WO2010148511A1 - Chimeric influenza virus-like particles comprising hemagglutinin - Google Patents
Chimeric influenza virus-like particles comprising hemagglutinin Download PDFInfo
- Publication number
- WO2010148511A1 WO2010148511A1 PCT/CA2010/000983 CA2010000983W WO2010148511A1 WO 2010148511 A1 WO2010148511 A1 WO 2010148511A1 CA 2010000983 W CA2010000983 W CA 2010000983W WO 2010148511 A1 WO2010148511 A1 WO 2010148511A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- chimeric
- plant
- influenza
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/145—Orthomyxoviridae, e.g. influenza virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16123—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16211—Influenzavirus B, i.e. influenza B virus
- C12N2760/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16211—Influenzavirus B, i.e. influenza B virus
- C12N2760/16223—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16211—Influenzavirus B, i.e. influenza B virus
- C12N2760/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention relates to vims-like particles. More specifically, the present invention is directed to virus-like particles comprising chimeric influenza hemagglutinin, and methods of producing chimeric influenza virus-like particles.
- Influenza is the leading cause of death in humans due to a respiratory virus, and during "flu season", it is estimated that 10-20% of the population worldwide may be infected, leading to 250-500,000 deaths annually.
- the current method of combating influenza in humans is by annual vaccination.
- the vaccine is usually a combination of several strains that are predicted to be the dominant strains for the coming flu-season, however the number of vaccine doses produced annually is not sufficient to vaccinate the world's population. For example, Canada and the United-States obtain enough vaccine doses to immunize about one third of their population, and in Europe, only about 17% can be vaccinated given current production - in the face of a worldwide flu pandemic, this production would be insufficient. Even if the necessary annual production could somehow be met in a given year, the dominant strains change from year to year, thus stockpiling at low-need times in the year is not practical. Economical, large scale production of an effective influenza vaccine is of significant interest to government and private industry alike.
- Influenza haemagglutinin (HA) surface glycoprotein is both a receptor-binding and membrane fusion protein. It is a trimer of identical subunits, each containing two disulphide- linked polypeptides, HAl and HA2, that are derived by proteolytic cleavage of a precursor, HAO, that has a signal peptide sequence at its N-terminus and a membrane anchor sequence at its C-terminus. Cleavage to form HAl and HA2 generates the N-terminus of the smaller polypeptide, HA2, which has the membrane anchor sequence at its C-terminus. Cleavage is required for membrane fusion activity but not for immunogenicity.
- the HA2 N-terminal sequence is called the 'fusion peptide' because cleavage at similar hydrophobic sequences is also required for the activity of other virus fusion proteins, and because 20-residue synthetic peptide analogues of the sequence fuse membranes in vitro.
- the surface of the globular 'head' comprises several flexible loops with well-characterized and variable antigenic regions designated as sites A, B, C, D and E (reviewed in Wiley et al., 1987. Annu. Rev Biochem 56:365-394). Insertion or replacement of short peptide sequences at some sites (e.g. B and E) for immunity studies have been described (Garcia-Sastre et al. 1995. Biologicals 23:171-178).
- Epidermal growth factor EGF
- single chain antibody scFV
- the Fc domain of an IgG ranging in size from 53 to 246 amino acids
- EGF epidermal growth factor
- scFV single chain antibody
- IgG IgG
- 90 and 140 amino acid domains of Bacillus anthracis protective antigen have been fused to the amino terminus of a H3 (Li et al., 2005. J. Virol 79:10003-1002).
- Copeland Copeland et al., 2005. J. Virol 79:6459-6471 describes the expression of the gpl20 Env HIV surface glycoprotein on a H3 stalk, where the gpl20 domain replaced the whole globular head of HA.
- influenza type A HA and NA proteins have been developed as recombinant influenza vaccine candidates. These approaches have focused on the expression, production, and purification of influenza type A HA and NA proteins, including expression of these proteins using baculovirus infected insect cells (Crawford et al, 1999 Vaccine 17:2265-74; Johansson, 1999 Vaccine 17:2073-80), viral vectors, and DNA vaccine constructs (Olsen et al., 1997 Vaccine 15:1149-56).
- VLPs virus-like particles
- production of a non-infectious influenza virus strain for vaccine purposes is one way to avoid inadvertent infection.
- virus-like particles (VLPs) as substitutes for the cultured virus have been investigated.
- VLPs mimic the structure of the viral capsid, but lack a genome, and thus cannot replicate or provide a means for a secondary infection.
- Current influenza VLP production technologies rely on the co-expression of multiple viral proteins, and this dependence represents a drawback of these technologies since in case of a pandemic and of yearly epidemics, response time is crucial for vaccination.
- a simpler VLP production system for example, one that relies on the expression of only one or a few viral proteins without requiring expression of non-structural viral proteins is desirable to accelerate the development of vaccines.
- Enveloped viruses may obtain their lipid envelope when 'budding' out of the infected cell and obtain the membrane from the plasma membrane, or from that of an internal organelle.
- influenza buds from the plasma membrane
- Only a few enveloped viruses are known to infect plants (for example, members of the Tospoviruses and Rhabdoviruses).
- the known plant enveloped viruses they are characterized by budding from internal membranes of the host cell, and not from the plasma membrane.
- a small number of recombinant VLPs have been produced in plant hosts, none were derived from the plasma membrane, raising the question whether plasma membrane-derived VLPs, including influenza VLPs can be produced in plants.
- VLPs formation of VLPs, in any system, places considerable demands on the structure of the proteins - altering short stretches of sequence that correspond to selected surface loops of a globular structure may not have much of an effect on expression of the polypeptide itself, however structural studies are lacking to demonstrate the effect of such alterations on the formation of VLPs.
- the cooperation of the various regions and structures of HA e.g. the membrane anchor sequences, the stalk or stem regions of the trimer that separate the globular head from the membranes
- the present invention relates to virus-like particles. More specifically, the present invention is directed to virus-like particles comprising chimeric influenza hemagglutinin, and methods of producing chimeric influenza hemagglutinin virus-like particles.
- VLP chimeric influenza virus-like particle
- the present invention provides a polypeptide comprising a chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F' 1, F '2 and F subdomain; the HDC comprises an RB, El and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA and the other subdomains are of one or more second influenza HA.
- the first and second influenza HA may independently be selected from the group comprising Hl, H3, H5 and B.
- the polypeptide may comprise a signal peptide.
- the present invention also provides a nucleic acid encoding the polypeptide comprising a chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F' 1, F'2 and F subdomain; the HDC comprises an RB, El and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA, and the other subdomains are of one or more second influenza HA.
- the nucleic acid may also encode the polypeptide that comprises a signal peptide in addition to the SDC, HDC and TDC as defined.
- VLPs chimeric influenza virus like particles
- the present invention includes the method described above wherein in the step of introducing (step a), the nucleic acid is introduced in the plant in a transient manner. Alternatively, in the step of introducing (step a), the nucleic acid is introduced in the plant and is stably integrated.
- the method may further comprise a step of: c) harvesting the host and purifying the VLPs.
- the present invention provides a plant, or portion thereof, comprising a chimeric influenza HA, or a nucleotide sequence encoding the chimeric influenza HA, the chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F' 1, F2 and F subdomain; the HDC comprises an RB, El and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA and the other subdomains are of one or more second influenza HA.
- SDC stem domain cluster
- HDC head domain cluster
- TDC transmembrane domain cluster
- the plant, or portion thereof, may further comprise a nucleic acid comprising a nucleotide sequence encoding one or more than one chaperone protein operatively linked to a regulatory region active in a plant.
- the one or more than one chaperon proteins may be selected from the group comprising Hsp40 and Hsp70.
- the present invention pertains to a virus like particle (VLP) comprising a chimeric influenza HA, the chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F' 1, F'2 and F subdomain; the HDC comprises an RB, El and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one subdomain is of a first influenza HA and the other subdomains are of one or more second influenza HA.
- the VLP may further comprise plant-specific N-glycans, or modified N-glycans.
- a composition comprising an effective dose of the VLP as just described and a pharmaceutically acceptable carrier is also provided.
- a method of inducing immunity to an influenza virus infection in a subject comprising administering the VLP to the subject.
- the VLP may administered to a subject orally, intradermally, intranasally, intramusclarly, intraperitoneally, intravenously, or subcutaneously.
- Regulatory regions that may be operatively linked to a sequence encoding a chimeric HA protein include those that are operative in a plant cell, an insect cell or a yeast cell.
- Such regulatory regions may include a plastocyanin regulatory region, a regulatory region of Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO), chlorophyll a/b binding protein (CAB) or ST-LS 1.
- Other regulatory regions include a 5 ' UTR, 3 ' UTR or terminator sequences.
- the plastocyanin regulatory region may be an alfalfa plastocyanin regulatory region; the 5' UTR, 3'UTR or terminator sequences may also be alfalfa sequences.
- the present invention provides a chimeric influenza HA polypeptide comprised of a first influenza and a second influenza, the first influenza and the second influenza may be independently selected from the group comprising B, Hl, H2, H3, H4, H5, H6, H7, H8, H9, HlO, HI l, H12, H13, H14, H15 and H16; with the proviso that the first influenza and the second influenza are not the same influenza type, subtype, or of the same origin.
- the chimeric influenza HA polypeptide comprises a signal peptide sequence
- the signal peptide sequence may be selected from the group comprising a native signal peptide sequence, an alfalfa PDI signal peptide sequence, an influenza H5 signal peptide sequence and an influenza Hl signal peptide sequence
- the present invention provides a method for producing a VLP containing chimeric influenza hemagglutinin (HA) within a host capable of producing a VLP, including a plant, insect, or yeast comprising, introducing a nucleic acid encoding a chimeric influenza HA comprising a stem domain cluster (SDC), a head domain cluster (HDC) and a transmembrane domain cluster (TDC) wherein: the SDC comprises an F' 1, F'2 and F subdomain; the HDC comprises an RB, El and E2 subdomain; the TDC comprises a TmD and Ctail subdomain; and wherein at least one
- VLPs can stimulate specific immune cells and enhance the immune response induced.
- Plant membranes are made of lipids, phosphatidylcholine (PC) and phosphatidylethanolamine (PE), and also contain glycosphingolipids that are unique to plants and some bacteria and protozoa. Sphingolipids are unusual in that they are not esters of glycerol like PC or PE but rather consist of a long chain amino alcohol that forms an amide linkage to a fatty acid chain containing more than 18 carbons.
- PC and PE as well as glycosphingolipids can bind to CDl molecules expressed by mammalian immune cells such as antigen-presenting cells (APCs) like dentritic cells and macrophages and other cells including B and T lymphocytes in the thymus and liver.
- APCs antigen-presenting cells
- the ability of plant N-glycans to facilitate the capture of glycoprotein antigens by antigen presenting cells may be advantageous of the production of chimeric VLPs in plants.
- plant-made chimeric VLPs induce a stronger immune reaction than chimeric VLPs made in other manufacturing systems and that the immune reaction induced by these plant-made chimeric VLPs is stronger when compared to the immune reaction induced by live or attenuated whole virus vaccines.
- chimeric VLPs provide the advantage as they are non-infectious, thus restrictive biological containment is not as significant an issue as it would be working with a whole, infectious virus, and is not required for production.
- Plant- made chimeric VLPs provide a further advantage again by allowing the expression system to be grown in a greenhouse or field, thus being significantly more economical and suitable for scale-up.
- VLPs may be produced in the absence of neuraminidase (NA), and there is no need to co-express NA, or to treat the producing cells or extract with sialidase (neuraminidase), to ensure VLP production in plants
- Figure IA shows a schematic diagram of HA subdomains.
- SP signal peptide
- Fl Fl
- F'2 fusion subdomains
- RB receptor-binding subdomain
- El and E2 esterase subdomains
- TMD/CT transmembrane and cytoplasmic tail subdomains.
- Figure IB shows schematic respresentations of plastocyanin-based expression cassettes (construct numbers: 774, 540, 660, 690, 691, 696) for the expression of hemagglutinin Hl A/Brisbane/59/2007 (Hl/Bri), hemagglutinin Hl A/New Caledonia/20/99 (H 1/NC) and hemagglutinin H5 A/Indonesia/5/05 (H5/Indo) in native and chimeric forms.
- Plasto pro alfalfa plastocyanin promoter
- Plasto ter alfalfa plastocyanin terminator
- SP signal peptide
- RB receptor-binding subdomain
- El-RB- E2 esterase and receptor-binding subdomains
- TMD/CT transmembrane and cytoplasmic tail subdomains
- PDI alfalfa protein disulfide isomerase.
- Figure 1C shows the amino acid sequence alignment superimposed with a structural alignment for several influenza HAs (B/Florida/4/2006 (BFlorida), SEQ ID NO:94 (GenBank Accession No. ACA33493 .
- Figure 2 shows the amino acid sequence of the indicated subdomains of chimeric HA expressed with, upper panel, constructs 690, 734 (SEQ ID NO: 11), 696 (SEQ ID NO: 112), and lower panel, 691 (SEQ ID NO: 113.
- Amino acids 1-92 of SEQ ID NO: 111 is the F'l+El domain of H5/Indo; amino acids 93-263 is an RB head domain of Hi/Brisbane and amino acids 264-552 is an E2+F'2 domain of H5/Indo.
- Amino acids 1-92 of SEQ ID NO: 112 is the F'l+El domain of H5/NC; ammo acids 93-301 is an RB head domain of H5/Indo and amino acids 302-586 is an E2+F'2 domain of Hl/NC.
- Amino acids 1-42 of SEQ ID NO: 113 is the F'l domain of H5/Indo; amino acids 43-273 is an El- RB-E2 head domain of Hi/Brisbane and amino acids 274-552 is an F'2 domain of H5/Indo.
- Figure 3 shows the amino acid sequence of the coding region of constructs 690 and 734 (SEQ. ID. NO. 80) comprising an RB subdomain of Hl/Bri, an H5/uido signal peptide, and a stem domain complex (SDC) comprising an H5/hido F'l, El, E2, F'2 and F subdomains.
