (Gly, Ala, Ser, Thr, Met) Is mentioned. It is expected that substitution with such similar amino acids will not change the phenotype of the protein (ie, is a conservative amino acid substitution). Examples of conservative amino acid substitutions are well known in the art and are described in various references (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).
  • the AAA domain peripheral sequence (corresponding to human 2412 to 2910 amino acids) important for the activity is conserved. preferable.
  • the degree of conservation is usually 60% or more, preferably 72% or more, more preferably 80% or more, still more preferably 90% or more (for example, 98% or more), and most preferably 100% as amino acid sequence identity.
  • the introduction is preferably performed so that the amino acid “*” shown in FIG. 9 is completely retained.
  • the amino acid “:” or “.” Shown in FIG. 9 is completely retained or the chemical properties are similar. It is preferable to introduce the amino acid so that the amino acid is substituted.
  • the definition of “amino acids with similar chemical properties” is as described above.
  • polypeptides of (2) and (3) above are natural mysterin polypeptides of animals. “Natural” means that the amino acid sequence constituting the polypeptide exists in nature.
  • polypeptides of (2) and (3) above include polypeptides having a different amino acid sequence from the polypeptide of (1) generated by the polymorphism of the human mysterin gene.
  • the polypeptides (2) and (3) above include orthologs of mysterin in animals other than humans.
  • “non-human animals” include mammals other than humans, birds, reptiles, amphibians, fish, insects, and the like.
  • mammals other than humans include, for example, laboratory animals such as rodents such as mice, rats, hamsters, guinea pigs, and rabbits; domestic animals such as pigs, cows, goats, horses, sheep, minks; pets such as dogs and cats Primates such as, but not limited to, monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans, chimpanzees;
  • the birds include chickens, quails, ducks, geese, turkeys, emu, ostriches, guinea fowls, and pigeons.
  • Examples of fish include zebrafish, puffer fish, medaka, goldfish and loach.
  • An ortholog of mysterin in a non-human animal refers to a nucleotide sequence (nucleotide sequence represented by SEQ ID NO: 1) encoding human mysterin disclosed herein, and a nucleic acid probe capable of specifically detecting mysterin Can be obtained by designing a primer or primer and using a well-known genetic engineering technique such as plaque hybridization or RACE PCR.
  • Preferred examples of the polypeptides (2) and (3) above include mysterin polypeptides that are homologous to human mysterin of mammals, typical birds, or fish. If the evolution time is long, the preservation of the complete gene structure is not necessarily observed due to diversity among species due to mutation such as insertion or deletion into the protein. However, functionally important parts are highly conserved between species. Peripheral sequence of the myelin AAA domain (corresponding to human amino acids 2412 to 2910) and RING finger domain sequence (corresponding to human amino acids 3997 to 4035), human, chimpanzee, mouse, rat, chicken, puffer, and zebrafish ( 2 domains exist in the genome), and multi-full alignment was performed for each domain. The alignment results are shown in FIGS.
  • the identity to the human mysterin amino acid sequence is as follows: chimpanzee 98%, mouse 82%, rat 80%, chicken 72%, puffer 67%, and zebrafish 68%, 63% (respectively mysterin 1 , 2).
  • identity to the human mysterin amino acid sequence is 97% chimpanzee, 69% mouse, 74% rat, 54% chicken, 51% puffer fish, and 53% and 42% zebrafish (mysterin 1 respectively) , 2).
  • mysterin 1 zRNF213
  • mysterin 2 zRNF213.1
  • a representative amino acid sequence of a zebrafish mysterin 1 polypeptide is shown in SEQ ID NO: 4.
  • the length of the polypeptide of the present invention is not particularly limited as long as it has ubiquitin ligase activity and ATPase activity, and a polypeptide having a desired length can be selected according to the purpose of use.
  • the polypeptide of the present invention has a length of 6000 amino acids or less, 5500 amino acids or less, 5400 amino acids or less, 5300 amino acids or less, 5250 amino acids or less, 5220 amino acids or less, 5210 amino acids The following can be selected as appropriate.
  • the polypeptide of the present invention usually has a length of 4800 amino acids or more, preferably 5000 amino acids or more, more preferably 5200 amino acids or more, and most preferably 5207 amino acids or more.
  • the polypeptide of the present invention may have one or more tag polypeptides or signal sequences.
  • the tag polypeptide refers to a polypeptide that is added to facilitate the detection and purification of the polypeptide.
  • tag polypeptides include, but are not limited to, epitope tags, fluorescent polypeptides, immunoglobulin Fc regions, and the like.
  • An epitope tag refers to a peptide that is specifically recognized by an antibody or other binding partner, specifically, a Flag tag, a polyhistidine tag, a c-Myc tag, an HA tag, an AU1 tag, a GST tag, an MBP tag. Etc. can be mentioned.
  • the fluorescent polypeptide include GFP, YFP, RFP, CFP, BFP, EGFP and the like.
  • tag polypeptides are well known to those skilled in the art, and various antibodies that specifically recognize the tag polypeptides are commercially available.
  • the signal sequence refers to a polypeptide sequence that directs the transport and localization of the polypeptide from the synthesis site to a specific site inside the cell or outside the cell simultaneously with or after translation of the polypeptide.
  • the signal sequence include a leader sequence that induces secretion of the polypeptide, a nuclear translocation signal sequence (for example, a nuclear translocation signal sequence of SV40 T antigen), a nuclear translocation signal sequence, a nucleolus localization signal, and the like. However, it is not limited to these.
  • Such signal sequences are well known to those skilled in the art, and can be appropriately selected according to the purpose.
  • the polypeptide of the present invention may be modified.
  • modifications include addition of lipid chains (aliphatic acylation (palmitoylation, myristoylation, etc.), prenylation (farnesylation, geranylgeranylation, etc.), phosphorylation (serine residue, threonine residue, tyrosine residue) Phosphorylation), acetylation, addition of sugar chain (N-glycosylation, O-glycosylation) and the like.
  • the polypeptide of the present invention contains an appropriate labeling agent such as a radioisotope (eg, 125 I, 131 I, 3 H, 14 C, etc.), an enzyme (eg, ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase). , Peroxidase, malate dehydrogenase, etc.), fluorescent substances (eg, fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg, luminol, luminol derivatives, luciferin, lucigenin, etc.), affinity tags (eg, biotin) Etc.).
  • a radioisotope eg, 125 I, 131 I, 3 H, 14 C, etc.
  • an enzyme eg, ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase.
  • polypeptide is used to mean a salt thereof.
  • Polypeptide salts include salts with physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metal salts), and particularly physiologically acceptable acid addition salts. preferable.
  • Such salts include, for example, salts with inorganic acids (eg hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid). Acid, tartaric acid, citric acid, malic acid, succinic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like.
  • the polypeptide of the present invention is preferably isolated or purified. “Isolation or purification” means that an operation for removing components other than the target component has been performed.
  • the purity of the isolated or purified polypeptide of the present invention is usually 50% or more, preferably 70% or more, more preferably 90% or more, Most preferably, it is 95% or more (for example, substantially 100%).
  • polypeptides of the invention are listed below: (A) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2; (B) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (here, the arginine at position 4810 in the amino acid sequence represented by SEQ ID NO: 2 is substituted with lysine); (C) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (here, aspartic acid at position 4013 in the amino acid sequence represented by SEQ ID NO: 2 is substituted with asparagine); (D) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (here, the asparagine at No.
  • SEQ ID NO: 2 comprises any one combination of substitutions selected from the following group; R4810K + D4013N, R4810K + N3962D, R4810K + R4062Q, D4013N + N3962D, D4013N + R4062Q, N3962D + R4062Q, R4810K + D4013N + N3962D, R4810K + D4013N + R4062Q, R4810K + N3962D + R4062Q, R4810K + N3962D + R4062Q, R4810K + N3962D + R4062Q, D4013N + N3962D + R4062Q, D4013N + N3962D + R4062Q, and R4810K + D40
  • the method for producing the polypeptide of the present invention is not particularly limited, and may be produced according to a known peptide synthesis method or may be produced using a known genetic recombination technique.
  • the peptide synthesis method may be, for example, either a solid phase synthesis method or a liquid phase synthesis method. If the partial peptide or amino acid that can constitute the polypeptide of the present invention is condensed with the remaining portion, and the product has a protecting group, the protecting polypeptide can be eliminated to produce the desired polypeptide.
  • polypeptide of the present invention When the polypeptide of the present invention is produced using genetic recombination technology, first, a polynucleotide encoding the polypeptide of the present invention as described later is obtained, and the host cell is expressed using an expression vector capable of expressing the polypeptide.
  • the polypeptide can be produced by transforming and culturing the resulting transformant. A method for producing the polypeptide of the present invention using the polynucleotide and gene recombination techniques will be described later.
  • the polypeptide of the present invention can be used to screen for candidate substances for angiogenesis regulating agents, to determine the risk of developing Moyamoya disease, to determine the risk of developing ischemic heart disease, to determine the likelihood of delivery of identical twins, This is useful for determining angiogenesis.
  • polynucleotide Encoding Mysterin Polypeptide The present invention provides a polynucleotide comprising a nucleotide sequence encoding the above-described polypeptide of the present invention.
  • the polynucleotide of the present invention may be DNA or RNA, or may be a DNA / RNA chimera.
  • the polynucleotide may be double-stranded or single-stranded. In the case of a double strand, it may be a double-stranded DNA, a double-stranded RNA or a DNA: RNA hybrid.
  • polynucleotide of the present invention examples include a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 1 or 3.
  • the nucleotide sequence represented by SEQ ID NO: 1 encodes a human mysterin polypeptide (SEQ ID NO: 2)
  • the nucleotide sequence represented by SEQ ID NO: 3 encodes a zebrafish mysterin 1 polypeptide (SEQ ID NO: 4).
  • SNP2 zebrafish mysterin 1 polypeptide
  • the 14429th guanine in the nucleotide sequence represented by SEQ ID NO: 1 was replaced with adenine. May be.
  • SNP6 SNP6
  • No. 12037 guanine in the nucleotide sequence represented by SEQ ID NO: 1 is converted to adenine. May be substituted.
  • adenine at position 11884 in the nucleotide sequence represented by SEQ ID NO: 1 is converted to guanine. May be substituted.
  • SNP8 because of a newly found SNP with an amino acid substitution in the mysterin locus (described in detail below as SNP8), 12185th guanine in the nucleotide sequence represented by SEQ ID NO: 1 is converted to adenine. May be substituted.
  • the nucleotide sequence represented by SEQ ID NO: 1 is , G14429a, g12037a, a11884g and g12185a may comprise 2, 3 or 4 substitutions.
  • the polynucleotide of the present invention can be easily produced by utilizing a known gene recombination technique based on the sequence information described in the sequence listing of the present specification. For example, by designing an appropriate primer based on the sequence information, RT-PCR using cDNA prepared from total RNA isolated from cells expressing mysterin (eg, renal cells such as 293 cells) as a template. Polynucleotides can be produced. Alternatively, the polynucleotide of the present invention may be synthesized by a polynucleotide synthesizer based on the sequence information described in the sequence listing of the present specification.
  • the obtained polynucleotide encoding the polypeptide of the present invention can be used as it is depending on the purpose, or after digestion with a restriction enzyme or adding a linker as desired.
  • the polynucleotide may have ATG as a translation initiation codon on the 5 'end side, and may have TAA, TGA or TAG as a translation stop codon on the 3' end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.
  • the polynucleotide of the present invention is preferably isolated or purified. “Isolation or purification” means that an operation for removing components other than the target component has been performed.
  • the purity of the isolated or purified polynucleotide of the present invention is usually 50% or more, preferably 70% or more, more preferably 90% or more, Most preferably, it is 95% or more (for example, substantially 100%).
  • the polynucleotide of the present invention is useful for producing a mysterin polypeptide. Further, by analyzing SNP2 and SNP6 contained in the polynucleotide of the present invention, it is possible to determine the onset risk of moyamoya disease and ischemic heart disease and the possibility of delivery of identical twins (detailed below). ).
  • Expression vector and transformant The present invention provides an expression vector containing the polynucleotide of the present invention and a transformant containing the expression vector.
  • the expression vector can be produced by operably linking the polynucleotide of the present invention downstream of a promoter in an appropriate expression vector.
  • the vector include plasmid vectors and virus vectors, and can be appropriately selected depending on the host cell to be used.
  • Host cells include prokaryotic cells and eukaryotic cells.
  • prokaryotic cells include Escherichia bacteria (such as Escherichia coli), Bacillus bacteria (such as Bacillus subtilis), and the like.
  • eukaryotic cells include yeast (Saccharomyces cerevisiae, etc.), insect cells (stolen larvae-derived cell lines (Spodoptera frugiperda cell; Sf cells), etc.), mammalian cells (human cells (293, etc.)) Monkey cells (such as COS-7), Chinese hamster cells (such as CHO cells)), and the like.
  • mammals include laboratory animals such as rodents and rabbits such as mice, rats, hamsters and guinea pigs; domestic animals such as pigs, cows, goats, horses, sheep and minks; pets such as dogs and cats; Examples include, but are not limited to, primates such as monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans and chimpanzees.
  • Plasmid vectors derived from E. coli eg, pBR322, pBR325, pUC12, pUC13
  • plasmid vectors derived from Bacillus subtilis eg, pUB110, pTP5, pC194
  • yeast-derived plasmid vectors eg, pSH19, pSH15
  • the type of virus vector can be appropriately selected according to the type of host cell used and the purpose of use. For example, when insect cells are used as the host, baculovirus vectors can be used. When mammalian cells are used as hosts, Moloney murine leukemia virus vectors, lentivirus vectors, Sindbis virus vectors and other retrovirus vectors, adenovirus vectors, herpes virus vectors, adeno-associated virus vectors, parvovirus vectors, Vaccinia virus vectors, Sendai virus vectors, and the like can be used.
