WO2011004957A2 - 결핵균 약제 내성 진단용 프로브 및 그 키트 - Google Patents

결핵균 약제 내성 진단용 프로브 및 그 키트 Download PDF

Info

Publication number
WO2011004957A2
WO2011004957A2 PCT/KR2010/002599 KR2010002599W WO2011004957A2 WO 2011004957 A2 WO2011004957 A2 WO 2011004957A2 KR 2010002599 W KR2010002599 W KR 2010002599W WO 2011004957 A2 WO2011004957 A2 WO 2011004957A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nos
probe
tuberculosis
resistance
Prior art date
Application number
PCT/KR2010/002599
Other languages
English (en)
French (fr)
Other versions
WO2011004957A3 (ko
Inventor
조상래
이혜영
방혜은
왕혜영
강미란
Original Assignee
엠앤디(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 엠앤디(주) filed Critical 엠앤디(주)
Publication of WO2011004957A2 publication Critical patent/WO2011004957A2/ko
Publication of WO2011004957A3 publication Critical patent/WO2011004957A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a probe for diagnosing resistance to a drug used as an anti-tuberculosis drug, a kit thereof, and a diagnostic method thereof. More specifically, the present invention relates to rifampin, isoniazid, ofloxacin, kanamycin, and streptomycin, which are major anti-tuberculosis drugs.
  • the present invention relates to a primer capable of amplifying resistance-related genes, a probe capable of detecting resistance-related mutations of the gene, and a drug resistance diagnostic kit for Mycobacterium tuberculosis comprising such primers and probes.
  • tuberculosis is a wasting chronic disease caused by Mycobacterium tuberculosis, which is detected in the tuberculosis of tuberculosis patients, according to the WHO report. About 1 billion people, or 1, are known to develop 8 million new tuberculosis (TB) patients each year (www.who.int/gtb/publications/globrep).
  • Tuberculosis is a fundamentally curable disease.
  • the main treatments for tuberculosis include rifampin (RPM), isoniazid (INH), and pyrazinamid (PZA) and etahambutol (EMB).
  • RPM rifampin
  • IH isoniazid
  • PZA pyrazinamid
  • EMB etahambutol
  • Long-term treatment of the first drug such as streptomycin (SM) for 6 months and if the first drug does not work, the second drug such as ofloxacin (OFX) or kanamycin (KAN)
  • OFX kanamycin
  • Use chemotherapy to be used (Tuberculosis: A global Emergency (news) .World Health Forum, 14 (4) 438, 1993. In: Ministry of Health and Welfare, Korean Tuberculosis Association. Tuberculosis control measures in the 2000s, 1997).
  • MDR- multidrug resistant TB
  • XDR-TB most resistant drug among the most resistant drug-resistant tuberculosis
  • Multidrug-resistant tuberculosis does not respond well to treatment, and despite taking medications, it is likely to continue to discharge tuberculosis bacteria and become the source of resistant tuberculosis bacteria, and to spread first-resistant tuberculosis. Therefore, although the rapid detection and effective treatment of MDR-TB is essential, there is a limitation that the rapid and accurate resistance test and the types of anti-TB drugs are limited. In addition, multidrug-resistant tuberculosis is an intractable tuberculosis that increases the mortality rate due to the high cost and low treatment efficiency.
  • HIV Human immunodeficiency virus
  • the prescription is decided in the absence of resistance test results.
  • the drug is selected and the drugs that have never been used are combined and treated with 4 to 7 types of drugs.
  • Include secondary medications such as kanamycin. Therefore, additional strategies are needed to improve the effectiveness of treatment, such as the identification of susceptibility results and the use of appropriate secondary agents.
  • tuberculosis bacteria resistant to secondary drugs have increased as a very effective drug for treating TB patients.
  • fluoroquinolone drugs have been developed based on a quinolone drug called nalidixic acid (Chen, FJ, HJ LU. J. Microviol.
  • Rapid and accurate drug sensitivity testing is essential for effective treatment of tuberculosis patients.
  • diagnostic kits include INNO-LiPA Rif., which detects mutations in the rpoB gene associated with rifampin resistance.
  • Genotype MTBDRplus assay (Hain Lifescience GmbH, Nehren, Germany), which has TB (Innogenetics, Ghent, Belgium), detects the mutations most frequently present in katG, inhA, and rpoB.
  • the prior art only detects mutations in the katG gene and inhA promoter site to diagnose isoniazid resistance. As described above, about 50-95% of strains resistant to isoniazid are mutated at the codon 315 site of the katG gene, 20-35% at the inhA promoter site and 10-15% at the oxyR-ahpC intergenic site. Is reported to be found. Therefore, diagnosing resistance to isoniazid with only the mutation of the katG gene and the inhA promoter region may not diagnose about 10-15% of the resistant strains.
  • the inflow of ofloxacin into the cell membrane It is known to be caused by porin proteins that enter the lipid bilayer or are present in the extracellular membrane (Kocagoz, T., C. j. hackbarth, I. unsal, EY Rosenberg, H. Nikaido, HF Chambers.Antimicrob) Agents Chemother. 1996. 40: 1768-1774.
  • DNA gyrase which enters the cell, acts on the DNA gyase, which seals the cut off portion of the DNA while maintaining its DNA's helix.
  • DNA gyrase is composed of two A subunits and two B subunits encoded by the gyrA and gyrB genes (Lu, T., X. Zhao, K. drlica.Antimicrob. Agents Chemother. 1999. 43: 2969-2974) .
  • Subunit B is responsible for the function of ATPase that provides the necessary energy.
  • the resistance of Mycobacterium tuberculosis to ofloxacin is due to a decrease in affinity for the drug of DNA gyrase or the release of ofloxacin by dfflux pump.
  • the decrease in affinity of DNA gyrase to ofloxacin is known to be caused by the DNA gyrase A mutation.
  • 50-80% of mutations related to ofloxacin resistance are concentrated in the codon 88-94 region. This site is known as quinolone Resistant Determining Region (QDRR) (Grimaldo, ER, TE Tupasi, AB Rivera, MI Remapio, RC Cardano, JO Derilo, VA Belen. Int. J. Tuberc. Lung Dis. 2001. 5: 546-550).
  • QDRR quinolone Resistant Determining Region
  • Kanamycin is a secondary drug used in the treatment of tuberculosis along with primary drugs such as rifampin and isoniazid in the aminoglycoside family, and binds to ribosomes 30s. Inhibit protein synthesis.
  • Streptomycin is a drug of the aminocyclitol glycoside family, and is generally used in primary treatment, and binds to 30s of ribosomes to inhibit protein synthesis.
  • the presence of mutations in the gene product targeted by the antituberculosis drug can be used to determine whether the drug is susceptible to Mycobacterium tuberculosis.
  • the present invention solves the above problems and the object of the present invention is to provide a probe for diagnosing the resistance to the drug being used as an anti-tuberculosis agent.
  • Still another object of the present invention is to provide a kit for diagnosing resistance to a drug used as an anti-tuberculosis agent.
  • Another object of the present invention is to provide a rapid diagnosis of anti-tuberculosis drug resistance related genes.
  • the present invention provides an anti-tuberculosis resistance gene probe having at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 21 to 67.
  • the anti-tuberculosis agent is preferably one or more agents selected from the group consisting of rifampin, isoniazid, opaxacin and kanamycin and streptomycin, but is not limited thereto.
  • the gene probe preferably binds specifically to one or more genes selected from the group consisting of Myc, katG, inhA, ahpC, and rpoB, gyrA, rrs, and rpsL genes, but is not limited thereto.
  • the present invention also provides a kit for diagnosing anti-TB drug resistance containing a primer capable of amplifying the above-described gene probe and Mycobacterium tuberculosis.
  • the primer is preferably a primer described in SEQ ID NOs: 1 to 20, but is not limited thereto.
  • kit of the present invention preferably further comprises a label means for detecting a PCR product.
  • the present invention comprises the steps of a) attaching the gene probe of the present invention to the solid support; b) hybridizing the PCR product of the amplified Mycobacterium tube with the gene probe; And c) provides an anti-tuberculous drug resistance diagnostic method comprising the step of detecting the hybridized product.
  • the PCR product of Mycobacterium tuberculosis is preferably obtained by the primers described in SEQ ID NOs: 1 to 20, but is not limited thereto.
  • the detection step is preferably detected using a luminescence or color reaction, but is not limited thereto.
  • cells were obtained from a sample, nucleic acids were extracted from the cells, and PCR amplification was performed. Methods of extracting nucleic acids from cells and PCR methods were performed through methods well known in the art, such as those described in Molecular cloning (1989) by Sambrook et al.
  • the nucleic acid amplification method of the present invention used a primer.
  • the primer is preferably about 10 to 25 bp in length oligonucleotide, but may be longer.
  • the primer is preferably single stranded but may be present in double or single stranded form. It described in the Example.
  • Sequences such as primers of the invention can be used to form a double helix optionally with complementary sequences, such as DNA derived from a sample.
  • complementary sequences such as DNA derived from a sample.
  • One skilled in the art can alter the hybridization conditions to change the selectivity of the primer for the target sequence.
  • nucleic acids of defined sequences of the invention may be employed in combination with appropriate means such as labels to determine hybridization.
  • suitable labeling means are various labeling means including fluorescence, radioisotope enzymes or other ligands.
  • PCR polymerase chain reaction
  • the amplification products can be separated using agarose, agarose-acrylamide or PAGE using the standard method described in Molecular cloning (1989) by Sambrook et al.
  • Chromatography such as adsorption, partitioning and ion exchange, can also be employed as an effective separation method. These separation methods can be adapted to function in clinical settings to process large volumes of samples, and new methods for separating or detecting thousands of samples at once, FMAT (fluorometric microvolume assay technique), chemiluminescence, and sequence detection systems (Applied) Biosystems) and mass spectroscopy.
  • FMAT fluorometric microvolume assay technique