- SEQ. ID. NO. 80 amino acid sequence of the coding region of constructs 690 and 734
- SDC stem domain complex
- Figure 4 shows the amino acid sequence of the coding region of construct 691 (SEQ. ID. NO. 81) comprising Hl/Bri head domain complex (HDC) comprsing El, RB, E2, an H5/Indo signal peptide, and H5/Indo stem domain complex (SDC) comprising H5/Indo F'l, F'2 and F subdomains.
- Figure 5 shows the amino acid sequence of the coding region of construct 696 (SEQ. ID. NO. 82) comprising an RB subdomain of H5/Indo, a PDI signal peptide, and Hl/NC stem domain complex comprising F'l, El, E2 and F'2.
- Figure 6 shows an immunoblot analysis of expression of Hl/Bri in native form, construct 774 (comprising Hl/Bri), construct 692 (comprising the head domain complex (HDC) of Hl/Bri), and construct 690 (comprising the RB sub domain of Hl/Bri fused with H5/Indo stem domain complex (SDC) in plants.
- construct 774 expresses Hl/Bri with the native signal peptide of Hl/Bri
- constructs 690, 691 express the HA with the native signal peptide of H5/Indo.
- Figure 7 shows an immunoblot analysis of expression of H5/Indo in native form, construct 660 (comprising H5/Indo, or contract 696 (comprising Hl/Indo RB subdomain fused with Hl/NC SDC, El and E2 subdomains).
- construct 660 comprising H5/Indo
- contract 696 comprising Hl/Indo RB subdomain fused with Hl/NC SDC, El and E2 subdomains.
- FIG. 8 shows a schematic representation of 35SCPMV/HT-based expression cassettes for the expression of Hl/Bri in native (construct 732) and chimeric (constructs 733 and 734) forms.
- Construct 733 comprising PDI signal peptide and HDC, SDC and transmembrane domain complex (TDC) of Hl/Bri, and contract 734 comprising an H5/Indo signal peptide, F'l, El, E2, F'2, F, and an RB from Hl/Bri.
- 35S pro CaMV 35S promoter, NOS ter: nopaline synthase terminator, SP: signal peptide, RB: receptor-binding subdomain, E1-RB-E2: esterase and receptor-binding subdomains, TMD/CT: transmembrane and cytoplasmic tail subdomains, PDI: alfalfa protein disulfide isomerase; CPMV-HT: 5' and 3' elements of the hyper translatable Cowpea Mosaic Virus expression system.
- Figure 9 shows immunoblot analysis of expression of Hl/Bri in native form, construct 732 (comprising Hl/Bri under the control of the 35SCPMV/HT-based expression cassette), construct 733 (comprising a PDI signal peptide fused with Hl/Bri; under the control of the 35SCPMV/HT-based expression cassette), or construct 734 comprising an Hl/Bri RB subdomain fused with an H5/Indo SDC, El and E2 subdomains; under the control of the 35SCPMV/HT-based expression cassette).
- construct 732 comprising Hl/Bri under the control of the 35SCPMV/HT-based expression cassette
- construct 733 comprising a PDI signal peptide fused with Hl/Bri; under the control of the 35SCPMV/HT-based expression cassette
- construct 734 comprising an Hl/Bri RB subdomain fused with an H5/Indo SDC, El and E2 subdomains
- FIG. 10 shows schematic representation of 35SCPMV/HT-based expression cassettes for the expression of H3 A/Brisbane/I 0/2007 HA (H3/Bri) and B/Florida/4/2006 HA (B/Flo) hemagglutinins.
- Construct 736 comprises H3/Bri fused to a PDI signal peptide.
- Contract 737 comprises the H3/Bri fused to a PDI signal peptide and an H5/Indo TMD/CT.
- Construct 739 comprises B/Flo fused to a PDI signal peptide.
- Contruct 745 comprises the B/Flo fused to a PDI signal peptide and an H5/hido TMD/CT.
- 35S pro CaMV 35S promoter, NOS ter: nopaline synthase terminator, SP: signal peptide, RB: receptor-binding subdomain, E1-RB-E2: esterase and receptor-binding subdomains, TMD/CT: transmembrane and cytoplasmic tail subdomains, PDI: alfalfa protein disulfide isomerase; CPMV-HT: 5' and 3' elements of the hyper translatable Cowpea Mosaic Virus expression system.
- Figure 11 shows the fusion border in constructs number 745 and 737. Origin of HA sequence is indicated by bullet-ended arrows. Amino acids of the transmembrane domain are QILSIYSTVA, and are preceded by amino acids that are part of the ectodomain.
- Figure 12 shows amino acid sequence of the chimeric H5/H3 hemagglutinin (SEQ. ID. NO. 83; contruct 737) comprising a PDI signal peptide, an ectodomain of H3 A/Brisbane/10/2007 and a TMD/CT of H5 A/Indonesia/5/2005.
- Figure 13 shows the amino acid sequence of the chimeric H5/B hemagglutinin (SEQ. ID. NO. 84) comprising an ectodomain of B/Florida/4/2006 and a TMD/CT of H5 A/Indonesia/5/2005 encoded by the open reading frame in construct number 745.
- Figure 14 shows immunoblot analysis of expression of B/Flo in native form, construct 739 (comprising PDI-B/Flo), or with construct 745 (comprising B/Flo HDC and SDC fused with an H5/Indo TDC). For each construct, total protein extracts from 3 separate plants were analyzed. Twenty micrograms of protein were loaded for each plant analyzed. The Western blot was revealed with anti-HA B/Florida polyclonal antibodies (NIBSC 07/356).
- Figure 15 shows immunoblot analysis of expression of H3/Bri in native form, construct 736 (comprising PDI sp - H3/Bri), or with contrcut 737 (H3/Bri HDC and SCD fused with an H5/Indo TDC).
- construct 736 comprising PDI sp - H3/Bri
- contrcut 737 H3/Bri HDC and SCD fused with an H5/Indo TDC
- Figure 16 shows size exclusion chromatography of leaf protein extracts from plants infiltrated with construct number 745. Relative protein content of elution fractions is presented for each fraction. Immunodetection (Western blot) of hemagglutinin using anti-HA B/Florida polyclonal antibodies (NlBSC 07/356) in fractions 7 to 15 is presented under the graph. The elution peak of Blue Dextran 2000 is indicated by the arrow (fraction 8).
- Figure 17 shows the nucleic acid sequence (SEQ ID NO: 52) of the synthesized fragment comprising the complete H5 (A/Indonesia/5/05 (H5N1)) coding region (including the signal peptide and the stop codon) flanked, in 5' by a HindIII site and, in 3', by a Sacl site.
- Figure 18 shows the nucleic acid sequence (SEQ E) NO: 53) of construct 660, an HA expression cassette comprising an alfalfa plastocyanin promoter and 5' UTR, hemagglutinin coding sequence of H5 form A/Indonesia/5/05 (H5N1), alfalfa plastocyanin 3' UTR and terminator sequences.
- Figure 19 shows the nucleic acid sequence (SEQ ID NO: 54) of the wild-type Hl (A/New Caledonia/20/99 (HlNl) (GenBank ace. no. AY289929) coding sequence without a TmD and Ctail.
- Figure 20 shows the nucleic acid sequence (SEQ ID NO: 55) of a synthesized fragment comprising Hl (A/New Caledonia/20/99 (HlNl) coding sequence lacking TmD and Ctail. In the 5' region, the last nucleotides originate from PDI SP and include a BgIII restriction site and in 3', a dual Sacl/Stul site is found immediately downstream of the stop codon.
- Figure 21 shows the nucleic acid sequence (SEQ ID NO: 56) of the synthesized fragment comprising the C-ter Hl (A/New Caledonia/20/99 (HlNl) coding sequence including the TmD and Ctail from the Kpnl site to the stop codon (flanked in 3' by a dual Sacl/Stul site).
- SEQ ID NO: 56 the nucleic acid sequence of the synthesized fragment comprising the C-ter Hl (A/New Caledonia/20/99 (HlNl) coding sequence including the TmD and Ctail from the Kpnl site to the stop codon (flanked in 3' by a dual Sacl/Stul site).
- Figure 22 shows the nucleotide sequence for Medicago sativa mRNA for protein disulfide isomerase. GenBank Accession No. Zl 1499 (SEQ ID NO: 57). Nucleotides 32-103 encode the PDI signal peptide.
- Figure 23 shows the nucleotide sequence for PromPlasto-PDISP-Plasto 3'UTR plasmid.
- Figure 23A shows the nucleotide sequence for PromPlasto-PDISP (SEQ ID NO:58).
- Figure 23B shows the nucleotide sequence from Plasto 3'UTR (SEQ ID NO:85).
- Protein disulfide isomerase (PDI) signal peptide is underlined.
- BgIII (AGATCT) and Sad (GAGCTC) restriction sites used for cloning are shown in bold.
- Figure 24 shows the nucleic acid sequence (SEQ ID NO: 59; construct 540) of the an HA expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, coding sequence of the signal peptide from PDI and of Hl form A/New Caledonia/20/99 (HlNl), alfalfa plastocyanin 3' UTR and terminator sequences. Hl from A/New Caledonia/20/1999 coding sequence is underlined.
- Figure 25 shows the nucleic acid sequence (SEQ ID NO: 60) of the synthesized fragment comprising the complete Hl (A/Brisbane/59/07 (HlNl)) coding region (including the signal peptide and the stop codon) flanked, in 5' by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a DraIII site and, in 3', by a Sacl site.
- SEQ ID NO: 60 the nucleic acid sequence of the synthesized fragment comprising the complete Hl (A/Brisbane/59/07 (HlNl)) coding region (including the signal peptide and the stop codon) flanked, in 5' by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a DraIII site and, in 3', by a Sacl site.
- Figure 26 shows the nucleic acid sequence (SEQ ID NO: 61 ; construct 774) of the an HA expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, hemagglutinin coding sequence of Hl form A/Brisbane/59/07 (HlNl), alfalfa plastocyanin 3' UTR and terminator sequences.
- Figure 27 shows the nucleic acid sequence of expression cassette number 828 (SEQ ID NO: 62), from Pad (upstream of the promoter) to Ascl (immediately downstream of the NOS terminator).
- SEQ ID NO: 62 the nucleic acid sequence of expression cassette number 828
- Pad upstream of the promoter
- Ascl immediate downstream of the NOS terminator
- CPMV HT 3' UTR sequencer underlined with mutated ATG in bold.
- Apal restriction site underlined and italic.
- Figure 28 shows the nucleic acid sequence (SEQ ID NO: 63; construct 690) of a chimeric H5/H1 expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3' UTR and terminator sequences. Chimeric HA coding sequence is underlined.
- Figure 29 shows the nucleic acid sequence (SEQ ID NO: 64; construct 691) of a chimeric H5/H1 expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3' UTR and terminator sequences. Chimeric HA coding sequence is underlined.
- Figure 30 shows the nucleic acid sequence (SEQ ID NO: 65; construct 696) of a chimeric H1/H5 expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3' UTR and terminator sequences. Chimeric HA coding sequence is underlined.
- Figure 31 shows the nucleic acid sequence (SEQ ID NO: 66; construct 732) of the an HA expression cassette comprising the CaMV 35 S promoter, CPMV-HT 5' UTR, hemagglutinin coding sequence of Hl form A/Brisbane/59/07 (HlNl), CPMV-HT 3' UTR and NOS terminator sequences. Coding sequence of Hl/Bri is underlined.
- Figure 32 shows the nucleic acid sequence (SEQ ID NO: 67) of the coding sequence, from ATG to stop, of intermediate construct number 787.
- Figure 33 shows the nucleic acid sequence (SEQ ID NO: 68; construct no. 733) of SpPDI Hl/Bri expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of Hl form A/Brisbane/59/07 (HlNl), CPMV-HT 3' UTR and NOS terminator sequences. Coding sequence of SpPDI H 1 /Bri is underlined.
- Figure 34 shows the nucleic acid sequence (SEQ ID NO: 69; construct 734) of a chimeric H5/H1 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3' UTR and NOS terminator sequences. Coding sequence of chimeric HA is underlined.
- Figure 35 shows the nucleic acid sequence (SEQ ID NO: 70) of the synthesized fragment comprising the complete H3 (A/Brisbane/ 10/07 (H3N2)) coding region (including the signal peptide and the stop codon) flanked, in 5' by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a DraIII site and, in 3', by a Sad site.
- H3 A/Brisbane/ 10/07
- Figure 36 shows the nucleic acid sequence (SEQ ID NO: 71 ; construct 736) of the an HA expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of H3 form A/Brisbane/ 10/07 (H2N3), CPMV-HT 3' UTR and NOS terminator sequences. Coding sequence of Sp PDI H3/Bris is underlined.
- Figure 37 shows the nucleic acid sequence (SEQ ID NO: 72; construct no. 737) of a chimeric H5/H3 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3' UTR and NOS terminator sequences. Coding sequence of chimeric HA is underlined.
- Figure 38 shows the nucleic acid sequence (SEQ ID NO: 73) of the synthesized fragment comprising the complete HA (B/Florida/4/06) coding region (including the signal peptide and the stop codon) flanked, in 5' by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a DraIII site and, in 3', by a Sad site.
- SEQ ID NO: 73 the nucleic acid sequence of the synthesized fragment comprising the complete HA (B/Florida/4/06) coding region (including the signal peptide and the stop codon) flanked, in 5' by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the initial ATG, starting with a DraIII site and, in 3', by a Sad site.
- Figure 39 shows the nucleic acid sequence (SEQ ID NO: 74; construct 739) of the an HA expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of HA form
- Figure 40 shows the nucleic acid sequence (SEQ ID NO: 75; construct 745) of a chimeric H5/B expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3' UTR and NOS terminator sequences. Coding sequence of chimeric HA is underlined.
- Figure 41 shows the nucleic acid sequence encoding Msjl (SEQ ID NO: 76).
- Figure 42 shows the nucleic acid sequence (SEQ ID NO: 77) of a portion of construct number R850, from HindIII (in the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator). HSP40 coding sequence is underlined.
- Figure 43 shows the nucleic acid sequence (SEQ ID NO: 78) of a portion of construct number R860, from HindIII (in the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator).
- the HSP70 coding sequence is underlined.
