WO2011016461A1 - Inhibiteur angiogenèse tumorale - Google Patents

Inhibiteur angiogenèse tumorale Download PDF

Info

Publication number
WO2011016461A1
WO2011016461A1 PCT/JP2010/063124 JP2010063124W WO2011016461A1 WO 2011016461 A1 WO2011016461 A1 WO 2011016461A1 JP 2010063124 W JP2010063124 W JP 2010063124W WO 2011016461 A1 WO2011016461 A1 WO 2011016461A1
Authority
WO
WIPO (PCT)
Prior art keywords
nsg1
seq
gene
cells
amino acid
Prior art date
Application number
PCT/JP2010/063124
Other languages
English (en)
Japanese (ja)
Inventor
京子 樋田
泰浩 樋田
嗣輝 大坪
幹雄 青木
剛之 岩崎
敏裕 甲斐
英史 佐藤
Original Assignee
大日本住友製薬株式会社
国立大学法人北海道大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 大日本住友製薬株式会社, 国立大学法人北海道大学 filed Critical 大日本住友製薬株式会社
Priority to JP2011525899A priority Critical patent/JP5669271B2/ja
Publication of WO2011016461A1 publication Critical patent/WO2011016461A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6875—Nucleoproteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to an angiogenesis inhibitor, and more particularly, to a substance having an activity of suppressing migration of tumor vascular endothelial cells and useful as a pharmaceutical agent such as a cancer therapeutic agent or a preventive agent, a screening method thereof, and the like.
  • angiogenesis is indispensable for cell growth, and when malignant tumors grow, tumor cells themselves produce angiogenesis-promoting substances and induce angiogenesis in order to obtain nutrients and oxygen necessary for growth. .
  • Angiogenesis is also induced when a malignant tumor metastasizes to another organ or site, and tumor cells move along the bloodstream.
  • angiogenesis which is a source of nutrients and oxygen for tumor cells
  • the tumor cell falls into a nutrient or oxygen-depleted state, and as a result, the therapeutic effect of suppressing the growth of the tumor cell and regression is achieved.
  • tumor blood vessels reaching the tumor are mentioned.
  • Tumors containing cancer cells produce angiogenesis-promoting substances when they are about 1 to 2 mm 3 in size, ingest the nutrients and oxygen necessary for the growth of the cells themselves, and develop a system for carrying away metabolic waste products. To build. This system promotes the initial growth of the cells.
  • angiogenesis inhibitors have been studied using vascular endothelial cell lines and normal vascular endothelial cells, but recently, it has become clear that the properties of tumor blood vessels and normal blood vessels are very different (non- (See Patent Document 1). For example, normal blood vessels have an ordered hierarchy of arteries, veins, and capillaries, while tumor blood vessels run disorderly.
  • tumor vascular endothelial cells ashesion, etc.
  • pericytes which enhances blood vessel permeability.
  • tumor blood vessels are immature blood vessels compared with normal blood vessels.
  • the conventional method using normal vascular endothelial cells is insufficient to find an ideal target for angiogenesis inhibitor as a cancer therapeutic agent.
  • the present inventors have established a technique for separating and culturing tumor vascular endothelial cells in order to search for a target factor of an ideal angiogenesis inhibitor.
  • neuron-specific gene family member 1 is a protein that is specifically expressed in the brain (see Non-Patent Document 2), and is a D1 dopamine receptor binding protein, calcine. Since it has a syon domain (D1 dopamine receptor-interacting, calcyon domain) in its molecule, it is presumed to be involved in dopamine receptor signaling. It also binds to syntaxin-13, an intracellular transport regulator molecule that is highly expressed in the developing brain, and transports or synapses cell membrane proteins such as AMPA-type glutamate receptor, transferrin receptor, and neuronal cell adhesion molecule L1. It has been reported to facilitate transport (see Non-Patent Documents 3 and 4). However, its physiological function is unknown, and it is known that NSG1 is highly expressed in tumor vascular endothelial cells and that migration of tumor vascular endothelial cells is suppressed by suppressing NSG1 expression or function. It was not done.
  • the problem to be solved by the present invention is an angiogenesis inhibitor, more specifically, a substance having an activity of suppressing migration of tumor vascular endothelial cells and useful as a pharmaceutical agent such as a cancer therapeutic agent or a preventive agent, and a screening method thereof It is to provide.
  • the inventors of the present application conducted isolation and culture of tumor vascular endothelial cells and conducted intensive studies. As a result, isolation of factors involved in migration of tumor vascular endothelial cells was performed. And succeeded in isolating substances that suppress the expression or function of the factor. That is, the present inventors have found NSG1 as a factor that is highly expressed in tumor vascular endothelial cells compared to normal vascular endothelial cells, and further, siRNA that inhibits NSG1 expression migrates to tumor vascular endothelial cells. It was found to show inhibitory activity. The present invention has been completed based on the above findings.
  • an antitumor agent comprising a substance that suppresses the expression or function of NSG1 as an active ingredient; [2] The agent according to [1], wherein the substance is a substance selected from the group consisting of the following (1) to (3), which suppresses the expression of NSG1: (1) an antisense nucleic acid against a transcription product of a gene encoding NSG1, (2) a ribozyme nucleic acid for the transcription product of the gene encoding NSG1, (3) a nucleic acid having RNAi activity for a transcription product of a gene encoding NSG1 or a precursor thereof; [3] The agent according to [1], wherein the substance is an antibody that binds to NSG1; [4] The agent according to any one of [1] to [3], wherein NSG1 is a protein comprising an amino acid sequence selected from the following (a) to (e): (A) the amino acid sequence represented by SEQ ID NO: 2, (B) In the amino acid sequence represented
  • a method for screening an angiogenesis inhibitor which comprises selecting a compound that reduces the expression level of a gene encoding NSG1;
  • a method for screening an angiogenesis inhibitor which comprises selecting a compound that decreases the function of NSG1;
  • angiogenesis inhibitor more specifically, a substance having an activity of suppressing migration of tumor vascular endothelial cells and useful as a pharmaceutical agent such as a cancer therapeutic agent or a preventive agent, and a screening method thereof. Became.
  • FIG. 1 It is a figure which shows the result of having compared the expression level of mouse
  • the vertical axis shows the expression level (Quantity value) of NSG1 mRNA.
  • normal vascular endothelial cells vascular endothelial cells collected from the skin tissue of normal mice were used.
  • Tumor vascular endothelial cells include vascular endothelial cells collected from tumor tissues of mice transplanted with HSC3 (human tongue cancer cells), OSRC2 (human kidney cancer cells), and A375SM (human highly metastatic melanoma cells). Using.
  • Mouse NSG1 expression was shown to be significantly higher in mouse primary tumor vascular endothelial cells compared to mouse primary normal vascular endothelial cells.
  • the present invention provides an angiogenesis inhibitor, specifically a tumor vascular endothelial cell migration inhibitor, comprising a substance that suppresses expression of NSG1 or a substance that suppresses function.
  • NSG1 is a known protein, known as Genbank Accession No .: NP_001035190, or Genbank Accession No .: NP_055207, SEQ ID NO: 2 or 4. It is a protein comprising the amino acid sequence of human NSG1 represented or an amino acid sequence substantially identical thereto.
  • NSG1 is a cell of a human or other warm-blooded animal (eg, guinea pig, rat, mouse, chicken, rabbit, dog, pig, sheep, cow, monkey, etc.) [eg, human fetal kidney cell HEK293, human Teratocarcinoma cell line derived from fetal testis NTera-2 etc.] or any tissue from which these cells are derived [eg fetal tissue etc.] or tissues expressed in vivo [eg brain etc.] It may be isolated and purified by a protein separation and purification technique.
  • a human or other warm-blooded animal eg, guinea pig, rat, mouse, chicken, rabbit, dog, pig, sheep, cow, monkey, etc.
  • human fetal kidney cell HEK293, human Teratocarcinoma cell line derived from fetal testis NTera-2 etc. or any tissue from which these cells are derived [eg fetal tissue etc.] or tissues expressed in vivo
  • amino acid sequence represented by SEQ ID NO: 2 or substantially the same amino acid sequence examples include the following (a) to (e): (A) the amino acid sequence represented by SEQ ID NO: 2; (B) In the amino acid sequence represented by SEQ ID NO: 2, one or more amino acids are deleted, added, inserted or substituted, and the following properties (1) to (3): (1) constitutes a protein capable of binding to syntaxin-13; (2) constitutes a protein having the intracellular transport function of cell membrane proteins; (3) can be recognized by an antibody that specifically recognizes a protein consisting of the amino acid sequence represented by SEQ ID NO: 2; An amino acid sequence having at least one of: (C) an amino acid sequence having 80% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having at least one of the above properties (1) to (3); (D) an amino acid sequence encoded by DNA having the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3; (E) encoded by a DNA that hybridizes under stringent conditions with a DNA
  • amino acid sequence of an ortholog in the mammal of the human protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or the human protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or a splice of the ortholog thereof examples include amino acid sequences in variants, allelic variants or polymorphic variants.
  • “homology” refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably the algorithm uses a sequence of sequences for optimal alignment). The percentage of identical and similar amino acid residues relative to all overlapping amino acid residues in which one or both of the gaps can be considered).
  • Similar amino acids means amino acids that are similar in physicochemical properties, such as aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn) ), Basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids with hydroxyl groups (Ser, Thr), amino acids with small side chains (Gly, Ala, Ser, Thr, Met), etc. Examples include amino acids classified into groups. It is expected that substitution with such similar amino acids will not change the phenotype of the protein (ie, is a conservative amino acid substitution). Specific examples of conservative amino acid substitutions are well known in the art and are described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).
  • Other algorithms for determining amino acid sequence homology include, for example, the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. Embedded in the program (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 1997 (1997))], Needleman et al., J. Mol.
  • the stringent conditions in the above (e) are, for example, the conditions described in Current Protocols, in Molecular, Biology, John, Wiley, & Sons, 6.3.1-6.3.6, 1999, for example, 6 ⁇ SSC (sodium chloride / sodium citrate) / 45 ° C., followed by one or more washes at 0.2 ⁇ SSC / 0.1% SDS / 50-65 ° C., but those skilled in the art will give equivalent stringency.
  • Hybridization conditions can be appropriately selected.
  • amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 is about 80% or more, preferably about 90% or more, with the amino acid sequence represented by SEQ ID NO: 2. More preferred is an amino acid sequence having an identity of about 95% or more, more preferably about 97% or more, particularly preferably about 98% or more, and most preferably about 99% or more.
  • a protein comprising an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 comprises an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2, and SEQ ID NO: 2 is a protein having substantially the same function as the protein consisting of the amino acid sequence represented by 2.
  • substantially the same function means that the properties are qualitatively the same, for example, physiologically or pharmacologically, and the degree of function (eg, about 0.1 to about 10 Times, preferably 0.5 to 2 times) and quantitative factors such as the molecular weight of the protein may be different.
  • NSG1 in vivo, that is, physiological function is unknown at present, (1) Whether it has the ability to bind to syntaxin-13 (2) A protein having an intracellular transport function of a cell membrane protein, or (3) a protein that can be recognized by an antibody that specifically recognizes a protein consisting of the amino acid sequence represented by SEQ ID NO: 2, It can be regarded as a “functional protein”.
  • the binding ability between NSG1 and syntaxin-13 can be measured according to the method described in Non-Patent Document 4.
  • a plasmid DNA expressing syntaxin-13 added with a myc tag and a plasmid DNA expressing NSG1 added with an EE tag are co-introduced into COS-7 cells, and the cells are extracted. Prepare the solution. After recovering the complex of syntaxin-13 and NSG1 by immunoprecipitation using an anti-myc antibody (or anti-EE antibody) in the cell extract, the complex is obtained by Western blotting using an anti-EE antibody (or anti-myc antibody). What is necessary is just to detect a body. Further, the intracellular transport function of cell membrane proteins can be measured by the method described in Non-Patent Document 4.
  • NSG1 in the present invention for example, (i) 1 to 50, preferably 1 to 30, more preferably 1 to 10, more preferably 1 to 1 in the amino acid sequence represented by SEQ ID NO: 2.
  • amino acid sequence represented by SEQ ID NO: 2 1 to 50, preferably 1 to 30, more preferably 1 to 10, more preferably 1 to a number (5, 4, 3 Or 2) an amino acid sequence in which one amino acid is substituted with another amino acid, or (v) a so-called mutein such as a protein containing an amino acid sequence combining them.