  • chemiluminescence chemiluminescence
  • sequence detection systems Applied Biosystems
  • Nucleic acids according to the invention will be detected and quantified.
  • the detection can be performed by visual means. Typical visual means method is to dye the gel with ethidium bromide and visualize the bands under UV light. If the amplification product is nucleotides labeled with radiation or fluorescence, the isolated amplification product performs radiosynthesis or fluorescent detection of the inserted radioisotope label.
  • the present invention includes a kit for carrying out the method.
  • the kit of the invention can comprise primers, enzymes for amplification and additional reagents.
  • the kits will include these one or more reagents in suitable container means.
  • the kits may also include reagents for isolating nucleic acids and purifying amplification products.
  • the components of the kits may be packaged in an aqueous medium or lyophilized form, and suitable container means of the kit include at least one vial, test tube, flask, bottle, etc. into which the components may be placed. If one or more components are present in the kit, they may include other additional containers, such as second, third, etc., where the additional components may be located separately. However, a combination of components may be included in one container.
  • the inventors of the present invention have attempted to develop a method capable of rapidly and more accurately diagnosing resistance to rifampin, isoniazid, iofloscin, kanamycin, and streptomycin.
  • genes that are targets of drugs of Mycobacterium tuberculosis which show resistance and sensitivity to each drug, Myc, katG, and inhA
  • wild-type and mutant probes were constructed to distinguish drug-resistant and sensitive bacteria. Therefore, it was confirmed that the use of such a probe can quickly diagnose the resistance to rifampin, isoniazid, ofloxacin, kanamycin and streptomycin, thereby completing the present invention.
  • the susceptibility test for the tuberculosis rifampin, isoniazid, orofaxin, kanamycin and streptomycin can be performed quickly and accurately, thus contributing to the effective treatment of tuberculosis patients. It will help to effectively block the transmission of Mycobacterium tuberculosis.
  • the present invention provides a drug for Mycobacterium tuberculosis, including a primer capable of amplifying genes related to resistance to rifampin, isoniazid, iofloscin, kanamycin and streptomycin, and a probe capable of detecting resistance related mutations of the genes.
  • a resistance diagnostic kit the present invention can detect whether each gene is mutated and thereby can quickly and accurately diagnose resistance to rifampin, isoniazid, orofoxcin, kanamycin, and streptomycin. There is. Therefore, the present invention will contribute to the effective treatment of tuberculosis patients.
  • 1 is a schematic flowchart of the present invention. That is, 1 the amine-labeled probe is bound to the membrane. 2 the target gene is amplified with a biotin-labeled primer and then reacted with the probe bound to the membrane. 3 Reacts with Streptavidin-conjugated alkaline phosphatase. 4 Detects defects of probe and amplified target gene by treating substrate of Alkaline phosphatase.
  • Figure 2 is an electrophoresis picture of the PCR product for diagnosing the resistance to rifampin and isoniazid.
  • M 100bp DNA Ladder (M & D, Wonju)
  • Lane 1-7 H37RV genomic DNA diluted 10-fold from 10ng / ul was tested for PCR amplification product
  • N PCR negative control.
  • Rifampin has an amplified product of 157bp
  • anoniazide is 108bp in KatG gene, 107bp in inAA gene, 157bp in ahpC gene and 126bp in Myc gene.
  • FIG. 3 and 4 are photographs showing the luminescence method (FIG. 3) and the color development method (FIG. 4) for rifampin and isoniazid using a reverse blot hybridization method.
  • the photographs show that rifampin and isoniazid can be detected for each part of the designed sensitivity and resistance probe.
  • Figure 5 is a photograph (top) showing the results of the diagnostic diagnosis of Mycobacterium tuberculosis resistance to rifampin and isoniazid.
  • R means drug resistance
  • S means drug sensitivity.
  • FIG. 6 is an electrophoretic photograph of a PCR product for diagnosing resistance to Ofloxacin and kanamycin and streptomycin.
  • M 100bp DNA Ladder (M & D, Wonju)
  • Lane1-29 PCR amplification product of clinically isolated tuberculosis strain
  • P PCR product of standard tuberculosis strain
  • N PCR negative control.
  • Ganamycin has an amplified product size of 326 bp
  • Ofloxacin is 318 bp
  • streptomycin is amplified to 571 bp in the rrs gene and 379 bp in the rpsL gene.
  • Figure 7 is a photograph showing the luminescence method for Ofloxacin and kanamycin and streptomycin using the reverse blot hybridization method. Photographs show that each can be detected for the part corresponding to the designed sensitivity and resistance probes of Ofloxacin, kanamycin and streptomycin.
  • FIG. 8 is a photograph (top) showing the results of diagnosis of resistance of Mycobacterium tuberculosis to Ofloxacin, kanamycin and streptomycin using a reverse blot hybridization method.
  • R means drug resistance
  • S means drug sensitivity.
  • Tolerance test for Ofloxacin, kanamycin, and streptomycin with clinical sample was shown in the result table.
  • S means drug resistance
  • S drug resistance
  • S sensitized
  • mt When attached to the resistant (mt) probe, it is represented by R.
  • Samples not detected in either sensitivity or resistance are marked with an X.
  • Figure 9 is a photograph (top) showing the results of the diagnostic diagnosis of Mycobacterium tuberculosis resistance to Ofloxacin, kanamycin and streptomycin using a reverse blot hybridization method.
  • R means drug resistance
  • S means drug sensitivity.
  • Clinical samples were used for Ofloxacin, kanamycin, and streptomycin.
  • FIG. 1 is a flowchart schematically illustrating a process of carrying out the present invention.
  • the present invention amplifies four sites known to be involved in rifampin, isoniazid, ofloxacin, kanamycin, and streptomycin resistance as shown in the flowchart through multiplex PCR, and amplified products are bound to membranes of rifampin and isoniazide. After reacting with wild type and mutant type probes to determine the resistance of Ofloxacin, kanamycin, and streptomycin, the PCR product was removed by non-specific binding. In addition, it processes enzymes that can show the binding of probes and PCR products as visible signals, and finally transfers these signals to hypersensitive films or image files for analysis.
  • Example 2 Amplification of Myc, katG, inhA, ahpC, rpoB gyrA, rrs, and rpsL genes of Mycobacterium tuberculosis
  • Example 1 Myc, katG, inhA, ahpC, and rpoB, gyrA, rrs, rpsL gene sites from the genomic DNA of Mycobacterium tuberculosis resistant and sensitive to rifampin, isoniazid, ofloxacin, kanamycin, and streptomycin isolated in Example 1
  • a primer capable of amplifying each gene and later to visualize the signal was prepared by labeling the biotin (biotin) at the 5 'end of the reverse primer (see Table 1).
  • the table shows primers for amplifying Myc, katG, inhA, ahpC, rpoB, gyrA, rrs, and rpsL gene regions, in which '*' represents primers labeled with Biontin.
  • Example 3 Drug resistance diagnosis of Mycobacterium tuberculosis using a probe capable of diagnosing rifampin, isoniazid, orofaxin, kanamycin and streptomycin resistance (luminescence)
  • the table shows a probe capable of diagnosing the resistance of tuberculosis to rifampin and isoniazid, toloxacin and kanamycin and streptomycin.
  • a reverse blot hybridization method was performed using each of the electroproduced probes.
  • a 16% biodegradation membrane Biodyne C binding membrane, Pall Biosupport, MI, USA
  • (w / v) carboxyl group on the membrane surface was immersed in 10 ml of DAC (1-ethyl-3-dimethyl-aminopropylcardiimide, Sigma Chem., Co., USA) solution for 15 minutes at room temperature. After activation, it was washed with distilled water and mounted on a blot (MN45 minblotter, Immunetics, USA).
  • Each probe prepared to include an amine group (amino group) at the 5 'end was diluted in 500 mM NaHCO 3 (pH 8.4) to a final volume of 150 ⁇ L, filled in an electric blot, and then reacted at room temperature for 60 minutes.
  • the electrical probe was coupled to the electrical membrane. After the reaction was completed, the solution containing the probe was removed, the membrane was removed from the electric blot, and then immersed in 100 ml of 0.4N NaOH solution at room temperature for 9 minutes to prevent the probe from further binding. Carboxyl groups on the membrane surface were inactivated. It was washed for 5 minutes at 60 ° C. with 2 ⁇ SSPE containing 0.1% (w / v) SDS. The electrowashed membrane was remounted in the blot to be perpendicular to the direction in which the probe was coupled.
  • 3 and 7 are photographs showing the diagnostic results of rifampin, isoniazid, oparoxine, kanamycin, and streptomycin resistance of Mycobacterium tuberculosis using a reverse blot hybridization method.
  • nucleotide sequences of katG, inhA, ahpC, rpoB, gyrA, rrs, and rpsL gene regions of Mycobacterium tuberculosis bacillus showing resistance and susceptibility to rifampin, isoniazid, ofloxacin, kanamycin, and streptomycin were used in the same manner as in Example 3.
  • reverse blot hybridization method using a probe designed to specifically bind to each wild type and mutant sequence First, the same method as in Example 3 The reverse blot hybridization membrane (Biodyne C binding membrane, Pall Biosupport, MI, USA) was produced.
  • Nitro blue tetrazolium chloride and 5-Bromo-4-chloro-3-indolylphosphate, toluidine salt in 67% DMSO (v / v), Roche Applied Science, Germany ] was diluted 1:50 with TBS solution at pH 9.5 and reacted with the membrane at room temperature for 10-30 minutes to detect labeled biotin on the PCR product bound to the probe (see FIG. 1). After the color reaction was completed, the color reaction was removed and tertiary distilled water was added to stop the color reaction.
  • FIGS. 4 and 9 are photographs showing the results of diagnosing the resistance of rifampin, isoniazide, oparoxine, kanamycin, and streptomycin in Mycobacterium tuberculosis using reverse blot hybridization method (color method).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Chemical Kinetics & Catalysis (AREA)