- Figure 44 shows the nucleic acid sequence (SEQ ID NO: 79) of a portion of construct number R870, from HindIII (in the multiple cloning site, 5 upstream of the promoter) to
- the HSP40 coding sequence is in underlined italic and the HSP70 coding sequence is underlined.
- Figure 45 shows a schematic representation of construct number R472.
- Figure 46 shows the disulfide bridge pattern of influenza type A. Bridge numbering: 1) Cys4HAl-Cysl37HA2, 2) Cys60HAl-Cys72HAl, 3) Cys94HAl-Cysl43HAl, 4) Cys292HAl-Cys318HAl 5) Cysl44HA2-Cysl48HA2 and 6) Cys52HAl-Cys277HAl.
- the disulfide bridges that differ between A and B ( Figure 47) subtypes are indicated with arrows. The numbering from mature H3 protein was used.
- Figure 47 shows the disulfide bridge pattern of influenza type B HA. Bridge numbering: 1) Cys4HAl-Cysl37HA2, 2) Cys60HAl-Cys72HAl, 3) Cys94HAl- Cysl43HAl, 4) Cys292HAl-Cys318HAl 5) Cysl44HA2-Cysl48HA2, 6) Cys52HAl- Cys277HAl, 7) Cys54HAl-Cys57HAl and 8) Cysl78HAl-Cys272HAl.
- the disulfide bridges that differ between A ( Figure 46) and B subtypes are indicated with arrows. The numbering from mature H3 protein was used.
- Figure 48 shows a schematic diagram of domain swap fusion junctions.
- Figure 48 A shows the fusion of RB subdomain from Hl/Bri, H3/Bri, and B/Flo with H5/Indo SDCs, and the RB subdomain of H5/ ⁇ ndo with Hl /NC stem domain.
- Figure 48B shows the fusion of El- RB-E2 subdomains (HDC) from Hl/Bri, H3/Bri or B/Flo with H5/Indo SDC, and of H5/Indo HDC withn Hl/NC SDC.
- HDC El- RB-E2 subdomains
- Figure 49A shows the nucleotide sequence SEQ ID NO: 86) of Hl A/California/04/09. Alfalfa protein disulfide isomerase signal peptide coding sequence is underlined and mature Hl coding sequence is highlighted in bold.
- Figure 49B shows the amino acid sequence (SEQ ID NO: 87) of the Hl A/California/04/09. Alfalfa protein disulfide isomerase signal peptide is underlined.
- Figure 50 shows an immunoblot analysis of expression of H5/B chimeric hemagglutinin (construct number 747; comprising B/Flo HDC and SDC fused with an H5/Indo TDC) after infiltration of AGL1/747 undiluted, co-infiltrated with AGL1/443 (empty vector) and co-infiltrated with AGL1/R870 (HSP40/HSP70).
- construct number 747 comprising B/Flo HDC and SDC fused with an H5/Indo TDC
- Figure 51 A shows the nucleotide sequence for the 2X35S promoter sequence (SEQ ID NO:88).
- Figure 5 IB shows the nucleotide sequence for construct 747 (SEQ ID NO:93) from Pad (upstream 35S promoter) to Ascl (immediately downstream NOS terminator). Coding sequence of chimeric HA is underlined. 2X35S promoter sequence is indicated in italics.
- the present invention relates to virus-like particles. More specifically, the present invention is directed to virus-like particles comprising chimeric influenza hemagglutinin, and methods of producing chimeric influenza virus-like particles.
- the present invention provides a nucleic acid comprising a nucleotide sequence encoding a chimeric influenza hemagglutinin (HA) operatively linked to a regulatory region active in a plant.
- HA hemagglutinin
- the present invention provides a method of producing virus like particles (VLPs) in a plant.
- the method involves introducing a nucleic acid encoding a chimeric influenza HA operatively linked to a regulatory region active in the plant, into the plant, or portion of the plant, and incubating the plant or a portion of the plant under conditions that permit the expression of the nucleic acid, thereby producing the VLPs.
- the present invention further provides for a VLP comprising a chimeric influenza HA.
- the VLP may be produced by the method as provided by the present invention.
- chimeric protein or “chimeric polypeptide”
- chimeric polypeptide it is meant a protein or polypeptide that comprises amino acid sequences from two or more than two sources, for example but not limited to, two or more influenza types or subtypes, or influenza's of a different origin, that are fused as a single polypeptide.
- the chimeric protein or polypeptide may include a signal peptide that is the same as, or heterologous with, the remainder of the polypeptide or protein.
- the chimeric protein or chimeric polypeptide may be produced, as a transcript from a chimeric nucleotide sequence, and the chimeric protein or chimeric polypeptide cleaved following synthesis, and as required, associated to form a multimeric protein.
- a chimeric protein or a chimeric polypeptide also includes a protein or polypeptide comprising subunits that are associated via disulphide bridges (i.e. a multimeric protein).
- a chimeric polpeptide comprising amino acid sequences from two or more than two sources may be processed into subunits, and the subunits associated via disulphide bridges to produce a chimeric protein or chimeric polypeptide (see Figures 46 and 47).
- the polypeptide may be hemagglutinin (HA), and each of the two or more than two amino acid sequences that make up the polpeptide may be obtained from different HA's to produce a chimeric HA, or chimeric influenza HA.
- HA hemagglutinin
- a chimeric HA may also include an amino acid sequence comprising heterologous signal peptide (a chimeric HA preprotein) that is cleaved after or during protein synthesis.
- a chimeric HA preprotein a chimeric HA preprotein
- the chimeric polypeptide, or chimeric influenza HA is not naturally occurring.
- a nucleic acid encoding a chimeric polypeptide may be described as a "chimeric nucleic acid”, or a "chimeric nucleotide sequence”.
- a virus-like particle comprised of chimeric HA may be described as a "chimeric VLP".
- the chimeric influenza HA may comprise a stem domain complex (SDC) a head domain complex (HDC) and a transmembrane domain complex (TDC), where one or more than one subdomain of either the SDC, HDC or TDC is of a first influenza HA type, subtype or from one origin, and one or more than one subdomain of either the SDC, HDC or TDC is from a second influenza HA type, subtype, or from a second or different origin.
- SDC stem domain complex
- HDC head domain complex
- TDC transmembrane domain complex
- the "SDC” comprises an F' 1, F '2 and F subdomain
- the "HDC” comprises an RB
- the "TDC” comprises a TmD and Ctail subdomain (TMD/CT; see Figures IA, 46 and 47).
- virus like particle refers to structures that self-assemble and comprise structural proteins such as influenza HA protein, or chimeric influenza HA protein.
- VLPs and chimeric VLPs are generally morphologically and antigenically similar to virions produced in an infection, but lack genetic information sufficient to replicate and thus are non-infectious.
- VLPs and chimeric VLPs may be produced in suitable host cells including plant host cells. Following extraction from the host cell and upon isolation and further purification under suitable conditions, VLPs and chimeric VLPs may be purified as intact structures.
- Chimeric VLPs, or VLPs, produced from influenza derived proteins, in accordance with the present invention do not comprise Ml protein.
- the Ml protein is known to bind RNA (Wakefield and Brownlee, 1989) which is a contaminant of VLP preparation.
- RNA is undesired when obtaining regulatory approval for the chimeric VLP product, therefore a chimeric VLP preparation lacking RNA may be advantageous.
- the chimeric VLPs of the present invention may be produced in a host cell that is characterized by lacking the ability to sialylate proteins, for example a plant cell, an insect cell, fungi, and other organisms including sponge, coelenterara, annelida, arthoropoda, mollusca, nemathelminthea, trochelmintes, plathelminthes, chaetognatha, tentaculate, chlamydia, spirochetes, gram-positive bacteria, cyanobacteria, archaebacteria, or the like. See, for example Gupta et al., 1999. Nucleic Acids Research 27:370-372; Toukach et al., 2007. Nucleic Acids Research 35:D280-D286; Nakahara et al., 2008. Nucleic Acids Research
- the chimeric VLPs produced as described herein do not typically comprise neuraminidase (NA). However, NA may be co-expressed with HA should VLPs comprising HA and NA be desired.
- NA neuraminidase
- the invention also provides VLPs comprising chimeric HA that obtain a lipid envelope from the plasma membrane of the cell in which the chimeric HA are expressed.
- VLPs comprising chimeric HA that obtain a lipid envelope from the plasma membrane of the cell in which the chimeric HA are expressed.
- the resulting VLP may obtain a lipid envelope from the plasma membrane of the plant cell.
- lipid refers to a fat-soluble (lipophilic), naturally-occurring molecules.
- a chimeric VLP produced in a plant according to some aspects of the invention may be complexed with plant-derived lipids.
- the plant-derived lipids may be in the form of a lipid bilayer, and may further comprise an envelope surrounding the VLP.
- the plant derived lipids may comprise lipid components of the plasma membrane of the plant where the VLP is produced, including phospholipids, tri-, di- and monoglycerides, as well as fat-soluble sterol or metabolites comprising sterols.
- Examples include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol, phosphatidylserine, glycosphingolipids, phytosterols or a combination thereof.
- a plant-derived lipid may alternately be referred to as a 'plant lipid'.
- phytosterols include campesterol, stigmasterol, ergosterol, brassicasterol, delta- 7-stigmasterol, delta-7-avenasterol, daunosterol, sitosterol, 24- methylcholesterol, cholesterol or beta-sitosterol - see, for example, Mongrand et al., 2004.
- the lipid composition of the plasma membrane of a cell may vary with the culture or growth conditions of the cell or organism, or species, from which the cell is obtained.
- beta-sitosterol is the most abundant phytosterol.
- Cell membranes generally comprise lipid bilayers, as well as proteins for various functions. Localized concentrations of particular lipids may be found in the lipid bilayer, referred to as 'lipid rafts'. These lipid raft microdomains may be enriched in sphingo lipids and sterols. Without wishing to be bound by theory, lipid rafts may have significant roles in endo and exocytosis, entry or egress of viruses or other infectious agents, inter-cell signal transduction, interaction with other structural components of the cell or organism, such as intracellular and extracellular matrices.
- the invention includes VLPs comprising chimeric HA, of which the subdomains may be obtained from any type, subtype of influenza virus which may infect humans, including, for example, B, Hl, H2, H3, H4, H5, H6, H7, H8, H9, HlO, HI l, H12, H13, H14, H15 and Hl ⁇ types or subtypes.
- influenza virus may be of an Hl, H3, H5 or B types or subtypes.
- Hl, H3, H5 or B types or subtypes include the A/New Caledonia/20/99 subtype (HlNl) ("Hl/NC”; SEQ ID NO.56), the Hl A/California 04/09 subtype (HlNl) ("Hl/Cal”; SEQ ID NO:86), the A/Indonesia/5/05 sub-type (H5N1) ("H5/Indo"), A/Brisbane/59/2007 (“Hl/Bri”), and B/Florida/4/2006 (“B/Flo”) and H3
- influenza viruses which infect other mammals or host animals, for example humans, primates, horses, pigs, birds, avian water fowl, migratory birds, quail, duck, geese, poultry, chicken, camel, canine, dogs, feline, cats, tiger, leopard, civet, mink, stone marten, ferrets, house pets, livestock, mice, rats, seal, whale and the like.
- influenza viruses may infect more than one host animal.
- hemagglutinin refers to a structural glycoprotein of influenza viral particles.
- the structure of influenza hemagglutinin is well-studied and demonstrates a high degree of conservation in secondary, tertiary and quaternary structure. This structural conservation is observed even though the amino acid sequence may vary (see, for example, Skehel and Wiley, 2000 Ann Rev Biochem 69:531-69; Vaccaro et al 2005; which is incorporated herein by reference).
- NCBI National Center for Biotechnology Information
- the HA monomer may be subdivided in three functional domains - a stem domain, or stem domain cluster (SDC), a globular head domain, or head domain cluster (HDC) and a transmembrane domain cluster (TDC).
- SDC stem domain cluster
- HDC head domain cluster
- TDC transmembrane domain cluster
- the SDC comprises four subdomains, a fusion peptide F, F' 1 and F'2 (this subdomain may be generally referred to as a 'backbone').
- the TDC comprises two subdomains, the transmembrane (TmD) and a C terminal tail (CT).
- CT C terminal tail
- the HDC comprises three subdomains, vestigial esterase domains ET and E2, and a receptor binding domain RB.
- the SDC and HDC may be collectively referred to as the 'ectodomain'.
- FIG. 1C An annotated structural alignment of various influenza subtypes is provided in Figure 1C.
- Amino acid variation is tolerated in hemagglutinins of influenza viruses. This variation provides for new strains that are continually being identified. Infectivity between the new strains may vary. However, formation of hemagglutinin trimers, which subsequently form VLPs is maintained.
- the present invention therefore, provides for a hemagglutinin amino acid sequence comprising chimeric HA, or a nucleic acid encoding a chimeric hemagglutinin amino acid sequence, that forms VLPs in a plant, and includes known sequences and variant HA sequences that may develop.
- the present invention also pertains to the use of a chimeric HA polypeptide comprising a TDC, SDC and HDC.
- the chimeric HA protein may be HAO, or a cleaved chimeric HA comprising subdomains of HAl and HA2 from two or more influenza types.
- the chimeric HA protein may be used in the production or formation of VLPs using a plant, or plant cell, expression system.
- HAO may be expressed and folded to form a trimer, which may subsequently assemble into VLPs. Cleavage of HAO yields HAl and HA2 polypeptides linked by a disulfide bridge (see Figures 1C, 46 and 47 for illustration of disulfide bridge patterns).
- cleavage of precursor HAO is required to trigger the conformational change of HA2 that release the fusion peptide (at the N terminus of the HA2 polypeptide) and make it available for fusion of the cell and viral membranes.
- VLPs are not infectious, and cleavage of the HA into HAl and HA2 is not required, for example, for vaccine production.
- Uncleaved HAO precursor also assembles in trimers and bud from plasma membrane to form VLP nanoparticles.
- the HAO polypeptide comprises several domains.
- HDC comprises several loops in antigenic regions designated as site A-E. Antibodies that may neutralize infectious influenza virus are frequently targeted to one or more of these sites.
- the vestigial esterase subdomains (El and E2) may have a role in fusion, and may bind Ca++.