  • amino acid sequence is inserted, deleted, added or substituted as described above, the position of the insertion, deletion, addition or substitution is determined by whether the protein has the ability to bind to syntaxin-13 or the cell membrane protein cell.
  • NSG1 include, for example, a human protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (Genbank Accession No. NP_001035190), or an ortholog thereof in other mammals (eg, mouse NSG1 protein (SEQ ID NO: 6, Genbank Accession No. NP_035072), rat NSG1 (Genbank Accession No. NP_077042), etc.), allelic variants, polymorphic variants [eg single nucleotide polymorphisms (SNPs)] and the like.
  • SNPs single nucleotide polymorphisms
  • the “gene encoding NSG1” is a gene having the amino acid sequence represented by SEQ ID NO: 2 shown in the above (a) to (e) or a nucleotide sequence encoding an amino acid sequence substantially identical thereto.
  • the amino acid sequence represented by SEQ ID NO: 2 one or more amino acids are deleted, added, inserted or substituted, and the following (1) to (3) properties: (1) constitutes a protein capable of binding to syntaxin-13; (2) constitutes a protein having the intracellular transport function of cell membrane proteins; (3) can be recognized by an antibody that specifically recognizes a protein consisting of the amino acid sequence represented by SEQ ID NO: 2;
  • a base sequence encoding an amino acid sequence having at least one of (H) a base sequence encoding an amino acid sequence having 80% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having at least one of the
  • the gene may be any of DNA such as cDNA or genomic DNA, or RNA such as mRNA, and is a concept including both a single-stranded nucleic acid sequence and a double-stranded nucleic acid sequence.
  • the nucleic acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 and the like are DNA sequences for convenience.
  • RNA sequences such as mRNA are shown, thymine ( Solve T) as uracil (U).
  • “substance that suppresses NSG1 expression” refers to the transcription level of NSG1-encoding gene (NSG1 gene), the level of post-transcriptional regulation, the level of translation to NSG1, and post-translational modification. It may act at any stage, such as the level of. Therefore, substances that suppress NSG1 expression include, for example, substances that inhibit transcription of the NSG1 gene (eg, antigenes), substances that inhibit the processing of early transcripts into mRNA, and mRNA transport to the cytoplasm.
  • substances that suppress NSG1 expression include, for example, substances that inhibit transcription of the NSG1 gene (eg, antigenes), substances that inhibit the processing of early transcripts into mRNA, and mRNA transport to the cytoplasm.
  • Substances that inhibit translation of NSG1 from mRNA eg, antisense nucleic acid, miRNA or those that degrade mRNA (eg, siRNA, ribozyme), substances that inhibit post-translational modification of the initial translation product, etc. .
  • mRNA eg, antisense nucleic acid, miRNA
  • degrade mRNA eg, siRNA, ribozyme
  • substances that inhibit post-translational modification of the initial translation product etc.
  • a substance selected from the group consisting of the following (1) to (3) is exemplified.
  • a preferable example of the transcript is mRNA.
  • nucleic acid containing As a substance that specifically inhibits the translation of mRNA of NSG1 gene from NSG1 (or degrades mRNA), preferably a base sequence complementary to or substantially complementary to the base sequence of these mRNAs or a part thereof
  • the nucleic acid containing is mentioned.
  • the nucleotide sequence substantially complementary to the nucleotide sequence of mRNA of NSG1 gene can bind to the mRNA target sequence and inhibit its translation under physiological conditions of tumor blood vessels that are mammalian target tissues. It means a base sequence having a degree of complementarity (or that cleaves the target sequence).
  • a base sequence that is completely complementary to the base sequence of the mRNA that is, a base sequence of a complementary strand of the mRNA
  • NCBI BLAST National Center for Biotechnology Information Basic Local Alignment Search Tool
  • the base sequence complementary or substantially complementary to the base sequence of mRNA of NSG1 gene includes the following (k) or (l): (k) a base sequence complementary or substantially complementary to the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3; (l) A nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 under stringent conditions, and the following properties (1) to (3): (1) has the ability to bind to syntaxin-13; (2) has a function of intracellular transport of cell membrane proteins; (3) can be recognized by an antibody that specifically recognizes a protein consisting of the amino acid sequence represented by SEQ ID NO: 2; A base sequence complementary or substantially complementary to a sequence encoding a protein having at least one of: Is mentioned.
  • the stringent conditions are as described above.
  • human NSG1 comprising the nucleotide sequence represented by SEQ ID NO: 1 (Genbank Accession No. NM_001040101) or the nucleotide sequence represented by SEQ ID NO: 3 (Genbank Accession No. NM_014392) mRNA or their orthologs in other mammals (eg, mouse NSG1 (SEQ ID NO: 5, Genbank Accession No. NM_010942), rat NSG1 (Genbank Accession No. NM_024128), etc.), and their splice variants, allelic variants And polymorphic variants.
  • SEQ ID NO: 1 Genbank Accession No. NM_001040101
  • SEQ ID NO: 3 Genbank Accession No. NM_014392
  • the nucleotide sequence of the NSG1 gene mRNA and the “part of the complementary or substantially complementary nucleotide sequence” are capable of specifically binding to the mRNA of the NSG1 gene and translating proteins from the mRNA.
  • the length and the position are not particularly limited as long as they can inhibit (or degrade the mRNA), but at least 10 bases that are complementary or substantially complementary to the target sequence from the viewpoint of sequence specificity. As mentioned above, it preferably contains about 15 bases or more.
  • the nucleic acid containing one of the following (1) to (3) is preferably exemplified as a nucleic acid complementary to or substantially complementary to the nucleotide sequence of mRNA of NSG1 gene or a part thereof: Is: (1) antisense nucleic acid against mRNA of NSG1 gene, (2) Ribozyme nucleic acid against mRNA of NSG1 gene, (3) A nucleic acid having RNAi activity against mRNA of NSG1 gene or a precursor thereof.
  • Antisense nucleic acid against mRNA of NSG1 gene includes a base sequence complementary to or substantially complementary to the base sequence of the mRNA or a part thereof. It is a nucleic acid and has a function of suppressing protein synthesis by forming a specific and stable duplex with a target mRNA.
  • Antisense nucleic acids are polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, Other polymers with non-nucleotide backbones (eg, commercially available protein nucleic acids and synthetic sequence specific nucleic acid polymers) or other polymers containing special linkages, provided that the polymer is a base such as found in DNA or RNA And a nucleotide having a configuration that allows attachment of a base).
  • RNA double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrids, unmodified polynucleotides (or unmodified oligonucleotides), known modifications Additions, such as those with labels known in the art, capped, methylated, one or more natural nucleotides replaced with analogs, intramolecular nucleotide modifications Such as those having uncharged bonds (eg methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged or sulfur-containing bonds (eg phosphorothioates, phosphorodithioates, etc.) Things such as proteins (eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-rigid Having a side chain group such as sugar (eg, monosaccharide), having an intercurrent compound (eg, acridine, psoralen),
  • nucleoside may include not only purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleosides and modified nucleotides may also be modified at the sugar moiety, for example, one or more hydroxyl groups are replaced by halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may be converted.
  • the antisense nucleic acid may be DNA or RNA, or may be a DNA / RNA chimera.
  • the RNA DNA hybrid formed by the target RNA and the antisense DNA can be recognized by endogenous RNase H and cause selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only the sequence in mRNA but also the sequence of the intron region in the initial translation product of the NSG1 gene.
  • the intron sequence can be determined by comparing the genomic sequence with the cDNA base sequence of the NSG1 gene using a homology search program such as BLAST or FASTA.
  • the target region of the antisense nucleic acid of the present invention is not particularly limited in length as long as the antisense nucleic acid hybridizes, and as a result, the translation into protein: NSG1 is inhibited.
  • the entire sequence or partial sequence of mRNA may be a short sequence of about 10 bases, and a long sequence of mRNA or the initial transcript.
  • an oligonucleotide consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases is preferred, but is not limited thereto.
  • 5 'end hairpin loop of NSG1 gene 5' end 6-base pair repeat, 5 'end untranslated region, translation start codon, protein coding region, ORF translation stop codon, 3' end untranslated region , 3 ′ end palindromic region or 3 ′ end hairpin loop, etc. may be selected as a preferred target region of the antisense nucleic acid, but is not limited thereto.
  • the antisense nucleic acid of the present invention not only hybridizes with mRNA of the NSG1 gene and initial transcription product to inhibit translation into proteins, but also binds to these genes that are double-stranded DNA to form triple strands ( A triplex) that can inhibit transcription to RNA (antigene).
  • the nucleotide molecule constituting the antisense nucleic acid may be natural DNA or RNA, but various chemicals may be used to improve stability (chemical and / or enzyme) and specific activity (affinity with RNA). Modifications can be included.
  • the phosphate residue (phosphate) of each nucleotide constituting the antisense nucleic acid is chemically modified, for example, phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be substituted with a phosphate residue.
  • PS phosphorothioate
  • methylphosphonate methylphosphonate
  • phosphorodithionate etc. It can be substituted with a phosphate residue.
  • the 2′-position hydroxyl group of the sugar (ribose) of each nucleotide is represented by —OR (R ⁇ CH 3 (2′-O-Me), CH 2 CH 2 OCH 3 (2′-O-MOE), CH 2 CH 2 NHC (NH) NH 2 , CH 2 CONHCH 3 , CH 2 CH 2 CN, etc.) may be substituted.
  • the base moiety pyrimidine, purine
  • BNA LNA
  • ENA ENA
  • the antisense oligonucleotide of the present invention determines the target sequence of mRNA or initial transcript based on the cDNA sequence or genomic DNA sequence of the NSG1 gene, and is a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman) Etc.) can be prepared by synthesizing a complementary sequence thereto.
  • any of the above-described antisense nucleic acids containing various modifications can be chemically synthesized by a method known per se.
  • Ribozyme nucleic acid for mRNA of NSG1 gene Another preferred example of a nucleic acid comprising a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of mRNA of NSG1 gene or a part thereof is the mRNA of the coding region.
  • Examples include ribozyme nucleic acids that can be cleaved specifically inside. “Ribozyme” refers to RNA having an enzyme activity that cleaves nucleic acids in a narrow sense, but in this specification, it is used as a concept including DNA as long as it has sequence-specific nucleic acid cleavage activity.
  • the most versatile ribozyme nucleic acids include self-splicing RNAs found in infectious RNAs such as viroids and virusoids, and hammerhead and hairpin types are known.
  • the hammerhead type exhibits enzyme activity at about 40 bases, and several bases at both ends (about 10 bases in total) adjacent to the part having the hammerhead structure are made complementary to the desired cleavage site of mRNA. By doing so, it is possible to specifically cleave only the target mRNA.
  • This type of ribozyme nucleic acid has the additional advantage of not attacking genomic DNA because it uses only RNA as a substrate.
  • the target sequence is made single-stranded by using a hybrid ribozyme linked with an RNA motif derived from a viral nucleic acid that can specifically bind to an RNA helicase.
  • a hybrid ribozyme linked with an RNA motif derived from a viral nucleic acid that can specifically bind to an RNA helicase [Proc. Natl. Acad. Sci. USA, 98 (10): 5572-5577 (2001)].
  • ribozymes are used in the form of expression vectors containing the DNA that encodes them, they should be hybrid ribozymes in which tRNA-modified sequences are further linked in order to promote the transfer of transcripts to the cytoplasm. [Nucleic Acids Res., 29 (13): 2780-2788 (2001)].
  • RNA interference RNA interference
  • siRNA is based on cDNA sequence information of a target gene, for example, Elbashir et al. (Genes Dev., 15, 188-200 (2001)), Teramoto et al. (FEBS Lett. 579 (13): p2878-82 (2005)) Can be designed according to the rules proposed by
  • the target sequence of siRNA basically has a length of 15 to 50 bases, preferably 19 to 49 bases, more preferably 19 to 27 bases.
  • AA + (N) 19 following AA, 19 Base sequence
  • AA + (N) 21 base sequence of 21 bases following AA
  • a + (N) 21 base sequence of 21 bases following A).
  • the nucleic acid of the present invention may have an additional base at the 5 ′ or 3 ′ end.
  • the length of the additional base is usually about 2 to 4 bases, and the total length of siRNA is 19 bases or more.
  • the additional base may be DNA or RNA, but use of DNA may improve the stability of the nucleic acid. Examples of such an additional base sequence include ug-3 ′, uu-3 ′, tg-3 ′, tt-3 ′, ggg-3 ′, guuu-3 ′, gttt-3 ′, and ttttt-3. Examples include, but are not limited to, ', uuuuu-3'.