  • a promoter that can initiate transcription in the host cell can be selected according to the type of host cell to be used. For example, when the host is Escherichia, trp promoter, lac promoter, T7 promoter and the like are preferable. When the host is Bacillus, SPO1 promoter, SPO2 promoter, penP promoter and the like are preferable. When the host is yeast, PHO5 promoter, PGK promoter and the like are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable. When the host is a mammalian cell, a subgenomic (26S) promoter, CMV promoter, SR ⁇ promoter and the like are preferable.
  • the expression vector of the present invention may contain an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40ori) and the like in a functional manner, if desired.
  • selectable markers include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin resistance gene (sometimes abbreviated as Amp r ), neomycin resistance gene (Neo). G418 resistance) which may be abbreviated as r ).
  • the expression vector of the present invention is preferably isolated or purified.
  • the expression vector of the present invention is useful for producing the polypeptide of the present invention because it can express the polypeptide of the present invention in an appropriate host cell.
  • the above-described expression vector of the present invention is prepared according to a gene transfer method known per se (for example, lipofection method, calcium phosphate method, microinjection method, protoplast fusion method, electroporation method, DEAE dextran method, gene transfer method using Gene Gun).
  • a gene transfer method known per se (for example, lipofection method, calcium phosphate method, microinjection method, protoplast fusion method, electroporation method, DEAE dextran method, gene transfer method using Gene Gun).
  • a transformant into which the expression vector has been introduced (the transformant of the present invention) can be produced.
  • the transformant can express the polypeptide of the present invention.
  • the transformant of the present invention is useful for producing the polypeptide of the present invention.
  • the polypeptide of the present invention can be produced by culturing the transformant of the present invention by a method known per se according to the type of host and isolating the polypeptide of the present invention from the culture.
  • the transformant whose host is Escherichia is cultured in an appropriate medium such as LB medium or M9 medium, usually at about 15 to 43 ° C. for about 3 to 24 hours.
  • the transformant whose host is Bacillus is cultured in an appropriate medium, usually at about 30 to 40 ° C. for about 6 to 24 hours.
  • Cultivation of the transformant whose host is yeast is usually carried out at about 20 ° C. to 35 ° C. for about 24 to 72 hours in a suitable medium such as a Burkholder medium.
  • Cultivation of transformants whose host is an insect cell or an insect is carried out in a suitable medium such as Grace's Insect medium supplemented with about 10% bovine serum, usually at about 27 ° C for about 3 to 5 days.
  • the transformant whose host is an animal cell is cultured in an appropriate medium such as a MEM medium supplemented with about 10% bovine serum, usually at about 30 ° C. to 40 ° C. for about 15 to 60 hours. In any culture, aeration and agitation may be performed as necessary.
  • the cell lysate or the culture supernatant is subjected to a plurality of chromatography such as reverse phase chromatography, ion exchange chromatography, affinity chromatography and the like. Can be achieved.
  • Non-human animal containing functional defect of mysterin The present invention provides a non-human animal comprising a functional defect of a gene (mysterin gene) encoding the polypeptide of the present invention.
  • Examples of the species of the animal of the present invention include mammals other than humans, birds, reptiles, amphibians, fish, and insects, with mammals, birds and fish being preferred.
  • mammals other than humans include, for example, laboratory animals such as rodents such as mice, rats, hamsters, guinea pigs, and rabbits; domestic animals such as pigs, cows, goats, horses, sheep, minks; pets such as dogs and cats Primates such as, but not limited to, monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans, chimpanzees;
  • the birds include chickens, quails, ducks, geese, turkeys, emu, ostriches, guinea fowls, and pigeons.
  • fish include zebrafish, medaka, goldfish and loach.
  • a preferred non-human mammal is a mouse.
  • a preferred bird is a chicken.
  • a functional defect of a mysterin gene refers to a state in which normal functions (ubiquitin ligase activity, ATPase activity, etc.) inherent to the mysterin gene cannot be sufficiently exerted, for example, a state in which the mysterin gene is not expressed at all, or a mysterin gene
  • the mysterin gene is in a state where its expression level is reduced to the extent that it cannot exert its normal function, or the function of the mysterin gene product has been completely lost, or to the extent that the normal function inherent in the mysterin gene cannot be exerted
  • a state in which the function of the product is reduced is mentioned.
  • the animal of the present invention has various characteristics associated with a functional defect of the mysterin gene.
  • the animals of the present invention have delayed embryogenesis and abnormalities in early angiogenesis and subsequent angiogenesis compared to wild type animals. Furthermore, it exhibits a particularly remarkable abnormality in angiogenesis of the head and eyes.
  • the animal of the present invention may be an animal accompanied with a modification of genomic DNA, a so-called genetically modified animal.
  • the genetically modified animal of the present invention may be a mysterin gene-deficient heterozygote or a mysterin gene-deficient homozygote.
  • the genetically modified animal of the present invention can be produced by a method known per se. First, a method for producing a chimeric animal useful for producing the genetically modified animal of the present invention will be described.
  • the animals of the present invention include chimeric animals useful for producing the genetically modified animals of the present invention.
  • the chimeric animal of the present invention can be produced, for example, by a method including the following steps (a) to (c): (A) providing an embryonic stem cell containing a functional defect of the mysterin gene; (B) introducing the embryonic stem cells into an embryo to obtain a chimeric embryo; and (c) transplanting the chimeric embryo into an animal to obtain a chimeric animal.
  • an embryonic stem cell (ES cell) containing a functional defect of the mysterin gene for example, the following 5.
  • ES cell embryonic stem cell
  • Those prepared by the method described in the section can be used.
  • the animal species from which the embryo is derived may be the same as the genetically modified animal species of the present invention, and is preferably the same as the animal species from which the embryonic stem cells to be introduced are derived.
  • embryos include blastocysts and 8-cell stage embryos.
  • Embryos can be obtained by mating female animals that have undergone superovulation treatment with hormone agents (for example, using PMSG having FSH-like action and hCG having LH action) and the like.
  • hormone agents for example, using PMSG having FSH-like action and hCG having LH action
  • methods for introducing embryonic stem cells into the embryo include micromanipulation methods and aggregation methods.
  • the chimeric embryo can be transferred to the uterus or fallopian tube of the animal.
  • the animal into which the chimeric embryo is transplanted is preferably a pseudopregnant animal.
  • a pseudopregnant animal can be obtained by mating a female animal having a normal cycle with a male animal castrated by vagina ligation or the like. The animal into which the chimeric embryo has been introduced becomes pregnant and gives birth to the chimeric animal.
  • the animal born is a chimeric animal. Whether or not the animal born is a chimeric animal can be confirmed by a method known per se, for example, by body color or coat color. For discrimination, DNA may be extracted from a part of the body, and Southern blot analysis or PCR assay may be performed.
  • the genetically modified animal of the present invention can be produced, for example, by a method including the following steps (a) to (d): (A) providing an embryonic stem cell containing a functional defect of the mysterin gene; (B) introducing the embryonic stem cell into an embryo to obtain a chimeric embryo; (C) transplanting the chimeric embryo into an animal to obtain a chimeric animal; and (d) mating the chimeric animal to obtain a mysterin gene-deficient heterozygote.
  • Steps (a) to (c) of the above method can be performed in the same manner as the method for producing a chimeric animal described above.
  • step (d) of the above method mating is performed after the chimeric animal obtained in step (c) has matured.
  • the mating can preferably take place between wild-type animals and chimeric animals or between chimeric animals.
  • a mysterin gene deficiency has been introduced into germline cells of a chimeric animal and a mysterin gene deficient heterozygous offspring can be obtained can be confirmed using various traits as indicators, for example, the body of a progeny animal It can be distinguished by color and coat color.
  • DNA may be extracted from a part of the body, and Southern blot analysis or PCR assay may be performed.
  • a mysterin gene-deficient homozygote can be produced by crossing the mysterin gene-deficient heterozygotes thus obtained.
  • a progeny animal having a genotype in which a gene derived from an embryonic stem cell and a gene derived from an animal used for mating are obtained is obtained.
  • the obtained mysterin gene deficient animal is backcrossed with a pure animal strain for about 5 to 8 generations. It is preferable to do.
  • backcrossing is carried out only by natural mating, it may take a long time, so in vitro fertilization techniques can be used as appropriate when it is desired to speed up generational changes.
  • the animal of the present invention may be an animal that is not accompanied by genomic DNA modification.
  • Such an animal can be obtained by, for example, administering a substance that specifically suppresses the expression or function of the mysterin gene (eg, antisense nucleic acid, siRNA, expression vector capable of expressing these nucleic acids) to the animal or forced expression in the animal.
  • a substance that specifically suppresses the expression or function of the mysterin gene eg, antisense nucleic acid, siRNA, expression vector capable of expressing these nucleic acids
  • Administration can be carried out using a suitable delivery means such as, for example, microinjection, liposomes. It is also possible to achieve a cell-specific mysterin gene functional defect.
  • morpholino antisense nucleic acids is advantageous from the viewpoint of ease of operation and time cost in the production of fish (eg, mysterin 1 in the case of zebrafish) in which expression of the mysterin gene is suppressed (Nucleic® Acid).
  • the morpholino antisense nucleic acid is complementary to the partial sequence of mysterin mRNA (here, the partial sequence within 25 bases of the splicing acceptor and donor boundary sequence) (the number of mismatches is usually 3 bases or less, preferably It consists of a nucleotide sequence of about 25 bases in length (1 base or less, most preferably 0).
  • the synthesized morpholino antisense nucleic acid is microinjected into the cytoplasm or yolk of a fertilized egg (embryo) at the 1-8 cell stage, the morpholino antisense nucleic acid inhibits splicing of mysterin mRNA in the nucleus, and exon skipping. The resulting frameshifted protein is produced.
  • the animal of the present invention is useful as an animal model for diseases associated with abnormal neovascularization.
  • Diseases related to abnormalities in angiogenesis include various factors such as occlusive diseases such as arteriosclerosis, arteriovenous malformations, neovascularization in tumors, inflammatory obstructive diseases, diabetic vascular disorders, and age-related macular degeneration Examples include vascular lesions and abnormalities in blood vessel construction due to a single gene such as Osler's disease.
  • the animal of the present invention is also useful for analysis of the mysterin gene and angiogenesis, and screening for substances that can regulate angiogenesis and those that can treat angiogenesis abnormalities.
  • gene expression profile is measured by means (for example, microarray) that enables comprehensive analysis of gene expression, and the gene of a control animal (same species or heterogeneous animal) such as a wild type animal is measured.
  • the gene expression profile of the animal of the present invention can be traced over time to evaluate the linkage between expression and progression of phenotype (abnormal neovascularization) and changes in gene expression profile.
  • Animal cell containing functional defect of mysterin The present invention provides an animal cell containing a functional defect of a gene (mysterin gene) encoding the polypeptide of the present invention.
  • Examples of the animal species of the present invention include mammals including humans, birds, reptiles, amphibians, fish, and insects, with mammals, birds and fish being preferred.
  • Examples of mammals include laboratory animals such as rodents and rabbits such as mice, rats, hamsters and guinea pigs; domestic animals such as pigs, cows, goats, horses, sheep and minks; pets such as dogs and cats;
  • Examples include, but are not limited to, primates such as monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans and chimpanzees.
  • Examples of the birds include chickens, quails, ducks, geese, turkeys, emu, ostriches, guinea fowls, and pigeons.
  • Examples of fish include zebrafish, medaka, goldfish and loach. Preferred mammals are humans or mice.
  • a preferred bird is a chicken.
  • a preferred fish is zebrafish.
  • the animal cell of the present invention can also be a cell derived from any tissue, for example, a somatic cell in which a mysterin gene is expressed (for example, heart, brain, liver, pancreas, muscle, lung, adrenal gland, bone marrow, placenta, Prostate, salivary gland, thymus, thyroid, trachea, uterus, spleen, somatic cells that make up blood vessels, vascular endothelial cells, vascular smooth muscle cells, pancreatic islets of Langerhans), spermatogonia, sperm, ovum, fertilization Examples include germline cells such as eggs, embryonic cells, and embryonic stem cells.
  • a somatic cell in which a mysterin gene is expressed for example, heart, brain, liver, pancreas, muscle, lung, adrenal gland, bone marrow, placenta, Prostate, salivary gland, thymus, thyroid, trachea, uterus, spleen, somatic cells that make up blood vessels,
  • the animal cell of the present invention may be either a primary cultured cell or a cell line.
  • An embryonic cell refers to a cell collected from an embryo and a cell generated by the division and not a embryo.
  • the animal cell of the present invention may be a cell accompanied by a modification of genomic DNA, a so-called genetically modified cell.
  • the genetically modified cell of the present invention can be, for example, a mysterin gene-deficient homozygote or a mysterin gene-deficient heterozygote.
  • the genetically modified cell of the present invention can be produced by a method known per se.
  • the animal cell of the present invention can be produced by a method comprising the following steps (a) to (c): (A) providing a targeting vector capable of inducing homologous recombination of the mysterin gene; (B) introducing the targeting vector into animal cells; and (c) selecting cells that have undergone homologous recombination from the cells into which the targeting vector has been introduced.