- the F, F'l and F '2 domains interact and cooperate to form a stem, raising the head of the HA trimer above the membrane.
- a TmD and CT may be involved in anchoring of the folded HA to a membrane.
- the TmD may have a role in affinity of HA for lipid rafts, while the CT may have a role in secretion of HA, while some of the cysteine residues found in the CT subdomain may be palmitoylated.
- a signal peptide may also be found at the N terminus of the HAO polypeptide.
- Figure 2 and Tables 4 and 5 provide examples of the amino acid sequences of SP, F' l, F'2, El, RB, E2 and F domains of some influenza virus subtypes.
- N-terminal signal peptide refers generally to a short (about 5-30 amino acids) sequence of amino acids, found generally at the N-terminus of a hemagglutinin polypeptide that may direct translocation of the newly-translated polypeptide to a particular organelle, or aid in positioning of specific domains of the polypeptide chain relative to others.
- the signal peptide of hemagglutinins target the translocation of the protein into the endoplasmic reticulum and have been proposed to aid in positioning of the N-terminus proximal domain relative to a membrane-anchor domain of the nascent hemagglutinin polypeptide to aid in cleavage and folding of the mature hemagglutinin.
- a signal peptide may be native to the hemagglutinin, or a signal peptide may be heterologous with respect to the primary sequence of hemagglutinin being expressed.
- a chimeric HA may comprise a signal peptide from a first influenza type, subtype or strain with the balance of the HA from one or more than one different influenza type, subtype or strain.
- the native SP of HA subtypes B Hl, H2, H3, H5, H6, H7, H9 or influenza type B may be used to express the HA in a plant system, hi some embodiments of the invention, the SP may be of an influenza type B, Hl, H3 or H5; or of the subtype Hl/Bri, Hl/NC, H5/Indo, H3/Bri or B/Flo.
- a SP may also be non-native, for example, from a structural protein or hemagglutinin of a virus other than influenza, or from a plant, animal or bacterial polypeptide.
- a non limiting example of a signal peptide that maybe used is that of alfalfa protein disulfide isomerase (PDI SP; nucleotides 32-103 of Accession No. Zl 1499; SEQ ID NO: 34; Figure 17) having the amino acid sequence:
- MAKNVAIFGLLFSLLLLVPSQIFAEE (nucleotides 32- 103 ; SEQ ID NO: 34)
- the present invention therefore provides for a chimeric influenza hemagglutinin comprising a native, or a non-native signal peptide, and nucleic acids encoding such chimeric hemagglutinins.
- Correct folding of the hemagglutinins may be important for stability of the protein, formation of multimers, formation of VLPs and function of the HA (ability to hemagglutinate), among other characteristics of influenza hemagglutinins.
- Folding of a protein may be influenced by one or more factors, including, but not limited to, the sequence of the protein, the relative abundance of the protein, the degree of intracellular crowding, the availability of cofactors that may bind or be transiently associated with the folded, partially folded or unfolded protein, the presence of one or more chaperone proteins, or the like.
- Heat shock proteins or stress proteins are examples of chaperone proteins, which may participate in various cellular processes including protein synthesis, intracellular trafficking, prevention of misfolding, prevention of protein aggregation, assembly and disassembly of protein complexes, protein folding, and protein disaggregation.
- chaperone proteins include, but are not limited to, Hsp ⁇ O, Hsp65, Hsp 70, Hsp90, HsplOO, Hsp20-30, HsplO, HsplOO-200, HsplOO, Hsp90, Lon, TF55, FKBPs, cyclophilins, CIpP, GrpE, ubiquitin, calnexin, and protein disulfide isomerases (see, for example, Macario, A.J.L., Cold Spring Harbor Laboratory Res. 25:59-70. 1995; Parsell, D. A. & Lindquist, S. Ann. Rev. Genet. 27:437-496 (1993); U.S. Patent No. 5,232,833).
- chaperone proteins for example but not limited to Hsp40 and Hsp70 may be used to ensure folding of a chimeric HA.
- Hsp70 examples include Hsp72 and Hsc73 from mammalian cells, DnaK from bacteria, particularly mycobacteria such as Mycobacterium leprae, Mycobacterium tuberculosis, and Mycobacterium bovis (such as Bacille-Calmette Guerin: referred to herein as Hsp71). DnaK from Escherichia coli, yeast and other prokaryotes, and BiP and Grp78 from eukaryotes, such as A. thaliana (Lin et al. 2001 (Cell Stress and Chaperones 6:201-208).
- Hsp70 A thaliana Hsp70 (encoded by Genbank ref: AY120747.1). Hsp70 is capable of specifically binding ATP as well as unfolded polypeptides and peptides, thereby participating in protein folding and unfolding as well as in the assembly and disassembly of protein complexes.
- Hsp40 examples include DnaJ from prokaryotes such as E. coli and mycobacteria and HSJl, HDJl and Hsp40 from eukaryotes, such as alfalfa (Frugis et al., 1999. Plant Molecular Biology 40:397-408).
- a particular example of an Hsp40 is M. sativa MsJl (AJ000995.1 or SEQ ID NO: 76).
- Hsp40 plays a role as a molecular chaperone in protein folding, thermotolerance and DNA replication, among other cellular activities.
- Figure 41 shows the nucleic acid sequence encoding Msj 1 (SEQ ID NO: 76).
- Hsp40 binds to the hydrophobic patches of unfolded (nascent or newly transferred) polypeptides, thus facilitating the interaction of Hsp70-ATP complex with the polypeptide. ATP hydrolysis leads to the formation of a stable complex between the polypeptide, Hsp70 and ADP, and release of Hsp40.
- Hsp70-ADP complex The association of Hsp70-ADP complex with the hydrophobic patches of the polypeptide prevents their interaction with other hydrophobic patches, preventing the incorrect folding and the formation of aggregates with other proteins (reviewed in Hartl, FU. 1996. Nature 381:571-579).
- Native chaperone proteins may be able to facilitate correct folding of low levels of recombinant protein, but as the expression levels increase, the abundance of native chaperones may become a limiting factor.
- High levels of expression of hemagglutinin in the agroinf ⁇ ltrated leaves may lead to the accumulation of hemagglutinin polypeptides in the cytosol, and co-expression of one or more than one chaperone proteins such as Hsp70, Hsp40 or both Hsp70 and Hsp40 may reduce the level of misfolded or aggregated hemagglutinin polypeptides, and increase the number of polypeptides exhibiting tertiary and quaternary structural characteristics that allow for hemagglutination and/or formation of virus-like particles.
- one or more than one chaperone proteins such as Hsp70, Hsp40 or both Hsp70 and Hsp40 may reduce the level of misfolded or aggregated hemagglutinin polypeptides, and increase the number of polypeptides exhibiting tertiary and quaternary structural characteristics that allow for hemagglutination and/or formation of virus-like particles.
- SEQ ID NO: 77 is a nucleic acid sequence of a portion of construct number R850, from HindIII (in the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP40 (underlined).
- SEQ ID NO: 78 is a nucleic acid sequence of a portion of construct number R.860, from HindIII (in the multiple cloning site, upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator), encoding HSP70 (underlined).
- SEQ ID NO: 79 is a nucleic acid sequence of a portion of construct number R870, from HindIII (in the multiple cloning site, 5 upstream of the promoter) to EcoRI (immediately downstream of the NOS terminator) encoding HSP40 (underlined italic) and HSP70 (underlined).
- the present invention also provides for a method of producing chimeric influenza VLPs in a plant, wherein a first nucleic acid encoding a chimeric influenza HA is co-expressed with a second nucleic acid encoding a chaperone.
- the first and second nucleic acids may be introduced to the plant in the same step, or may be introduced to the plant sequentially.
- VLPs may be assessed for structure and size by, for example, hemagglutination assay, electron microscopy, or by size exclusion chromatography.
- total soluble proteins may be extracted from plant tissue by homogenizing (Polytron) sample of frozen-crushed plant material in extraction buffer, and insoluble material removed by centrifugation. Precipitation with PEG may also be of benefit. The soluble protein is quantified, and the extract passed through a SephacrylTM column. Blue Dextran 2000 may be used as a calibration standard. Following chromatography, fractions may be further analyzed by immunoblot to determine the protein complement of the fraction.
- the present invention also provides for a plant comprising a nucleic acid encoding one, or more than one chimeric influenza hemagglutinin and a nucleic acid encoding one or more than one chaperones.
- the present invention includes nucleotide sequences:
- SEQ ID NO: 63 construct 690; a chimeric H5/H 1 expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3 ' UTR and terminator sequences) and the underlined portion of SEQ ID NO:63 encoding SP, Fl, El of H5/Indo-RB of Hl/Bri-E2, F2, F, TMD/CT of H5/Indo;
- SEQ ID NO: 64 construct 691 ; a chimeric H5/H 1 expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3' UTR and terminator sequences), and the underlined portion of SEQ ID NO:64, encoding SP, Fl, of H5/Indo-El, RB.E2 of Hl/Bri-F2, F, TMD/CT of H5/Indo;
- SEQ ID NO: 65 construct 696; a chimeric H1/H5 expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3' UTR and terminator sequences
- SEQ ID NO: 65 construct 696; a chimeric H1/H5 expression cassette comprising alfalfa plastocyanin promoter and 5' UTR, chimeric hemagglutinin coding sequence, alfalfa plastocyanin 3' UTR and terminator sequences
- SEQ ID NO: 68 construct 733; the SpPDI Hl/Bri expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of Hl form A/Brisbane/59/07 (HlNl), CPMV-HT 3' UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:68, encoding PDI SP-Fl, El, RB,E2, F'2, F, TMD/CT of Hl/BRI;
- SEQ ID NO: 69 construct 734; a chimeric H5/H1 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3' UTR and NOS terminator sequences).
- the coding sequence of chimeric HA is underlined, encoding the same chimieric HA as SEQ ID NO: 63;
- SEQ ID NO: 71 construct 736; an HA expression cassette comprising the
- CaMV 35S promoter CaMV 35S promoter, CPMV-HT 5' UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of H3 form A/Brisbane/ 10/07 (H2N3), CPMV-HT 3' UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO: 71 encoding PDI SP-Fl, El, RB,E2, F2, F, TMD/CT of H3/Bri;
- SEQ ID NO: 72 construct 737; a chimeric H5/H3 expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3' UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:72 encoding PDI SP-F'l, El, RB,E2, F'2, F, TMD/CT of H5/Indo;
- SEQ ID NO: 74 construct 739; an HA expression cassette comprising the
- CaMV 35S promoter CaMV 35S promoter, CPMV-HT 5' UTR, coding sequence of the signal peptide from PDI, hemagglutinin coding sequence of HA form B/Florida/4/06, CPMV-HT 3' UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:74 encoding PDI SP-F'l, El, RB,E2, F'2, F, TMD/CT of B/Flo;
- SEQ ID NO: 75 construct 734; a chimeric H5/B expression cassette comprising the CaMV 35S promoter, CPMV-HT 5' UTR, chimeric hemagglutinin coding sequence, CPMV-HT 3 ' UTR and NOS terminator sequences), and the underlined portion of SEQ ID NO:75 encoding PDI SP-F'l, El, RB,E2, F'2, F of B/Flo-TND/CT of H5/Indo.
- the present invention also includes a nucleotide sequence that hybridizes under stringent hybridisation conditions to the underlined portions of any one of SEQ ID NOs:63-65, 68, 69, and 71-75.
- the present invention also includes a nucleotide sequence that hybridizes under stringent hybridisation conditions to a complement of the underlined portions of any one of SEQ ID NOs:63-65, 68, 69, and 71-75.
- expression of the nucleotide sequence within a plant cell forms a chimeric VLP
- the chimeric VLP may be used to produce an antibody that is capable of binding HA, including mature HA, HAO, HAl, or HA2 of one or more influenza types or subtypes.
- the chimeric VLP when administered to a subject, induces an immune response.
- Hybridization under stringent hybridization conditions is known in the art (see for example Current Protocols in Molecular Biology, Ausubel et al., eds. 1995 and supplements; Maniatis et al., in Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982; Sambrook and Russell, in Molecular Cloning: A Laboratory
- An example of one such stringent hybridization conditions may be about 16-20 hours hybridization in 4 X SSC at 65°C, followed by washing in 0.1 X SSC at 65°C for an hour, or 2 washes in 0.1 X SSC at 65°C each for 20 or 30 minutes.
- an exemplary stringent hybridization condition could be overnight (16-20 hours) in 50% formamide, 4 X SSC at 42°C, followed by washing in 0.1 X SSC at 65°C for an hour, or 2 washes in 0.1 X SSC at 65°C each for 20 or 30 minutes, or overnight (16-20 hours), or hybridization in Church aqueous phosphate buffer (7% SDS; 0.5M NaPO 4 buffer pH 7.2; 10 mM EDTA) at 65°C, with 2 washes either at 50 0 C in 0.1 X SSC, 0.1% SDS for 20 or 30 minutes each, or 2 washes at 65°C in 2 X SSC, 0.1% SDS for 20 or 30 minutes each.
- the present invention includes nucleotide sequences that are characterized as having about 70, 75, 80, 85, 87, 90, 91, 92, 93 94 95, 96, 97, 98, 99, 100% or any amount therebetween, sequence identity, or sequence similarity, with the nucleotide sequence encoding chimeric HA according to the underlined portions of any one of SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ BD NO: 74, SEQ ID NO: 75, wherein the nucleotide sequence encodes a hemagglutinin protein that when expressed forms a chimeric VLP, and that the chimeric VLP induces the production of an antibody.
- expression of the nucleotide sequence within a plant cell forms a chimeric VLP, and the chimeric VLP may be used to produce an antibody that is capable of binding HA, including mature HA, HAO, HAl, or HA2.
- the VLP when administered to a subject, induces an immune response.
- An "immune response” generally refers to a response of the adaptive immune system.
- the adaptive immune system generally comprises a humoral response, and a cell- mediated response.
- the humoral response is the aspect of immunity that is mediated by secreted antibodies, produced in the cells of the B lymphocyte lineage (B cell).
- Secreted antibodies bind to antigens on the surfaces of invading microbes (such as viruses or bacteria), which flags them for destruction.