  • siRNA may have a protruding portion sequence (overhang) at the 3 ′ end, and specifically includes those to which dTdT (dT represents a deoxythymidine residue of deoxyribonucleic acid) is added. . Further, it may be a blunt end (blunt end) without end addition.
  • the siRNA may have a different number of bases in the sense strand and the antisense strand. For example, the “aiRNA” in which the antisense strand has a protruding sequence (overhang) at the 3 ′ end and the 5 ′ end. Can be mentioned.
  • a typical aiRNA consists of 21 bases in the antisense strand, 15 bases in the sense strand, and has an overhang structure of 3 bases at each end of the antisense strand (Sun, X. et al., Nature Biotechnology Vol26 No. .12 p1379, International Publication No. WO2009 / 029688 Pamphlet). Specifically, a blunt-end siRNA having a length of 25 bases as described in Example 5 or a target sequence portion as described in Example 9 having a length of 19 bases and a dTdT at the 3 ′ end is used. SiRNA having a total length of 21 bases to which is added.
  • the position of the target sequence is not particularly limited, but it is desirable to select the target sequence from the 5′-UTR and the start codon to about 50 bases, and from regions other than the 3′-UTR.
  • BLAST http: //www.ncbi.nlm Investigate using homology search software such as .nih.gov / BLAST /
  • a sense strand having a 3 'end overhang of TT or UU at 19-21 bases after AA (or NA), a sequence complementary to the 19-21 bases and TT or A double-stranded RNA consisting of an antisense strand having a 3 ′ end overhang of UU may be designed as an siRNA.
  • siRNA short hairpin RNA
  • an arbitrary linker sequence for example, about 5-25 bases
  • the sense strand and the antisense strand are combined with each other. It can be designed by linking via a linker sequence.
  • siRNA and / or shRNA sequences can be searched using search software provided free of charge on various websites.
  • Such sites include, for example, siRNA Target (Finder (http://www.ambion.com/jp/techlib/misc/siRNA_finder.html) and pSilencer (registered trademark) Expression ⁇ ⁇ ⁇ ⁇ ⁇ Vector insert design tools provided by Ambion ( http://www.ambion.com/jp/techlib/misc/psilencer_converter.html), GeneSeer provided by RNAi Codex (http://codex.cshl.edu/scripts/newsearchhairpin.cgi) Not.
  • the ribonucleoside molecule constituting siRNA may also be modified in the same manner as the above-described antisense nucleic acid in order to improve stability, specific activity and the like.
  • siRNA if all ribonucleoside molecules in natural RNA are replaced with a modified form, RNAi activity may be lost, so the introduction of the minimum modified nucleoside that allows the RISC complex to function is necessary. .
  • RNA with various chemical modifications can be substituted (see Usman and Cedergren, 1992, TIBS 17,34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163).
  • phosphate residues (phosphates) of each nucleotide constituting siRNA are converted into chemically modified phosphates such as phosphorothioate (PS), methylphosphonate, and phosphorodithionate. It can be substituted with a residue.
  • PS phosphorothioate
  • methylphosphonate methylphosphonate
  • phosphorodithionate phosphorodithionate
  • the 2′-position hydroxyl group of the sugar (ribose) of each nucleotide is represented by —OR (R ⁇ CH 3 (2′-O-Me), CH 2 CH 2 OCH 3 (2′-O-MOE), CH 2 CH 2 NHC (NH) NH 2 , CH 2 CONHCH 3 , CH 2 CH 2 CN, etc.) or a fluorine atom (—F) may be substituted.
  • the base moiety pyrimidine, purine
  • the method for modifying an antisense nucleic acid described in (1) above can be used. Or you may give the chemical modification (2'-deoxylation, 2'-H) which substitutes a part of RNA in siRNA with DNA.
  • an artificial nucleic acid LNA: Locked Nucleic Acid
  • the sense strand and antisense strand constituting siRNA are linked via a linker to a ligand, peptide, sugar chain, antibody, lipid, positive charge or molecular structure that specifically recognizes a receptor present on the cell surface. It may be chemically bonded to oligoarginine, Tat peptide, Rev peptide or Ant peptide that adsorbs and penetrates the surface layer.
  • the siRNA is synthesized by synthesizing the sense strand and antisense strand of the target sequence on the mRNA with a DNA / RNA automatic synthesizer and denatured in an appropriate annealing buffer at about 90 to about 95 ° C. for about 1 minute, It can be prepared by annealing at about 30 to about 70 ° C. for about 1 to about 8 hours. It can also be prepared by synthesizing a short hairpin RNA (shRNA) serving as a precursor of siRNA and cleaving it with a dicer.
  • shRNA short hairpin RNA
  • a nucleic acid designed to generate an siRNA against the mRNA of the NSG1 gene in vivo also includes a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of the NSG1 gene mRNA. Defined as encompassed by a nucleic acid containing a moiety. Examples of such nucleic acids include expression vectors constructed so as to express the above-mentioned shRNA and siRNA.
  • shRNA is an oligo containing a base sequence in which the sense strand and the antisense strand of the target sequence on mRNA are linked by inserting a spacer sequence (for example, about 5 to 25 bases) long enough to form an appropriate loop structure.
  • Vectors expressing shRNA include tandem type and stem loop (hairpin) type.
  • siRNA sense strand expression cassette and antisense strand expression cassette are linked in tandem, and each strand is expressed and annealed in the cell to form double stranded siRNA (dsRNA).
  • dsRNA double stranded siRNA
  • the latter is one in which an shRNA expression cassette is inserted into a vector, in which shRNA is expressed in cells and processed by dicer to form dsRNA.
  • a pol II promoter for example, a CMV immediate early promoter
  • a pol III promoter is generally used.
  • polIII promoters include mouse and human U6-snRNA promoters, human H1-RNase P RNA promoter, and human valine-tRNA promoter.
  • a sequence in which 4 or more Ts are continuous is used as a transcription termination signal.
  • the siRNA or shRNA expression cassette thus constructed is then inserted into a plasmid vector or viral vector.
  • vectors include retrovirus, lentivirus, adenovirus, adeno-associated virus, herpes virus, Sendai virus and other viral vectors, animal cell expression plasmids, and the like.
  • siRNA can be chemically synthesized according to a conventional method using an automatic DNA / RNA synthesizer such as a 394-Applied Biosystems, Inc. synthesizer based on the nucleotide sequence information.
  • an automatic DNA / RNA synthesizer such as a 394-Applied Biosystems, Inc. synthesizer based on the nucleotide sequence information.
  • nucleic acid protecting group for example, dimethoxytrityl group at the 5 'end
  • a coupling group for example, phosphoramidite at the 3' end
  • RNA containing modified RNA or DNA a modified RNA (eg, 2′-O-methyl nucleotide, 2′-deoxy-2′-fluoro nucleotide) may be used as a raw material, and the coupling reaction These conditions can be adjusted as appropriate.
  • a borage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide) can be used.
  • oligonucleotides may be synthesized separately and joined together after synthesis, for example by ligation (Moore et al., 1992, Science 256,9923; Draper et al. International Publication WO93 / 23569; Shabarova et al. , 1991, Nucleic Acids Research 19,4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16,951; And may be connected together by hybridization.
  • siRNA molecules can also be synthesized by tandem synthesis.
  • both siRNA strands are synthesized as a single contiguous oligonucleotide separated by a cleavable linker, which is then cleaved to produce separate siRNA fragments that are hybridized and purified .
  • the linker may be a polynucleotide linker or a non-nucleotide linker.
  • the synthesized siRNA molecules can be purified using methods known to those skilled in the art. For example, a method of purification by gel electrophoresis or a method of purification using high performance liquid chromatography (HPLC) can be mentioned.
  • siRNA molecules can be inserted into DNA or RNA vectors and expressed using recombinant vectors.
  • the vector can be a DNA plasmid or a viral vector.
  • the viral vector expressing siRNA is not limited, adenovirus and the like can be used.
  • siRNA examples include the following groups: (1) siRNA in which the double-stranded RNA portion comprises a base sequence consisting of SEQ ID NOs: 7 to 9 and 16 to 34, (2) The siRNA according to (1) above, wherein an overhang of 2 to 4 bases is added to the 3 ′ end, (3) The siRNA according to (1) or (2), wherein at least one base is chemically modified, or (4) The siRNA according to any one of (1) to (3), wherein at least one phosphodiester bond is chemically modified, Etc. can be illustrated.
  • the base length of the double-stranded RNA portion of siRNA is 15-50 bases, preferably 19-50 bases, more preferably 19-49 bases, 15-49 bases, more preferably 19-25 bases, 15- 25 bases, more preferably 19 to 23 bases.
  • Nucleic acid containing a base sequence complementary to or substantially complementary to the base sequence of mRNA of NSG1 gene or a part thereof is provided in a special form such as a liposome or a microsphere, applied to gene therapy, It can be given in an added form.
  • the additional form can be used as a polycationic substance such as polylysine, which acts to neutralize the charge of the phosphate group skeleton, to enhance the interaction with the cell membrane, or to increase the uptake of nucleic acid
  • examples include hydrophobic substances such as lipids (eg, phospholipids, cholesterol, etc.).
  • Preferred lipids for addition include cholesterol and derivatives thereof (eg, cholesteryl chloroformate, cholic acid, etc.).
  • nucleic acids can be attached via bases, sugars, intramolecular nucleoside linkages.
  • examples of the other group include a cap group specifically arranged at the 3 'end or 5' end of a nucleic acid, which prevents degradation by nucleases such as exonuclease and RNase.
  • capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol.
  • NSG1 expression inhibitory activity of these nucleic acids should be examined using transformants with the NSG1 gene introduced, in vivo or in vitro NSG1 gene expression system, or in vivo or in vitro protein: NSG1 translation system. Can do.
  • the substance that inhibits the expression of NSG1 in the present invention is not limited to a nucleic acid comprising a base sequence complementary to or substantially complementary to the base sequence of mRNA of NSG1 gene as described above, or a part thereof, and NSG1 production
  • Other substances such as low molecular weight compounds may be used as long as they are directly or indirectly inhibited.
  • Such a substance can be obtained, for example, by the screening method of the present invention described later.
  • the “substance that suppresses the function of NSG1” may be any substance as long as it suppresses the function of NSG1 once produced functionally.
  • examples of the substance that suppresses the function of NSG1 include an antibody against NSG1.
  • the antibody may be a polyclonal antibody or a monoclonal antibody. These antibodies can be produced according to per se known antibody or antiserum production methods.
  • the isotype of the antibody is not particularly limited, but preferably IgG, IgM or IgA, particularly preferably IgG.
  • the antibody is not particularly limited as long as it has at least a complementarity determining region (CDR) for specifically recognizing and binding a target antigen.
  • CDR complementarity determining region
  • Fab, Fab ′, F (ab ') 2 such as fragments, scFv, scFv-Fc, conjugation molecules prepared by genetic engineering such as minibodies and diabodies, or molecules having a protein stabilizing action such as polyethylene glycol (PEG)
  • PEG polyethylene glycol
  • the antibody preferably a monoclonal antibody
  • the antibody is an antibody with reduced risk of showing antigenicity when administered to a human.
  • Specific examples include fully human antibodies, humanized antibodies, mouse-human chimeric antibodies, and particularly preferably fully human antibodies. Humanized antibodies and chimeric antibodies can be produced by genetic engineering according to conventional methods.
  • fully human antibodies can be produced from human-human (or mouse) hybridomas, but in order to provide a large amount of antibodies stably and at low cost, human antibody-producing mice and phage display methods are used. It is desirable to manufacture using.
  • the substance that suppresses the function of NSG1 is desirably a substance excellent in tumor blood vessel migration and cell membrane permeability. Therefore, another preferable substance that suppresses the function of NSG1 is a low-molecular compound commensurate with Lipinski's Rule. Such a compound can be obtained, for example, using the screening method of the present invention described later.
  • a substance that suppresses the expression or function of NSG1 has an angiogenesis inhibitory activity, specifically a tumor angiogenesis inhibitory activity, more specifically a tumor vascular endothelial cell migration inhibitory activity. It is useful for improving a patient's pathology and preventing cancer, particularly cancer metastasis and recurrence. Therefore, a medicament containing a substance that suppresses the expression or function of NSG1 can be used as a preventive and / or therapeutic agent (antitumor agent) for cancer.
  • An antisense nucleic acid of the present invention that binds complementarily to a transcription product of a pharmaceutical NSG1 gene containing an antisense nucleic acid, a ribozyme nucleic acid, siRNA and a precursor thereof, and can suppress translation of a protein from the transcription product, SiRNA (or ribozyme) that has a base sequence that is homologous (or complementary) to the transcription product (mRNA) of the NSG1 gene, and can cleave the transcription product as a target, and is a precursor of the siRNA shRNA and the like (hereinafter may be collectively referred to as “the nucleic acid of the present invention”) suppress the expression of NSG1 in vivo and suppress the migration of tumor vascular endothelial cells, and therefore can be used as antitumor agents.