  • the targeting vector capable of inducing homologous recombination of the mysterin gene used in step (a) of the above method is a mysterin cDNA sequence (SEQ ID NO: 1) disclosed in the sequence listing of the present specification, a genomic DNA sequence ( Based on the information of SEQ ID NO: 5), genomic DNA of the mysterin gene of the desired animal can be obtained, and can be easily produced by those skilled in the art according to a general genetic engineering technique in creating a knockout mouse.
  • the targeting vector is introduced into the animal cell.
  • the method for introducing the targeting vector into animal cells include the calcium phosphate method, the lipofection method / liposome method, and the electroporation method.
  • the targeting vector is introduced into an animal cell, homologous recombination of genomic DNA containing the mysterin gene occurs in the animal cell.
  • animal cell into which the targeting vector is introduced one produced by a method known per se, one commercially available, or one available from a predetermined organization can be used.
  • the types of animal cells are as described above.
  • an embryonic stem cell when used as an animal cell into which a targeting vector is introduced, the embryonic stem cell can be established by culturing an inner cell mass separated from a blastocyst of any animal on a feeder cell.
  • existing embryonic stem cells can be obtained commercially or from a predetermined organization. Examples of existing mouse embryonic stem cells include ES-D3 cells, ES-E14TG2a cells, SCC-PSA1 cells, TT2 cells, AB-1 cells, J1 cells, R1 cells, E14.1 cells, RW-4 cells, etc. Is mentioned.
  • embryonic stem cells derived from mammals such as humans, mink, hamsters, pigs, cattle, marmoset, rhesus monkeys, etc. have been established at present. You can also.
  • somatic cells such as kidney cells are used as animal cells into which the targeting vector is introduced
  • the somatic cells into which the targeting vector is introduced may be either primary cultured cells or cell lines.
  • Primary cultured cells and cell lines can be prepared by a method known per se (for example, Current Protocols in Cell Biology, John John Wiley and Sons, Inc. (2001)).
  • step (c) of the above method in order to select animal cells in which homologous recombination has occurred with genomic DNA containing the mysterin gene, the animal cells after introduction of the targeting vector are screened. For example, after selection by positive selection, negative selection, etc., screening based on genotype (for example, PCR method, Southern blot hybridization method) is performed.
  • genotype for example, PCR method, Southern blot hybridization method
  • a karyotype analysis of the recombinant embryonic stem cell is further performed.
  • Karyotype analysis confirms that there is no chromosomal abnormality in the selected recombinant embryonic stem cells.
  • Karyotype analysis can be performed by a method known per se.
  • the karyotype of embryonic stem cells is preferably confirmed in advance before introducing the targeting vector.
  • the genetically modified cells of the present invention can also be isolated from the genetically modified animals of the present invention. Since the genetically modified animal of the present invention contains a functional defect of the mysterin gene, the genetically modified cell isolated from the genetically modified animal of the present invention also contains a functional defect of the mysterin gene.
  • cells isolated from the genetically modified animal of the present invention may be modified by a method such as genetic engineering techniques. Isolation and modification of cells can be performed by a method known per se (for example, Current Protocols in Cell Biology, John Wiley and Sons, Inc. (2001)).
  • the animal cell of the present invention may be a cell that is not accompanied by genomic DNA modification.
  • a cell can be prepared, for example, by introducing a substance that specifically suppresses the expression or function of the mysterin gene (for example, an antisense nucleic acid, siRNA, or an expression vector capable of expressing these nucleic acids) into the cell.
  • a substance that suppresses the expression or function of the mysterin gene into cells can be performed by a method known per se, such as microinjection, calcium phosphate method, lipofection method / liposome method, electroporation method and the like.
  • the animal cell of the present invention is useful for analysis of mysterin gene and angiogenesis, screening for a substance that can regulate angiogenesis and a substance that can treat angiogenesis abnormality, and production of the animal of the present invention.
  • the present invention also includes a method for screening a candidate substance for an angiogenesis regulator, comprising evaluating whether a test substance can regulate the expression or function of a mysterin gene, and a blood vessel obtained by the screening method.
  • a candidate substance for angiogenesis regulator is provided.
  • test substance to be used for the screening method may be any known compound or novel compound, for example, nucleic acid, carbohydrate, lipid, protein, peptide, organic low molecular weight compound, prepared using combinatorial chemistry technology Examples thereof include a compound library, a random peptide library prepared by solid phase synthesis or a phage display method, or natural components derived from microorganisms, animals and plants, marine organisms, and the like.
  • the screening method of the present invention includes the following steps (a) to (c): (A) contacting the test substance with a cell capable of measuring the expression of the mysterin gene; (B) measuring the expression level of the mysterin gene in the cell contacted with the test substance, and comparing the expression level with the expression level of the mysterin gene in the control cell not contacted with the test substance; and (c) above ( A step of selecting a test substance that regulates the expression level of the mysterin gene based on the comparison result of b).
  • step (a) of the above method the test substance is placed under contact with cells capable of measuring mysterin gene expression.
  • Contact of the test substance with a cell capable of measuring the expression of the mysterin gene can be performed in a culture medium.
  • a cell capable of measuring the expression of a mysterin gene refers to a cell capable of directly or indirectly evaluating the expression level of a mysterin gene product, for example, a transcription product or a translation product.
  • a cell that can directly evaluate the expression level of a mysterin gene product can be a cell that can naturally express a mysterin gene (eg, a cell that naturally expresses a mysterin gene), while a product of a mysterin gene.
  • a cell capable of indirectly assessing the expression level of can be a cell that allows a reporter assay for the mysterin gene transcriptional regulatory region.
  • Cells that can measure the expression of the mysterin gene are animal cells, such as mammalian cells such as mice, rats, hamsters, guinea pigs, rabbits, dogs, monkeys, humans, avian cells such as chickens, and fish cells such as zebrafish. obtain.
  • mammalian cells such as mice, rats, hamsters, guinea pigs, rabbits, dogs, monkeys, humans, avian cells such as chickens, and fish cells such as zebrafish. obtain.
  • the cells that can naturally express the mysterin gene are not particularly limited as long as they potentially express the mysterin gene.
  • Such cells can be easily identified by those skilled in the art, and primary cultured cells, cell lines derived from the primary cultured cells, commercially available cell lines, cell lines available from cell banks, and the like can be used. Examples of cell lines in which the mysterin gene is expressed include 293 cells.
  • the mysterin gene is known to be expressed in the tissues or cells described above, such tissues or cells (for example, heart, brain, liver, pancreas, muscle, lung, adrenal gland, bone marrow, placenta) , Prostate cells, salivary glands, thymus, thyroid, trachea, uterus, spleen, somatic cells that make up blood vessels, vascular endothelial cells, vascular smooth muscle cells, pancreatic Langerhans pancreatic B cells) May be.
  • tissues or cells for example, heart, brain, liver, pancreas, muscle, lung, adrenal gland, bone marrow, placenta
  • Prostate cells salivary glands, thymus, thyroid, trachea, uterus, spleen, somatic cells that make up blood vessels, vascular endothelial cells, vascular smooth muscle cells, pancreatic Langerhans pancreatic B cells
  • a cell that enables a reporter assay for a mysterin gene transcription regulatory region is a cell that contains a mysterin gene transcription regulatory region and a reporter gene operably linked to the region.
  • the mysterin gene transcription regulatory region and reporter gene can be inserted into an expression vector.
  • the mysterin gene transcription regulatory region is not particularly limited as long as it is a region capable of controlling mysterin gene expression. For example, a region from the transcription start point to about 2 kbp upstream, or one or more bases in the nucleotide sequence of this region is missing. Examples include a region consisting of a lost, substituted or added base sequence and having the ability to control transcription of the mysterin gene.
  • the reporter gene may be any gene that encodes a detectable protein or an enzyme that produces a detectable substance.
  • a GFP green fluorescent protein
  • GUS ⁇ -glucuronidase
  • LUC luciferase
  • CAT Chloramphenicol acetyltransferase
  • a cell into which a mysterin gene transcription regulatory region and a reporter gene operably linked to the region are introduced can quantitatively analyze the expression level of the reporter gene as long as the mysterin gene transcription regulatory function can be evaluated.
  • the introduced cell is a cell that can naturally express the mysterin gene ( For example, cells that naturally express the mysterin gene) are preferred.
  • the culture medium in which the test substance is contacted with the cells capable of measuring the expression of the mysterin gene is appropriately selected according to the type of cells used, and includes, for example, about 5 to 20% fetal bovine serum.
  • the culture conditions are also appropriately determined according to the type of cells to be used. For example, the pH of the medium is about 6 to about 8, the culture temperature is usually about 30 to about 40 ° C., and the culture time is About 12 to about 72 hours.
  • step (b) of the above method first, the expression level of the mysterin gene in the cell contacted with the test substance is measured.
  • the expression level can be measured by a method known per se in consideration of the type of cells used. For example, when a cell capable of naturally expressing the mysterin gene is used as a cell capable of measuring the expression of the mysterin gene, the expression level is a method known per se for a mysterin gene product, for example, a transcription product or a translation product. Can be measured.
  • the expression level of the transcript can be measured by preparing total RNA from cells and performing RT-PCR, Northern blotting, or the like.
  • the expression level of the translation product can be measured by preparing an extract from the cells and using an immunological technique.
  • a radioisotope immunoassay RIA method
  • an ELISA method Methods in Enzymol. 70: 419-439 (1980)
  • a fluorescent antibody method or the like
  • a cell capable of performing a reporter assay for the mysterin gene transcriptional regulatory region is used as a cell capable of measuring mysterin gene expression
  • the expression level can be measured based on the signal intensity of the reporter.
  • the expression level of the mysterin gene in the cells contacted with the test substance is compared with the expression level of the mysterin gene in the control cells not contacted with the test substance.
  • the comparison of expression levels is preferably performed based on the presence or absence of a significant difference.
  • the expression level of the mysterin gene in the control cells that are not contacted with the test substance is the expression level measured at the same time, even if the expression level is measured in advance compared to the measurement level of the mysterin gene expression level in the cell that is in contact with the test substance.
  • it may be an amount, it is preferably an expression amount measured simultaneously from the viewpoint of the accuracy and reproducibility of the experiment.
  • a test substance that regulates the expression level of the mysterin gene is selected.
  • the regulation of the expression level of the mysterin gene can be an increase or decrease in the expression level.
  • a test substance that increases (promotes expression) the expression level of a mysterin gene can be a candidate substance for a prophylactic or therapeutic agent for angiogenesis abnormality.
  • a test substance that decreases (suppresses expression) the expression level of the mysterin gene can be an inducer of abnormal angiogenesis. Therefore, it becomes possible to select a candidate substance for a research reagent such as a drug such as a prophylactic or therapeutic agent for angiogenesis abnormality or an angiogenesis abnormality inducer, using the expression level of the mysterin gene as an index.
  • the screening method of the present invention comprises the following steps (a) to (c): (A) contacting the test substance with a mysterin polypeptide; (B) measuring the function of the mysterin polypeptide in the presence of the test substance and comparing the function with the function of the mysterin polypeptide in the absence of the test substance; and (c) (b) above A step of selecting a test substance that modulates the function of the mysterin polypeptide based on the result of.
  • step (a) of the above method the test substance is brought into contact with the mysterin polypeptide.
  • Contact of the test substance with the polypeptide can be performed by mixing the test substance and the mysterin polypeptide in an appropriate buffer.
  • Mysterin polypeptide can be prepared by a method known per se.
  • a mysterin polypeptide can be isolated and purified from the above-described mysterin gene expression tissue.
  • the recombinant polypeptide can It can be produced by the method described in the section.
  • Examples of the function of the mysterin polypeptide in step (b) of the above method include ubiquitin ligase activity and ATPase activity.
  • the ubiquitin ligase activity and ATPase activity are as described in 1. above. It can be measured by the method described in the section.
  • the function of the mysterin polypeptide in the presence of the test substance is compared with the function of the mysterin polypeptide in the absence of the test substance.
  • the comparison of functions is preferably performed based on the presence or absence of a significant difference.
  • Measurement of mysterin polypeptide function in the absence of the test substance is performed simultaneously with measurement of mysterin polypeptide function in the presence of the test substance, even if it was performed in advance. However, it is preferable to measure simultaneously from the viewpoint of the accuracy and reproducibility of the experiment.
  • a test substance that regulates the function of mysterin polypeptide is selected.
  • Modulation of the function of a mysterin polypeptide can be promotion or suppression of function.
  • a test substance that promotes the function of mysterin polypeptide can be a candidate substance for a prophylactic or therapeutic agent for angiogenesis abnormality.