Abstract

본 발명은 항결핵제로 사용되고 있는 약제에 대한 내성 여부를 진단하기 위 한 프로브, 그 키트 및 그 진단방법에 관한 것으로 더욱 상세하게는 주요 항결핵제인 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 내성 관련 유전자를 증폭할 수 있는 프라이머 및 해당 유전자의 내성 관련 돌연변이 여부를 검출할 수 있는 프로브 그리고 이러한 프라이머 및 프로브를 포함하는 결핵균의 약제 내성 진단 키트에 관한 것이다. 본 발명의 키트 및 방법을 이용하면 주요 항결핵제인 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 결핵균의 약제내성여부를 종래의 기술보다 신속하고 정확하게 진단함으로써 결핵환자들의 보다 효과적인 치료를 위해 활용될 수 있다.

Description

결핵균 약제 내성 진단용 프로브 및 그 키트
본 발명은 항결핵제로 사용되고 있는 약제에 대한 내성 여부를 진단하기 위한 프로브, 그 키트 및 그 진단방법에 관한 것으로 더욱 상세하게는 주요 항결핵제인 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 내성 관련 유전자를 증폭할 수 있는 프라이머 및 해당 유전자의 내성 관련 돌연변이 여부를 검출할 수 있는 프로브 그리고 이러한 프라이머 및 프로브를 포함하는 결핵균의 약제 내성 진단 키트에 관한 것이다.
일반적으로 결핵은 결핵환자가 기침을 할 때 나오는 비말핵에서 검출되는 결핵균 (Mycobacterium tuberculosis)에 의해 감염되는 소모성 만성 질환으로, WHO의 보고서에 의하면 현재 결핵균에 감염되어 있는 사람은 전세계 인구의 3분의 1에 해당하는 약 19억 명에 이르며, 이들 감염자 중에서 매년 800만 명의 새로운 결핵(Tuberculosis, TB) 환자가 발생하는 것으로 알려져있다 (www.who.int/gtb/publications/globrep).
결핵은 근본적으로 치료가 가능한 질병으로, 결핵의 주된 치료법은 리팜핀 (rifampin; RMP), 아이소니아지드(isoniazid; INH)를 주치료제로 하여 피라지나마이드(pyrazinamid; PZA), 에탐뷰톨(ethambutol;EMB), 스트렙토마이신 (streptomycin, SM) 등의 1차 약제를 6개월간 장기 치료하고 1차 약제가 듣지 않으면 2차 약제인 오플로삭신(ofloxacin; OFX), 가나마이신(kanamycin; KAN) 같은 2차 약제를 이용하는 화학요법을 사용한다(Tuberculosis: A global Emergency(news). World Health Forum, 14(4)438, 1993. In:보건복지부, 대한결핵협회. 2000년대의 결핵관리대책, 1997).
그러나 이와 같은 결핵의 치료는 약제에 내성을 갖는 결핵균, 특히 항결핵 효과가 가장 높은 리팜핀과 아이소니아지드나 두 약제 모두에 내성을 갖는 결핵균이 원인이 되는 다제약제내성결핵(multidrug resistant TB, MDR-TB)의 출현에 의해 매우 어려워졌다. 최근의 논문에 의하면 현재 전 세계에 분포하는 다제내성결핵환자는 5천만명에 이르는 것으로 알려져 있고 매년 약 275,000명의 새로운 MDR-TB 환자가 발생하며 이는 새로운 결핵환자의 약 3.5%정도이고, 특히 아시아의 경우에는 MDR-TB가 차지하는 비율이 7%정도로 되는 것으로 추산되며, 다제내성결핵 중 가장 강력한 내성을 보이는 슈퍼내성결핵(extensively drug-resistant tuberculosis, XDR-TB)은 치료성적이 50%에도 미치지 못하는 것으로 학계에 보고되어 왔다. (Dye, C., 등, 2002. Worldwide incidence of multidrug-resistant tuberculosis. J. Infect. Dis. 185,11971202).
다제내성결핵은 치료에 잘 반응하지 않으므로 약제를 복용함에도 불구하고 계속 결핵균을 배출하여 내성 결핵균의 전염원이 되어 초회내성결핵을 전파시킬 가능성이 높다. 따라서 다제내성결핵의 신속한 발견과 효과적인 치료가 필수적임에도 불구하고 신속하고 정확한 내성검사법과 사용가능한 항결핵약제의 종류가 제한되어 있다는 한계점이 있다. 또한 다제내성 결핵은 치료에 막대한 비용이 들 뿐 아니라 치료효율도 낮아 사망률이 증가되는 난치성 결핵이다.
개발도상국이나 HIV(인간 면역결핍 바이러스;Human immunodeficiency virus)의 발병이 높은 남아프리카에서는 이들에 대한 치료가 무방비상태에 있으므로 다제내성 환자가 양산되고 있는 실정이며. 러시아를 포함한 많은 동유럽 국가들에서 특히 다제내성결핵 환자의 유병률이 높은데 결핵환자의 7-22%가 여기에 속한다고 보고되고 있다. 이들 나라에서는 특별히 광범위한 인구이동이나 HIV 감염이 없는 데도 다제내성을 포함한 결핵이 증가하고 있어서 서유럽뿐 아니라 전 세계를 긴장시키고 있다.
세계보건기구 (WHO)에 따르면 한 명의 다제내성결핵 환자가 적절히 치료되지 않고 방치될 경우 약 12명의 새로운 결핵환자가 발생한다고 한다. WHO 2006년 보고서에 따르면 2006년 새로 발생한 약 900만 명의 결핵 환자 가운데 49만 명 정도가 각종 치료약물에 내성이 있는 다제내성결핵(MDR-TB)이고 4만여 명은 광범위 약제내성결핵(extensively drug resistant TB;XDR-TB) 환자였다. 특히 최근 55개 국가에서 보고가 급증하고 있는 XDR-TB균은 치료가 사실상 불가능하고 사망률 또한 높다. 또한 모든 다제내성결핵환자중 23.7%이상이 광범위약제내성결핵 환자였으며, WHO는 신종 결핵균 중 절반 이상이 이처럼 약물 내성을 보유한 것으로 보고 있다. (Talenti A., Imboden P., Marchesi F., Lowrie D., Cole S., Colson M. J., Matter L., Schepfer K.,Bodmer T.(1993) Detection of rifampin-resistance mutation in Mycobacterium tuberculosis. Lancet 341:647650).
결핵환자의 치료를 시작할 때 내성 검사 결과가 없는 상태에서 처방을 결정하는데, 이때는 환자의 과거 치료력을 확인 후 한번도 사용하지 않은 약제를 골라 4종류에서 7종류까지 약제를 병합하여 치료하며 오플로삭신이나 가나마이신등과 같은 2차약제를 포함시킨다. 따라서 치료의 효과를 높이기 위해서는 빠른 감수성 결과의 확인과 적절한 2차 약제의 사용 등 추가적인 전략이 필요하다.
다제내성 결핵환자가 증가함에 따라 2차 약제의 사용 빈도도 높아졌으며, 이에 따라 2차약제에 내성을 갖는 결핵균이 출현하게 되어 약제에 내성을 갖는 결핵균의 발생은 치료가 매우 어려워졌다. 특히 리팜핀 발견 이후 결핵환자치료에 매우 유효한 약제로서 2차 항결핵제로 많이 사용된 플루오로퀴놀론계(fluoroquinolone, FQ) 약제에 내성을 가진 결핵균도 증가하게 되었다. 2차 항결핵약제 가운데 플루오로퀴놀론계통의 약제들은 날리디식 액시드(nalidixic acid)라는 퀴놀론약제를 기본 구조로 하여 발전해 왔다(Chen, F.J., H. J. LU. J. Microviol. Immunol. Infect. 2003. 36:1-9). 그리고 이 계통의 약제는 호흡기 감염에 매우 유용한 것으로 알려져 있으며 3세대 퀴놀론항균제로 임상에서 널리 사용되고 있다(Dong, Y., C. Xu, X. Zhao, J. Domagala, k. Drlica. Antimicrob. Agents Chemother. 1998. 42:2978-2984). 플루오로퀴놀론계 약제들 중 결핵 치료에는 오플로삭신이 가장 많이 사용되고 있다(Fattorini L., E. Iona, M. L. Ricci, O. F. Thoresen, G. orru, M. R. Oggioni, E. Tortoli, C. Piersimoni, P. Chiaradonna, M. Tronci, G. Pozzi, G. Orefici. Micro. Drug. Resist. 1999. 5:265-270).
결핵환자의 효과적인 치료를 위해서는 신속하고 정확한 약제 감수성 검사가 필수적이다. 그러나 우리나라를 포함한 많은 나라에서 사용하고 있는 미생물학적배양방법을 이용할 경우, 천천히 자라는 결핵균의 특성상 환자로부터 균을 분리하고 약제 감수성 검사의 결과를 얻기까지는 2개월의 기간이 소요된다. 이 방법은 오랜 기간 배양을 하기 때문에 다른 균에 의해 오염될 확률도 높아서 재검사를 해야 하는 경우도 많고 숙련된 기술자를 필요로 한다.
고체배지를 이용한 미생물학적인 방법의 단점을 보완하고자 액체배지를 사용하는 약제 감수성 검사법이 개발되었다. 미국의 Becton Dickinson社에서 개발한 BACTEC system과 MGIT(mycobacterium growth indicator tube) 등은 액체배지에 결핵균을 접종하고 결핵균이 자라기 시작하면 만들어내는 대사산물을 측정하는 방법으로 일주일내에 결과를 얻을 수 있다. 그러나 이러한 방법은 검사에 사용할 수 있는 약제가 제한되어 있고 비결핵균 마이코박테리아(Nontuberculosis mycobactera:NTM)도 자랄 수 있기 때문에 잘못된 검사결과를 초래할 수도 있고 마이코박테리아동정을 별도로 수행해야한다는 단점이 있다.
따라서 신속하고 정확한 약제 감수성 검사를 위해서 새로운 방법이 필요하게 되었다. 최근 결핵균의 약제내성의 기작이 밝혀지기 시작하면서 이에 관한 연구들이 활발하게 진행되었다.
이와 같은 약제 내성관련 유전자의 돌연변이 여부를 검출할 수 있는 진단법개발에 관한 많은 연구들이 이루어졌으며 일부 연구결과는 실제 제품으로 상용화되어 사용되고 있다. 상용화된 진단키트로는 리팜핀 내성과 관련된 rpoB 유전자 내의 돌연변이를 검출하는 INNO-LiPA Rif. TB(Innogenetics, Ghent, Belgium)가 있고 최근에는 katG, inhA, 그리고 rpoB 내에 가장 빈번하게 나타나는 돌연변이를 검출하는 Genotype MTBDRplus assay (Hain Lifescience GmbH, Nehren, Germany)가 상용화 되었다. Genotype MTBDRplus assay와 INNO-LiPA Rif. TB test와 동일한 원리를 가지고 있지만 리팜핀과 아이소니아지드 내성을 동시에 진단할 수 있다는 장점이 있다(Johanna Ma¨kinen, 등. J Clin Microbiol., 2006, Feb. 44(2): 350-352; Doris Hillemann, 등. J Clin Microbiol., 2005. Aug. 43(8):36993703). 두 방법의 기본원리는 나이트로셀루로스 막에 결합시킨 야생형 타입과 돌연변이 타입 프로브와 결핵균의 해당 유전자의 PCR 산물을 결합시키는 reverse line blot hybridization법이다.