  • the medicament containing the nucleic acid of the present invention has low toxicity and can be used as a liquid or as a pharmaceutical composition of an appropriate dosage form as a human or non-human mammal (eg, rat, rabbit, sheep, pig, cow, cat, It can be administered orally or parenterally (eg, intravascular administration, subcutaneous administration, etc.) to dogs, monkeys, etc.
  • a human or non-human mammal eg, rat, rabbit, sheep, pig, cow, cat
  • parenterally eg, intravascular administration, subcutaneous administration, etc.
  • the nucleic acid of the present invention When used as the antitumor agent, it can be formulated and administered according to a method known per se. That is, the nucleic acid of the present invention is inserted alone or in a functional manner into an appropriate expression vector for mammalian cells such as a retrovirus vector, adenovirus vector, adenovirus associated virus vector, etc., and then formulated according to conventional means. can do.
  • the nucleic acid can be administered as it is or together with an auxiliary agent for promoting intake by a catheter such as a gene gun or a hydrogel catheter. Alternatively, it can be aerosolized and locally administered into the trachea as an inhalant.
  • the nucleic acid may be formulated (injection) alone or with a carrier such as a liposome and administered intravenously, subcutaneously, etc. .
  • the nucleic acid of the present invention may be administered per se or as an appropriate pharmaceutical composition.
  • the pharmaceutical composition used for administration may contain the nucleic acid of the present invention and a pharmacologically acceptable carrier, diluent or excipient.
  • Such pharmaceutical compositions are provided as dosage forms suitable for oral or parenteral administration.
  • injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included.
  • Such an injection can be prepared according to a known method.
  • a method for preparing an injection it can be prepared, for example, by dissolving, suspending or emulsifying the nucleic acid of the present invention in a sterile aqueous liquid or oily liquid usually used for injection.
  • an aqueous solution for injection for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)) and the like may be used in combination.
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)
  • oily liquid for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solub
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups Agents, emulsions, suspensions and the like.
  • Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field.
  • a carrier and excipient for tablets for example, lactose, starch, sucrose, and magnesium stearate are used.
  • the above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dose of the active ingredient.
  • dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories.
  • the nucleic acid of the present invention is preferably contained, for example, usually 5 to 500 mg per dosage unit form, especially 5 to 100 mg for injections and 10 to 250 mg for other dosage forms.
  • the dosage of the above-mentioned pharmaceutical containing the nucleic acid of the present invention varies depending on the administration subject, target disease, symptom, administration route, etc., but for example, when used for the treatment / prevention of cancer, the nucleic acid of the present invention. Is usually about 0.01 to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight, about 1 to 5 times a day, preferably 1 day a day. It is convenient to administer about 3 times by intravenous injection. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.
  • compositions may appropriately contain other active ingredients as long as an undesirable interaction is not caused by blending with the nucleic acid of the present invention.
  • Antibodies against NSG1 and low molecular compounds that suppress NSG1 expression or function can inhibit the production or function of NSG1. Therefore, since these substances suppress the expression or function of NSG1 in vivo, they can be used as preventive and / or therapeutic agents for cancer.
  • a medicine containing the above-mentioned antibody or low molecular weight compound has low toxicity, and is used as a liquid or as a pharmaceutical composition of an appropriate dosage form as a human or mammal (eg, rat, rabbit, sheep, pig, cow, cat). Can be administered orally or parenterally (eg, intravascular administration, subcutaneous administration, etc.).
  • the above-described antibodies and low-molecular compounds may be administered per se, or may be administered as an appropriate pharmaceutical composition.
  • the pharmaceutical composition used for administration may contain the above antibody or low molecular compound or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient.
  • Such pharmaceutical compositions are provided as dosage forms suitable for oral or parenteral administration.
  • injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included.
  • Such an injection can be prepared according to a known method.
  • a method for preparing an injection it can be prepared, for example, by dissolving, suspending or emulsifying the antibody of the present invention or a low molecular weight compound or a salt thereof in a sterile aqueous liquid or oily liquid usually used for injection.
  • an aqueous solution for injection for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)) and the like may be used in combination.
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)
  • oily liquid for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solub
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups Agents, emulsions, suspensions and the like.
  • Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field.
  • a carrier and excipient for tablets for example, lactose, starch, sucrose, and magnesium stearate are used.
  • the above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dose of the active ingredient.
  • dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories.
  • the antibody or low molecular weight compound is preferably contained in an amount of usually 5 to 500 mg per dosage unit form, particularly 5 to 100 mg for injections and 10 to 250 mg for other dosage forms.
  • the dose of the above-mentioned medicament containing the above-mentioned antibody or low-molecular compound or a salt thereof varies depending on the administration subject, target disease, symptom, administration route, etc., for example, when used for the treatment / prevention of cancer. Is usually about 0.01 to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight 1 to 5 times a day, with an antibody or low molecular weight compound as a single dose. Conveniently administered by intravenous injection to a degree, preferably about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. When symptoms are particularly severe, the dose may be increased according to the symptoms.
  • Each of the above-described compositions may contain other active ingredients as long as an undesirable interaction is not caused by blending with the above antibody or low molecular weight compound.
  • An angiogenesis inhibitor comprising a pharmaceutical comprising the above-mentioned antisense nucleic acid against NSG1, ribozyme nucleic acid, siRNA and its precursor, an antibody against NSG1, a low-molecular compound that suppresses the expression or function of NSG1, etc.
  • a pharmaceutical comprising the above-mentioned antisense nucleic acid against NSG1, ribozyme nucleic acid, siRNA and its precursor, an antibody against NSG1, a low-molecular compound that suppresses the expression or function of NSG1, etc.
  • Specific cancers include solid cancer, transitional cell carcinoma, colon cancer, colorectal cancer, colon cancer, lung cancer (small cell cancer), lung cancer (non-small cell lung cancer), kidney cancer (renal cell carcinoma), renal pelvis and ureter Cancer, biliary tract cancer, liver cancer (hepatocellular carcinoma), brain tumor, glioma (glioma), glioblastoma, glioblastoma multiforme, pancreatic cancer, head and neck cancer (squamous cell carcinoma), multiple myeloma , Bone and soft tissue tumors, prostate cancer, penile cancer, testicular cancer, ovarian cancer, gastrointestinal stromal tumor (GIST), stomach cancer, female genital cancer, cervical cancer, breast cancer, melanoma (melanoma), lymphoma (non-Hodgkin), Lymphoma (Hodgkin), lymphoma (diffuse large cell type), leukemia (acute myeloid), leukemia (chronic lymphoid), es
  • a pharmaceutical composition containing the above-mentioned antisense nucleic acid against NSG1, ribozyme nucleic acid, nucleic acid containing siRNA and its precursor, an antibody against NSG1, or a low molecular weight compound that suppresses the expression or function of NSG1 is an abnormal blood vessel. Since it suppresses endothelial cell migration, it is used as an angiogenesis inhibitor as a disease associated with abnormal angiogenesis.
  • diabetic retinopathy choroidal neovascularization, macular degeneration, heart failure, abnormal myelogenesis, influenza, inflammation Arthritis, hepatitis C, psoriasis, edema, neurodegenerative disease, amyloidosis, idiopathic pulmonary fibrosis, multiple sclerosis, Wilson disease, von Hippel-Lindau disease, Crohn's disease, systemic mastocytosis, myeloproliferative syndrome, Myelodysplasia etc.
  • diabetic retinopathy, macular degeneration, inflammation, arthritis, psoriasis, edema, idiopathic pulmonary fibrosis, von Hippel Linda Disease, treatment of Crohn's disease can be used prophylactically, or to proceed prevented.
  • Treatment or prevention of cancer with a pharmaceutical composition containing the above-mentioned antisense nucleic acid against NSG1, ribozyme nucleic acid, siRNA and its precursor, an antibody against NSG1, a low molecular weight compound that suppresses the expression or function of NSG1, etc. May be used alone, or may be used in combination with one or more drugs having anticancer activity and / or radiation therapy.
  • the drugs to be used in combination are not particularly limited.
  • angiogenesis inhibitors such as Bevacizumab, Sunitinib, Sorafenib, Erlotinib, Erbitax
  • blood vessel destruction drugs such as ASA404, 5-FU (fluorouracil), gemcitabine
  • chemotherapeutic agents such as cisplatin, irinotecan, carboplatin, and paclitaxel.
  • NSG1 Screening for Drug Candidate Compounds for Diseases
  • a compound or a salt thereof that suppresses the expression and / or function of NSG1 can be used as a preventive and / or therapeutic agent (antitumor agent) for cancer. Therefore, a cell producing NSG1 can be used as a tool for screening a substance having angiogenesis inhibitory activity by using the expression level and / or function of NSG1 (or NSG1 gene) as an index.
  • the screening method involves culturing cells capable of producing NSG1 in the presence and absence of a test substance, Comparing the expression level and / or function of NSG1 below.
  • the cell having the ability to produce NSG1 used in the above screening method may be a human or other mammalian cell that naturally expresses them or a biological sample (eg, blood, tissue, organ, etc.) containing the same.
  • a biological sample eg, blood, tissue, organ, etc.
  • blood, tissues, organs, etc. derived from non-human animals they may be isolated from the living body and cultured, or the test substance is administered to the living body itself, and these biological samples are isolated after a certain period of time. May be.
  • Examples of cells having the ability to produce NSG1 include various transformants prepared by known and commonly used genetic engineering techniques.
  • animal cells such as H4IIE-C3 cells, HepG2 cells, HEK293 cells, COS7 cells, CHO cells are preferably used. Specifically, it hybridizes under stringent conditions with a DNA encoding NSG1 (that is, the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 or a base sequence complementary to the base sequence).
  • NSG1 that is, the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 or a base sequence complementary to the base sequence.
  • a DNA comprising a base sequence encoding a polypeptide having the same function as that of the protein consisting of the amino acid sequence represented by SEQ ID NO: 2) and ligated downstream of the promoter in an appropriate expression vector It can prepare by introduce
  • the gene encoding NSG1 can be obtained by conventional genetic engineering methods (eg, Sambrook J., Frisch EF, Maniatis T., Molecular Cloning 2nd edition), published by Cold Spring Harbor Laboratory (Cold Spring Harbor Laboratory). press), etc.). That is, the DNA encoding NSG1, for example, a cell that produces NSG1 as described above by synthesizing an appropriate oligonucleotide as a probe or primer based on the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3. It can be cloned from tissue-derived cDNA or cDNA library using hybridization or PCR. Hybridization can be performed, for example, according to the method described in Molecular Cloning 2nd edition (above). When a commercially available library is used, hybridization can be performed according to the method described in the instruction manual attached to the library.
  • the DNA base sequence can be determined using a known kit such as Mutan TM -super Express Km (Takara Shuzo), Mutan TM -K (Takara Shuzo), etc., using the ODA-LA PCR method, the Gapped duplex method, Conversion can be performed according to a method known per se such as the Kunkel method or a method analogous thereto.
  • the cloned DNA can be used as it is depending on the purpose, or after digestion with a restriction enzyme or addition of a linker, if desired.
  • the DNA may have ATG as a translation initiation codon on the 5 ′ end side, and may have TAA, TGA or TAG as a translation termination codon on the 3 ′ end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.
  • NSG1 protein
  • NSG1 protein