  • a test substance that suppresses the function of mysterin polypeptide can be an inducer of abnormal angiogenesis. Accordingly, it is possible to select a candidate substance for a research reagent such as a pharmaceutical agent such as a prophylactic or therapeutic agent for angiogenesis abnormality or an inducer of angiogenesis abnormality using the function of mysterin polypeptide as an index. .
  • the screening method of the present invention includes the following steps (a) to (c): (A) contacting the test substance with a mysterin polypeptide; (B) measuring the binding ability of the test substance to the mysterin polypeptide; and (c) selecting a test substance having the binding ability to the mysterin polypeptide based on the result of (b) above.
  • step (a) of the above method the test substance is brought into contact with the mysterin polypeptide.
  • Contact of the test substance with the polypeptide can be performed by mixing the test substance and the mysterin polypeptide in an appropriate buffer.
  • step (b) of the above method the binding ability of the test substance to the mysterin polypeptide is measured.
  • the binding ability can be measured by a method known per se, for example, a binding assay, a method using surface plasmon resonance (for example, use of Biacore (registered trademark)).
  • a test substance capable of binding to the mysterin polypeptide is selected.
  • a test substance capable of binding to the mysterin polypeptide may be a substance capable of regulating (for example, promoting or suppressing) the function of the mysterin gene. Therefore, this methodology can be useful, for example, as a first screening for substances that can regulate the function of the mysterin gene.
  • a test substance that efficiently regulates the function of the mysterin polypeptide can be reliably selected.
  • the screening method of the present invention can also be performed by administering a test substance to an animal.
  • the animal include mammals such as mice, rats, hamsters, guinea pigs, rabbits, dogs, monkeys, and the animals of the present invention.
  • a test substance that regulates the expression level of the mysterin gene can be selected.
  • the screening method of the present invention enables screening for candidate substances for regulators of angiogenesis. Therefore, the screening method of the present invention is useful for the development of a pharmaceutical agent such as a preventive or therapeutic agent for angiogenesis abnormality, or the development of a research reagent such as an angiogenesis abnormality inducer.
  • a pharmaceutical agent such as a preventive or therapeutic agent for angiogenesis abnormality
  • a research reagent such as an angiogenesis abnormality inducer.
  • a polynucleotide comprising a SNP associated with moyamoya disease is a polynucleotide comprising a contiguous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof, the partial sequence comprising 4766 T> C ( SNP1), 73097 G> A (SNP2), 120764 G> A (SNP3), 152917G> A (SNP4) and 232102 G> A (SNP5), and at least one SNP selected from the partial sequence
  • SNP allele included in the present invention is a minor allele, and the partial sequence or its complementary sequence provides a polynucleotide having a length of at least 12 nucleotides.
  • the present invention provides a polynucleotide comprising a contiguous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof, wherein the partial sequence is 4766 T> C (SNP1), 73097 G.
  • SEQ ID NO: 5 is a partial nucleotide sequence of human chromosome 17 DNA containing a mysterin gene and genes in its peripheral region (FLJ3520, NPTX1, CARD14, and Raptor (KIAA1303)). Contig # NT010783 registered in NCBI. It corresponds to the 15th nucleotides 43560001 to 43795000.
  • the nucleotide sequence represented by SEQ ID NO: 5 includes the following novel SNPs associated with moyamoya disease, which are present on human chromosome 17.
  • SNP at position 4766 which is T or C (abbreviated herein as 4766 T> C, or SNP1)
  • SNP at position 73097 which is G or A (in this specification, 73097 G> A, or SNP2)
  • SNP at position 152917 which is G or A abbreviated as 152917 G> A or SNP4 herein
  • SNP at position 232102 which is G or A (232102 G> A or SNP5 herein) Abbreviated).
  • the nucleotide sequence represented by SEQ ID NO: 5 also includes the following novel SNPs associated with moyamoya disease that are present on human chromosome 17.
  • SNP at position 55977 which is G or A (abbreviated as 55977 G> A or SNP6 in this specification), SNP at position 55712 which is A or G (abbreviated as 55712 A> G or SNP7 in this specification), and SNP at position 57483 which is G or A (57483G> A or SNP8 in this specification) Abbreviated).
  • the position of the SNP is described based on the position of the nucleotide in the nucleotide sequence represented by SEQ ID NO: 5.
  • SNP at position 4766 means the SNP at the nucleotide at position 4766 in the nucleotide sequence represented by SEQ ID NO: 5.
  • nucleotide sequence is described as a DNA sequence unless otherwise specified.
  • polynucleotide is RNA
  • thymine (T) is appropriately replaced with uracil (U).
  • the polynucleotide of the present invention includes at least one (1, 2, 3, 4 or 5, preferably 1) SNP selected from the group consisting of the above five SNPs. That is, in a preferred embodiment, the polynucleotide of the present invention includes SNP1, SNP2, SNP3, SNP4 or SNP5.
  • the polynucleotide of the present invention has at least one selected from the group consisting of the above 8 SNPs (1, 2, 3, 4, 5, 6, 7 or 8, preferably 1,). SNPs are included. That is, in a preferred embodiment, the polynucleotide of the present invention includes SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7 or SNP8.
  • the SNP allele contained in the polynucleotide of the present invention is a minor allele. That is, when SNP1 is included in the polynucleotide of the present invention, the SNP is “C”; when SNP2 is included, the SNP is “A”; when SNP3 is included, the SNP is “A”. If SNP4 is included, the SNP is “A”; if SNP5 is included, the SNP is “A”.
  • the SNP when the polynucleotide of the present invention includes SNP6, the SNP is “A”; when SNP7 is included, the SNP is “G”; when SNP8 is included, the SNP is “A”.
  • the polynucleotide of the present invention may be DNA, RNA, or DNA / RNA chimera, but is preferably DNA.
  • the nucleic acid may be double-stranded or single-stranded, but is preferably single-stranded.
  • the polynucleotide of the present invention includes a complementary sequence of a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5, the complementarity of the complementary sequence is 100%.
  • the length of the continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or its complementary sequence contained in the polynucleotide of the present invention is 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, Preferably it is 20 nucleotides or more (for example, 25 nucleotides or more).
  • the upper limit of the length of the partial sequence or its complementary sequence is not particularly limited, but from the viewpoint of ease of synthesis and detection sensitivity of SNP, the length is usually 1000 nucleotides or less, preferably 100 nucleotides or less. More preferably, it is 50 nucleotides or less, More preferably, it is 30 nucleotides or less.
  • the length of the polynucleotide of the present invention is at least 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, and further preferably 20 nucleotides or more.
  • the upper limit of the length of the polynucleotide of the present invention is not particularly limited, but from the viewpoint of ease of synthesis, it is usually 1000 nucleotides or less, preferably 100 nucleotides or less, more preferably 50 nucleotides or less, and even more preferably 30 nucleotides or less. It is.
  • the polynucleotide of the present invention may contain an arbitrary additional sequence in addition to a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof.
  • the polynucleotide of the present invention contains an appropriate labeling agent such as a radioisotope (eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.), an enzyme (eg, ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase, etc.), fluorescent substances (eg, fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg, luminol, luminol derivatives, luciferin, lucigenin, etc.), etc. It may be labeled with.
  • a radioisotope eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.
  • an enzyme eg, ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase, peroxidase
  • the polynucleotide of the present invention is preferably isolated or purified.
  • the polynucleotide of the present invention can be used as a nucleic acid probe or primer for detecting SNPs 1 to 5, it is useful as a diagnostic agent for the onset risk of moyamoya disease associated with these SNPs.
  • SNP2 correlates with ischemic heart disease and the frequency of delivery of identical twins
  • the polynucleotide of the present invention contains SNP2
  • the polynucleotide contains the risk of developing ischemic heart disease, It is useful as a diagnostic agent for the possibility of delivery of identical twins (see sections 8 to 10 below).
  • the polynucleotide of the present invention can be used as a nucleic acid probe or primer for detecting SNPs 1 to 8, and thus is useful as a diagnostic agent for the onset risk of moyamoya disease associated with these SNPs. .
  • the present invention relates to 4766 T> C (SNP1), 73097 G> A (SNP2), 120764 G> A (SNP3), 152917 G> A in the nucleotide sequence represented by SEQ ID NO: 5. (SNP4) and 232102 G> A (SNP5)
  • SNP5 A method for determining the risk of developing Moyamoya disease comprising detecting at least one SNP selected from the group consisting of G> A (SNP5) is provided.
  • the present invention provides 4766 T> C (SNP1), 73097 G> A (SNP2), 12076 G> A (SNP3), 152917 G> A (SNP4) in the nucleotide sequence represented by SEQ ID NO: 5. Detecting at least one SNP selected from the group consisting of 232102 G> A (SNP5), 55777 G> A (SNP6), 55712 A> G (SNP7) and 57483 G> A (SNP8), A method for determining the risk of developing moyamoya disease is provided.
  • the determination method of the present invention includes the following steps (a) and (b): (A) detecting at least one SNP selected from the group consisting of SNP1, SNP2, SNP3, SNP4, and SNP5 in the nucleotide sequence represented by SEQ ID NO: 5 from a biological sample collected from an animal; (B) A step of evaluating the risk of developing Moyamoya disease based on the detected SNP type.
  • the determination method of the present invention includes the following steps (a ′) and (b ′): (A ′) detecting at least one SNP selected from the group consisting of SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7 and SNP8 in the nucleotide sequence represented by SEQ ID NO: 5 from a biological sample collected from an animal The step of: (B ') The process of evaluating the onset risk of moyamoya disease based on the detected SNP type.
  • At least one SNP selected from the group consisting of SNP1-5 (or SNP1-8) is detected in a biological sample collected from an animal (subject). Measure the type of the SNP.
  • an animal the above-mentioned 5. Mammals listed in the section are preferred, and humans are particularly preferred.
  • the human race is not particularly limited, but is preferably East Asian (East Asian / Mongoloid).
  • the human race is not particularly limited, but is preferably Caucasian (white).
  • the human race is preferably East Asian (East Asian / Mongoloid).
  • the human race is preferably Caucasian (white).
  • race is a group that can be distinguished as a specific subgroup in the Homo sapiens species. Race has a unique and distinguishable combination of genes and is identified by the characteristics (both mental and physical) created by the combination of genes. Members of the same race share a distinct genetic feature because they share a common genetic ancestry and, as a result, share similar gene combinations.
  • East Asian means a person who originated in Japan, Korea, China, Taiwan or Mongolia.
  • the East Asian is preferably a Japanese, a Korean, or a Chinese.
  • a person skilled in the art can easily identify the individual's race based on information on the individual's physical characteristics, country of origin, origin of ancestors, and the like.
  • any tissue, cell, body fluid, etc. from which genomic DNA can be collected can be used.
  • hair, nails, skin, mucous membrane, blood, plasma, serum, saliva and the like are preferably used.
  • the SNP detection method is well known in the art. For example, RFLP (restriction fragment length polymorphism) method, PCR-SSCP (single-stranded DNA higher-order structure polymorphism analysis) method, ASO (Allele Specific Oligonucleotide) hybridization method, sequencing method, ARMS (Amplification Refracting Mutation System) ) Method, denaturing gradient gel electrophoresis (Denaturing Gradient Gel Electrophoresis) method, RNAseA cleavage method, DOL (Dye-labeled Oligonucleotide Ligation) method, TaqMan PCR method, primer extension method, invader method and the like.
  • RFLP restriction fragment length polymorphism
  • PCR-SSCP single-stranded DNA higher-order structure polymorphism analysis
  • ASO Allele Specific Oligonucleotide hybridization method
  • sequencing method ARMS (Amplification Refracting Mutation System)
  • denaturing gradient gel electrophoresis Den
  • a minor allele (adenine) of SNP2 it can be determined that the risk of developing moyamoya disease is extremely high compared to the case where the minor allele is not detected.
  • SNP7 or 8 Since mutation of SNP7 or 8 is accompanied by amino acid substitution of mysterin, the amino acid substitution of mysterin caused by this minor allele of SNP7 or 8 may affect the onset of moyamoya disease. Thus, in one preferred embodiment of the invention, SNP 7 or 8 is detected.
  • DNA usually has a double helix structure consisting of two strands complementary to each other. Therefore, in the present specification, even when the DNA sequence in one strand is shown for convenience, the sequence (100% complementarity) complementary to the sequence (base) is also disclosed as a matter of course. Is interpreted. For those skilled in the art, if one DNA sequence (base) is known, a sequence (base) complementary to the sequence (base) is obvious. Therefore, taking SNP1 as an example, even when the base on the complementary strand corresponding to the base at position 4766 of the nucleotide sequence shown in SEQ ID NO: 5 is G (guanine), the subject is at risk of developing Moyamoya disease. , Can be determined to be relatively high.
  • nucleotide sequence disclosed in the present specification for example, the nucleotide sequence represented by SEQ ID NO: 5 and information on the SNP, and the nucleotide sequence disclosed in the sequence listing (represented by SEQ ID NO: 5).
  • Slight difference between the nucleotide sequence of the corresponding site on the subject's chromosome 17 DNA and the nucleotide sequence of the subject nucleotide sequence or a continuous partial sequence thereof or the complementary sequence thereof
  • nucleotide sequence derived from the subject by aligning the nucleotide sequence represented by SEQ ID NO: 5 with the nucleotide sequence derived from the subject.
  • nucleotide sequence disclosed in the present specification for example, the nucleotide sequence represented by SEQ ID NO: 5
  • the information on the SNP to use the nucleotide sequence disclosed in the sequence listing (SEQ ID NO: 5
  • a slight difference (deletion, substitution, addition) between the nucleotide sequence represented by (1) or a contiguous partial sequence thereof or a complementary sequence thereof and the nucleotide sequence of the corresponding site on the subject chromosome 17 DNA , Increase or decrease in the number of repetitive sequences, etc.) the nucleotide sequence represented by SEQ ID NO: 5 and the nucleotide sequence derived from the subject are aligned to obtain the nucleotide derived from the subject.
  • the SNP may be detected for at least one of the chromosome 17 of the subject.