- Humoral immunity is used generally to refer to antibody production and the processes that accompany it, as well as the effector functions of antibodies, including Th2 cell activation and cytokine production, memory cell generation, opsonin promotion of phagocytosis, pathogen elimination and the like.
- modulate or “modulation” or the like refer to an increase or decrease in a particular response or parameter, as determined by any of several assays generally known or used, some of which are exemplified herein.
- a cell-mediated response is an immune response that does not involve antibodies but rather involves the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen.
- NK natural killer cells
- Cell-mediated immunity is used generally to refer to some Th cell activation, Tc cell activation and T-cell mediated responses.
- Cell mediated immunity is of particular importance in responding to viral infections.
- the induction of antigen specific CD8 positive T lymphocytes may be measured using an ELISPOT assay; stimulation of CD4 positive T-lymphocytes may be measured using a proliferation assay.
- Anti-influenza antibody titres may be quantified using an ELISA assay; isotypes of antigen-specific or cross reactive antibodies may also be measured using anti-isotype antibodies (e.g. anti -IgG, IgA, IgE or IgM). Methods and techniques for performing such assays are well-known in the art.
- a hemagglutination inhibition (HI, or HAI) assay may also be used to demonstrate the efficacy of antibodies induced by a vaccine, or vaccine composition comprising chimeric HA or chimeric VLP can inhibit the agglutination of red blood cells (RBC) by recombinant HA.
- Hemagglutination inhibitory antibody titers of serum samples may be evaluated by microtiter HAI (Aymard et al 1973). Erythrocytes from any of several species may be used - e.g. horse, turkey, chicken or the like. This assay gives indirect information on assembly of the HA trimer on the surface of VLP, confirming the proper presentation of antigenic sites on HAs.
- Cross-reactivity HAI titres may also be used to demonstrate the efficacy of an immune response to other strains of virus related to the vaccine subtype.
- serum from a subject immunized with a vaccine composition comprising a chimeric hemagglutinin comprising an HDC of a first influenza type or subtype may be used in an HAI assay with a second strain of whole virus or virus particles, and the HAI titer determined.
- HA capacity of HA to bind to RBC from different animals is driven by the affinity of HA for sialic acids bound with ⁇ 2,3 or ⁇ 2,6 linkages and the presence of these sialic acids on the surface of RBC.
- Equine and avian HA from influenza viruses agglutinate erythrocytes from all several species, including turkeys, chickens, ducks, guinea pigs, humans, sheep, horses and cows; whereas human HAs will bind to erythrocytes of turkey, chickens, ducks, guinea pigs, humans and sheep (Ito T. et al, 1997, Virology, 227:493-499; Medeiros R et al, 2001. Virology 289:74-85).
- Cytokine presence or levels may also be quantified.
- a T-helper cell response (Thl/Th2) will be characterized by the measurement of IFN- ⁇ and IL-4 secreting cells using by ELISA (e.g. BD Biosciences OptEIA kits).
- ELISA e.g. BD Biosciences OptEIA kits.
- Peripheral blood mononuclear cells (PBMC) or splenocytes obtained from a subject may be cultured, and the supernatant analyzed.
- T lymphocytes may also be quantified by fluorescence-activated cell sorting (FACS), using marker specific fluorescent labels and methods as are known in the art.
- FACS fluorescence-activated cell sorting
- a microneutralization assay may also be conducted to characterize an immune response in a subject, see for example the methods of Rowe et al., 1973.
- Virus neutralization titers may be obtained several ways, including: 1) enumeration of lysis plaques (plaque assay) following crystal violet fixation/coloration of cells; 2) microscopic observation of cell lysis in culture; 3) ELISA and spectrophotometric detection of NP virus protein (correlate with virus infection of host cells)
- Sequence identity or sequence similarity may be determined using a sequence comparison program, such as that provided within DNASIS (for example, using, but not limited to, the following parameters: GAP penalty 5, #of top diagonals 5, fixed GAP penalty 10, k-tuple 2, floating gap 10, and window size 5).
- sequence comparison program such as that provided within DNASIS (for example, using, but not limited to, the following parameters: GAP penalty 5, #of top diagonals 5, fixed GAP penalty 10, k-tuple 2, floating gap 10, and window size 5).
- GAP penalty 5 #of top diagonals 5
- fixed GAP penalty 10 k-tuple 2
- window size 5 floating gap
- Nucleic acid or amino acid sequences may be compared or aligned and consensus sequences may be determined using any of several software packages known in the art, for example MULTALIN (Corpet F., 1988, Nucl. Acids Res., 16 (22), 10881-10890), BLAST, CLUSTAL or the like; alternately sequences may be aligned manually and similarities and differences between the sequences determined.
- a fragment or portion of a protein, fusion protein or polypeptide includes a peptide or polypeptide comprising a subset of the amino acid complement of a particular protein or polypeptide, provided that the fragment can form a chimeric VLP when expressed.
- the fragment may, for example, comprise an antigenic region, a stress-response-inducing region, or a region comprising a functional domain of the protein or polypeptide.
- the fragment may also comprise a region or domain common to proteins of the same general family, or the fragment may include sufficient amino acid sequence to specifically identify the full-length protein from which it is derived.
- a fragment or portion may comprise from about 60% to about 100%, of the length of the full length of the protein, or any amount therebetween, provided that the fragment can form a chimeric VLP when expressed.
- a fragment or portion may be from about 150 to about 500 amino acids, or any amount therebetween, depending upon the chimeric HA, and provided that the fragment can form a chimeric VLP when expressed.
- a fragment may be from 150 to about 500 amino acids, or any amount therebetween, from about 200 to about 500 amino acids, or any amount therebetween, from about 250 to about 500 amino acids, or any amount therebetween, from about 300 to about 500 or any amount therebetween, from about 350 to about 500 amino acids, or any amount therebetween, from about 400 to about 500 or any amount therebetween, from about 450 to about 500 or any amount therebetween, depending upon the chimeric HA, and provided that the fragment can form a chimeric VLP when expressed.
- a chimeric HA protein For example, about 5, 10, 20, 30, 40 or 50 amino acids, or any amount therebetween may be removed from the C terminus, the N terminus or both the N and C terminus of a chimeric HA protein, provided that the fragment can form a chimeric VLP when expressed.
- the present invention describes, but is not limited to, expression of a nucleic acid encoding a chimeric HA in a plant portion of a plant, or a plant cell, and the production of chimeric influenza VLPs from the plant, suitable for vaccine production.
- nucleic acids examples include, for example, but are not limited to, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75.
- the present invention further provides expression of a nucleic acid encoding a chimeric HA, for example but not limited to SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75 in a plant, a portion of a plant, or a plant cell, and production of influenza vaccine candidates or reagents comprised of recombinant influenza structural proteins that self-assemble into functional and immunogenic homotypic macromolecular protein structures, including subviral influenza particles and chimeric influenza VLP, in transformed plant cells.
- the invention provides for chimeric VLPs, and a method for producing chimeric VLPs in a plant expression system, from the expression of a single chimeric envelope protein.
- the nucleic acid encoding the chimeric HA of influenza subtypes for example SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 75 maybe synthesized by reverse transcription and polymerase chain reaction (PCR) using HA RNA.
- PCR polymerase chain reaction
- the RNA may be isolated from Hl/NC, Hl/Bri, H3/Bri, B/Flo or H5/Indo, or from cells infected with these or other influenza virus types or subtypes.
- oligonucleotide primers specific for the HA RNA may be used.
- a nucleic acid encoding a chimeric HA may be chemically synthesized using methods as would be known to one of skill in the art.
- the present invention is further directed to a gene construct comprising a nucleic acid encoding a chimeric HA, as described above, operatively linked to a regulatory element that is operative in a plant.
- regulatory elements operative in a plant cell include but are not limited to a plastocyanin regulatory region (US 7,125,978; which is incorporated herein by reference), or a regulatory region of Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO; US 4,962,028; which is incorporated herein by reference), chlorophyll a/b binding protein (CAB; Leutwiler et al; 1986; which is incorporated herein by reference), ST-LSl (associated with the oxygen-evolving complex of photosystem II and described by Stockhaus et al.1987, 1989; which is incorporated herein by reference).
- a plastocyanin regulatory region US 7,125,978; which is incorporated herein by reference
- the gene constrcut of the present invention may also comprise a constitutive promoter that directs the expression of a gene that is operatively linked to the promoter throughout the various parts of a plant and continuously throughout plant development.
- a constitutive promoter is that associated with the CaMV 35S transcript (e.g. Odell et al., 1985, Nature, 313: 810-812, which is incorporated by reference).
- An example of a sequence comprising a plastocyanin regulatory region is the sequence 5' to the underlined sequenced encoding a PDI signal peptide of SEQ ID NO: 58.
- a regulatory element or regulatory region may enhance translation of a nucleotide sequence to which is it operatively linked, where the nucleotide sequence may encode a protein or polypeptide.
- Another example of a regulatory region is that derived from the untranslated regions of the Cowpea Mosaic Virus (CPMV), which maybe used to preferentially translate the nucleotide sequence to which it is operatively linked.
- CPMV Cowpea Mosaic Virus
- CPMV-HT hyper-translatable CMPV system
- an aspect of the invention provides for a nucleic acid comprising a regulatory region operatively linked to a sequence encoding a chimeric influenza HA.
- the regulatory region may be a plastocyanin regulatory element, and the chimeric influenza HA may comprise subdomains from H5/Indo, Hl/Bri, H3/Bri, Hl/NC, B/Flo influenza types, subtypes or strains.
- Nucleic acid sequences comprising a plastocyanin regulatory element and a chimeric influenza HA are exemplified herein by SEQ ID NOs: 63 and 64.
- Nucleic acid sequences comprising a 35S regulatory element and a chimeric influenza HA are exemplified herein by SEQ ID NOs: 68, 69 and 71-75.
- the invention provides for a nucleic acid comprising a CPMV regulatory region and a chimeric influenza HA, comprising subdomains from H5/Indo, Hl/Bri, H3/Bri, Hl/NC, B/Flo influenza types, subtypes or strains.
- Nucleic acid sequences comprising a CPMP regulatory element and a chimeric HA are exemplified herein by SEQ ID NOs: 66-69 and 71-75.
- Plant-produced chimeric influenza VLPs bud from the plasma membrane and the lipid composition of the chimeric VLPs reflects that of the plant cell or plant tissue type from which they are produced.
- the VLPs produced according to the present invention comprise chimeric HA of two or more than two types or subtypes of influenza, complexed with plant derived lipids. Plant lipids can stimulate specific immune cells and enhance the immune response induced.
- Plant lipids such as PC (phosphatidyl choline) and PE (phosphatidyl ethanolamine), as well as glycosphingolipids can bind to CDl molecules expressed by mammalian immune cells such as antigen-presenting cells (APCs) like dendritic cells and macrophages and other cells including B and T lymphocytes in the thymus and liver (reviewed in Tsuji M,. 2006 Cell MoI Life Sci 63: 1889-98).
- CDl molecules are structurally similar to major histocompatibility complex (MHC) molecules of class I and their role is to present glycolipid antigens to NKT cells (Natural Killer T cells).
- MHC major histocompatibility complex
- NKT cells Natural Killer T cells
- NKT cells Upon activation, NKT cells activate innate immune cells such as NK cells and dendritic cells and also activate adaptive immune cells like the antibody-producing B cells and T-cells.
- the phytosterols present in an influenza VLP complexed with a lipid bilayer, such as an plasma-membrane derived envelope may provide for an advantageous vaccine composition.
- plant-made VLPs including those comprising chimeric HA, complexed with a lipid bilayer, such as a plasma-membrane derived envelope, may induce a stronger immune reaction than VLPs made in other expression systems, and may be similar to the immune reaction induced by live or attenuated whole virus vaccines.
- the invention provides for a VLP comprising a chimeric HA, complexed with a plant-derived lipid bilayer.
- the plant- derived lipid bilayer may comprise the envelope of the VLP.
- the VLP produced within a plant may include a chimeric HA comprising plant-specific N-glycans. Therefore, this invention also provides for a VLP comprising a chimeric HA having plant specific N-glycans.
- chimeric HA having modified N-glycans may be produced.
- a chimeric HA comprising a modified glycosylation pattern, for example with reduced fucosylated, xylosylated, or both, fucosylated and xylosylated, N-glycans may be obtained, or chimeric HA having a modified glycosylation pattern may be obtained, wherein the protein lacks fucosylation, xylosylation, or both, and comprises increased galatosylation.
- modulation of post-translational modifications for example, the addition of terminal galactose may result in a reduction of fucosylation and xylosylation of the expressed chimeric HA when compared to a wild-type plant expressing chimeric HA.
- HA having a modified glycosylation pattern may be achieved by co-expressing the protein of interest along with a nucleotide sequence encoding beta-l,4galactosyltransferase (GaIT), for example, but not limited to mammalian GaIT, or human GaIT however GaIT from another sources may also be used.
- the catalytic domain of GaIT may also be fused to a CTS domain (i.e. the cytoplasmic tail, transmembrane domain, stem region) of N-acetylglucosaminyl transferase (GNTl), to produce a GNTl-GaIT hybrid enzyme, and the hybrid enzyme may be co-expressed with HA.
- the HA may also be co-expressed along with a nucleotide sequence encoding N-acetylglucosaminyltrasnferase III (GnT-III), for example but not limited to mammalian GnT-III or human GnT-III, GnT-III from other sources may also be used. Additionally, a GNTl-GnT-III hybrid enzyme, comprising the CTS of GNTl fused to GnT-III may also be used.
- GnT-III N-acetylglucosaminyltrasnferase III
- the present invention also includes VLP's comprising chimeric HA having modified N-glycans.
- the presence of plant N-glycans on a chimeric HA may stimulate the immune response by promoting the binding of HA by antigen presenting cells. Stimulation of the immune response using plant N glycan has been proposed by Saint- Jore-Dupas et al. (Trends Biotechnol 25: 317-23, 2007). Furthermore, the conformation of the VLP may be advantageous for the presentation of the antigen, and enhance the adjuvant effect of VLP when complexed with a plant derived lipid layer.
- regulatory region By “regulatory region”, “regulatory element” or “promoter” it is meant a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative association, or operatively linked, with a gene of interest, this may result in expression of the gene of interest.