  • a culture obtained by preparing a plasmid that allows the NSG1 gene to be expressed in a host cell, introducing it into the host cell, transforming it, and then culturing the transformed host cell (transformant) You only need to get NSG1 from things.
  • the plasmid include a promoter that can replicate autonomously in a host cell, can replicate autonomously, can be easily isolated and purified from the host cell, and can function in the host cell.
  • Preferred examples include those in which a gene encoding NSG1 is introduced into an expression vector having a detectable marker.
  • Various types of expression vectors are commercially available. For example, an expression vector used for expression in E.
  • coli is an expression vector containing a promoter such as lac, trp, tac, etc., and these are commercially available from Pharmacia, Takara Bio and the like. Restriction enzymes used for introducing a gene encoding NSG1 into the expression vector are also commercially available from Takara Bio. If it is necessary to induce further high expression, a ribosome binding region may be linked upstream of the gene encoding protein: NSG1. Examples of the ribosome binding region used include those described in reports by Guarente L. et al. (Cell 20, p543) and Taniguchi et al. (Genetics of Industrial Microorganisms, p202, Kodansha).
  • animal cell expression plasmids eg pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo
  • bacteriophages such as ⁇ phage
  • animal virus vectors such as retrovirus, vaccinia virus, adenovirus, etc. It can also be used.
  • the promoter may be any promoter as long as it is appropriate for the host used for gene expression.
  • SR ⁇ promoter for example, SR ⁇ promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, ⁇ -actin A gene promoter, aP2 gene promoter, etc. are used.
  • CMV promoter, SR ⁇ promoter and the like are preferable.
  • an expression vector containing an enhancer, a splicing signal, a poly A addition signal, a selectable marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), etc. is used as desired. Can do.
  • Selectable markers include, for example, dihydrofolate reductase gene (hereinafter abbreviated as dhfr, methotrexate (MTX) resistance), ampicillin resistance gene (hereinafter abbreviated as amp r ), neomycin resistance gene ( hereinafter sometimes abbreviated as neo r, include G418 resistance) and the like.
  • dhfr dihydrofolate reductase gene
  • amp r ampicillin resistance gene
  • neomycin resistance gene hereinafter sometimes abbreviated as neo r, include G418 resistance
  • the target gene can also be selected using a medium not containing thymidine.
  • An NSG1-expressing cell can be produced by transforming a host with an expression vector containing the above-described DNA encoding NSG1.
  • host cells include prokaryotic or eukaryotic microbial cells, insect cells, or mammalian cells.
  • mammalian cells examples include HepG2 cells, HEK293 cells, HeLa cells, human FL cells, monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary cells (hereinafter abbreviated as CHO cells), dhfr gene-deficient CHO cells ( hereinafter, CHO (dhfr -) cell), mouse L cells, mouse AtT-20, mouse myeloma cells, mouse myeloma cells, rat H4IIE-C3 cells, rat GH3 cells can be used.
  • Escherichia coli and the like can be preferably mentioned from the viewpoint that mass preparation of NSG1 becomes easy.
  • the plasmid obtained as described above can be introduced into the host cell by an ordinary genetic engineering method.
  • the transformant can be cultured by a conventional method used for culturing microorganisms, insect cells or mammalian cells.
  • culturing is performed in a medium appropriately containing an appropriate carbon source, nitrogen source, and micronutrients such as vitamins.
  • the culture method may be any of solid culture and liquid culture, and preferred examples include liquid culture such as aeration and agitation culture.
  • Transformation can be performed by calcium phosphate coprecipitation method, PEG method, electroporation method, microinjection method, lipofection method and the like.
  • PEG method New Cell Engineering Experiment Protocol
  • electroporation method microinjection method
  • lipofection method lipofection method and the like.
  • the methods described in Cell Engineering Supplement 8, New Cell Engineering Experiment Protocol, 263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973) can be used.
  • a transformed cell obtained as described above, a mammalian cell having an ability to produce NSG1 or a tissue / organ containing the cell is, for example, a minimal essential medium (MEM) containing about 5 to 20% fetal calf serum.
  • MEM minimal essential medium
  • DMEM Dulbecco's modified Eagle medium
  • RPMI 1640 medium RPMI 1640 medium
  • the pH of the medium is preferably about 6-8.
  • Cultivation is usually carried out at about 30-40 ° C, with aeration and agitation as necessary.
  • NSG1 may be obtained by combining methods commonly used for isolation and purification of general proteins. For example, the transformants obtained by the above culture are collected by centrifugation or the like, and the transformants are crushed or dissolved, and if necessary, proteins are solubilized, and various types such as ion exchange, hydrophobicity, gel filtration, etc. What is necessary is just to refine
  • test substance examples include proteins, peptides, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like. These substances may be novel or may be known ones.
  • a control cell that is not contacted with a test substance can also be used as a comparative control.
  • Do not contact the test substance means that the same amount of solvent (blank) as the test substance is added instead of the test substance, or that the expression level of the NSG1 or NSG1 gene or the function of NSG1 is affected. The case where a negative control substance not given is added is also included.
  • the contact of the test substance with the cells may be performed by, for example, the above-mentioned medium or various buffers (for example, HEPES buffer, phosphate buffer, phosphate buffered saline, Tris-HCl buffer, borate buffer, acetic acid).
  • the test substance can be added to a buffer solution or the like, and the cells can be incubated for a certain time.
  • concentration of the test substance to be added varies depending on the type of compound (solubility, toxicity, etc.), but is appropriately selected within the range of about 0.1 nM to about 100 ⁇ M, for example. Examples of the incubation time include about 10 minutes to about 24 hours.
  • the state of the animal individual is not particularly limited, but for example, a model mouse transplanted with cancer cells [for example, A375SM (human highly metastatic A mouse produced by transplanting the KSN / Slc nude mouse under the right dorsal skin].
  • A375SM human highly metastatic A mouse produced by transplanting the KSN / Slc nude mouse under the right dorsal skin.
  • the animals are raised in an environment of SPF grade or higher.
  • Contact of the test substance with the cells is carried out by administering the test substance to the animal individual.
  • the administration route is not particularly limited, and examples thereof include intravenous administration, intraarterial administration, subcutaneous administration, intradermal administration, intraperitoneal administration, oral administration, intratracheal administration, and rectal administration.
  • the dose is not particularly limited.
  • a dose of about 0.5 to 20 mg / kg can be administered 1 to 5 times a day, preferably 1 to 3 times a day for 1 to 14 days.
  • the above screening method can be carried out by contacting a test substance with an extract of the cells or NSG1 isolated and purified from the cells, instead of the cells having the ability to produce NSG1.
  • the present invention relates to a screening for a substance having angiogenesis inhibitory activity, characterized by comparing the expression of the protein (gene) in cells having the ability to produce NSG1 in the presence and absence of the test substance.
  • a method The cells used in this method, the type of test substance, the mode of contact between the test substance and cells, etc. are the same as described above.
  • the expression level of NSG1 is a nucleic acid that can hybridize with the above-described DNA encoding NSG1 under stringent conditions, that is, the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3, or a complementary nucleotide sequence thereto.
  • a nucleic acid (DNA) that can hybridize under stringent conditions hereinafter sometimes referred to as “the nucleic acid for detection of the present invention”
  • mRNA is measured at the RNA level by detecting the mRNA of the NSG1 gene. be able to.
  • the expression level can also be measured at the protein level by detecting these proteins using the above-described antibody against NSG1 (hereinafter sometimes referred to as “the detection antibody of the present invention”). Therefore, more specifically, the present invention (A) Cells having the ability to produce NSG1 are cultured in the presence and absence of a test substance, and the amount of mRNA encoding the protein under both conditions is measured using the nucleic acid for detection of the present invention.
  • a method for screening a substance having angiogenesis-inhibiting activity characterized by comparing, and (b) culturing cells capable of producing NSG1 in the presence and absence of a test substance under both conditions
  • a method for screening for a substance having an angiogenesis inhibitory activity comprising measuring and comparing the amount of the protein in, using the detection antibody of the present invention is provided.
  • screening for a substance that changes the expression level of NSG1 can be performed as follows.
  • Normal or disease for example, transplanted model mice such as colon cancer and lung cancer: model mice transplanted with cancer cells subcutaneously on the right back of KSN / Slc nude mice
  • model non-human mammals for example, mice, Rats, rabbits, sheep, pigs, cattle, cats, dogs, monkeys, etc.
  • blood, a specific organ eg, brain, etc.
  • a tissue or cell isolated from the organ is obtained.
  • the mRNA of NSG1 can be quantified by extracting mRNA from cells or the like by a usual method, or can be quantified by Northern blot analysis known per se.
  • the protein amount of NSG1 can be quantified using Western blot analysis or various immunoassay methods described in detail below.
  • a cell that expresses the NSG1 gene (for example, a transformant introduced with NSG1) is prepared according to the method described above, and a test substance is added to a medium or a buffer when culturing according to a conventional method for a certain period of time.
  • NSG1 contained in the cells or mRNA encoding the same is quantified in the same manner as in (i) above. Can be analyzed.
  • the detection and quantification of the expression level of the NSG1 gene can be performed by a known method such as Northern blotting or RT-PCR using RNA prepared from the cells or a complementary polynucleotide transcribed therefrom. Specifically, by using as a primer or probe a polynucleotide having at least 15 consecutive nucleotides in the nucleotide sequence of the NSG1 gene and / or its complementary polynucleotide, the presence or absence of expression of the NSG1 gene in RNA or its expression The level can be detected and measured.
  • Such a probe or primer is based on the base sequence of NSG1 gene, for example, primer 3 (HYPERLINK http://www.genome.wi.mit.edu/cgi-bin/primer/primer3.cgi) or vector NTI (Infomax) can be used for designing.
  • the primer or probe When using Northern blotting, the primer or probe is labeled with a radioisotope (32P, 33P, etc .: RI) or a fluorescent substance and hybridized with cell-derived RNA transferred to a nylon membrane or the like according to a conventional method. After soy, the formed duplex of the primer or probe (DNA or RNA) and RNA is used as a signal derived from the primer or probe label (RI or fluorescent substance) as a radiation detector (BAS- 1800II (manufactured by Fuji Film) or a method of detecting and measuring with a fluorescence detector can be exemplified.
  • a radioisotope 32P, 33P, etc .: RI
  • RI a fluorescent substance
  • the probe is labeled according to the protocol, hybridized with cell-derived RNA, and then the signal derived from the labeled product of the probe is multibiotic.
  • a method of detecting and measuring with Major STORM860 can also be used.
  • cDNA is prepared from cell-derived RNA according to a conventional method, and a target NSG1 gene region can be amplified using this as a template.
  • a method of detecting the amplified double-stranded DNA obtained by hybridizing a primer (a normal strand that binds to the above cDNA (-strand) and a reverse strand that binds to a + strand) and performing PCR according to a conventional method can be illustrated.
  • the detection of the amplified double-stranded DNA was performed by a method for detecting the labeled double-stranded DNA produced by performing the PCR using a primer previously labeled with RI or a fluorescent substance.
  • a method can be used in which double-stranded DNA is transferred to a nylon membrane or the like according to a conventional method, and the labeled primer is used as a probe to hybridize with this to detect it.
  • the produced labeled double-stranded DNA product can be measured with an Agilent 2100 Bioanalyzer (manufactured by Yokogawa Analytical Systems). Also, prepare an RT-PCR reaction solution according to the protocol with SYBR Green RT-PCR Reagents (Applied Biosystems) and react with ABI PRIME 7900 Sequence Detection System (Applied Biosystems) to detect the reaction product. You can also The expression of the NSG1 gene in the cells to which the test substance is added is 2/3 times or less, preferably 1/2 times or less, more preferably 1/3 times the expression level in the control cells to which no test substance is added. The test substance can be selected as an NSG1 gene expression-suppressing substance as long as it is below.