  • the method of the present invention is selected from the group consisting of cytosine in SNP1, adenine in SNP2, adenine in SNP3, adenine in SNP4, adenine in SNP5, adenine in SNP6, guanine in SNP7, and adenine in SNP8. If at least one minor allele is detected in at least one allele, it can be determined that the risk of developing Moyamoya disease is relatively high compared to the case where the minor allele is not detected. That is, in the method of the present invention, the SNP may be detected for at least one of the chromosome 17 of the subject.
  • the mysterin polypeptide was isolated from the subject and the amino acid at position 4810 was The risk of developing moyamoya disease can also be determined by identification.
  • the mysterin polypeptide can be isolated by using a well-known method in the biochemical field such as antibody column chromatography.
  • the amino acid at position 4810 can be identified by using a peptide sequencer or a well-known method in the biochemical field such as mass spectrum.
  • the major allele of SNP2 gives arginine as amino acid 4810 of human mysterin polypeptide, and the minor allele of SNP2 gives lysine as amino acid 4810 of human mysterin polypeptide. Therefore, as a result of identifying the amino acid No. 4810, when lysine is detected, the risk of developing Moyamoya disease is relatively higher than when lysine is not detected (that is, when only arginine is detected). Can be determined.
  • the mutations in SNPs 6, 7 and 8 are amino acid substitution No. 4013 (aspartic acid ⁇ asparagine), amino acid substitution No. 3962 (aspartic acid ⁇ aspartic acid) and amino acid No. 4062 of human mysterin, respectively. Since the substitution (arginine ⁇ glutamine) is involved, the mysterin polypeptide is isolated from the subject, and the amino acids No. 4013, No. 3962 and No. 4062 are identified, respectively. It can be judged. The mysterin polypeptide can be isolated by using a well-known method in the biochemical field such as antibody column chromatography. Identification of amino acids Nos.
  • 4013, 3962, and 4062 can be performed by using a peptide sequencer or a well-known method in the biochemical field such as mass spectrum.
  • the major allele of SNP6 gives aspartic acid as amino acid 4013 of human mysterin polypeptide, and the minor allele of SNP6 gives asparagine as amino acid 4013 of human mysterin polypeptide. Accordingly, as a result of identifying amino acid No. 4013, when asparagine is detected, the risk of developing moyamoya disease is relatively higher than when asparagine is not detected (that is, when only aspartic acid is detected). It can be determined that the price is high.
  • the major allele of SNP7 gives asparagine as amino acid 3962 of human mysterin polypeptide, and the minor allele of SNP7 gives aspartic acid as amino acid 3962 of human mysterin polypeptide. Accordingly, as a result of identifying the amino acid No. 3962, when aspartic acid is detected, the risk of developing moyamoya disease is relative to when aspartic acid is not detected (that is, when only asparagine is detected). It can be determined to be high.
  • the major allele of SNP8 gives arginine as amino acid 4062 of human mysterin polypeptide, and the minor allele of SNP8 gives glutamine as amino acid 4062 of human mysterin polypeptide. Therefore, as a result of identifying amino acid No. 4062, when glutamine is detected, the risk of developing Moyamoya disease is relatively higher than when glutamine is not detected (that is, when only arginine is detected). Can be determined.
  • the present invention also provides a diagnostic agent for the onset risk of moyamoya disease, comprising a reagent for detecting at least one SNP selected from the group consisting of SNPs 1 to 5.
  • a nucleic acid probe capable of specifically detecting at least one SNP selected from the group consisting of SNP5) preferably SNP2
  • a primer capable of specifically amplifying a region containing the SNP. I can do it.
  • the present invention provides a diagnostic agent for the risk of developing Moyamoya disease, comprising a reagent for detecting at least one SNP selected from the group consisting of SNPs 1-8.
  • SNPs 1 to 8 As a reagent for detecting at least one SNP selected from the group consisting of SNPs 1 to 8, (1 ′) 4766 T> C (SNP1), 73097 G> A (SNP2), 120764 G> A (SNP3), 152917 G> A (SNP4), 232102 G> A in the nucleotide sequence represented by SEQ ID NO: 5 (SNP5), 55977 G> A (SNP6), 55712 A> G (SNP7) and 57483 G> A (SNP8) are specifically detected at least one SNP (preferably SNP2 or SNP6) selected from the group consisting of And (2 ′) a primer that can specifically amplify the region containing the SNP.
  • hybridization conditions include low stringency conditions.
  • the low stringent conditions are, for example, conditions of 42 ° C., 5 ⁇ SSC, 0.1% SDS, and preferably 50 ° C., 2 ⁇ SSC, 0.1% SDS in washing after hybridization. is there. More preferable hybridization conditions include highly stringent conditions.
  • High stringent conditions are, for example, 65 ° C., 0.1 ⁇ SSC, and 0.1% SDS.
  • factors affecting the stringency of hybridization include multiple factors such as temperature and salt concentration, and those skilled in the art can realize the same stringency by selecting these factors as appropriate. is there.
  • the nucleic acid probe of (1) or (1 ′) is preferably an affinity for the polynucleotide represented by SEQ ID NO: 5 wherein the SNP targeted by the nucleic acid probe is a major allele, and the SNP is a minor allele. There is a difference between the affinity for the polynucleotide represented by SEQ ID NO: 5 and it hybridizes to one of the major allele and minor allele under appropriate conditions (for example, highly stringent conditions). However, it does not hybridize to the other.
  • the probe of (1) is a polynucleotide comprising a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof, the partial sequence comprising 4766 T> C (SNP1), 73097 G> A (SNP2), 120764 G> A (SNP3), 152917 G> A (SNP4) and 232102 G> A (SNP5), wherein the SNP included in the partial sequence comprises at least one SNP selected from the group consisting of Examples of the polynucleotide include a major allele or a minor allele, and the partial sequence or its complementary sequence has a length of at least 12 nucleotides.
  • the polynucleotide includes at least one (1, 2, 3, 4 or 5, preferably 1) SNP selected from the group consisting of the above five SNPs. That is, in a preferred embodiment, the polynucleotide includes SNP1, SNP2, SNP3, SNP4 or SNP5. When detecting SNP1, the polynucleotide includes SNP1, when detecting SNP2, the polynucleotide includes SNP2, and when detecting SNP3, the polynucleotide includes SNP3. When SNP4 is detected, the polynucleotide includes SNP4, and when SNP5 is detected, the polynucleotide includes SNP5.
  • the SNP allele contained in the polynucleotide is a major allele or a minor allele. That is, when SNP1 is included in the polynucleotide of the present invention, the SNP is “T” or “C”; when SNP2 is included, the SNP is “G” or “A”; and SNP3 is included. The SNP is “G” or “A”; when SNP4 is included, the SNP is “G” or “A”; when SNP5 is included, the SNP is “G” or “A”. It is.
  • the probe of (1 ′) is a polynucleotide comprising a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof, and the partial sequence is 476647T> C ( SNP1), 73097 G> A (SNP2), 12076 G> A (SNP3), 15292929G> A (SNP4), 232102 G> A (SNP5), 55977 G> A (SNP6), 55712 A> G (SNP7) And at least one SNP selected from the group consisting of 57483 G> A (SNP8), the allele of the SNP included in the partial sequence is a major allele or a minor allele, and the partial sequence or its complementary sequence is Exemplified are polynucleotides having a length of at least 12 nucleotides.
  • the polynucleotide includes at least one (1, 2, 3, 4, 5, 6, 7 or 8, preferably 1) SNP selected from the group consisting of the above 6 SNPs. That is, in a preferred embodiment, the polynucleotide includes SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7 or SNP8. When detecting SNP1, the polynucleotide includes SNP1, when detecting SNP2, the polynucleotide includes SNP2, and when detecting SNP3, the polynucleotide includes SNP3. When SNP4 is detected, the polynucleotide includes SNP4.
  • the polynucleotide when detecting SNP5, the polynucleotide includes SNP5, and when detecting SNP6, the polynucleotide includes SNP4.
  • the nucleotide includes SNP6.
  • SNP7 is detected, the polynucleotide includes SNP7.
  • SNP8 is detected, the polynucleotide includes SNP8.
  • the SNP allele contained in the polynucleotide is a major allele or a minor allele. That is, when SNP1 is included in the polynucleotide of the present invention, the SNP is “T” or “C”; when SNP2 is included, the SNP is “G” or “A”; and SNP3 is included.
  • the SNP is “G” or “A”; when SNP4 is included, the SNP is “G” or “A”; when SNP5 is included, the SNP is “G” or “A”.
  • SNP6 is included, the SNP is “G” or “A”; when SNP7 is included, the SNP is “A” or “G”; when SNP8 is included, the SNP is “G” or “A”.
  • the polynucleotide that is the nucleic acid probe of (1) or (1 ') may be DNA, RNA, or DNA / RNA chimera, but is preferably DNA.
  • the nucleic acid may be double-stranded or single-stranded, but is preferably single-stranded.
  • the complementarity of the complementary sequence is preferably 100%.
  • the length of the continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or its complementary sequence contained in the polynucleotide is 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, still more preferably 20 nucleotides or more (for example, 25 nucleotides or more).
  • the upper limit of the length of the partial sequence or its complementary sequence is not particularly limited, but from the viewpoint of ease of synthesis and detection sensitivity of SNP, the length is usually 1000 nucleotides or less, preferably 100 nucleotides or less. More preferably, it is 50 nucleotides or less, More preferably, it is 30 nucleotides or less.
  • the length of the polynucleotide is at least 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, and further preferably 20 nucleotides or more.
  • the upper limit of the length of the polynucleotide of the present invention is not particularly limited, but from the viewpoint of ease of synthesis, it is usually 1000 nucleotides or less, preferably 100 nucleotides or less, more preferably 50 nucleotides or less, and even more preferably 30 nucleotides or less. It is.
  • the polynucleotide may contain an arbitrary additional sequence in addition to a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof.
  • the polynucleotide also contains an appropriate labeling agent such as a radioisotope (eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.), an enzyme (eg, ⁇ -galactosidase, ⁇ - Labeled with glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase, etc.), fluorescent substances (eg fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg luminol, luminol derivatives, luciferin, lucigenin, etc.) May be.
  • a radioisotope eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.
  • an enzyme eg, ⁇ -galactosidase, ⁇ - Labeled with glucosidase, alkaline phosphatase, peroxidase, mal
  • telomere amplification of SNP by primer refers to PCR amplification of a region containing a specific SNP of a DNA consisting of a nucleotide sequence represented by SEQ ID NO: 5 in a primer. This region means that PCR amplification is not performed.
  • the primer of the above (2) starts complementary strand synthesis toward the selected SNP site using a polynucleotide (for example, genomic DNA) containing at least one SNP selected from the group consisting of SNPs 1 to 5 as a template.
  • Primers that can be included are included.
  • the primer can also be expressed as a primer for providing an origin of replication on the 3 'side of the SNP site in the polynucleotide containing the SNP site.
  • the interval between the region where the primer hybridizes and the SNP site is arbitrary. A suitable length can be selected for the interval between the two according to the analysis method of the base at the SNP site.
  • the primer is designed so that an amplification product usually having a length of 25 to 500, for example, 50 to 200 nucleotides can be obtained as a region including the SNP site. be able to.
  • a person skilled in the art can design a primer suitable for each analysis method based on nucleotide sequence information about the surrounding DNA region including the SNP site.
  • the nucleotide sequence constituting the primer of the above (2) can be appropriately modified as well as the nucleotide sequence completely complementary to the partial sequence of the nucleotide sequence shown in SEQ ID NO: 5 or its complementary sequence.
  • the primer (2 ′) mentioned above is directed toward the selected SNP site using a polynucleotide (eg, genomic DNA) containing at least one SNP selected from the group consisting of SNPs 1 to 8 as a template. Primers capable of initiating complementary strand synthesis are included.
  • the primer can also be expressed as a primer for providing an origin of replication on the 3 'side of the SNP site in the polynucleotide containing the SNP site.
  • the interval between the region where the primer hybridizes and the SNP site is arbitrary. A suitable length can be selected for the interval between the two according to the analysis method of the base at the SNP site.
  • the primer is designed so that an amplification product usually having a length of 25 to 500, for example, 50 to 200 nucleotides can be obtained as a region including the SNP site. be able to.
  • a person skilled in the art can design a primer suitable for each analysis method based on nucleotide sequence information about the surrounding DNA region including the SNP site.
  • the nucleotide sequence constituting the primer (2 ') can be appropriately modified as well as a nucleotide sequence completely complementary to the partial sequence of the nucleotide sequence shown in SEQ ID NO: 5 or its complementary sequence.
  • the primers (2) and (2 ') may be DNA, RNA, or DNA / RNA chimera, but are preferably DNA.
  • the nucleic acid may be double-stranded or single-stranded, but is preferably single-stranded.
  • the length of the region in which the primers (2) and (2 ′) can hybridize to the nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 1 or a complementary sequence thereof is 12 nucleotides or more, preferably 15 nucleotides or more, more preferably Is 18 nucleotides or more, more preferably 20 nucleotides or more (for example, 25 nucleotides or more).
  • the upper limit of the length of the partial sequence or its complementary sequence is not particularly limited, but from the viewpoint of ease of synthesis, the length is usually 100 nucleotides or less, preferably 50 nucleotides or less, more preferably 30 nucleotides or less. It is.
  • the lengths of the primers (2) and (2 ') are at least 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, and further preferably 20 nucleotides or more.
  • the upper limit of the length of the polynucleotide of the present invention is not particularly limited, but from the viewpoint of ease of synthesis, the length is usually 100 nucleotides or less, preferably 50 nucleotides or less, more preferably 30 nucleotides or less. .
  • the primers (2) and (2 ') may contain an arbitrary additional sequence in addition to a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof.
  • the primer may be a suitable labeling agent such as a radioisotope (eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.), an enzyme (eg, ⁇ -galactosidase, ⁇ -glucosidase). , Alkaline phosphatase, peroxidase, malate dehydrogenase, etc.), fluorescent substances (eg fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg luminol, luminol derivatives, luciferin, lucigenin, etc.) It may be.
  • a radioisotope eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.
  • an enzyme eg, ⁇ -galactosidase, ⁇ -glucosidase.
  • Alkaline phosphatase eg, peroxidase, malate dehydrogenase