그러나 종래기술은 아이소니아지드 내성을 진단하기 위하여 katG 유전자 및 inhA 프로모터 부위의 돌연변이만을 검출한다. 상기에 기술하였듯이 아이소니아지드에 내성을 보이는 균주의 약 50-95%는 katG 유전자의 codon 315부위에, 20 -35%의 균주는 inhA 프로모터 부위에 그리고 10-15%는 oxyR-ahpC intergenic 부위에 돌연변이가 발견된다고 보고되고 있다. 따라서 katG 유전자와 inhA 프로모터 부위의 돌연변이 여부만을 가지고 아이소니아지드에 대한 내성을 진단하는 것은 약 10-15%정도의 내성균주를 진단하지 못할 수도 있다.오플로삭신(ofloxacin)의 세포내로의 유입은 세포막의 지질이중층을 통해 유입되거나 세포외막에 존재하는 포린(porin)단백질에 의해 일어나는 것으로 알려져 있다(Kocagoz, T., C. j. Hackbarth, I. unsal, E. Y. Rosenberg, H. Nikaido, H. F. Chambers. Antimicrob. Agents Chemother. 1996. 40:1768-1774. ).
세포내로 들어온 오플로삭신(ofloxacin)은 DNA의 나선구조를 유지하면서 DNA의 잘려진 부위를 봉합하는 DNA gyase에 작용한다. DNA gyrase는 gyrA와 gyrB 유전자에 암호화되어 있는 A subunit과 B subunit 이 각각 두 개씩 합쳐져 이루어져 있다(Lu, T., X. Zhao, K. drlica. Antimicrob. Agents Chemother. 1999. 43:2969-2974). DNA가 복제되기 위해서는 수소결합을 통하여 붙어있는 두 개의 DNA가닥이 분리되어야 하는데 이때 DNA 가닥을 끊어주고 다시 결합시키는 과정은 subunit A가 하며 이때 필요한 에너지를 제공하는 ATPase의 기능을 subunit B가 담당한다(Guillemin, I., V. Jarlier, E. Chmbau. Antimicrob. Agents Chemother. 1998. 42:2084-2088). 오플로삭신(ofloxacin)은 gyrase subunit A에 작용하는 것으로 알려져 있다(Takiff , H., L. Ssalazar, C. Guerrero, W. Philipp, W. M. Huang, B. Kreiswirth. Antimicrob. Agents Chemother.1994. 38:773-780. ; Xu, C., B. N. Kreiswirth, S. sreeratsan, J. M. Musser, K. Drlica. J. Infect. Dis. 1996. 174:1127-1130).
결핵균의 오플로삭신(ofloxacin)에 대한 내성은 DNA gyrase의 약제에 대한 친화력 감소나 dfflux pump에 의한 오플로삭신(ofloxacin)의 배출 등이 있다. DNA gyrase의 오플로삭신에 대한 친화력 감소는 DNA gyrase A 돌연변이에 의해 일어난다고 알려져 있고, 특히 codon 88-94부위에 오플로삭신(ofloxacin) 내성과 관련된 돌연변이가 50~80%정도 집중적으로 존재하는 것으로 알려져 있어 이 부위를 QRDR(quinolone Resistant Determining Region)이라고 한다(Grimaldo, E. R., T. E. Tupasi, A. B. Rivera, M. I. Quelapio, R. C. Cardano, J. O. Derilo, V. A. Belen. Int. J. Tuberc. Lung Dis. 2001. 5:546-550).
가나마이신(kanamycin)은 아미노글리코시드(Aminoglycoside)계통으로 리팜핀(rifampin), 아이소니아지드(isoniazid)등의 1차약제와 함께 결핵을 치료하는데 이용하는 2차 약제로, 리보솜(ribosome)의 30s에 결합하여 단백질 합성을 저해한다.
스트렙토마이신(streptomycin)은 아미노사이클리톨 글리코시드(aminocyclitol glycoside)계통의 약제로, 일반적으로 1차치료에 사용되며, 리보솜(ribosome)의 30s에 결합하여 단백질 합성을 저해한다.
이러한 연구결과들을 볼 때, 항결핵제의 타겟이 되는 유전자산물의 돌연변이 유무를 확인함으로써 해당 항결핵제에 대한 결핵균의 약제 감수성 여부를 판정할 수 있는 것이다.
본 발명은 상기의 문제점을 해결하고 상기의 필요성에 의하여 안출된 것으로 서 본 발명의 목적은 항결핵제로 사용되고 있는 약제에 대한 내성 여부를 진단하기 위한 프로브를 제공하는 것이다.
본 발명의 또 다른 목적은 항결핵제로 사용되고 있는 약제에 대한 내성 여부를 진단하기 위한 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 항결핵약제 내성관련 유전자의 신속 진단법을 제공하는 것이다.
상기의 목적을 달성하기 위하여 본 발명은 서열번호 21 내지 67로 이루어진 군으로부터 선택된 하나 이상의 염기서열을 가지는 항결핵제 내성 진단용 유전자 프로브를 제공한다.
본 발명에 있어서, 상기 항결핵제는 리팜핀, 아이소니아지드, 오플로삭신과 가나마이신 및 스트렙토마이신으로 구성된 군으로부터 선택된 하나 이상의 약제인 것이 바람직하나 이에 한정되지 아니한다.
또 본 발명에 있어서, 상기 유전자 프로브는 Myc, katG, inhA, ahpC, 및 rpoB, gyrA, rrs 및 rpsL 유전자로 구성된 군으로부터 선택된 하나 이상의 유전자와 특이적으로 결합하는 것이 바람직하나 이에 한정되는 것은 아니다.
또한 본 발명은 상기의 유전자 프로브 및 결핵균을 증폭할 수 있는 프라이머를 함유하는 항결핵제 내성 진단용 키트를 제공한다.
본 발명에 있어서, 상기 프라이머는 서열번호 1 내지 20에 기재된 프라이머인 것이 바람직하나 이에 한정되는 것은 아니다.
또 본 발명의 키트는 PCR산물을 탐지하기 위한 표지수단을 더욱 포함하는 것이 바람직하다.
또한 본 발명은 a) 본 발명의 상기의 유전자 프로브를 고체 서포트에 부착하는 단계;b) 증폭된 결핵균의 PCR 산물을 상기 유전자 프로브와 교잡하는 단계; 및 c) 상기 교잡된 산물을 검출하는 단계를 포함하는 항결핵제 내성 진단방법을 제공한다.
본 발명에 있어서, 상기 결핵균의 PCR 산물은 서열번호 1 내지 20에 기재된 프라이머에 의하여 수득된 것이 바람직하나 이에 한정되는 것은 아니다.
또 본 발명에 있어서, 상기 검출단계는 발광 또는 발색반응을 이용하여 검출하는 것이 바람직하나 이에 한정되는 것은 아니다.
본 발명은 검체로부터 세포를 얻어서 그 세포로부터 핵산을 추출하고, PCR 증폭을 수행하였다. 세포로부터 핵산을 추출하는 방법 및 PCR 방법은 Sambrook 등의 Molecular cloning(1989)에 기재된 방법과 같은 당업계에 주지된 방법을 통하여 수행하였다.
본 발명의 핵산 증폭 방법은 프라이머를 사용하였다. 일반적으로 프라이머는 약 10에서 25bp 길이의 올리고뉴크레오타이드가 바람직하나 더 긴 것도 가능하며, 프라이머는 단일 가닥이 바람직하나 이중 또는 단일 가닥 형태로 존재할 수도 있으며, 본 발명에서 사용한 특정 프라이머는 본 발명의 실시예에 기재하였다.
본 발명의 프라이머 및 프로브는 통상의 올리고뉴크레오타이드 합성법에 의하여 제조되었으며, 그러한 합성 방법은 미국 특허 제 4,659,774, 4,816,571, 5,141,813,5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 및 5,602,244 등에 개재된다.
본 발명의 프라이머와 같은 서열들은 샘플로부터 유래한 DNA와 같은 상보적인 서열들과 선택적으로 이중 나선을 형성하는 데 사용될 수 있다. 당업자는 타겟 서열에 대한 프라이머의 선택성을 변화시키기 위하여 교잡 조건을 변경할 수 있다.
일부 실시예에서는 교잡을 결정하기 위하여 표지와 같은 적당한 수단과 결합하여 본 발명의 한정된 서열의 핵산을 채택할 수 있다. 적당한 표지수단은 형광,방사성동위원소 효소 또는 다른 리간드를 포함하는 다양한 표지 수단이 가능하다.
다양한 주형 의존적인 과정들이 주어진 세포 샘플에 존재하는 특정 유전자 산물을 증폭하는데 가능하다. 가장 공지된 증폭 방법 중 하나가 중합효소 연쇄반응(PCR)이다 이 방법은 미국특허 제 4,683,202 및 4,800,159 등에 기재된다.
일반적으로 한 단계 또는 또 다른 단계에서 증폭산물을 주형 또는 초과 프라이머 또는 다른 증폭산물로부터 분리하는 것이 바람직하다. 예를 들어 증폭 산물은 Sambrook 등의 Molecular cloning(1989)에 기재된 표준 방법을 아가로스, 아가로스-아크릴아마이드 또는 PAGE를 사용하여 분리될 수 있다.
또 흡착, 분배, 이온교환 등과 같은 크로마토그래피도 효과적인 분리방법으로 채택될 수 있다. 이들 분리방법들은 대량의 샘플을 가공하기 위하여 임상 셋팅에서 기능하도록 채택될 수 있으며, 수천개의 샘플을 한번에 분리하거나 검출할 수 있는 새로운 방법인 FMAT (fluorometric microvolume assay technique),chemiluminescence, sequence detection systems (Applied Biosystems) 및 질량 분광법 등이 있다.
본 발명에 따른 핵산은 검출되고 정량화될 것이다. 일 실시예에서 그 검출은 시각적 수단에 의하여 수행될 수 있다. 전형적인 시각적 수단 방법은 ethidium bromide로 젤을 염색하고, UV 광 하에서 밴드들을 시각화하는 것이다. 또 만약 증폭 산물이 방사선 또는 형광으로 표지된 뉴크레오타이드이면 분리된 증폭산물은 삽입된 방사선동위원소 표지의 방사성 신티그램 촬영 또는 형광 검출을 수행한다.