  • Screening for substances that change the expression level of NSG1 can also be performed by a reporter gene assay using the transcriptional regulatory region of the NSG1 gene.
  • the “transcriptional regulatory region” usually refers to a range from several kb to several tens of kb upstream of the chromosomal gene.
  • 5′-race method for example, 5
  • 5′-RACE method for example, 5
  • Genome Walker Kit which can be carried out using a “-full Race Core Kit (manufactured by Takara Bio Inc.), etc.), oligocap method, S1 primer mapping and the like
  • Genome Walker Kit The 5′-upstream region is obtained using Clontech, etc., and the obtained upstream region can be identified by a technique including a step of measuring promoter activity.
  • a reporter protein expression vector is constructed by linking a nucleic acid encoding a reporter protein (hereinafter referred to as “reporter gene”) in a functional form downstream of the transcriptional regulatory region of the NSG1 gene.
  • reporter gene a reporter protein
  • the vector may be prepared by a method known to those skilled in the art. That is, the conventional genetic engineering described in ⁇ Molecular Cloning: A Laboratory Manual 2nd edition '' (1989), Cold Spring Harbor Laboratory Press, ⁇ Current Protocols In Molecular Biology '' (1987), John Wiley & Sons, Inc.
  • the transcriptional regulatory region of NSG1 gene excised according to the technique can be incorporated on a plasmid containing a reporter gene.
  • Reporter proteins include ⁇ -glucuronidase (GUS), luciferase, chloramphenicol transacetylase (CAT), ⁇ -galactosidase (GAS), green fluorescent protein (GFP) and the like.
  • the reporter gene which is operably linked to the transcriptional regulatory region of the prepared NSG1 gene, is inserted into a vector that can be used in the cell into which the reporter gene is to be introduced using ordinary genetic engineering techniques, and the plasmid is And can be introduced into a suitable host cell.
  • Stable transformed cells can be obtained by culturing in a medium with selection conditions according to the selection marker gene mounted on the vector.
  • a reporter gene in which the transcription regulatory region of the NSG1 gene is operably linked may be transiently expressed in the host cell.
  • a method for measuring the expression level of the reporter gene a method corresponding to each reporter gene may be used. For example, when a luciferase gene is used as a reporter gene, the transformed cell is cultured for several days, and then an extract of the cell is obtained. The extract is then reacted with luciferin and ATP to cause chemiluminescence, and its luminescence intensity Promoter activity can be detected by measuring.
  • a commercially available luciferase reaction detection kit such as Picker Gene Dual Kit (registered trademark; manufactured by Toyo Ink) can be used.
  • a method for measuring the protein amount of NSG1 specifically, for example, (I) Quantifying NSG1 in a sample solution by competitively reacting the detection antibody of the present invention with the sample solution and labeled NSG1 and detecting the labeled protein bound to the antibody How, (Ii) The sample solution is reacted with the detection antibody of the present invention insolubilized on the carrier and another labeled detection antibody of the present invention simultaneously or continuously, and then the labeling agent on the insolubilized carrier.
  • Detection and quantification of the protein expression level of NSG1 can be quantified according to a known method such as Western blotting using an antibody recognizing NSG1.
  • Western blotting uses an antibody that recognizes NSG1 as the primary antibody, and then binds to the primary antibody labeled with a radioisotope such as 125 I, a fluorescent substance, or an enzyme such as horseradish peroxidase (HRP) as the secondary antibody. This is carried out by measuring the signal derived from these labeling substances with a radiation measuring instrument (BAI-1800II: manufactured by Fuji Film Co., Ltd.), a fluorescence detector or the like.
  • a radiation measuring instrument BAI-1800II: manufactured by Fuji Film Co., Ltd.
  • detection is performed according to the protocol using ECL Plus Western Blotting Detection System (Amersham Pharmacia Biotech), and multi-biomager STORM860 (Amersham Pharmacia Biotech) is used. It can also be measured.
  • the form of the antibody is not particularly limited, and may be a polyclonal antibody using NSG1 as an immunogen, or a monoclonal antibody thereof, and further, at least a sequence of amino acid sequences constituting NSG1.
  • An antibody having antigen-binding property to a polypeptide usually consisting of 8 amino acids, preferably 15 amino acids, more preferably 20 amino acids can also be used.
  • Methods for producing these antibodies are already well known, and the antibodies of the present invention can also be produced according to these conventional methods (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley and Sons. Section 11.12-11.13).
  • the two antibodies recognize different portions of NSG1.
  • an antibody that reacts with the C-terminus of the protein can be used as the other antibody.
  • a labeling agent used in a measurement method using a labeling substance for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, or the like is used.
  • the radioisotope for example, [ 125 I], [ 131 I], [ 3 H], [ 14 C] and the like are used.
  • the enzyme a stable enzyme having a large specific activity is preferable.
  • ⁇ -galactosidase ⁇ -glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used.
  • fluorescent material for example, fluorescamine, fluorescein isothiocyanate and the like are used.
  • luminescent substance for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used.
  • a biotin- (strept) avidin system can also be used for binding of an antibody or antigen to a labeling agent.
  • the method for quantifying NSG1 using the detection antibody of the present invention is not particularly limited, and the amount of antibody, antigen or antibody-antigen complex corresponding to the amount of antigen in the sample solution is chemically or physically determined. Any measurement method may be used as long as it is a measurement method that is detected by means and calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephrometry, competition method, immunometric method and sandwich method are preferably used. In view of sensitivity and specificity, for example, the sandwich method described later is preferably used.
  • the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, or glass.
  • the sample solution is reacted with the insolubilized detection antibody of the present invention (primary reaction), and further labeled with another detection antibody of the present invention (secondary reaction), and then on the insolubilized carrier.
  • primary reaction By measuring the amount or activity of the labeling agent, NSG1 in the sample solution can be quantified.
  • the primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at different times.
  • the labeling agent and the insolubilization method can be the same as those described above.
  • the antibody used for the immobilized antibody or labeled antibody is not necessarily one type, and a mixture of two or more types of antibodies is used for the purpose of improving measurement sensitivity. May be.
  • the detection antibody of the present invention can also be used in measurement systems other than the sandwich method, such as a competitive method, an immunometric method, or nephrometry.
  • a competitive method NSG1 in a sample solution and labeled NSG1 are reacted competitively with an antibody, and then unreacted labeled antigen (F) and labeled antigen (B) bound to the antibody are separated.
  • B / F separation Measure NSG1 in the sample solution by measuring the amount of either B or F label.
  • a soluble antibody is used as an antibody
  • B / F separation is performed using polyethylene glycol or a secondary antibody against the antibody (primary antibody)
  • a solid phase is used as the primary antibody.
  • NSG1 in a sample solution and immobilized NSG1 are allowed to compete with a certain amount of labeled antibody, and then the solid phase and the liquid phase are separated, or the NSG1 in the sample solution is separated from NSG1.
  • An excess amount of labeled antibody is reacted, and then solid-phased NSG1 is added to bind unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated.
  • the amount of label in any phase is measured to quantify the amount of antigen in the sample solution.
  • nephrometry the amount of insoluble precipitate produced as a result of antigen-antibody reaction in a gel or solution is measured.
  • Laser nephrometry using laser scattering is preferably used even when the amount of NSG1 in the sample solution is small and only a small amount of precipitate is obtained.
  • An NSG1 measurement system may be constructed by adding ordinary technical considerations to those skilled in the art to the usual conditions and operation methods in each method. For details of these general technical means, it is possible to refer to reviews, books and the like. For example, Hiroshi Irie “Radioimmunoassay” (Kodansha, published in 1974), Hiroshi Irie “Sequel Radioimmunoassay” (published in Kodansha, 1979), “Enzyme Immunoassay” edited by Eiji Ishikawa et al.
  • the amount of NSG1 in cells can be quantified with high sensitivity by using the detection antibody of the present invention.
  • the expression level (mRNA level or protein level) of NSG1 in the presence of the test substance is about 20% or more, preferably about 30%, compared to the case in the absence of the test substance.
  • the test substance when it is inhibited more preferably by about 50% or more, the test substance can be selected as a candidate for an NSG1 expression-suppressing substance, and thus a substance having angiogenesis inhibitory activity.
  • a cell containing a reporter gene under the control of the transcriptional regulatory region in the NSG1 gene can be used instead of the cell expressing the NSG1 gene.
  • Such cells may be cells, tissues, organs or individuals of transgenic animals into which a reporter gene (eg, luciferase, GFP, etc.) under the control of the transcriptional regulatory region of the NSG1 gene has been introduced.
  • a reporter gene eg, luciferase, GFP, etc.
  • the expression level of NSG1 can be evaluated by measuring the expression level of the reporter gene using a conventional method.
  • the screening method of the present invention can also be performed using as an index whether or not a test substance suppresses the function of NSG1. Specifically, it is measured by the method described in Non-Patent Document 4 whether the test substance suppresses the ability of NSG1 to bind to syntaxin-13, and the test substance that suppresses the function of NSG1 is selected as a candidate substance. Can be selected. Alternatively, it is possible to measure whether or not the test substance suppresses the intracellular transport function of the cell membrane protein by the method described in Non-Patent Document 4, and select the test substance that suppresses the function of NSG1 as a candidate substance. it can.
  • the binding ability with syntaxin-13 in the absence of the test substance or the intracellular transport function of the cell membrane protein is about 10% or more, preferably about 20% or more, more preferably about 30% or more, More preferably, when the substance is inhibited by about 50% or more, the test substance can be selected as a candidate for an NSG1 function-suppressing substance, and thus a substance having an angiogenesis inhibitory activity.
  • the test substance in tumor vascular endothelial cells expressing NSG1, it can be carried out by measuring whether or not migration of the cells is suppressed by adding a test substance.
  • cell migration of tumor vascular endothelial cells in the presence of the test substance is about 10% or more, preferably about 20% or more, more preferably about 30% or more, compared to cell migration in the absence of the test substance. More preferably, when the substance is inhibited by about 50% or more, the test substance can be selected as a candidate for an NSG1 function-suppressing substance, and thus a substance having angiogenesis inhibitory activity.
  • the screening method described above as a control, cells that have been knocked out of the NSG1 gene are used, and the test substance does not exhibit the above function in control cells that do not express the NSG1 gene. Can be confirmed. That is, it can be confirmed that the action mechanism of the candidate substance having angiogenesis inhibitory activity obtained in the above screening method is based on suppression of NSG1 or NSG1 gene expression or suppression of NSG1 function.
  • the substance that suppresses the expression or function of NSG1 obtained by using any one of the screening methods of the present invention is useful as a medicament for the prevention and / or treatment of cancer.
  • the compound obtained using the screening method of the present invention is used as the above-mentioned prophylactic / therapeutic agent, it can be formulated in the same manner as the low molecular weight compound that suppresses the expression or function of NSG1, and has the same administration route and
  • the dose may be administered orally or parenterally to humans or mammals (eg, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.). it can.
  • the present invention provides a method for determining the onset or onset risk of cancer, characterized by measuring the expression level of NSG1 in a sample collected from a test animal.
  • the method includes the following steps (a) and (b).
  • a step of determining that a test animal having an increased risk of developing cancer or having a high risk of developing in the future is provided.
  • test animals include humans and other mammals, preferably humans, mice, rats, rabbits, dogs, monkeys and the like that are widely used as experimental animals.