- a regulatory element may be capable of mediating organ specificity, or controlling developmental or temporal gene activation.
- a “regulatory region” includes promoter elements, core promoter elements exhibiting a basal promoter activity, elements that are inducible in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers.
- regulatory region also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region. [00161]
- regulatory element or “regulatory region” typically refers to a sequence of DNA, usually, but not always, upstream (5') to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site.
- nucleotide sequences located within introns, or 3' of the sequence may also contribute to the regulation of expression of a coding region of interest.
- An example of a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element.
- eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence comprised of adenosine and thymidine nucleotide base pairs usually situated approximately 25 base pairs upstream of a transcriptional start site.
- a promoter element comprises a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as listed above) that modify gene expression.
- regulatory regions There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive.
- a regulatory region that is developmentally regulated, or controls the differential expression of a gene under its control is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue.
- some regulatory regions that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well.
- tissue- specific regulatory regions for example see-specific a regulatory region, include the napin promoter, and the cruciferin promoter (Rask et al., 1998, J. Plant Physiol.
- a leaf-specific promoter includes the plastocyanin promoter (see, for example SEQ ID NO: 58); US 7,125,978, which is incorporated herein by reference).
- An inducible regulatory region is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed.
- the protein factor that binds specifically to an inducible regulatory region to activate transcription may be present in an inactive form, which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent.
- the inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus.
- a plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods.
- Inducible regulatory elements may be derived from either plant or non-plant genes (e.g. Gatz, C. and Lenk, I.R.P., 1998, Trends Plant Sci. 3, 352-358; which is incorporated by reference).
- Examples, of potential inducible promoters include, but not limited to, tetracycline-inducible promoter (Gatz, C.,1997, Ann. Rev. Plant Physiol. Plant MoI. Biol. 48, 89-108; which is incorporated by reference), steroid inducible promoter (Aoyama, T.
- a constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development.
- constitutive regulatory elements include promoters associated with the CaMV 35S transcript. (Odell et al., 1985, Nature, 313: 810-812), the rice actin 1 (Zhang et al, 1991, Plant Cell, 3: 1155-1165), actin 2 (An et al., 1996, Plant J., 10: 107-121), or tms 2 (U.S. 5,428,147, which is incorporated herein by reference), and triosephosphate isomerase 1 (Xu et. al., 1994, Plant Physiol.
- genes the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant MoI. Biol. 29: 637-646), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995, Plant MoI. Biol. 29: 637-646), and the tobacco translational initiation factor 4A gene (Mandel et al, 1995 Plant MoI. Biol. 29: 995-1004).
- the term "constitutive" as used herein does not necessarily indicate that a gene under control of the constitutive regulatory region is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types even though variation in abundance is often observed.
- Constitutive regulatory elements may be coupled with other sequences to further enhance the transcription and/or translation of the nucleotide sequence to which they are operatively linked.
- the CPMV-HT system is derived from the untranslated regions of the Cowpea mosaic virus (CPMV) and demonstrates enhanced translation of the associated coding sequence.
- CPMV Cowpea mosaic virus
- nucleic acid or amino acid sequence is naturally occurring, or “wild type”.
- operatively linked it is meant that the particular sequences, for example a regulatory element and a coding region of interest, interact either directly or indirectly to carry out an intended function, such as mediation or modulation of gene expression.
- the interaction of operatively linked sequences may, for example, be mediated by proteins that interact with the operatively linked sequences.
- the one or more than one nucleotide sequence of the present invention may be expressed in any suitable plant host that is transformed by the nucleotide sequence, or constructs, or vectors of the present invention.
- suitable hosts include, but are not limited to, agricultural crops including alfalfa, canola, Brassica spp., maize, Nicotiana spp., alfalfa, potato, ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, cotton and the like.
- the one or more chimeric genetic constructs of the present invention can further comprise a 3' untranslated region.
- a 3' untranslated region refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3' end of the mRNA precursor.
- Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5' AATAAA-3' although variations are not uncommon.
- Non-limiting examples of suitable 3 ' regions are the 3 ' transcribed non- translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene, plant genes such as the soybean storage protein genes, the small subunit of the ribulose-1, 5-bisphosphate carboxylase gene (ssRUBISCO; US 4,962,028; which is incorporated herein by reference), the promoter used in regulating plastocyanin expression, described in US 7,125,978 (which is incorporated herein by reference).
- Ti Agrobacterium tumor inducing
- One or more of the chimeric genetic constructs of the present invention may also include further enhancers, either translation or transcription enhancers, as may be required.
- Enhancers may be located 5' or 3' to the sequence being transcribed. Enhancer regions are well known to persons skilled in the art, and may include an ATG initiation codon, adjacent sequences or the like. The initiation codon, if present, may be in phase with the reading frame ("in frame") of the coding sequence to provide for correct translation of the transcribed sequence.
- the constructs of this invention may be further manipulated to include plant selectable markers.
- Useful selectable markers include enzymes that provide for resistance to chemicals such as an antibiotic for example, gentamycin, hygromycin, kanamycin, or herbicides such as phosphinothrycin, glyphosate, chlorosulfuron, and the like.
- enzymes providing for production of a compound identifiable by colour change such as GUS (beta-glucuronidase), or luminescence, such as luciferase or GFP, may be used.
- transgenic plants also considered part of this invention.
- Methods of regenerating whole plants from plant cells are also known in the art.
- transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells.
- an appropriate medium which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells.
- shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants.
- the plants may then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques.
- Transgenic plants can also be generated without using tissue cultures.
- transgenic plants, trees, yeast, bacteria, fungi, insect and animal cells containing the chimeric gene construct comprising a nucleic acid encoding recombinant, chimeric HA or HAO for VLP production, in accordance with the present invention.
- the regulatory elements of the present invention may also be combined with coding region of interest for expression within a range of host organisms that are amenable to transformation, or transient expression.
- host organisms include, but are not limited to plants, both monocots and dicots, for example but not limited to corn, cereal plants, wheat, barley, oat, Nicotiana spp, Brassica spp, soybean, bean, pea, alfalfa, potato, tomato, ginseng, and Arabidopsis.
- transformation it is meant the interspecific transfer of genetic information
- nucleotide sequence that is manifested genotypically, phenotypically or both.
- the interspecific transfer of genetic information from a chimeric construct to a host may be heritable and the transfer of genetic information considered stable, or the transfer may be transient and the transfer of genetic information is not inheritable.
- plant matter any material derived from a plant.
- Plant matter may comprise an entire plant, tissue, cells, or any fraction thereof.
- plant matter may comprise intracellular plant components, extracellular plant components, liquid or solid extracts of plants, or a combination thereof.
- plant matter may comprise plants, plant cells, tissue, a liquid extract, or a combination thereof, from plant leaves, stems, fruit, roots or a combination thereof.
- Plant matter may comprise a plant or portion thereof which has not been subjected to any processing steps. A portion of a plant may comprise plant matter.
- the plant material may be subjected to minimal processing steps as defined below, or more rigorous processing, including partial or substantial protein purification using techniques commonly known within the art including, but not limited to chromatography, electrophoresis and the like.
- minimal processing it is meant plant matter, for example, a plant or portion thereof comprising a protein of interest which is partially purified to yield a plant extract, homogenate, fraction of plant homogenate or the like (i.e. minimally processed).
- Partial purification may comprise, but is not limited to disrupting plant cellular structures thereby creating a composition comprising soluble plant components, and insoluble plant components which may be separated for example, but not limited to, by centrifugation, filtration or a combination thereof, hi this regard, proteins secreted within the extracellular space of leaf or other tissues could be readily obtained using vacuum or centrifugal extraction, or tissues could be extracted under pressure by passage through rollers or grinding or the like to squeeze or liberate the protein free from within the extracellular space.
- Minimal processing could also involve preparation of crude extracts of soluble proteins, since these preparations would have negligible contamination from secondary plant products. Further, minimal processing may involve aqueous extraction of soluble protein from leaves, followed by precipitation with any suitable salt. Other methods may include large scale maceration and juice extraction in order to permit the direct use of the extract.
- the plant matter in the form of plant material or tissue may be orally delivered to a subject.
- the plant matter may be administered as part of a dietary supplement, along with other foods, or encapsulated.
- the plant matter or tissue may also be concentrated to improve or increase palatability, or provided along with other materials, ingredients, or pharmaceutical excipients, as required.
- Examples of a subject or target organism that the VLPs of the present invention may be administered to include, but are not limited to, humans, primates, birds, water fowl, migratory birds, quail, duck, geese, poultry, chicken, swine, sheep, equine, horse, camel, canine, dogs, feline, cats, tiger, leopard, civet, mink, stone marten, ferrets, house pets, livestock, rabbits, mice, rats, guinea pigs or other rodents, seal, whale and the like.
- target organisms are exemplary, and are not to be considered limiting to the applications and uses of the present invention.
- a plant comprising the chimeric HA according to some embodiments of the invention, or expressing the VLP comprising the chimeric HA according to some embodiments of the invention may be administered to a subject or target organism, in a variety of ways depending upon the need and the situation.
- the chimeric HA obtained from the plant may be extracted prior to its use in either a crude, partially purified, or purified form. If the chimeric HA is to be at least partially purified, then it may be produced in either edible or non-edible plants.
- the plant tissue may be harvested and directly feed to the subject, or the harvested tissue may be dried prior to feeding, or an animal may be permitted to graze on the plant with no prior harvest taking place. It is also considered within the scope of this invention for the harvested plant tissues to be provided as a food supplement within animal feed. If the plant tissue is being feed to an animal with little or not further processing it is preferred that the plant tissue being administered is edible.
- Post-transcriptional gene silencing may be involved in limiting expression of transgenes in plants, and co-expression of a suppressor of silencing from the potato virus Y (HcPro) maybe used to counteract the specific degradation of transgene mRNAs (Brigneti et al., 1998).
- Alternate suppressors of silencing are well known in the art and may be used as described herein (Chiba et al., 2006, Virology 346:7-14; which is incorporated herein by reference), for example but not limited to, TEV-pl/HC-Pro (Tobacco etch virus-pl/HC-Pro), BYV -p21, pl9 of Tomato bushy stunt virus (TBSV pl9), capsid protein of Tomato crinkle virus (TCV -CP), 2b of Cucumber mosaic virus; CMV-2b), p25 of TEV-pl/HC-Pro (Tobacco etch virus-pl/HC-Pro), BYV -p21, pl9 of Tomato bushy stunt virus (TBSV pl9), capsid protein of Tomato crinkle virus (TCV -CP), 2b of Cucumber mosaic virus; CMV-2b), p25 of TEV-pl/HC-Pro (Tobacco etch virus-pl/HC-Pro),
- Potato virus X (PVX-p25), pi 1 of Potato virus M (PVM-pl 1), pi 1 of Potato virus S (PVS- pi 1), pl6 of Blueberry scorch virus, (BScV -pi 6), p23 of Citrus tristeza virus (CTV-p23), p24 of Grapevine leafroll-associated virus-2, (GLRa V-2 p24), plO of Grapevine virus A, (GVA-p 10), p 14 of Grapevine virus B (GVB-pl4), plO of Heracleum latent virus (HLV-plO), or pi 6 of Garlic common latent virus (GCLV-pl6).
- a suppressor of silencing for example, but not limited to, HcPro, TEV -pl/HC-Pro, BYV- ⁇ 21, TBSV pl9, TCV-CP, CMV- 2b, PVX-p25, PVM-pl 1, PVS-pl 1, BScV-pl6, CTV-p23, GLRaV-2 p24, GBV-pl4, HLV- p 10, GCLV-pl6 or GVA-p 10, may be co-expressed along with the nucleic acid sequence encoding the protein of interest to further ensure high levels of protein production within a plant.
- VLPs produced as described herein do not comprise neuraminidase (NA).
- NA may be co-expressed with HA should VLPs comprising HA and NA be desired.
- the present invention further includes a suitable vector comprising the chimeric HA sequence suitable for use with either stable or transient expression systems.
- the genetic information may be also provided within one or more than one construct.
- a nucleotide sequence encoding a protein of interest may be introduced in one construct, and a second nucleotide sequence encoding a protein that modifies glycosylation of the protein of interest may be introduced using a separate construct. These nucleotide sequences may then be co-expressed within a plant.
- a construct comprising a nucleotide sequence encoding both the protein of interest and the protein that modifies glycosylation profile of the protein of interest may also be used.
- the nucleotide sequence would comprise a first sequence comprising a first nucleic acid sequence encoding the protein of interest operatively linked to a promoter or regulatory region, and a second sequence comprising a second nucleic acid sequence encoding the protein that modifies the glycosylation profile of the protein of interest, the second sequence operatively linked to a promoter or regulatory region.
- co-expressed it is meant that two, or more than two, nucleotide sequences are expressed at about the same time within the plant, and within the same tissue of the plant. However, the nucleotide sequences need not be expressed at exactly the same time. Rather, the two or more nucleotide sequences are expressed in a manner such that the encoded products have a chance to interact.
- the protein that modifies glycosylation of the protein of interest may be expressed either before or during the period when the protein of interest is expressed so that modification of the glycosylation of the protein of interest takes place.
- the two or more than two nucleotide sequences can be co-expressed using a transient expression system, where the two or more sequences are introduced within the plant at about the same time under conditions that both sequences are expressed.
- a platform plant comprising one of the nucleotide sequences, for example the sequence encoding the protein that modifies the glycosylation profile of the protein of interest, may be transformed, either transiently or in a stable manner, with an additional sequence encoding the protein of interest.
- sequence encoding the protein that modifies the glycosylation profile of the protein of interest may be expressed within a desired tissue, during a desired stage of development, or its expression may be induced using an inducible promoter, and the additional sequence encoding the protein of interest may be expressed under similar conditions and in the same tissue, to ensure that the nucleotide sequences are co-expressed.
- constructs of the present invention can be introduced into plant cells using
- Transient expression methods may be used to express the constructs of the present invention (see Liu and Lomonossoff, 2002, Journal of Virological Methods, 105:343- 348; which is incorporated herein by reference).
- a vacuum-based transient expression method as described by Kapila et al. 1997 Plant Science 122:101-108 (incorporated herein by reference) may be used.