본 발명은 상기 방법을 수행하기 위한 키트를 포함한다. 비한정적인 실시예에서 본 발명의 키트는 프라이머들, 증폭을 위한 효소 및 부가적인 시약을 포함할 수 있다. 따라서 본 키트들은 적당한 용기 수단들에 이들 하나 이상의 시약들을 포함할 것이다. 그 키트들은 또한 핵산을 분리하고 증폭 산물을 정제하는 시약들을 포함할 수도 있다. 키트들의 구성성분은 수용성 매체 또는 동결건조 형태로 포장될 수 있고, 키트의 적당한 용기 수단은 구성성분이 들어갈 수 있는 적어도 하나의 바이알, 시험관, 플라스크, 병 등을 포함한다. 키트에 하나 이상의 구성요소가 존재한다면 부가적인 구성요소들이 따로 위치될 수 있는 제2, 제3 등의 다른 부가적인용기를 포함할 수 있다. 그러나 여러 구성요소의 조합이 하나의 용기에 포함될 수 도 있다.
이하 본 발명을 설명한다.
본 발명자들은 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 내성 여부를 신속하면서 좀 더 정확하게 진단할 수 있는 방법을 개발하고자 하였다.
즉, 상기 본 발명의 주요 목적인 결핵균의 약제 감수성 검사를 신속하게 수행할 수 있는 분자생물학적 진단법을 제공하기 위하여 각각의 약제에 내성과 감수성을 보이는 결핵균의 약제의 타겟이 되는 유전자, Myc, katG, inhA, ahpC, rpoB , gyrA, rrs, rpsL 부위의 염기서열 분석 결과를 바탕으로 하여 약제 내성균과 감성균을 구별할 수 있는 야생형 프로브와 돌연변이형 프로브를 제작하였다. 따라서 이와 같은 프로브를 이용할 경우 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 내성을 신속하게 진단할 수 있음을 확인하였고, 이로써 본 발명을 완성하게 되었다.
따라서, 본 발명의 키트를 이용하면, 결핵균의 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 감수성검사를 신속하고 정확하게 수행할 수 있으므로 결핵환자의 효과적인 치료에 이바지할 것이고 이로써 다제 내성 결핵균의 전파를 효율적으로 차단함에 도움이 될 것이다.
본 발명은 주요 항결핵제인 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 내성 관련 유전자를 증폭할 수 있는 프라이머 및 해당 유전자의 내성 관련 돌연변이를 검출할 수 있는 프로브를 포함하는 결핵균의 약제 내성 진단 키트를 제공하므로 본 발명을 이용하면, 각 유전자의 돌연변이 여부를 검출할 수 있고 이를 통해서 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 내성 여부를 신속하고 정확하게 진단할 수 있는 효과가 있다. 따라서 본 발명은 결핵환자의 효과적인 치료에 이바지할 수 있을 것이다.
도 1은 본 발명의 대략적인 순서도이다. 즉 ① 아민기를 표지한 프로브를 멤브레인에 결합시킴.②타겟 유전자를 biotin이 라벨된 프라이머로 증폭한 후, membrane에 결합된 프로브와 반응시킴. ③ Streptavidin-conjugated alkaline phosphatase와 반응시킴. ④ Alkaline phosphatase의 기질을 처리하여 프로브와 증폭된 타켓유전자의 결함을 검출함.
도 2는 리팜핀과 아이소니아지드에 대한 내성여부를 진단하기 위한 PCR 산물의 전기영동사진이다. 사진에서 M: 100bp DNA Ladder(엠앤디, 원주), Lane 1-7: H37RV genomic DNA를 10ng/㎕부터 10배 희석하여 민감도 테스트를 실시한 PCR 증폭산물이며, N: PCR negative control을 나타낸다. 리팜핀은 증폭된 산물의 크기가 157bp이며, 아이소니아지드는 KatG 유전자에서 108bp이며, inhA 유전자에서 107bp, ahpC 유전자에서 157bp, Myc 유전자에서는 126bp로 증폭된다.
도 3과 4는 리버스 블랏 하이브리다이제이션 방법을 이용한 리팜핀과 아이소니아지드에 대한 발광법(도 3)과 발색법(도 4)을 보여주는 사진이다. 리팜핀과 아이소니아지드의 설계된 감성과 내성 프로브에 해당되는 부분에 대해 각각 검출될 수 있는 것을 보여주는 사진이다.
도 5는 리팜핀과 아이소니아지드에 대한 결핵균의 내성 진단 결과를 발색법으로 보여주는 사진(상단)이다. 아래쪽의 결과표(하단)에서 R은 약제 내성결과이고 S는 약제감수성을 의미한다. 임상샘플을 가지고 리팜핀과 아이소니아지드에 대한 내성검사를 진행한 것으로 결과표에서 보면 한 샘플에 대해 모두 감성(wt)프로브에만 붙게 되면 S로 표시하였으며, 2가지 검사 중 한가지 또는 두가지에 대해 내성(mt)프로브에 붙게 되면 R로 표시하였다.
도 6은 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 내성 여부를 진단하기 위한 PCR 산물의 전기영동 사진이다. 사진에서 M: 100bp DNA Ladder(엠앤디, 원주),Lane1-29: 임상분리결핵균주의 PCR 증폭산물, P: 표준결핵균주의 PCR 산물, N: PCR negative control을 나타낸다. 가나마이신은 증폭된 산물의 크기가 326bp이며, 오플로삭신은 318bp이며 스트렙토마이신은 rrs 유전자에서 571bp와 rpsL 유전자에서 379bp로 증폭된다.
도 7은 리버스 블랏 하이브리다이제이션 방법을 이용한 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 발광법을 보여주는 사진이다. 오플로삭신, 가나마이신 및 스트렙토마이신의 설계된 감성과 내성 프로브에 해당되는 부분에 대해 각각 검출될 수 있는 것을 보여주는 사진이다.
도 8은 리버스 블랏 하이브리다이제이션 방법을 이용한 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 결핵균의 내성 진단 결과를 발광법으로 보여주는 사진(상단)이다. 아래쪽의 결과표(하단)에서 R은 약제 내성결과이고 S는 약제감수성을 의미한다. 임상샘플을 가지고 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 내성검사를 진행한 것으로 결과표에서 보면 한 샘플에 대해 모두 감성(wt)프로브에만 붙게 되면 S로 표시하였으며, 3가지 검사 중 한가지 또는 두가지에 대해 내성(mt)프로브에 붙게 되면 R로 표시하였다. 감성이나 내성에서 모두 검출되지 않은 샘플에 대해서는 X로 표시하였다.
도 9는 리버스 블랏 하이브리다이제이션 방법을 이용한 오플로삭신과 가나마이신 및 스트렙토마이신에 대한 결핵균의 내성 진단 결과를 발색법으로 보여주는 사진(상단)이다. 아래쪽의 결과표(하단)에서 R은 약제 내성결과이고 S는 약제감수성을 의미한다. 임상샘플을 가지고 오플로삭신과 가나마이신 및 스트렙토마이신에 대한
내성검사를 진행한 것으로 결과표에서 보면 한 샘플에 대해 모두 감성(wt)프로브에만 붙게 되면 S로 표시하였으며, 3가지 검사중 한가지 또는 두가지에 대해 내성(mt)프로브에 붙게 되면 R로 표시하였다.
이하, 본 발명의 실시예에 대하여 첨부된 도면을 참조하면서 상세히 설명하기로 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
도 1은 본 발명을 수행하는 과정을 대략적으로 설명한 순서도이다. 본 발명은 순서도에서와 같이 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신 내성과 관련되어 있다고 알려진 4개의 부위를 multiplex PCR를 통하여 증폭하고, 증폭된 산물을 membrane에 결합된 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신 내성을 판별할 수 있는 wild type과 돌연변이 type 프로브와 반응을 시키고 세척과정을 통하여 비특이적인 결합을 한 PCR 산물을 제거한다. 그리고 프로브와 PCR산물의 결합을 가시적인 시그날로 보여줄 수 있는 효소를 처리하고 최종적으로 이 시그날을 Hypersensitive film이나 이미지 파일로 옮기고 분석하는 방법이다.
실시예 1: 결핵균의 DNA 수득
리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 내성을 보이는 균주와 감성을 보이는 균주를 Ogawa 배지에서 호기성 상태로 3주간 배양한 후, 형성된 결핵균 집락을 loop로 수집하여 400㎕ TE(10mM Tris-HCl, pH 8.0, 1mM EDTA)에 잘 풀어주었다. 그리고 결핵균을 사멸시키기 위하여 80℃에서 한 시간 동안 반응시켰다. 여기에 50㎕의 lysozyme(10mg/ml)을 넣고 잘 섞은 후, 37℃에서 밤새도록 반응시켰다. 5㎕의 10mg/ml proteinase K(Sigma Chem. Co., USA) 5㎕와 70㎕의 10%(w/v) SDS(Sodiumdodexyl sulfate, Sigma Chem. Co., USA)를 넣고 잘 섞은 후, 65℃에서 10분간 반응시켰다. 100㎕의 5M NaCl(Sodium chloride, Ducksan, Korea)을 넣고 섞은 후, 65℃로 미리 데워놓은 CTAB(Cetyl Trimethyl Ammonium Bromide, Sigma Chem. Co.,USA)를 100㎕ 넣고 잘 섞고 65℃에서 10분간 반응시켰다.
Chloroform:isoamylalcohol (=24:1(v/v)) 700㎕를 넣고 잘 섞은 후 원심분리하였다. DNA를 포함하는 상층액만을 새로운 튜브로 옮기고 450㎕의 isopropanol(Merck)을 넣고 섞은 후 -20℃에 30분간 DNA를 침전시켰다. 4℃, 12,000rpm으로 30분간 원심분리 후, 상층액을 따라내고 1ml의 70% ethanol를 넣고 튜브 5회 가량 뒤집었다.다시 4℃에서 10분간 원심분리 후 상층액을 따라 버리고 30분간 건조시킨 후, 50㎕의 TE에 DNA를 녹인다. 녹인 DNA는 농도를 확인한 후에 1ng/㎕로 희석하여 PCR에 사용하였다.
실시예 2: 결핵균의 Myc, katG, inhA, ahpC, rpoB gyrA, rrs, 및 rpsL 유전자의 증폭