  • the measurement target sample include blood, plasma, serum, cerebrospinal fluid, lymph fluid, saliva, mucous membrane, urine, tears, semen, joint fluid, biopsy sample, and the like.
  • the expression level of NSG1 gene and the amount of protein in the sample can be measured by the same method as described in the above screening method using the expression level of the gene or the protein as an index. As a result of the above measurement, when the expression level of NSG1 gene or NSG1 in the sample collected from the test animal is significantly higher than the expression level of NSG1 gene or NSG1 in the sample collected from the normal animal It can be determined that the test animal has cancer or has a high risk of developing in the future.
  • the expression level in a normal animal is identified in advance, for example, the average value + 2SD is defined as a cutoff value, and the expression level of NSG1 gene or the amount of NSG1 in a sample collected from the test animal If the value is exceeded, the test animal can also be determined to have developed cancer or have a high risk of developing in the future.
  • HSC3 human tongue cancer cells
  • SIGMA DMEM medium
  • FBS manufactured by Hyclone
  • A375SM human highly metastatic melanoma cells
  • MEM medium containing 10% FBS (Hyclone)
  • OSRC2 human kidney cancer cells
  • RPMI medium SIGMA
  • HBSS Hank's buffered salt solution
  • Example 2 Transplantation of cancer cells into mice 6 to 7-week-old mice (strain: KSN / Slc nude, sex: female, breeder: Nippon SLC) subcutaneously transplanted in Example 1 per mouse. 0.1 ml of the cell suspension was injected using a 1 mL syringe syringe (Terumo) and a 27G needle (Terumo). The mice were reared until the diameter of the transplanted tumor was about 10 mm.
  • Example 3 Preparation of Mouse Primary Vascular Endothelial Cells
  • the tumor subcutaneously transplanted mice prepared in Example 2 were euthanized after general anesthesia with isoflurane (Abbott Japan). After removing the tumor part (tumor mass) and cutting it finely with scissors in 20 ml of a collagenase type II (Collagenase Type II, GIBCO) solution with a final concentration of 10-15 mg / ml, the final concentration becomes 20-30 ⁇ g / ml As described above, DNase (Roche) was added and incubated at 37 ° C. for 30 minutes (shaking) to prepare a cell suspension.
  • a collagenase type II Collagenase Type II, GIBCO
  • the tube containing the cell suspension is placed on ice, and the suspension (upper layer) from which the undigested tissue fragments that have precipitated are removed is transferred to a new 50 mL tube through a 100 ⁇ m mesh size cell strainer (BD Biosciences). did.
  • the collagenase was inactivated by adding the same amount of FBS as the cell suspension.
  • the cells were collected by centrifugation at 1000 rpm at 4 ° C. for 5 minutes, and then suspended in 20 mL of HBSS (GIBCO).
  • the suspension was suspended in 1 ml of HBSS containing 0.5% BSA and incubated (stirred) at room temperature for 20 minutes.
  • 5 ⁇ l of rat anti-mouse CD31 antibody Purified Rat Anti-mouse CD31, manufactured by BD Biosciences pharmingen
  • the cells were suspended in 0.5% BSA-containing HBSS and centrifuged again at 1000 rpm and 4 ° C for 5 minutes.
  • an LS column (LS Columns, manufactured by Miltenyi Biotec) is used.
  • the following operation was performed using First, place the selected column on the attached magnetic magnet, add 500 ⁇ l of MACS buffer 3 times to perform calibration (initial calibration), add 1 mL of cell suspension to the column, and wash 3 times with 500 ⁇ l of MACS buffer. did.
  • the column was removed from the magnet, and the magnetically labeled CD31 positive cells remaining in the column were pushed out into a 15 ml tube with 1 mL of MACS buffer using a syringe attached to the column.
  • 6-well plate (Nunc) coated with PBS containing 1.5% gelatin (manufactured by SIGMA) after resuspending the cells using EGM-2MV (manufactured by Lonza) dedicated to vascular endothelial cells and counting the number of cells 2x10 5 cells / well in a 20% FBS-containing EGM-2MV medium containing diphtheria toxin (Calbiochem) at a final concentration of 500 ng / ml for 16 hours and then converted to a medium containing no diphtheria toxin. Cultured for 2 weeks.
  • the cultured cells are collected, resuspended in HBSS containing 0.5% BSA, and then BS1-B4 positive cells are separated and collected by MACS using BS1-B4 (Vector Laboratories) instead of the CD31 antibody.
  • the tumor vascular endothelial cells were used in the following experiments.
  • normal vascular endothelial cells were prepared in the same manner as the above-described method for preparing tumor vascular endothelial cells, starting from the skin blood vessels of mice not transplanted with tumor cells.
  • Example 4 Cultivation of mouse primary vascular endothelial cells Cultured at 37 ° C. under 5% CO 2 using a growth medium for vascular endothelial cells (Brett Kit EGM-2MV, manufactured by Lonza). During passage, after removing the medium from the flask by suction, it was washed once with PBS (GIBCO), added with 0.05% trypsin-EDTA solution (GIBCO), then at 37 ° C and 5% CO 2 The cells detached in 3 minutes were suspended and collected by adding DMEM medium containing 10% FBS (manufactured by Nacalai Tesque). The cell suspension was centrifuged at 800 rpm for 5 minutes at room temperature, and the cells were collected, diluted and suspended in EGM-2MV medium, and cultured.
  • a growth medium for vascular endothelial cells (Brett Kit EGM-2MV, manufactured by Lonza).
  • Example 5 SiRNA transfection of mouse primary vascular endothelial cells Add 1.44 ⁇ l of 10 ⁇ M siRNA solution and 8 ⁇ l of Lipofectamine RNAiMAX reagent (Invitrogen) to 0.8 ml of EBM-2 medium (Lonza) and mix at room temperature for 10- The mixture was allowed to stand for 20 minutes to form a complex of the following siRNA (showing only the sense strand) and liposome.
  • mNSG1-1 siRNA CCCAAGAUAGCCGAGUUCACCGUCA (SEQ ID NO: 7)
  • mNSG1-2 siRNA CCGAGGGUGUCACCGAGAGGUUUAA
  • mNSG1-3 siRNA UCUUCCUGGUUGUCUACAAAGUGUA (SEQ ID NO: 9)
  • vascular endothelial cell suspension diluted to 9 ⁇ 10 4 cells / ml in EBM-2 medium containing 0.5% FBS, and mixed.
  • the mixture was dispensed at 1.5 ml / well into a 6-well plate (Asahi Techno Glass) for RNA preparation and 2.25 ml / well onto a 6-well plate (Asahi Techno Glass) for migration assay. . 37 ° C., after 6 hours of culture under 5% CO 2, EGM-2 MV medium equal volumes of (Lonza Inc.) were added, respectively, 37 ° C. until carrying out the assay, and incubated under 5% CO 2 .
  • siRNA used here are commercially available from Invitrogen (mNSG1-1: Nsg1 Stealth Select RNAi (registered trademark) siRNA (MSS276087), mNSG1-2: Nsg1 Stealth Select RNAi siRNA (MSS276088), and mNSG1-3. : Nsg1 Stealth Select RNAi siRNA (MSS276089).
  • Example 6 Migration assay Angiogenesis system: Measured using a vascular endothelial migration assay (Becton Dickinson). That is, 48 hours after siRNA transfection, the medium of the 6-well plate for migration assay prepared in Example 5 was removed by suction, washed once with PBS (manufactured by GIBCO), and then EBM-2 containing 0.2% BSA. The medium was added at 1-2 ml / well and cultured at 37 ° C. under 5% CO 2 for 2-3 hours. After detaching and suspending the cells by pipetting, the number of cells was counted by staining with 0.2% trypan blue (GIBCO).
  • GIBCO vascular endothelial migration assay
  • the above cell suspension was added at 0.25 ml / well to the upper chamber of a 24-well plate for migration assay (Becton Dickinson) returned to room temperature, followed by EGM-2MV diluted 10-fold with EBM-2 medium.
  • the medium was added to the lower well at 0.75 ml / well and cultured in a CO 2 incubator (37 ° C., 5% CO 2 condition) for 16-20 hours.
  • Fluorescence values are measured with a downward photometric fluorescence plate reader (CytoFluor II, manufactured by PerSeptive Biosystems) (excitation wavelength: 485 nm / measurement wavelength: 530 nm), corrected by the number of cells in the upper chamber and corrected for the fluorescence value per 10 4 cells. Calculated. The measurement value was calculated assuming that the measured value of only the medium containing no cells (blank) was 0%, and the measured value of the cells (mock) added with only the transfection reagent not containing siRNA was 100%. The results are shown in Table 1. From the above, it was shown that when the NSG1 gene siRNA was transfected, migration was specifically inhibited by tumor vascular endothelial cells.
  • RNA was prepared from the cells described in Example 5 using QuickGene-800 (Fuji Film) according to the attached protocol. That is, 48 hours after siRNA transfection, the medium was aspirated and removed from each well of the 6-well plate for RNA preparation prepared in Example 5, and then LRC lysis attached to QuickGene RNA cultured cell kit S (Fuji Film) was attached. A mixed solution obtained by adding 2-mercaptoethanol at 10 ⁇ l / ml to the solution was added at 350 ⁇ l / well to prepare a cell lysate.
  • RNA mode was selected and RNA was automatically prepared.
  • concentration of the prepared RNA was measured with Nanodrop-1000 (manufactured by Thermo scientific) and subjected to RT-PCR reaction. (RT-PCR) Using the prepared RNA as a template, cDNA was synthesized using TaqMan Reverse Transcription Reagents (ABI).
  • a pair of primers (a normal strand that binds to the cDNA ( ⁇ strand) and a reverse strand that binds to the + strand so that the base sequence region encoding the gene to be quantified can be specifically amplified. ) was designed and synthesized in the usual way.
  • primers 1 and 2 having the base sequences shown below were used.
  • Mouse NSG1 Primer 1 GCCCTGATGGGTTTGTCTTGA (SEQ ID NO: 10)
  • Mouse NSG1 Primer 2 CACTGGAGTCTTGCTCCGTGTAGTA (SEQ ID NO: 11)
  • 18S ribosomal RNA primer 1 GGGAGCCTGAGAAACGGC (SEQ ID NO: 12)
  • 18S ribosomal RNA primer 2 GGGTCGGGAGTGGGTAATTT (SEQ ID NO: 13)
  • control cell means a cell (mock) containing no transfection reagent and containing only the transfection reagent.
  • Table 2 shows the inhibition rate of mouse NSG1 gene expression when each siRNA of the mouse NSG1 gene (see Example 5) was introduced into mouse primary tumor vascular endothelial cells.
  • NSG1 was suppressed by three types of siRNA, mNSG1-1, mNSG1-2, and mNSG1-3.
  • Example 8 Expression in mouse primary tumor vascular endothelial cells RNA was prepared from the cells prepared in Example 4 by the method described in Example 7, and quantitative RT-PCR was performed. As a result, it was shown that the expression of NSG1 was significantly higher in mouse primary tumor vascular endothelial cells than in mouse primary normal vascular endothelial cells. (Fig. 1)
  • Example 9 Suppression of human NSG1 expression Phosphoramidite method using amidite for siRNA sequence against human NSG1 (see Table 3) (21-base double-stranded siRNA consisting of 19 base pairs and 2-base 3'-end overhang) was synthesized with an RNA synthesizer (ABI394). 10 ml of Lipofectamine RNAiMAX reagent (manufactured by Invitrogen) was added per 1 ml of Opti-MEM medium (manufactured by GIBCO), mixed, and dispensed into a 6-well plate (manufactured by Asahi Techno Glass) at 400 ⁇ l / well.
  • RNAiMAX RNAiMAX diluted solution
  • 2 ml of HEK293 (human embryonic kidney cell line) cell suspension prepared at 1x10 5 cells / ml in DMEM medium (Nacalai Tesque) containing 10% FBS was added at 37 ° C, 5% Incubate overnight under CO 2 conditions.
  • Untreated cells were used as control cells.
  • the following primers were used.
  • Human NSG1 Primer 1 AGGTTTAAGGTCTCCGTGTTGGTCC (SEQ ID NO: 14)
  • Human NSG1 Primer 2 TAGACAACCAGGAAGACGACGCAG (SEQ ID NO: 15)
  • 18S ribosomal RNA primer 1 GGGAGCCTGAGAAACGGC (SEQ ID NO: 12)
  • 18S ribosomal RNA primer 2 GGGTCGGGAGTGGGTAATTT (SEQ ID NO: 13)
  • Table 3 shows the portion corresponding to the sense strand of the target gene, and the actually prepared siRNA has an overhang sequence “dTdT” added to the 3 ′ end of the sequence shown in Table 3. Yes.
  • Example 10 SiRNA Transfection into Mouse Primary Tumor Vascular Endothelial Cells
  • Example 9 Of the siRNA sequences for human NSG1 described in Table 3, the sequence completely matched mouse NSG1 and had a high expression inhibitory effect on human NSG1 SEQ ID NO: 17
  • siRNA transfection of mouse primary tumor vascular endothelial cells was performed using the siRNA represented by SEQ ID NO: 34 and the siRNA represented by SEQ ID NO: 34.
  • vascular endothelial cell suspension diluted to 6.6 ⁇ 10 4 cells / ml in EBM-2 medium containing 0.5% FBS, and mixed.
  • the mixture was dispensed at 1.5 ml / well into a 6-well plate (Asahi Techno Glass) for RNA preparation and 2 ml / well into a 6-well plate (Asahi Techno Glass) for migration assay.
  • EGM-2MV medium Lonza
  • Example 11 Migration Assay A migration assay was performed according to the method described in Example 6 for the siRNA represented by SEQ ID NO: 17 and the siRNA represented by SEQ ID NO: 34 produced in Example 9. The results of confirming the cell migration inhibitory effect are shown in Table 4.
  • the siRNA represented by SEQ ID NO: 17 and the siRNA represented by SEQ ID NO: 34 suppressed the migration of primary tumor vascular endothelial cells by suppressing the gene expression of NSG1.
  • Example 12 Quantitative RT-PCR From the cells described in Example 10, RNA was prepared 24 hours after siRNA transfection according to the method described in Example 7, and quantitative RT-PCR was performed. Table 5 shows the inhibition rate of mouse NSG1 gene expression of the siRNA represented by SEQ ID NO: 17 and the siRNA represented by SEQ ID NO: 34 when introduced into mouse primary tumor vascular endothelial cells.
  • the substance that suppresses the expression or function of NSG1 or NSG1 gene of the present invention exhibits a tumor vascular endothelial cell migration inhibitory activity, and is useful as a medicine, specifically as a therapeutic or prophylactic agent for cancer.
  • the screening method of the present invention is useful for searching for an angiogenesis inhibitor that is a candidate substance for cancer treatment or prevention.
  • siRNA SEQ ID NOs: 10-15 PCR primers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)