  • various enzymes, enzyme substrates, buffers, and the like can be combined depending on the SNP detection method.
  • the enzyme an enzyme necessary for various analysis methods exemplified as the method for detecting SNP, such as DNA polymerase, DNA ligase, or restriction enzyme, can be shown.
  • the buffer solution a buffer solution suitable for maintaining the activity of the enzyme used for these analyzes is appropriately selected.
  • the enzyme substrate for example, a substrate for complementary strand synthesis is used.
  • the diagnostic agent of the present invention When the diagnostic agent of the present invention is used, the risk of developing moyamoya disease can be easily determined by the determination method of the present invention.
  • the present invention provides a method for determining the risk of developing ischemic heart disease, comprising detecting 73097 G> A (SNP2) in the nucleotide sequence represented by SEQ ID NO: 5. To do.
  • the determination method of the present invention includes the following steps (a) and (b): (A) a step of detecting SNP2 in the nucleotide sequence represented by SEQ ID NO: 5 for a biological sample collected from an animal (subject); (B) A step of evaluating the risk of developing ischemic heart disease based on the detected SNP type.
  • Ischemic heart disease is a general term for diseases in which blood flow to the myocardium is blocked by coronary artery occlusion or stenosis, causing damage to the heart.
  • Examples of the ischemic heart disease include myocardial infarction and angina.
  • step (a) of the above method SNP2 is detected in a biological sample collected from an animal, and the type of the SNP is measured.
  • the animal the above-mentioned mammals are preferable, and a human is particularly preferable.
  • the human race is not particularly limited but is preferably East Asian (East Asian / Mongoloid).
  • East Asian means a person who originated in Japan, Korea, China, Taiwan or Mongolia.
  • the East Asian is preferably a Japanese, a Korean, or a Chinese.
  • a person skilled in the art can easily identify the individual's race based on information on the individual's physical characteristics, country of origin, origin of ancestors, and the like.
  • Human sex is not particularly limited, but is preferably a woman who seems to have few general risk factors.
  • the age of a human is not particularly limited, but is preferably 35 to 54 years old.
  • any tissue, cell, body fluid, etc. from which genomic DNA can be collected can be used, but from the viewpoint of easy availability and minimal invasiveness, Hair, nails, skin, mucous membrane, blood, plasma, serum, saliva and the like are preferably used.
  • the SNP detection method is well known in the art. For example, RFLP (restriction fragment length polymorphism) method, PCR-SSCP (single-stranded DNA higher-order structure polymorphism analysis) method, ASO (Allele Specific Oligonucleotide) hybridization method, sequencing method, ARMS (Amplification Refracting Mutation System) ) Method, denaturing gradient gel electrophoresis (Denaturing Gradient Gel Electrophoresis) method, RNAseA cleavage method, DOL (Dye-labeled Oligonucleotide Ligation) method, TaqMan PCR method, primer extension method, invader method and the like.
  • RFLP restriction fragment length polymorphism
  • PCR-SSCP single-stranded DNA higher-order structure polymorphism analysis
  • ASO Allele Specific Oligonucleotide hybridization method
  • sequencing method ARMS (Amplification Refracting Mutation System)
  • denaturing gradient gel electrophoresis Den
  • DNA usually has a double helix structure consisting of two strands complementary to each other. Therefore, in the present specification, even when the DNA sequence in one strand is shown for convenience, the sequence (100% complementarity) complementary to the sequence (base) is also disclosed as a matter of course. Is interpreted. For those skilled in the art, if one DNA sequence (base) is known, a sequence (base) complementary to the sequence (base) is obvious. Therefore, even when the base type of the site on the complementary strand corresponding to the site at position 73097 of the nucleotide sequence set forth in SEQ ID NO: 5 is T (thymine), the subject is at risk of developing ischemic heart disease, It can be determined that it is relatively high.
  • nucleotide sequence disclosed in the present specification for example, the nucleotide sequence represented by SEQ ID NO: 5 and information on the SNP, and the nucleotide sequence disclosed in the sequence listing (represented by SEQ ID NO: 5).
  • Slight difference between the nucleotide sequence of the corresponding site on the subject's chromosome 17 DNA and the nucleotide sequence of the subject nucleotide sequence or a continuous partial sequence thereof or the complementary sequence thereof
  • the nucleotide sequence derived from the subject by aligning the nucleotide sequence represented by SEQ ID NO: 5 with the nucleotide sequence derived from the subject. It is possible to accurately identify whether the base corresponds to SNP2 and detect SNP2. Such a case is also included in “detecting 73097 G> A (SNP2) in the nucleotide sequence represented by SEQ ID NO: 5”.
  • SNP2 may be detected for at least one of the chromosome 17 of the subject.
  • the mysterin polypeptide was isolated from the subject and the amino acid at position 4810 was Identification can also determine the onset risk of ischemic heart disease.
  • the mysterin polypeptide can be isolated by using a well-known method in the biochemical field such as antibody column chromatography.
  • the amino acid at position 4810 can be identified by using a peptide sequencer or a well-known method in the biochemical field such as mass spectrum.
  • the major allele of SNP2 gives arginine as amino acid 4810 of human mysterin polypeptide, and the minor allele of SNP2 gives lysine as amino acid 4810 of human mysterin polypeptide. Therefore, as a result of identifying the amino acid at position 4810, when lysine is detected, the risk of developing ischemic heart disease is relative to when lysine is not detected (that is, when only arginine is detected). It can be determined to be high.
  • the present invention also provides a diagnostic agent for the risk of developing ischemic heart disease, comprising a reagent for detecting SNP2.
  • the probe of (1) is preferably represented by SEQ ID NO: 5 having an affinity for the polynucleotide represented by SEQ ID NO: 5 in which SNP2 is a major allele (guanine), and the SNP2 is a minor allele (adenine). And hybridizes to one of the major and minor alleles under appropriate conditions (eg, the above highly stringent conditions), but to the other Does not hybridize.
  • the probe of (1) is a polynucleotide comprising a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof, the partial sequence comprising 73097 G> A (SNP2),
  • SNP2 73097 G> A
  • Examples of the polynucleotide include that the allele of the SNP contained in the partial sequence is a major allele or a minor allele, and the partial sequence or its complementary sequence has a length of at least 12 nucleotides.
  • the allele of SNP2 contained in the polynucleotide is a major allele (guanine) or a minor allele (adenine).
  • the polynucleotide may be DNA, RNA, or a DNA / RNA chimera, but is preferably DNA.
  • the nucleic acid may be double-stranded or single-stranded, but is preferably single-stranded.
  • the complementarity of the complementary sequence is preferably 100%.
  • the length of the continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or its complementary sequence contained in the polynucleotide is 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, still more preferably 20 nucleotides or more (for example, 25 nucleotides or more).
  • the upper limit of the length of the partial sequence or its complementary sequence is not particularly limited, but from the viewpoint of ease of synthesis and detection sensitivity of SNP, the length is usually 1000 nucleotides or less, preferably 100 nucleotides or less. More preferably, it is 50 nucleotides or less, More preferably, it is 30 nucleotides or less.
  • the length of the polynucleotide is at least 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, and further preferably 20 nucleotides or more.
  • the upper limit of the length of the polynucleotide of the present invention is not particularly limited, but from the viewpoint of ease of synthesis, it is usually 1000 nucleotides or less, preferably 100 nucleotides or less, more preferably 50 nucleotides or less, and even more preferably 30 nucleotides or less. It is.
  • the polynucleotide may contain an arbitrary additional sequence in addition to a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof.
  • the polynucleotide also contains an appropriate labeling agent such as a radioisotope (eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.), an enzyme (eg, ⁇ -galactosidase, ⁇ - Labeled with glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase, etc.), fluorescent substances (eg fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg luminol, luminol derivatives, luciferin, lucigenin, etc.) May be.
  • a radioisotope eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.
  • an enzyme eg, ⁇ -galactosidase, ⁇ - Labeled with glucosidase, alkaline phosphatase, peroxidase, mal
  • telomere amplification of SNP by primer refers to PCR amplification of a region containing a specific SNP of a DNA consisting of a nucleotide sequence represented by SEQ ID NO: 5 in a primer. This region means that PCR amplification is not performed.
  • the primer (2) includes a primer that can initiate complementary strand synthesis toward SNP2 using a polynucleotide containing SNP2 (eg, genomic DNA) as a template.
  • the primer can also be expressed as a primer for providing a replication origin on the 3 'side of SNP2 in a polynucleotide containing SNP2.
  • region which a primer hybridizes and SNP2 is arbitrary. A suitable length can be selected for the interval between the two according to the SNP base analysis method.
  • the primer in the case of a primer for analysis by DNA chip or direct sequencing, the primer should be designed so that an amplification product usually having a length of 25 to 500, for example, 50 to 200 nucleotides can be obtained as a region containing SNP2. Can do.
  • a person skilled in the art can design a primer according to the analysis method based on the nucleotide sequence information about the peripheral DNA region containing SNP2.
  • the nucleotide sequence constituting the primer of the above (3) can be appropriately modified as well as a nucleotide sequence completely complementary to the partial sequence of the nucleotide sequence shown in SEQ ID NO: 5 or its complementary sequence.
  • the primer (2) may be DNA, RNA, or DNA / RNA chimera, but is preferably DNA.
  • the nucleic acid may be double-stranded or single-stranded, but is preferably single-stranded.
  • the length of the region where the primer (2) can hybridize to the nucleic acid consisting of the nucleotide sequence set forth in SEQ ID NO: 1 or a complementary sequence thereof is 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, More preferably, it is 20 nucleotides or more (for example, 25 nucleotides or more).
  • the upper limit of the length of the partial sequence or its complementary sequence is not particularly limited, but from the viewpoint of ease of synthesis, the length is usually 100 nucleotides or less, preferably 50 nucleotides or less, more preferably 30 nucleotides or less. It is.
  • the length of the primer (2) is at least 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 18 nucleotides or more, and further preferably 20 nucleotides or more.
  • the upper limit of the length of the polynucleotide of the present invention is not particularly limited, but from the viewpoint of ease of synthesis, the length is usually 100 nucleotides or less, preferably 50 nucleotides or less, more preferably 30 nucleotides or less. .
  • the primer (2) above may contain an arbitrary additional sequence in addition to a continuous partial sequence of the nucleotide sequence represented by SEQ ID NO: 5 or its complementary sequence.
  • the primer may be a suitable labeling agent such as a radioisotope (eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.), an enzyme (eg, ⁇ -galactosidase, ⁇ -glucosidase). , Alkaline phosphatase, peroxidase, malate dehydrogenase, etc.), fluorescent substances (eg fluorescamine, fluorescein isothiocyanate, etc.), luminescent substances (eg luminol, luminol derivatives, luciferin, lucigenin, etc.) It may be.
  • a radioisotope eg, 125 I, 131 I, 3 H, 14 C, 32 P, 33 P, etc.
  • an enzyme eg, ⁇ -galactosidase, ⁇ -glucosidase.
  • Alkaline phosphatase eg, peroxidase, malate dehydrogenase
  • various enzymes, enzyme substrates, buffers, and the like can be combined depending on the SNP detection method.
  • the enzyme an enzyme necessary for various analysis methods exemplified as the method for detecting SNP, such as DNA polymerase, DNA ligase, or restriction enzyme, can be shown.
  • the buffer solution a buffer solution suitable for maintaining the activity of the enzyme used for these analyzes is appropriately selected.
  • the enzyme substrate for example, a substrate for complementary strand synthesis is used.
  • the diagnostic agent of the present invention When the diagnostic agent of the present invention is used, the risk of developing ischemic heart disease can be easily determined by the determination method of the present invention.
  • the present invention includes the possibility of delivery of identical twins, comprising detecting 73097 G> A (SNP2) in the nucleotide sequence represented by SEQ ID NO: 5. A determination method is provided.
  • the determination method of the present invention includes the following steps (a) and (b): (A) a step of detecting SNP2 in the nucleotide sequence represented by SEQ ID NO: 5 for a biological sample collected from an animal; (B) A step of evaluating the feasibility of identical twins based on the detected SNP type.
  • step (a) of the above method SNP2 is detected in a biological sample collected from an animal, and the type of the SNP is measured.
  • the animal the above-mentioned mammals are preferable, and a human is particularly preferable.
  • the human race is not particularly limited but is preferably East Asian (East Asian / Mongoloid).
  • East Asian means a person who originated in Japan, Korea, China, Taiwan or Mongolia.
  • the East Asian is preferably a Japanese, a Korean, or a Chinese.
  • a person skilled in the art can easily identify the individual's race based on information on the individual's physical characteristics, country of origin, origin of ancestors, and the like.
  • any tissue, cell, body fluid, etc. from which genomic DNA can be collected can be used, but from the viewpoint of easy availability and minimal invasiveness, Hair, nails, skin, mucous membrane, blood, plasma, serum, saliva and the like are preferably used.
  • the SNP detection method is well known in the art. For example, RFLP (restriction fragment length polymorphism) method, PCR-SSCP (single-stranded DNA higher-order structure polymorphism analysis) method, ASO (Allele Specific Oligonucleotide) hybridization method, sequencing method, ARMS (Amplification Refracting Mutation System) ) Method, denaturing gradient gel electrophoresis (Denaturing Gradient Gel Electrophoresis) method, RNAseA cleavage method, DOL (Dye-labeled Oligonucleotide Ligation) method, TaqMan PCR method, primer extension method, invader method and the like.
  • RFLP restriction fragment length polymorphism
  • PCR-SSCP single-stranded DNA higher-order structure polymorphism analysis
  • ASO Allele Specific Oligonucleotide hybridization method
  • sequencing method ARMS (Amplification Refracting Mutation System)
  • denaturing gradient gel electrophoresis Den