상기 실시예 1에서 분리한 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 내성 및 감성을 보이는 결핵균의 genomic DNA로부터 Myc, katG, inhA, ahpC, 및 rpoB, gyrA, rrs, rpsL유전자 부위를 동시에 증폭하기 위하여 각 유전자를 증폭할 수 있는 프라이머를 디자인하고 후에 시그날을 가시화하기 위하여 역방향 프라이머의 5' 말단에 바이오틴(biotin)을 표지하여 제작하였다(참조: 표 1).
표 1
유전자 프라이머 프라이머염기서열 Tm GC(%) 길이
Myc 470FF GCGTCGGTCGCTATAAGGT 54 57 19 서열번호1
MTB-1R* ACCCTCGTGCAAGCGGACCAG 65 66 21 서열번호2
KatG KatG-F GACTCGTATGGCACCGGAAC 56 60 20 서열번호3
KatG-R* CCGTACAGGATCTCGAGGAA 53 55 20 서열번호4
inhA inhA-F GCTCGTGGACATACCGATTT 53 50 20 서열번호5
inhA-R* ACTGAACGGGATACGAATGG 53 50 20 서열번호6
ahpC ahpC-F CCGGCTAGCACCTCTTGGCG 63 70 20 서열번호7
ahpC-R ATTGATCGCCAATGGTTAGC 53 45 20 서열번호8
rpoB TR-9 TCGCCGCGATCAAGGAGTTCT 62 57 21 서열번호9
TR-8* TGCACGTCGCGGACCTCCA 65 68 19 서열번호10
rpo-F CCGCGATCAAGGAGTTCTTC 55 55 20 서열번호11
rpo-R* CACGCTCACGTGACAGACCG 59 65 20 서열번호12
gyrA gyrA-1F CAGCTACATCGACTATGCGA 51 50 20 서열번호13
gyrA-1R* GCTTCGGTGTACCTCATCG 53 58 19 서열번호14
KM rrs-1F TCCTTAAAAGCCGGTCTCAG 53 50 20 서열번호15
rrs-1R* ACAGACAAGAACCCCTCACG 54 55 20 서열번호16
SM rrs-420F TTCACCATCGACGAAGGTCC 57 55 20 서열번호17
rrs-990R* CTAGACGCGTCCTGTGCATGT 57 57 21 서열번호18
rpsL-1F GGCCGACAAACAGAACGT 53 56 18 서열번호19
rpsL-1R* GTAACGGCTGCGTGCCTGT 58 63 19 서열번호20
상기 표는 Myc, katG, inhA, ahpC, rpoB, gyrA, rrs, 및 rpsL 유전자 부위를 증폭하기 위한 프라이머를 나타내며, 표에서 '*'는 Biontin으로 표지한 프라이머를 나타낸다.
상기 수득한 각 DNA를 5㎕를 주형으로 하고 [표 1]의 서열번호 1-20의 10쌍의 프라이머와 dNTP, Taq DNA polymerase를 PCR 기기(Thermal cycler, GeneAmp PCR System 2700)에 적용하여 PCR을 수행하여(95℃ 5분, 95℃ 30초, 60℃ 30초에서 10cycle 을 먼저 수행한후, 다시 95℃ 30초, 54℃ 30초에서 40cycle로 수행하고 마지막으로 72℃ 10분으로 진행하였다), 결핵균의 Myc(126bp), rpoB(157bp), KatG(108bp), inhA(107bp), ahpC(157bp), gyrA(318bp), rrs(326bp), rrs420(571bp), rpsL(379bp)유전자 부위를 증폭하였다.
실시예 3: 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신 내성 여부를 진단할 수 있는 프로브를 이용한 결핵균의 약제 내성 진단(발광법)
상기 실시예 1에서 수득한 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 내성과 감성을 보이는 결핵균의 katG, inhA, ahpC, rpoB, gyrA, rrs 및 rpsL 유전자 부위의 염기서열을 바탕으로 하여 각각의 야생형과 돌연변이 염기서열에 특이적으로 결합할 수 있는 프로브를 설계하고 프로브를 멤브레인에 결합시키기 위하여 각 프로브의 5 말단에 아민기를 결합하여 제작하였다(참조: 표 2)
표 2
Figure PCTKR2010002599-appb-T000001
상기 표는 결핵균의 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신 내성 여부를 진단할 수 있는 프로브를 나타낸다.
이어, 전기 제작한 각각의 프로브를 이용한 리버스 블랏 하이브리다이제이션(reverse blot hybridization) 방법을 수행하였다: 먼저, 리버스 블랏 하이브리다이제이션용 멤브레인(Biodyne C binding membrane, Pall Biosupport, MI, USA)을 16%(w/v) DAC(1-ethyl-3-dimethyl-aminopropylcardiimide, Sigma Chem., Co., USA) 용액 10㎖에 침지하여 실온에서 15분 동안 방치하여 멤브레인 표면의 카프복실기(carboxyl group)를 활성화시킨 후, 증류수로 세척하고, 이를 블랏장치(MN45 minblotter, Immunetics, USA)에 장착시켰다.
전기 5' 말단에 아민기(amino group)를 포함하도록 제작한 각각의 프로브를 500mM NaHCO3(pH 8.4)에 최종부피가 150㎕이 되도록 희석하고, 이를 전기 블랏장치에 채운 다음, 상온에서 60분간 반응시켜서, 전기 프로브를 전기 멤브레인에 결합시켰다. 반응이 종결된 다음, 프로브를 포함하는 용액을 제거하고, 전기 블랏장치에서 멤브레인을 이탈시킨 후, 실온상태의 100㎖의 0.4N NaOH용액에 9분 동안 침지하여 프로브의 결합이 더 이상 진행되지 않도록 멤브레인 표면의 카프복실기(carboxyl group)을 불활성화시켰다. 이를 0.1%(w/v) SDS가 포함된 2× SSPE로 60℃에서 5분간 세척하였다. 전기 세척된 멤브레인을 프로브가 결합된 방향과 수직이 되도록 블랏장치에 다시 장착하였다.
한편, 상기 실시예 2에서 결핵균의 증폭된 PCR 산물을 20㎕를 DS(denaturation solution; 0.2N NaOH, 0.2mM EDTA)와 동량 섞어 실온에서 5분간 정치시켜 놓은 후 2× SSPE/0.1%(w/v) SDS 용액으로 희석한 다음 이를 전기 블랏장치에 가하였다. 50℃에서 30분간 하이브리다이제이션 반응을 수행하였다. 전기 희석액을 제거한 다음, 멤브레인을 분리하여, 2× SSPE/0.5%(w/v) SDS 용액으로 리팜핀과 아이소니아지드는 63℃에서, 오플로삭신과 가나마이신 및 스트렙토마이신 65℃에서 10분간 2회 세척하였다. 전기 세척된 멤브레인에 2× SSPE/0.5%(w/v) SDS 용액에 1:2000(v/v)으로 희석한 알칼라인포스파타아제(스트렙타비딘 표지)(alkaline phosphataselabeled streptavidin, Boehringer Mannheim, Germany)을 처리하여 실온에서 30분간 반응시키고, 이를 2× SSPE/0.5%(w/v) SDS 용액으로 실온에서 5분간 2회 세척하고 2× SSPE 용액으로 실온에서 5분씩 2회 세척하였다. 알칼라인포스파타아제에 반응하는 기질 용액(Gene Images CDP-starTM detection kit, Amersham Bioscience,UK)에 적용하여 표지된 바이오틴을 검출하였다(참조: 도 1).
도 3과 도 7은 리버스 블랏하이브리다이제이션 방법을 이용한 결핵균의 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신 내성 진단결과를 나타내는 사진이다.
실시예 4: 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신 내성 여부를 진단할 수 있는 프로브를 이용한 결핵균의 약제 내성 진단(발색법)
상기 실시예 3에서와 동일한 방법으로 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신에 내성과 감성을 보이는 결핵균의 katG, inhA, ahpC, rpoB, gyrA, rrs, rpsL 유전자 부위의 염기서열을 바탕으로 하여 각각의 wild type과 돌연변이 염기서열에 특이적으로 결합할 수 있도록 디자인되어 있는 프로브를 이용한 리버스 블랏 하이브리다이제이션 (reverse blot hybridization) 방법을 수행하였다: 먼저, 상기 실시예 3에서와 동일한 방법으로 리버스 블랏 하이브리다이제이션용 멤브레인(Biodyne C binding membrane, Pall Biosupport, MI, USA)을 제작하였다. 제작된 멤브레인에 상기 실시예 2의 증폭된 PCR 산물을 20㎕를 DS(denaturation solution; 0.2N NaOH, 0.2mM EDTA)와 동량 섞어 실온에서 5분간 정치시켜 놓은 후 2× SSPE/0.1%(w/v) SDS 용액으로 희석한 다음 이를 전기 블랏장치에 가하였다. 전기 희석액을 제거한 다음, 2× SSPE/ 0.5%(w/v) SDS 용액으로 65℃에서 10분간 2회 세척하였다. 전기 세척된 멤브레인에 2× SSPE/ 0.5%(w/v) SDS 용액에 1:2000(v/v)으로 희석한 알칼라인포스파타아제(스트렙타비딘 표지)(alkaline phosphatase-labeled streptavidin, Roche Applied Science, Germany)을 처리하여 실온에서 30분간 반응시켰다. 반응이 끝난 멤브레인을 TBS용액(pH7.5)으로 실온에 1분간 2회 세척하였다. 알칼라인포스파타아제에 반응하는 발색용 기질 용액인 NBT/BCIP[Nitro blue tetrazolium chloride and 5-Bromo-4-chloro-3-indolylphosphate, toluidine salt in 67% DMSO(v/v), Roche Applied Science, Germany]를 pH 9.5인 TBS용액으로 1:50으로 희석하여 실온에서 멤브레인에 10-30분간 반응시키면서 프로브에 결합한 PCR 산물에 표지된 바이오틴을 검출하였다(참조: 도 1). 발색반응이 끝난 용액은 발색용액을 제거하고 3차 증류수를 첨가하여 발색반응을 정지시켰다. 도 4와 도 9는 리버스 블랏 하이브리다이제이션 방법을 이용한 결핵균의 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신 내성 진단 결과를 나타내는 사진이다(발색법).