- These methods may include, for example, but are not limited to, a method of Agro-inoculation or Agro-infiltration, however, other transient methods may also be used as noted above.
- a mixture of Agrobacteria comprising the desired nucleic acid enter the intercellular spaces of a tissue, for example the leaves, aerial portion of the plant (including stem, leaves and flower), other portion of the plant (stem, root, flower), or the whole plant.
- a tissue for example the leaves, aerial portion of the plant (including stem, leaves and flower), other portion of the plant (stem, root, flower), or the whole plant.
- the Agrobacterium After crossing the epidermis the Agrobacterium infect and transfer t-DNA copies into the cells.
- the t-DNA is episomally transcribed and the mRNA translated, leading to the production of the protein of interest in infected cells, however, the passage of t-DNA inside the nucleus is transient.
- the VLPs comprising chimeric HA provided by the present invention may be used in conjunction with an existing influenza vaccine, to supplement the vaccine, render it more efficacious, or to reduce the administration dosages necessary.
- the vaccine may be directed against one or more than one influenza virus.
- suitable vaccines include, but are not limited to, those commercially available from Sanofi-Pasteur, ID Biomedical, Merial, Sinovac, Chiron, Roche, Medlmmune, GlaxoSmithKline, Novartis, Sanofi-Aventis, Serono, Shire Pharmaceuticals and the like.
- the VLPs of the present invention may be admixed with a suitable adjuvant as would be known to one of skill in the art.
- the VLP may be used in a vaccine composition comprising an effective dose of the VLP for the treatment of a target organism, as defined above.
- the VLP produced according to the present invention may be combined with VLPs obtained using different influenza proteins, for example, neuraminidase (NA).
- NA neuraminidase
- the present invention provides a method for inducing immunity to influenza virus infection in an animal or target organism comprising administering an effective dose of a vaccine comprising one or more than one VLP.
- the vaccine may be administered orally, intradermally, intranasally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.
- compositions according to various embodiments of the invention may comprise VLPs of two or more influenza strains or subtypes.
- "Two or more” refers to two, three, four, five, six, seven, eight, nine, 10 or more strains or subtypes.
- the strains or subtypes represented may be of a single subtype (e.g. all HlNl, or all H5N1), or may be a combination of subtypes.
- Exemplary subtype and strains include H5/Indo, Hl/Bri, Hl/NC, H3/Bri, B/ Flo .
- the choice of combination of strains and subtypes may depend on the geographical area of the subjects likely to be exposed to influenza, proximity of animal species to a human population to be immunized (e.g. species of waterfowl, agricultural animals such as swine, etc) and the strains they carry, are exposed to or are likely to be exposed to, predictions of antigenic drift within subtypes or strains, or combinations of these factors. Examples of combinations used in past years are available in the databases maintained by the World Health Organization (WHO) (see URL: who.int/csr/dieease/influenza/vaccine recommendations 1 /en).
- WHO World Health Organization
- the two or more VLPs may be expressed individually, and the purified or semi-purified VLPs subsequently combined. Alternately, the VLPs may be co-expressed in the same host, for example a plant, protion of plant, or plant cell. The VLPs may be combined or produced in a desired ratio, for example about equivalent ratios, or may be combined in such a manner that one subtype or strain comprises the majority of the VLPs in the composition. [00193] Therefore, the invention provides for compositions comprising VLPs of two or more strains or subtypes.
- an article of manufacture comprising packaging material and a composition comprising a VLP comprising a chimeric HA.
- the composition includes a physiologically or pharmaceutically acceptable excipient, and the packaging material may include a label which indicates the active ingredients of the composition (e.g. the VLP).
- kits comprising a composition comprising a nucleic acid encoding a chimeric
- kits may be useful for production of VLPs comprising the chimeric HA, and the instructions may include, for example, information on expressing the nucleic acid in a plant or a plant cell, instructions for harvesting and obtaining the VLPs from the plant or plant tissue.
- kits for the preparation of a medicament comprising a
- VLP comprising a chimeric HA, along with instructions for its use
- the instructions may comprise a series of steps for the preparation of the medicament, the medicament being useful for inducing a therapeutic or prophylactic immune response in a subject to whom it is administered.
- the kit may further comprise instructions addressing dose concentrations, dose intervals, preferred administration methods or the like.
- Table 1 presents oligonucleotide primers used for expression cassettes assembly.
- the first cloning step consisted in assembling a receptor plasmid containing upstream and downstream regulatory elements of the alfalfa plastocyanin gene.
- the plastocyanin promoter and 5'UTR sequences were amplified from alfalfa genomic DNA using oligonucleotide primers Xmal-pPlas.c (SEQ K) NO:1) and SacI-ATG-pPlas.r (SEQ ID NO:2).
- the resulting amplification product was digested with Xmal and Sad and ligated into pCAMBIA2300 (Cambia, Canberra, Australia), previously digested with the same enzymes, to create pCAMBIApromoPlasto.
- the 3'UTR sequences and terminator of the plastocyanin gene was amplified from alfalfa genomic DNA using the following primers: SacI-PlasTer.c (SEQ ID NO: 3) and EcoRI-PlasTer.r (SEQ ID NO:4), and the product was digested with Sad and EcoRI before being inserted into the same sites of pCAMBIApromoPlasto to create pCAMBIAPlasto.
- H5N 1 A fragment encoding hemagglutinin from influenza strain A/Indonesia/5/05 (H5N 1 ; Ace. No. LANL ISDN125873) was synthesized by Epoch Biolabs (Sugar Land, TX, USA).
- the H5 coding region was cloned into a plastocyanin-based expression cassette by the PCR-based ligation method presented in Darveau et al. (1995).
- a first PCR amplification was obtained using primers Plasto-443c (SEQ ID NO:5;) and SpHA(Ind)- Plasto.r (SEQ ID NO:6) and pCAMBIApronioPlasto as template.
- a second amplification was performed with primers Plasto-SpHA (SEQ ID NO: 7) and HA(Ind)-Sac.r (SEQ ID NO:8) with H5 coding fragment (SEQ ID NO:52; Figure 17) as template.
- the amplification obtained from both reactions were mixed together and the mixture served as template for a third reaction (assembling reaction) using Plasto-443c (SEQ ID NO.5) and HA(Ind)-Sac.r (SEQ ID NO:8) as primers.
- the resulting fragment was digested with BamHI (in the plastocyanin promoter) and Sad (at the 3 'end of the fragment) and cloned into pCAMBIAPlasto previously digested with the same enzymes.
- the resulting plasmid, named 660 is presented in Figure 18 (SEQ ID NO:53).
- HlNl Caledonia/20/99
- PDISP including a BgIII restriction site
- Sacl/Stul site was added immediately downstream of the stop codon at the 3' terminal end of the fragment, to yield SEQ ID NO: 55 ( Figure 20).
- a second fragment encoding the C-terminal end of the Hl protein (comprising a transmembrane domain and cytoplasmic tail) from the Kpnl site to the stop codon, and flanked in 3' by Sad and Stul restriction sites was also synthesized (SEQ ID NO. 56; Figure 21).
- the first Hl fragment was digested with BgIII and Sad and cloned into the same sites of a binary vector (pCAMBIAPlasto) containing the plastocyanin promoter and 5' UTR fused to the signal peptide of alfalfa protein disulfide isomerase (PDI) gene (nucleotides 32-103; Accession No. Zl 1499; SEQ ID NO: 57; Figure 22) resulting in a PDI-Hl chimeric gene downstream of the plastocyanin regulatory elements.
- PDI alfalfa protein disulfide isomerase
- the sequence of the plastocyanin- based cassette, containing the promoter and PDI signal peptide up to the BgIII restriction site and the plastocyanin terminator downstream of a Sad site, is presented in SEQ ID NO. 58 ( Figure 23).
- the addition of the C-terminal end of the Hl coding region (encoding the transmembrane domain and the cytoplasmic tail) was obtained by inserting the synthesized fragment (SEQ ID NO. 56; Figure 21) previously digested with Kpnl and Sacl, into the Hl expression plasmid.
- the resulting construct, named 540 is presented in SEQ ID NO. 59 ( Figure 24).
- Expression cassette number 774 driving the expression of Hl from
- A/Brisbane/59/07 was assembled as follows.
- a synthetic fragment was synthesized comprising the complete hemagglutinin coding sequence (from ATG to stop) flanked in 3' by alfalfa plastocyanin gene sequences corresponding to the first 84 nucleotides upstream of the plastocyanin ATG starting with a DraIII restriction site.
- the synthetic fragments also comprised a Sacl site immediately downstream of the stop codon.
- the synthetic fragment was synthesized by Top Gene Technologies (Montreal, QC, Canada). The fragment synthesized is presented in SEQ ID NO. 60 ( Figure 25). For the assembly of the complete expression cassette, the synthetic fragment was digested with DraIII and Sacl and cloned into pCAMBIAPlasto previously digested with the same enzymes to give construct 774 (SEQ ID NO. 61; Figure 26).
- CPMV-Hr expression cassettes use the 35S promoter to control the expression of an mRNA comprising a coding sequence of interest flanked, in 5', by nucleotides 1-512 from the Cowpea mosaic virus (CPMV) RNA2 with mutated ATG at positions 115 and 161, and in 3', by nucleotides 3330-3481 from the CPMV RNA2 (corresponding to the 3' UTR) followed by the NOS terminator.
- Plasmid pBD-C5-lLC (Sainsbury et al. 2008; Plant Biotechnology Journal 6: 82-92 and PCT Publication WO 2007/135480), was used for the assembly of CPMV-Hr-based hemagglutinin expression cassettes.
- the mutation of ATGs at position 115 and 161 of the CPMV RNA2 was done using a PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). Two separate PCRs were performed using pBD-C5-lLC as template.
- the primers for the first amplification were pBinPlus.2613c (SEQ ID NO: 9) and Mut-ATG115.r (SEQ ID NO: 10).
- the primers for the second amplification were Mut-ATG161.c (SEQ ID NO: 11) and LC-C5-1.11Or (SEQ ID NO: 12).
- the two fragments obtained were mixed and used as template for a third amplification using pBinPlus.2613c (SEQ ID NO: 9) and LC-C5-1.11Or (SEQ ID NO: 12) as primers.
- the resulting fragment was digested with Pad and Apal and cloned into pBD-C5-lLC digested with the same enzymes.
- the construct generated, named 828, is presented in Figure 27 (SEQ ID NO: 62).
- a chimeric HA was made by replacing the RB domain in the H5
- a second fragment comprising the Hl A/Brisbane/59/07 RB domain coding sequence, was amplified with primers El H5N-E1 HlB.c (SEQ ID NO: 14) and E2 H5I-RB HlB.r (SEQ ID NO: 15) using construct number 774 (SEQ ID NO:61; Figure 26) as template.
- a third fragment comprising E2, F'2, F, transmembrane and cytoplasmic domains from H5 A/Indonesia/5/05 was amplified using primers RB H1B-E2 H5I.c (SEQ ID NO: 16) and HA(Ind)-SacI.r (SEQ ID NO:8) with construct number 660 (SEQ ID NO: 53; Figure 18) as template.
- Amplification products were then mixed and used as template for a second round of amplification (assembling reaction) with primers Plasto-443c (SEQ ID NO:5) and HA(Ind)- Sacl.r (SEQ ID NO:8).
- construct number 660 SEQ ID NO: 53; Figure 18
- construct number 690 SEQ ID NO: 63
- the construct is presented in Figure 28.
- a chimeric HA was assembled by replacing the E 1-RB-E2 domains in H5
- the second fragment containing the Hl A/Brisbane/59/07 E1-RB-E2 domains coding sequence, was amplified with primers F'l H5N-E1 HlB.c (SEQ ID NO: 18) and F'2 H5I-E2 HIB.r (SEQ ID NO: 19) using construct number 774 (SEQ ID NO:61; Figure 26) as template.
- F'2, F, transmembrane and cytoplasmic domains from H5 A/Indonesia/5/05 were amplified using primers E2 H1B-F'2 H5I.c (SEQ ID NO: 20) and HA(Ind)-SacI.r (SEQ ID NO: 8) with construct number 660 (SEQ ID NO: 53; Figure 18) as template.
- Amplification products were then mixed and used as template for a second round of amplification (assembling reaction) with primers Plasto-443c (SEQ ID NO:5) and HA(Ind)-SacI.r (SEQ ID NO: 8).
- construct number 660 SEQ ID NO: 53; Figure 18
- construct number 691 SEQ ID NO: 64
- a chimeric HA was made by replacing the RB domain in the Hl A/New Caledonia/20/99 with that of H5 A/Indonesia/5/05 using the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)).
- PDISP signal peptide of alfalfa protein disulfide isomerase
- a second fragment comprising the H5 A/Indonesia/5/05 RB domain coding sequence, was amplified with primers El HlNC-El H5I.c (SEQ ID NO: 22) and E2 HlNC-RB H5I.r (SEQ ID NO: 23) using construct number 660 (SEQ ID NO: 53; Figure 18) as template.
- Athird fragment comprising E2, F'2, F, transmembrane and cytoplasmic domains from Hl A/New Caledonia/20/99 was amplified using primers RB H5I-E2 HlNCc (SEQ ID NO: 24) and HA-SacI.r (SEQ ID NO: 25) with construct number 540 (SEQ ID NO: 59; Figure 24) as template.
- Amplification products were then mixed and used as template for a second round of amplification (assembling reaction) with primers Plasto-443c (SEQ ID NO: 5) and HA-SacI.r (SEQ ID NO: 25).
- construct number 540 SEQ ID NO: 59; Figure 24
- construct number 696 SEQ ID NO: 65
- CPMV-Hr as follows. Restriction sites Apal (immediately upstream of ATG) and Stul (immediately downstream of the stop codon) were added to the hemagglutinin coding sequence by performing a PCR amplification with primers Apal- ⁇ lB.c (SEQ ID NO: 26) and StuI- ⁇ lB.r (SEQ ID NO: 27) using construct number 774 (SEQ ID NO: 61; Figure 26) as template. The resulting fragment was digested with Apal and Stul restriction enzymes and cloned into construct number 828 (SEQ ID NO: 62; Figure27) digested with the same enzymes. Resulting cassette was named construct number 732 (SEQ ID NO: 66; Figure 31). J- Assembly of SpPDI-Hl A/Brisbane/59/2007 in CPMV-HJ expression cassette (construct number 733).