  • DNA usually has a double helix structure consisting of two strands complementary to each other. Accordingly, in the present specification, even when the DNA sequence in one strand is shown for convenience, the sequence (100% complementarity) complementary to the sequence (base) is also disclosed as a matter of course. Is interpreted. For those skilled in the art, if one DNA sequence (base) is known, a sequence (base) complementary to the sequence (base) is obvious. Therefore, even when the base type is T (thymine) for the site on the complementary strand of the sequence corresponding to the site at position 73097 of the nucleotide sequence shown in SEQ ID NO: 5, It can be determined that the frequency of delivery is relatively high.
  • T thymine
  • nucleotide sequence disclosed in the present specification for example, the nucleotide sequence represented by SEQ ID NO: 5 and information on the SNP, and the nucleotide sequence disclosed in the sequence listing (represented by SEQ ID NO: 5).
  • Slight difference between the nucleotide sequence of the corresponding site on the subject's chromosome 17 DNA and the nucleotide sequence of the subject nucleotide sequence or a continuous partial sequence thereof or the complementary sequence thereof
  • the nucleotide sequence derived from the subject by aligning the nucleotide sequence represented by SEQ ID NO: 5 with the nucleotide sequence derived from the subject. It is possible to accurately identify whether the base corresponds to SNP2 and detect SNP2. Such a case is also included in “detecting 73097 G> A (SNP2) in the nucleotide sequence represented by SEQ ID NO: 5”.
  • SNP2 may be detected for at least one of the chromosome 17 of the subject.
  • the mysterin polypeptide was isolated from the subject and the amino acid at position 4810 was Identification can also determine the feasibility of identical twins.
  • the mysterin polypeptide can be isolated by using a well-known method in the biochemical field such as antibody column chromatography.
  • the amino acid at position 4810 can be identified by using a peptide sequencer or a well-known method in the biochemical field such as mass spectrum.
  • the major allele of SNP2 gives arginine as amino acid 4810 of human mysterin polypeptide, and the minor allele of SNP2 gives lysine as amino acid 4810 of human mysterin polypeptide. Therefore, as a result of identification of amino acid No. 4810, when lysine was detected, the relative feasibility of identical twins compared to the case where lysine was not detected (that is, only arginine was detected). Can be determined to be high.
  • the present invention also provides a diagnostic agent for the feasibility of identical twins, including a reagent for detecting SNP2.
  • various enzymes, enzyme substrates, buffers, and the like can be combined depending on the SNP detection method.
  • the enzyme an enzyme necessary for various analysis methods exemplified as the method for detecting SNP, such as DNA polymerase, DNA ligase, or restriction enzyme, can be shown.
  • the buffer solution a buffer solution suitable for maintaining the activity of the enzyme used for these analyzes is appropriately selected.
  • the enzyme substrate for example, a substrate for complementary strand synthesis is used.
  • the diagnostic agent of the present invention When the diagnostic agent of the present invention is used, the possibility of delivery of identical twins can be easily determined by the determination method of the present invention.
  • Example 1 Identification of new SNPs and analysis of allele frequency of each SNP in patients with moyamoya disease Study population This study was approved by the Ethics Committee of Kyoto University School of Medicine and was written by all subjects. Obtained informed consent by. Two types of moyamoya disease case participants were enrolled in this study. The first type is a family unit participant selected to participate in this study due to the clear presence of one or more moyamoya disease cases in relatives. Thirty-four moyamoya probands, including 31 Japanese and 3 Koreans, were enrolled in this study. To verify the diagnosis, a history and risk factors for vascular disease were collected from the proband and its family members. recruited founder family members who were admitted to Kyoto University Hospital or other partner hospitals.
  • Genotyping, mapping and haplotype estimation were performed as previously described (Neurology vol70: 2357-2363, 2008). Briefly, genomic DNA was extracted from patient blood samples using the QIAamp DNA Blood Mini Kit (Qiagen GmbH, Hilden, Germany).
  • Genomic DNA extracted from peripheral blood was amplified by PCR with fluorescently labeled markers, and the PCR products were analyzed using ABI Prism 3100 Avant Genetic Analyzer (Applied Biosystems, Foster City, Calif.) And Genescan program. Detailed mapping markers were designed according to physical location information from NCBI Map Viewer (http://www.ncbi.nlm.nih.gov/mapview/). Linkage analysis was performed using a multipoint parametric linkage method assuming an autosomal dominant genetic model (J Neurol Neurosurg Psychiatry, vo. 77, pages 1025-1029, 2006 and Neurology vol70: 2357-2363, 2008). As previously reported, inevitable carriers were treated as those who developed (Neurology vol70: 2357-2363, 2008).
  • the phenotype of non-onset individuals was “unknown” and the “unrelated” spouse was “non-onset”. Based on an observed morbidity of 6.03 per 100,000 (Stroke, vol. 39, pages 42-47, 2008), the disease allele frequency should be set to 0.00003015, but even if asymptomatic In view of the recent increase in the number of patients diagnosed with moyamoya disease by magnetic resonance imaging (MRI) and MRA, the allele frequency is calculated from a lower LOD score by linkage analysis. It was set to 0.0001, which is considered to be strict (J Clin Neurosci, vol. 13, pages 334-338, 2006;). The phenotype replication frequency was assumed to be 0.00001.
  • the allele frequency of each microsatellite marker was estimated from all unrelated spouses using the Merlin software (Nat Genet, vol. 30, pages 97-101, 2002). Analysis was performed using GENEHUNTER version 2.0 (http://www.broad.mit.edu/ftp/distribution/software/genehunter/) (Am J Hum Genet, vol. 58, pages 1347-1363, 1996) .
  • Raptor was sequenced for a control region approximately 2 kbp upstream of the first exon. After PCR amplification and purification, sequencing was performed using an ABI Prism 3100 Avant DNA Sequencer (Applied Biosystems). We checked the Single Nucleotide Polymorphism database (dbSNP) for reference (http://www.ncbi.nlm.nih.gov/SNP/index.html).
  • SNPs Five mutations (SNPs) were identified in the 4 individuals who developed the pedigree in the sequence (Table 1).
  • the frequency of minor alleles of SNP1 to SNP5 was about 52% or more in non-familial moyamoya disease patients and extremely high, about 79% or more in familial moyamoya disease patients.
  • all familial moyamoya patients had minor alleles.
  • the frequency of minor alleles SNP1 to SNP5 remained around 2%. Therefore, it was shown that the risk of moyamoya disease can be determined by determining SNP1 to SNP5.
  • the minor allele of SNP2 may be a founder mutation of moyamoya disease in Asians.
  • the odds ratios for each SNPs are summarized in Table 11.
  • Example 2 Cloning and functional analysis of mysterin (cloning of mysterin) The predicted gene C17orf27 where SNP2 is located and the predicted gene KIAA1618 where SNP1 is located were cloned. Six cDNA fragments were obtained from mRNA recovered from the Human Embryonic Kidney 293 cell line by reverse transcription. They were combined using an endogenous restriction enzyme cleavage site to obtain a full-length cDNA.
  • KIAA1618 and C17orf27 are disclosed on the Internet homepage of NCBI as two independent genes (accession numbers: NP_066005.2 and NP_065965.3), but surprisingly, C17orf27 and KIAA1618 are complete structural genes respectively. Rather, it became clear that C17orf27 and KIAA1618 were linked together to constitute one structural gene encoding a huge protein consisting of about 5000 amino acids (FIG. 1). This new gene was named mysterin.
  • the cDNA sequence of human mysterin is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2, respectively.
  • ATPase activity of mysterin The amino acid sequence of human mysterin was analyzed for homology using the BLAST program. As a result, the regions of amino acids 2415-2436 and 2481-2494 showed strong homology with the known motifs Walker A and Walker B, respectively (FIG. 5). These motifs are conserved in dynein, proteasome, p97, FtsH, etc., and are NTP binding motif and divalent cation binding motif, respectively. These two motifs are known to have ATPase activity by conjugation. ing. From this, it was predicted that mysterin has ATPase activity.
  • a protein in which a GST tag is fused to the N-terminus of the region containing these motifs contained in human mysterin is expressed in E. coli and purified using glutathione sepharose. ATPase activity was measured.
  • the fusion protein is mixed with magnesium ions and ATP at a final concentration of 5 mM at the final concentration shown in FIG. 6, incubated for 30 minutes, mixed with PCA at a final concentration of 1% to stop the reaction, and then reacted with malachite green for 30 minutes. Incubated.
  • Example 3 Preparation of mysterin-deficient zebrafish and analysis thereof (site setting and preparation of mysterin-complementary DNA fragment) Since the mysterin ortholog gene of zebrafish (Danio rerio) was unidentified, the mysterin gene of zebrafish was identified based on the cDNA sequence of human mysterin, and the cDNA was cloned. As a result, two types of mysterin 1 (zRNF213) and mysterin 2 (zRNF213.1) existed, and mysterin 1 (zRNF213) was found to be a human homologous gene.
  • the cDNA sequence of zebrafish mysterin 1 is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO: 4, respectively.
  • the nucleotides at positions 2538 to 10462 of SEQ ID NO: 3 (corresponding to amino acids at positions 847 to 3487 in SEQ ID NO: 4) were actually cloned and the nucleotide sequence was determined experimentally. The remaining portion was subjected to amino acid prediction based on the nucleotide sequence that was gene-predicted by GENSCAN based on the zebrafish genomic sequence.
  • mysterin antisense morpholino hereinafter abbreviated as mysterin MO
  • mysterin MO a complementary DNA fragment for preparing a mysterin gene deficient.
  • the nucleotide sequence of mysterin MO is shown in SEQ ID NOs: 6 and 7.
  • zRNF213spMO1-A ACTCGTTGATGTCTGAAGTGATAAA (SEQ ID NO: 6)
  • zRNF213spMO1-D AGCTAGGAGAAAGTCCTACCAATTT (SEQ ID NO: 7)
  • zebrafish embryos 5 ng mysterin Mysterin MO for exon acceptor site and mysterin MO for donor site were implanted into zebrafish embryos at 1 to 8 cell stage.
  • the genetic background of the zebrafish embryo used at this time is a line expressing GFP specifically in vascular endothelial cells, fli-EGFP (Tg (fl1: egfp)) (Lawson ND and Weinstein BM, Developmental Biology 243: 307 -318 (2002)), this line is useful as a blood vessel imaging analysis tool.
  • Zebrafish were reared under artificial conditions of 14 h light period, 10 h dark period, and 28 ° C. Mating was performed by isolating zebrafish males and females before the incubator enters the dark period, and conversely with the males and females the next morning immediately after the light period. Eggs were collected within 30 minutes of fertilization and the above-described antisense morpholinos were injected into 60-180 eggs per test. The injected eggs were incubated in water containing methylene blue and 0.03% sea salt at 28 ° C.
  • the injected egg was rinsed with water containing methylene blue and 0.03% seawater salt and cultured in an incubator with an internal temperature of 28.5 ° C. Fluorescence was observed and confirmed in developing embryos after 72 hours of culture.
  • Example 4 Relationship between risk of developing ischemic heart disease and SNP2 Based on the frequency of the National Basic Life Survey conducted by the Ministry of Health, Labor and Welfare in 1998, the prevalence of ischemic heart disease was also observed in the age group. Compared with value. As a result, the prevalence of ischemic heart disease in relatively young women aged 35-54, who are generally assumed to be at low risk for ischemic heart disease, with minor alleles (founder mutations) of SNP2 was found to be significantly higher (Table 13).
  • Example 5 Possibility of delivery of identical twins and association with SNP2
  • Example 6 New SNPs related to moyamoya disease found in Caucasian families Genetic analysis was conducted on white spouses from the Czech Republic (CAU-Ped1, Fig. 11) and 12 sporadic cases in Germany.
  • the proband of the family (CAU_Ped1_12) developed a mild ischemic stroke at the age of 30, and his mother died at the age of 35 due to ischemic stroke.
  • the proband had four offspring with two unrelated spouses.
  • the second child (CAU_Ped1_122) with the first spouse was diagnosed with moyamoya disease at the age of five.
  • Genomic DNA was extracted from the blood of the proband father, and direct sequencing was performed on all coding regions of the seven genes SLC26A11, KIAA1618, LOC100287062, C17orf27, FLJ35220, LOC728991, and NPTX1, and 165 variant (registered: 133) Pieces, unregistered: 32 pieces).
  • an unregistered variant present in the coding region is one of C17orf27 (SEQ ID NO: 5, 55777 position G> A; human mysterin No. 4013 amino acid substitution (aspartic acid ⁇ asparagine) (D4013N)) It was only. This variant was inherited by three children with moyamoya disease (FIG. 11).
  • D4013N, N3962D, R4062Q allele was not found, and the allele frequency in the Caucasian population was 1% or less, It was considered a mutation. Based on the above, it was concluded that D4013N allele is a mutation causing causative Moyamoya disease. D4013N is located in the RING finger domain, but biochemical analysis did not affect ubiquitin ligase activity.
  • a polypeptide of a novel gene mysterin a polynucleotide encoding the polypeptide, an expression vector, an animal containing a mysterin functional defect, and the like are provided.
  • Comprehensive analysis of the human genome gene sequence predicted the existence of two independent structural genes, C17orf27 and KIAA1618, at the mysterin locus, but C17orf27 and KIAA1618 are not complete structural genes, respectively. It became clear that KIAA1618 was connected to one to constitute the mysterin locus. Analysis of knockdown zebrafish of the mysterin gene revealed that mysterin has a function of regulating angiogenesis.
  • the present invention also provides new SNPs that exist at or near the mysterin locus.
  • the SNPs correlate with the frequency of moyamoya disease, ischemic heart disease, and the frequency of delivery of identical twins. By analyzing this SNPs, the risk of developing moyamoya disease and ischemic heart disease, the delivery of identical twins It is possible to determine the possibility.
  • This application is based on Japanese Patent Application No. 2009-244938 filed in Japan (filing date: October 23, 2009), the contents of which are incorporated in full herein.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne un gène inédit, connu sous le nom de « Mystérine », qui participe à l'obstruction artérielle au niveau de la partie terminale de l'artère carotide interne, ainsi qu'à la néogenèse, qui constituent les lésions fondamentales de la maladie de Moya-Moya, un polypeptide connu sous le nom de « Mystérine », un polynucléotide codant pour ledit polypeptide et ainsi de suite. L'invention concerne également de multiples polymorphismes mononucléotidiques liés à la maladie de Moya-Moya qui sont présents au niveau du locus de la Mystérine et dans son voisinage. Il est possible de déterminer le risque de survenue de la maladie de Moya-Moya grâce à une détection de ces polymorphismes mononucléotidiques.
PCT/JP2010/068737 2009-10-23 2010-10-22 Gène associé à la maladie de moya-moya et son utilisation WO2011049207A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2011537321A JP5854423B2 (ja) 2009-10-23 2010-10-22 モヤモヤ病関連遺伝子及びその利用