Abstract

L'invention porte sur un agent anti-tumoral, de façon spécifique un agent anti-angiogenèse, comprenant, comme principe actif, une substance capable d'inhiber l'expression ou la fonction de NSG1, de façon spécifique un acide nucléique antisens pour un produit de la transcription d'un gène codant pour NSG1, un acide ribonucléique pour un produit de la transcription d'un gène codant pour NSG1, un acide nucléique ayant une activité ARNi sur un produit de la transcription d'un gène codant pour NSG1, un anticorps capable de se lier à NSG1 ou similaires ; et sur un procédé de criblage d'un agent anti-angiogenèse, qui est caractérisé par la sélection d'un composé qui peut réduire le niveau d'expression d'un gène codant pour NSG1 ou le niveau d'expression de NSG1 ou qui peut réduire la fonction de NSG1.
PCT/JP2010/063124 2009-08-04 2010-08-03 Inhibiteur angiogenèse tumorale WO2011016461A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2011525899A JP5669271B2 (ja) 2009-08-04 2010-08-03 腫瘍血管新生阻害剤

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2009-181537 2009-08-04
JP2009181537 2009-08-04

Publications (1)

Publication Number Publication Date
WO2011016461A1 true WO2011016461A1 (fr) 2011-02-10

Family

ID=43544356

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/063124 WO2011016461A1 (fr) 2009-08-04 2010-08-03 Inhibiteur angiogenèse tumorale

Country Status (2)

Country Link
JP (1) JP5669271B2 (fr)
WO (1) WO2011016461A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108070645A (zh) * 2016-11-11 2018-05-25 中国科学院上海生命科学研究院 Stx-t在预防和/或治疗贫血或其相关疾病的应用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
C. C. YAP ET AL.: "The somatodendritic endosomal regulator NEEP21 facilitates axonal targeting of Ll/NgCAM", THE JOURNAL OF CELL BIOLOGY, vol. 180, no. 4, 2008, pages 827 - 842 *
C. DEBAIGT ET AL.: "Crucial Role of Neuron- enriched Endosomal Protein of 21 kDa in Sorting between Degradation and Recycling of Internalized G-protein-coupled Receptors", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 34, 2004, pages 35687 - 35691 *
L. CARLOCK ET AL.: "Variable subcellular localization of a neuron-specific protein during NTera 2 differentiation into post- mitotic human neurons", MOLECULAR BRAIN RESEARCH, vol. 42, 1996, pages 202 - 212 *
S. ALBERI ET AL.: "The endosomal protein NEEP21 regulates AMPA receptor-mediated synaptic transmission and plasticity in the hippocampus", MOLECULAR AND CELLULAR NEUROSCIENCE, vol. 29, no. 2, 2005, pages 313 - 319, XP004902667, DOI: doi:10.1016/j.mcn.2005.03.011 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108070645A (zh) * 2016-11-11 2018-05-25 中国科学院上海生命科学研究院 Stx-t在预防和/或治疗贫血或其相关疾病的应用

Also Published As

Publication number Publication date
JP5669271B2 (ja) 2015-02-12
JPWO2011016461A1 (ja) 2013-01-10

Similar Documents

Publication Publication Date Title
JP5794514B2 (ja) 腫瘍血管新生阻害剤
JP7175526B2 (ja) 細胞遊走調節に関する疾患の予防・治療剤および肺間質の疾患の疾患活動性判定・予後評価
JP2011032236A (ja) 腫瘍血管新生阻害剤
JP2015173601A (ja) がん幹細胞の増殖抑制物質のスクリーニング方法
WO2010140694A1 (fr) Procédé pour le criblage d'inhibiteur utilisant un facteur capable de stimuler la production de peptide amyloïde bêta, et inhibiteur obtenu par celui-ci
WO2017195809A1 (fr) Inhibiteur d'expression d'un promoteur d'inflammation, procédé de criblage du principe actif de cet inhibiteur, cassette d'expression utile pour ce procédé, agent de diagnostic et procédé de diagnostic
JP5669271B2 (ja) 腫瘍血管新生阻害剤
WO2011040421A1 (fr) Méthode de criblage
WO2011115271A1 (fr) Inhibiteur d'angiogenèse de tumeur
JP6226315B2 (ja) 炎症性疾患の予防・治療剤、並びに炎症性疾患予防・治療薬のスクリーニング方法
JP7450268B2 (ja) がん幹細胞マーカー及びがん幹細胞標的薬
JP2012135304A (ja) アミロイドベータ産生制御因子を用いた阻害剤スクリーニング方法
WO2011019065A1 (fr) Inhibiteur de l'angiogenèse tumorale
WO2011115268A1 (fr) Inhibiteur d'angiogenèse de tumeur
EP2123303A1 (fr) Agent améliorant pour la résistance à l'insuline
JP6653120B2 (ja) Ｉｋａｒｏｓ阻害に基づく抗炎症薬
WO2016031996A1 (fr) Agent prophylactique/thérapeutique contre l'arthrite, trousse d'essai pour l'arthrite, et procédé de criblage d'agent prophylactique/thérapeutique contre l'arthrite
JP5176035B2 (ja) Ｄｒｅｆを分子標的とする癌治療用組成物
WO2009084668A1 (fr) Procédé d'inhibition de la prolifération de cellules cancéreuses, inhibiteur de prolifération et procédé de criblage
KR101862520B1 (ko) ANKs1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법
JP2011105669A (ja) 抗腫瘍剤および抗腫瘍剤のスクリーニング方法
KR20170049024A (ko) ANKs1a 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물 및 이의 스크리닝 방법
WO2016194993A1 (fr) Médicament à base d'acide nucléique ciblant le cancer de type slco1b3
JP2010111623A (ja) 糖鎖認識受容体の新規用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10806460

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2011525899

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10806460

Country of ref document: EP

Kind code of ref document: A1