Claims (12)

  1. 서열번호 23에서 서열번호 30의 유전자 중에서 선택된 rpo 유전자 부위에 결합하는 프로브;
    서열번호 31 또는 서열번호 32의 katG 유전자 부위에 결합하는 프로브;
    서열번호 33에서 서열번호 36의 유전자 중에서 선택된 inhA 유전자 부위에 결합하는 프로브;
    서열번호 37에서 서열번호 41의 유전자 중에서 선택된 ahpC 유전자 부위에 결합하는 프로브;
    서열번호 42에서 서열번호 53의 유전자 중에서 선택된 rrs 유전자 부위에 결합하는 프로브;
    서열번호 54에서 서열번호 57의 유전자 중에서 선택된 rpsL 유전자 부위에 결합하는 프로브; 및
    서열번호 58에서 서열번호 67의 유전자 중에서 선택된 gyrA 유전자 부위에 결합하는 프로브로 구성된 프로브 군으로부터 선택된 하나 이상의 항결핵제 내성 진단용 유전자 프로브.
  2. 제 1항에 있어서, 상기 프로브는 서열번호 21 및 서열번호 22로 구성된 군으로부터 선택된 프로브를 추가로 포함하는 항결핵제 내성 진단용 유전자 프로브.
  3. 제 1항 또는 제 2항에 있어서, 상기 항결핵제는 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신으로 구성된 군으로부터 선택된 하나 이상의 약제인 항결핵제 내성 진단용 유전자 프로브.
  4. 제 1항 또는 제 2항의 유전자 프로브 및 결핵균을 증폭할 수 있는 프라이머를 함유하는 항결핵제 내성 진단용 조성물.
  5. 제 4항에 있어서, 상기 프라이머는 상기 프라이머는 서열번호 1과 2; 서열번호 3과 4; 서열번호 5와 6; 서열번호 7과 8; 서열번호 9와 10; 서열번호 11과 12; 서열번호 13과 14; 서열번호 15와 16; 서열번호 17과 18; 서열번호 19와 20으로 이루어진 프라이머쌍으로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍인 항결핵제 내성 진단용 조성물.
  6. 제 1항 또는 제2항의 유전자 프로브 및 결핵균을 증폭할 수 있는 프라이머를 함유하는 항결핵제 내성 진단용 키트.
  7. 제 6항에 있어서, 상기 프라이머는 서열번호 1과 2; 서열번호 3과 4; 서열번호 5와 6; 서열번호 7과 8; 서열번호 9와 10; 서열번호 11과 12; 서열번호 13과 14; 서열번호 15와 16; 서열번호 17과 18; 서열번호 19와 20으로 이루어진 프라이머쌍으로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍인 항결핵제 내성 진단용 키트.
  8. 제 6항에 있어서, 상기 키트는 PCR산물을 탐지하기 위한 표지수단을 더욱 포함하는 항결핵제 내성 진단용 키트.
  9. a) 제 1항 또는 제 2항의 유전자 프로브를 고체 서포트에 부착하는 단계;b) 증폭된 결핵균의 PCR 산물을 상기 유전자 프로브와 교잡하는 단계; 및 c) 상기 교잡된 산물을 검출하는 단계를 포함하는 항결핵제 내성 진단방법.
  10. 제 9항에 있어서, 상기 항결핵제는 리팜핀과 아이소니아지드와 오플로삭신과 가나마이신 및 스트렙토마이신으로 구성된 군으로부터 선택된 하나 이상의 약제인 항결핵제 내성 진단방법.
  11. 제 9항에 있어서, 상기 결핵균의 PCR 산물은 서열번호 1과 2; 서열번호 3과 4; 서열번호 5와 6; 및 서열번호 7과 8; 서열번호 9와 10; 서열번호 11과 12; 서열번호 13과 14; 서열번호 15와 16; 서열번호 17과 18; 서열번호 19와 20으로 이루어진 프라이머쌍으로 구성된 군으로부터 선택된 하나 이상의 프라이머쌍에 의하여 수득된 것을 특징으로 하는 항결핵제 내성 진단방법.
  12. 제 9항에 있어서, 상기 검출단계는 발광 또는 발색반응을 이용하여 검출하는 것을 특징으로 하는 항결핵제 내성 진단방법.
PCT/KR2010/002599 2009-07-07 2010-04-26 결핵균 약제 내성 진단용 프로브 및 그 키트 WO2011004957A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20090061761 2009-07-07
KR10-2009-0061761 2009-07-07