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2009244938 2009-10-23
JP2009-244938 2009-10-23

Publications (1)

Publication Number Publication Date
WO2011049207A1 true WO2011049207A1 (fr) 2011-04-28

Family

ID=43900430

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/068737 WO2011049207A1 (fr) 2009-10-23 2010-10-22 Gène associé à la maladie de moya-moya et son utilisation

Country Status (2)

Country Link
JP (1) JP5854423B2 (fr)
WO (1) WO2011049207A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160010269A (ko) * 2014-12-01 2016-01-27 이화여자대학교 산학협력단 SNAR-G2 유전자 프로모터의 CpG 메틸화 변화를 이용한 모야모야병 진단용 조성물 및 이의 이용
CN110396525A (zh) * 2019-07-03 2019-11-01 中山大学附属第一医院 Rnf213基因完整敲除纯合子斑马鱼的制备方法和用途
WO2019225803A1 (fr) * 2018-05-25 2019-11-28 의료법인 성광의료재단 Association entre un polymorphisme de nucléotide simple de rnf213 et un risque de développer une maladie de moyamoya chez les coréens

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5822293B2 (ja) * 2011-08-10 2015-11-24 公立大学法人横浜市立大学 Ｒｎｆ２１３遺伝子多型による重症もやもや病の予測方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005514903A (ja) * 2001-05-18 2005-05-26 インサイト・ゲノミックス・インコーポレイテッド 受容体と膜結合タンパク質
WO2009042680A2 (fr) * 2007-09-24 2009-04-02 Board Of Regents Of The University Of Texas System Détection des mutations de acta2 et myh11 pour évaluer le risque de maladie vasculaire

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005514903A (ja) * 2001-05-18 2005-05-26 インサイト・ゲノミックス・インコーポレイテッド 受容体と膜結合タンパク質
WO2009042680A2 (fr) * 2007-09-24 2009-04-02 Board Of Regents Of The University Of Texas System Détection des mutations de acta2 et myh11 pour évaluer le risque de maladie vasculaire

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CHEN M. ET AL: "A novel heterozygous missense mutation 377T > C (V126A) of TGIF gene in a family segregated with holoprosencephaly and moyamoya disease", PRENAT.DIAGN., vol. 26, no. 3, 2006, pages 226 - 230 *
KANG H.S. ET AL: "Single Nucleotide Polymorphisms of Tissue Inhibitor of Metalloproteinase Genes in Familial Moyamoya Disease", NEUROSURGERY, vol. 58, no. 6, 2006, pages 1074 - 1080 *
MINEHARU Y. ET AL: "Autosomal dominant moyamoya disease maps to chromosome 17q25.3", NEUROLOGY, vol. 70, no. 24, 2008, pages 2357 - 2363 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160010269A (ko) * 2014-12-01 2016-01-27 이화여자대학교 산학협력단 SNAR-G2 유전자 프로모터의 CpG 메틸화 변화를 이용한 모야모야병 진단용 조성물 및 이의 이용
KR101596357B1 (ko) 2014-12-01 2016-02-22 이화여자대학교 산학협력단 SNAR-G2 유전자 프로모터의 CpG 메틸화 변화를 이용한 모야모야병 진단용 조성물 및 이의 이용
WO2019225803A1 (fr) * 2018-05-25 2019-11-28 의료법인 성광의료재단 Association entre un polymorphisme de nucléotide simple de rnf213 et un risque de développer une maladie de moyamoya chez les coréens
KR102063486B1 (ko) 2018-05-25 2020-01-09 의료법인 성광의료재단 Rnf213 단일염기다형성과 한국인 모야모야병 발병 위험도의 연관성
CN110396525A (zh) * 2019-07-03 2019-11-01 中山大学附属第一医院 Rnf213基因完整敲除纯合子斑马鱼的制备方法和用途

Also Published As

Publication number Publication date
JP5854423B2 (ja) 2016-02-09
JPWO2011049207A1 (ja) 2013-03-14

Similar Documents

Publication Publication Date Title
JP2011013231A5 (ja) ビタミンｋエポキシド還元酵素複合体サブユニット１ ｖｋｏｒｃ１、クマリンおよびその誘導体の治療標的
JP4777251B2 (ja) ビタミンｋエポキシド還元酵素複合体サブユニット１ｖｋｏｒｃ１、クマリンおよびその誘導体の治療標的
JPWO2015108180A6 (ja) 痛風発症関連分子、並びに、尿酸関連疾患素因及び炎症関連疾患素因の評価方法及び評価キット、検査体及び薬
JPWO2015108180A1 (ja) 痛風発症関連分子、並びに、尿酸関連疾患素因及び炎症関連疾患素因の評価方法及び評価キット、検査体及び薬
JP2007512002A5 (fr)
JP2004520005A (ja) オステオレビン遺伝子多型性
JP5854423B2 (ja) モヤモヤ病関連遺伝子及びその利用
JP4146353B2 (ja) マウス精子形成遺伝子とヒト男性不妊関連遺伝子、ならびにこれらを用いた診断システム
US20060172322A1 (en) Mutations in the C7orf11 (TTDN1) gene causative of non-photosensitive trichothiodystrophy
CN112996542A (zh) 用于淋巴系统病症的诊断和治疗的组合物和方法
DK2037948T3 (en) Detection and treatment of dementia
US20040152088A1 (en) Methods for diagnosing and treating heart disease
US20060223063A1 (en) Method of diagnosis of type 2 diabetes and early onset thereof
CA2852631A1 (fr) Un gene et ses mutations associees a une crise d'epilepsie et a des troubles moteurs
JP5804341B2 (ja) エストロゲン関連疾患の判定方法
US7507531B2 (en) Use of 5-lipoxygenase activating protein (FLAP) gene to assess susceptibility for myocardial infarction
JP2013039065A (ja) 自己炎症疾患又は自己免疫疾患関連遺伝子及びその利用
AU2004247896B2 (en) Mutations in the SLC40A1 gene associated to impaired iron homeostasis
US20150031569A1 (en) Mutations of the GPR179 Gene in Congenital Stationary Night Blindness
AU2002354947B2 (en) Methods for diagnosing and treating diseases and conditions of the digestive system and cancer
WO2013142286A1 (fr) Modifications génétiques associées à l'autisme et au phénotype autistique dans la population israélienne, et leurs procédés d'utilisation pour le diagnostic et le traitement de l'autisme
US10125395B2 (en) Genetic alterations and methods of use thereof for the diagnosis and treatment of type I diabetes
WO2022056028A1 (fr) Modifications génétiques associées à l'œsophagite à éosinophiles et leurs procédés d'utilisation pour le diagnostic et le traitement d'une maladie
Rainger et al. Loss of the BMP Antagonist
WO2011061184A1 (fr) Procédés pour diagnostiquer des maladies cutanées

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10825056

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2011537321

Country of ref document: JP

122 Ep: pct application non-entry in european phase

Ref document number: 10825056

Country of ref document: EP

Kind code of ref document: A1