Publications (2)

Publication Number Publication Date
WO2011004957A2 true WO2011004957A2 (ko) 2011-01-13
WO2011004957A3 WO2011004957A3 (ko) 2011-05-26

Family

ID=43429628

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/002599 WO2011004957A2 (ko) 2009-07-07 2010-04-26 결핵균 약제 내성 진단용 프로브 및 그 키트

Country Status (2)

Country Link
KR (1) KR101155973B1 (ko)
WO (1) WO2011004957A2 (ko)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102184637B1 (ko) * 2016-08-04 2020-11-30 연세대학교 원주산학협력단 퀀타매트릭스 어세이 플랫폼 기반 결핵 및 비결핵 항산균의 검출 및 동정과 결핵균의 리팜핀 내성여부를 동시 확인할 수 있는 진단법 및 그 키트
KR101865899B1 (ko) * 2016-08-25 2018-06-08 솔젠트 (주) 결핵균, 비결핵균 및 다제내성결핵균 동시 검출용 진단키트

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030030266A (ko) * 2001-10-09 2003-04-18 주식회사 에스제이하이테크 마이코박테리아의 균주 감별, 결핵균의 스트레인 감별과항생제 내성을 검출하기 위한 프로브를 포함하는마이크로어레이와 이를 이용한 검출 방법 및 진단 키트
KR20030041415A (ko) * 2001-11-20 2003-05-27 주식회사 바이오메드랩 마이코박테리움 종 구별 및 약제내성 탐지를 위한진단키트 및 그 키트의 제조방법
KR20050009052A (ko) * 2003-07-15 2005-01-24 김철민 결핵균의 항생제 내성을 검출하기 위한 프로브를 포함하는마이크로어레이와 이를 이용한 검출 방법 및 진단 키트
KR20070037238A (ko) * 2005-09-30 2007-04-04 주식회사 바이오세움 결핵균 특이 유전자 검출키트

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100419897B1 (ko) * 2000-09-14 2004-03-03 김상재 아이나 내성 결핵균 검사용 프로브
KR100446850B1 (ko) * 2001-07-19 2004-09-04 이혜영 마이코박테리아의 동정 및 ｒｐｏＢ 유전자의 돌연변이에의해 얻어지는 항 결핵제 내성의 동시 검출방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030030266A (ko) * 2001-10-09 2003-04-18 주식회사 에스제이하이테크 마이코박테리아의 균주 감별, 결핵균의 스트레인 감별과항생제 내성을 검출하기 위한 프로브를 포함하는마이크로어레이와 이를 이용한 검출 방법 및 진단 키트
KR20030041415A (ko) * 2001-11-20 2003-05-27 주식회사 바이오메드랩 마이코박테리움 종 구별 및 약제내성 탐지를 위한진단키트 및 그 키트의 제조방법
KR20050009052A (ko) * 2003-07-15 2005-01-24 김철민 결핵균의 항생제 내성을 검출하기 위한 프로브를 포함하는마이크로어레이와 이를 이용한 검출 방법 및 진단 키트
KR20070037238A (ko) * 2005-09-30 2007-04-04 주식회사 바이오세움 결핵균 특이 유전자 검출키트

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE DDBJ 17 June 2007 'Mycobacterium tuberculosis isolate MDR RpoB (rpoB) gene, partial cds' Database accession no. EF628293 *
DATABASE GENBANK 07 May 2003 'Mycobacterium gordonae type II RNA polymerase beta subunit (rpoB) gene, partial cds' Database accession no. AY271343 *

Also Published As

Publication number Publication date
KR101155973B1 (ko) 2012-06-18
KR20110004265A (ko) 2011-01-13
WO2011004957A3 (ko) 2011-05-26

Similar Documents

Publication Publication Date Title
Cardoso et al. Screening and characterization of mutations in isoniazid-resistant Mycobacterium tuberculosis isolates obtained in Brazil
Koeleman et al. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR
Chroma et al. Genetic methods for detection of antibiotic resistance: focus on extended-spectrum β-lactamases
JPWO2005103249A1 (ja) 結核菌検出用プライマー及びプローブ、並びにこれを用いたヒト型結核菌の検出方法
WO2018012896A1 (ko) 결핵균 및 비결핵균 동시 진단용 멀티플렉스 pcr 프라이머 세트, 프라이머 세트를 포함하는 조성물 및 키트
Pilo et al. Bovine Bacillus anthracis in Cameroon
Hazbón Recent advances in molecular methods for early diagnosis of tuberculosis and drug-resistant tuberculosis
US6884588B1 (en) Nucleotide sequences for detection of bacillus anthracis
KR100990756B1 (ko) 결핵균 약제 내성 진단용 프로브 및 그 키트
US20080014588A1 (en) Compositions and methods for detecting multidrug resistant strains of M. tuberculosis having mutations in genes of the mutT family
RU2405836C2 (ru) Способ выявления микобактерий туберкулеза генотипа beijing
WO2019088702A1 (ko) 퀀타매트릭스 어세이 플랫폼 기반 헬리코박터 파이로리균 및 그 균의 항생제 내성에 관련된 유전자의 검출을 확인할 수 있는 진단법 및 그 응용
Das et al. Genetic heterogeneity revealed by sequence analysis of Mycobacterium tuberculosis isolates from extra-pulmonary tuberculosis patients
EP1992703B1 (en) Method for detection of mutant gene
WO2011004957A2 (ko) 결핵균 약제 내성 진단용 프로브 및 그 키트
WO2018026141A1 (ko) 퀀타매트릭스 어세이 플랫폼 기반 결핵 및 비결핵 항산균의 검출 및 동정과 결핵균의 리팜핀 내성여부를 동시 확인할 수 있는 진단법 및 그 키트
Antonov et al. Molecular identification and typing of Burkholderia pseudomallei and Burkholderia mallei: when is enough enough?
US6013435A (en) Drug resistance screening method using multiplex amplification
Giles et al. Use of applied biosystems 7900HT sequence detection system and Taqman assay for detection of quinolone-resistant Neisseria gonorrhoeae
KR101425149B1 (ko) 원-튜브 네스티드 실시간 피시알을 이용한 개선된 결핵균 진단방법
PT760005E (pt) Detaccao e diferenciacao de bacterias do complexo de mycobacterium tuberculosis por oligotipificacao da repeticao de variante directa
WO2015037769A1 (ko) 패혈증 진단용 조성물 및 그 방법 및 키트
Le Roux et al. Use of a high resolution melt real-time polymerase chain reaction (PCR) assay for the environmental monitoring of Vibrio cholerae
Ahmad et al. Comparison of performance of two DNA line probe assays for rapid detection of multidrug-resistant isolates of Mycobacterium tuberculosis
Suresh et al. Rapid detection of rifampicin-resistant Mycobacterium tuberculosis by in-house, reverse line blot assay

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10797232

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10797232

Country of ref document: EP

Kind code of ref document: A2