- Hl coding sequence was amplified with primers SpPDI-HlB.c (SEQ ID NO: 28) and SacI-HIB.r (SEQ ID NO: 29) using construct 774 (SEQ ID NO: 61; Figure 26) as template.
- the resulting fragment consisted in the Hl coding sequence flanked, in 5', by the last nucleotides encoding PDISP (including a BgIII restriction site) and, in 3 ', by a Sad restriction site.
- the fragment was digested with BgIII and Sad and cloned into construct number 540 (SEQ ID NO: 59; Figure 24) previously digested with the same restriction enzymes.
- construct number 787 SEQ ID NO: 67
- Restriction sites Apal (immediately upstream ATG) and Stul (immediately downstream stop codon) were added to the hemagglutinin coding sequence by performing a PCR amplification with primers Apal- SpPDLc (SEQ ID NO: 30) and StuI-HlB.r (SEQ ID NO: 27) using construct number 787 (SEQ ID NO: 67; Figure 32) as template.
- Resulting fragment was digested with Apal and Stul restriction enzymes and cloned into construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes.
- Resulting cassette was named construct number 733 (SEQ ID NO: 68; Figure 33).
- A/Brisbane/59/07 in H5 A/Indonesia/5/05 backbone was cloned into CPMV-HT as follows. Restriction sites Apal (immediately upstream of ATG) and Stul (immediately downstream of the stop codon) were added to the chimeric hemagglutinin coding sequence by performing a PCR amplification with primers Apal-H5 (A-Indo).lc (SEQ ID NO: 31) and H5 (A-Indo)- StuI.1707r (SEQ ID NO: 32) using construct number 690 (SEQ ID NO: 63; Figure 28) as template.
- Resulting fragment was digested with Apal and Stul restriction enzymes and cloned into construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes.
- Resulting cassette was named construct number 734 (SEQ ID NO: 69; Figure 34).
- A/Brisbane/10/2007 was cloned into CPMV-HT as follows.
- a synthetic fragment was synthesized comprising the complete hemagglutinin coding sequence (from ATG to stop) flanked in 3' by alfalfa plastocyanin gene sequence corresponding to the first 84 nucleotides (starting with a DraIII restriction site) upstream of the plastocyanin ATG.
- the synthetic fragment also comprised a Sad site immediately after the stop codon.
- Synthetic fragment was synthesized by Top Gene Technologies (Montreal, QC, Canada). The fragment synthesized is presented in SEQ ID NO: 70 ( Figure 35) and was used as template for further PCR-based ligation.
- PDISP signal peptide was amplified using primers Apal-SpPDLc (SEQ ID NO: 30) and H3B-SpPDI.r (SEQ ID NO: 33) with construct number 540 (SEQ ID NO: 59; Figure 24) as template.
- another fragment containing a portion of the coding sequence of H3 A/Brisbane/10/2007 was amplified with primers SpPDI- H3B.c (SEQ ID NO: 34) and StuI-H3B.r (SEQ ID NO: 35) using previously synthesized fragment (SEQ ID NO. 70; Figure 35) as template.
- Amplification products were then mixed and used as template for a second round of amplification (assembling reaction) with primers Apal-SpPDI.c (SEQ ID NO: 30) and StuI-H3B.r (SEQ ID NO: 35).
- the resulting fragment was digested with Apal and Stul restriction enzymes and cloned into construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes.
- Resulting cassette was named construct number 736 (SEQ ID NO: 71; Figure 36).
- A/Brisbane/ 10/2007 and to the transmembrane and cytoplasmic domains of H5 A/Indonesia/5/2005 was cloned into CPMV-HT as follows.
- PDISP-H3 coding sequence was fused to the H5 transmembrane domain by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85(1995)).
- a fragment comprising PDISP signal peptide and ectodomain from H3 Brisbane was generated by amplification (with Apal restriction site upstream of the PDISP initial ATG) using primers ApaI-SpPDI.c (SEQ ID NO: 30) and TmD H5I-H3B.r (SEQ ID NO: 36) with construct number 736 (SEQ ID NO: 71; Figure 36) as template.
- construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes.
- Resulting cassette was named construct number 737 (SEQ ID NO: 72; Figure 37).
- B/Florida/4/2006 was cloned into CPMV-HT as follows.
- a synthetic fragment was synthesized comprising the complete hemagglutinin coding sequence (from ATG to stop) flanked in 3' by alfalfa plastocyanin gene sequence corresponding to the first 84 nucleotides (starting with a Drain restriction site) upstream of the plastocyanin ATG.
- the synthetic fragment also comprised a Sad restriction site immediately after the stop codon.
- the synthetic fragment was synthesized by Epoch Biolabs (Sugar Land, Texas, USA). The fragment synthesized is presented in SEQ ID NO: 73 ( Figure 38) and was used as template for further PCR-based ligation.
- PDISP signal peptide was amplified using primers Apal-SpPDI.c (SEQ ID NO: 30) and HBF-SpPDLr (SEQ ID NO: 38) with construct number 540 (SEQ ID NO: 59; Figure 24) as template.
- another fragment containing a portion of the coding sequence of HA from B/Florida/4/2006 was amplified with primers SpPDI- HBF.c (SEQ ID NO: 39) and StuI-HBF.r (SEQ ID NO: 40) using previously synthesized fragment (SEQ ID NO. 73; Figure 38) as template.
- Amplification products were then mixed and used as template for a second round of amplification (assembling reaction) with primers Apal-SpPDLc (SEQ ID NO: 30) and StuI-HBF.r (SEQ ID NO: 40).
- the resulting fragment was digested with Apal and Stul restriction enzymes and cloned into construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes.
- Resulting cassette was named construct number 739 (SEQ ID NO: 74; Figure 39).
- HA B/Florida/4/2006 and to the transmembrane and cytoplasmic domains of H5 A/Indonesia/5/2005 was cloned into CPMV-Hr as follows.
- PDISP-B/Florida/4/2006 ectodomain coding sequence was fused to the H5 transmembrane and cytoplasmic domains by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77- 85(1995)).
- a fragment comprising PDISP signal peptide fused to the ectodomain from HA B/Florida/4/2006 was generated by amplification using primers Apal- SpPDLc (SEQ ID NO: 30) and TmD H5I-B Flo.r (SEQ ID NO: 41) with construct number 739 (SEQ ID NO: 74; Figure 39) as template.
- Apal- SpPDLc SEQ ID NO: 30
- TmD H5I-B Flo.r SEQ ID NO: 41
- construct number 739 SEQ ID NO: 74; Figure 39
- another fragment containing H5 Indonesia transmembrane and cytoplasmic domains was amplified with primers B FIo-TmD H5I.c (SEQ ID NO: 42) and H5 (A-Indo)-StuI.1707r (SEQ ID NO: 32) using construct number 660 (SEQ ID NO.
- Amplification products were then mixed and used as template for a second round of amplification (assembling reaction) with primers Apal-SpPDI.c (SEQ ID NO: 30) and H5 (A-Indo)-StuI.1707r (SEQ ID NO: 32).
- the resulting fragment was digested with Apal and Stul restriction enzymes and cloned into construct number 828 (SEQ ID NO: 62; Figure 27) digested with the same enzymes.
- Resulting cassette was named construct number 745 (SEQ ID NO: 75; Figure 40).
- Apal-M prot.r (SEQ ID NO:92) TCTCCATGGGCCCGACAAATTTGGGCAGAATATACAGAAGCTTA
- construct 745 (SEQ ID NO 75; Figure 40) as template.
- the two fragments obtained were then mixed and used as template for a second round of PCR (assembling reaction) with PacI-MCS-2X35S.c (SEQ ID NO:89 and Apal-M prot.r (SEQ ID NO:92) as primers.
- Resulting fragment was the digested with Pad and Apal and cloned into construct 745 (SEQ ID NO 75; Figure 40) digested with the same restriction enzymes.
- construct 747 (SEQ ID NO:93), is presented in Figure 5OB.
- Hsp heat shock protein
- Plasmid pNir3K51 (previously described in US Patent No. 6,420,548) was digested with HindIII and EcoRI. The resulting fragment was cloned into pCAMBIA2300 (Cambia, Canberra, Australia) digested by the same restriction enzyme to give pCAMBIA-Nir3K51.
- Coding sequences for Hsp70 and Hsp40 were cloned separately in the acceptor plasmid pCAMBIANir3K51 by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26:77-85 (1995)).
- Msj 1 coding sequence (SEQ ID NO: 76; Figure 41) was amplified by RT-PCR from alfalfa (ecotype Rangelander) leaf total RNA using primers Hsp40Luz.lc (SEQ ID NO: 43) and Hsp40Luz-SacI.1272r (SEQ ID NO: 44). A second amplification was performed with primers Plasto-443c (SEQ ID NO: 5) and Hsp40Luz-Plasto.r (SEQ ID NO: 45) with construct 660 (SEQ ID NO: 53; Figure 18) as template.
- PCR products were then mixed and used as template for a third amplification (assembling reaction) with primers Plasto-443c (SEQ ID NO: 5) and Hsp40Luz-SacI.1272r (SEQ ID NO: 44).
- the resulting fragment was digested with Hpal (in the plastocyanin promoter) and cloned into pCAMBIANir3K51, previously digested with Hpal (in the Nir promoter) and Sad, and filed with T4 DNA polymerase to generate blunt ends. Clones obtained were screened for correct orientation and sequenced for sequence integrity.
- the resulting plasmid, named R850 is presented in Figure 42 (SEQ ID NO: 77).
- the coding region of the Athsp70-l was amplified by RT-PCR from Arabidopsis leaf RNA using primers Hsp70Ara.lc (SEQ ID NO: 46) and Hsp70Ara-SacI.1956r (SEQ ID NO: 47). A second amplification was performed with primers Plato-443c (SEQ ID NO: 5) and Hsp70Ara-Plasto.r (SEQ ID NO: 48) with construct 660
- a dual Hsp expression plasmid was assembled as follows. R860 (SEQ ID NO:
- construct number 660 SEQ ID NO: 53; Figure 18
- Plasmid R472 is presented in Figure 45.
- Construct number 443 corresponds to pCAMBIA2300 (empty vetor).
- Table2 Agrobacterium strains used for expression of influenza hemagglutinins with native or PDI signal peptides
- Nicotiana benthamiana plants were grown from seeds in flats filled with a commercial peat moss substrate. The plants were allowed to grow in the greenhouse under a 16/8 photoperiod and a temperature regime of 25 0 C day/20°C night. Three weeks after seeding, individual plantlets were picked out, transplanted in pots and left to grow in the greenhouse for three additional weeks under the same environmental conditions. Prior to transformation, apical and axillary buds were removed at various times as indicated below, either by pinching the buds from the plant, or by chemically treating the plant
- Agrobacteria transfected with each construct were grown in a YEB medium supplemented with 10 mM 2-[N-morpholino]ethanesulfonic acid (MES), 20 ⁇ M acetosyringone, 50 ⁇ g/ml kanamycin and 25 ⁇ g/ml of carbenicillin pH5.6 until they reached an ODgoo between 0.6 and 1.6.
- Agrobacterium suspensions were centrifuged before use and resuspended in infiltration medium (10 mM MgCl 2 and 10 mM MES pH 5.6). Syringe- infiltration was performed as described by Liu and Lomonossoff (2002, Journal of Virological Methods, 105:343-348).
- A. tumefaciens suspensions were centrifuged, resuspended in the infiltration medium and stored overnight at 4°C. On the day of infiltration, culture batches were diluted in 2.5 culture volumes and allowed to warm before use.
- Leaf sampling and total protein extraction [00229] Following incubation, the aerial part of plants was harvested, frozen at -80 0 C, crushed into pieces. Total soluble proteins were extracted by homogenizing (Polytron) each sample of frozen-crushed plant material in 3 volumes of cold 50 mM Tris pH 8, 0.15 M NaCl, 0.04% sodium metabisulfite and 1 mM phenylmethanesulfonyl fluoride. After homogenization, the slurries were centrifuged at 20,000 g for 20 min at 4°C and these clarified crude extracts (supernatant) kept for analyses. The total protein content of clarified crude extracts was determined by the Bradford assay (Bio-Rad, Hercules, CA) using bovine serum albumin as the reference standard.
- Biochemicals, Rockport IL Proteins were separated by SDS-PAGE under reducing conditions and stained with Coomassie Blue. Stained gels were scanned and densitometry analysis performed using ImageJ Software (NIH).
- Proteins from elution fraction from SEC were precipitated with acetone (Bollag et al., 1996), resuspended in 1/5 volume in equilibration/elution buffer and separated by SDS-PAGE under reducing conditions and electrotransferred onto polyvinylene difluoride (PVDF) membranes (Roche Diagnostics Corporation, Indianapolis, IN) for immunodetection. Prior to immunoblotting, the membranes were blocked with 5% skim milk and 0.1% Tween- 20 in Tris-buffered saline (TBS-T) for 16-18h at 4°C.
- PVDF polyvinylene difluoride
- Table 3 Electrophoresis conditions, antibodies, and dilutions for immunoblotting of expressed proteins.
- FII Fitzgerald Industries International, Concord, MA, USA
- NIBSC National Institute for Biological Standards and Control
- JIR Jackson ImmunoResearch, West Grove, PA, USA
- ITC Immune Technology Corporation, Woodside, NY, USA;
- extracts to be loaded on size exclusion chromatography crude protein extracts were clarified and concentrated using the following method. Extracts were centrifuged at 70 000 g, 4 0 C for 20 min and the pellet was washed twice by resuspension in 1 volume (compared to the initial extract volume) of extraction buffer (50 mM Tris pH 8, 0.15 M NaCl) and centrifugation at 70 000 g, 4° C for 20 min. The resulting pellet was resuspended in 1/3 volume (compared to the initial extract volume) and proteins (including VLPs) were precipitated by the addition of 20% (w/v) PEG 3350 followed by incubation on ice for Ih.
- extraction buffer 50 mM Tris pH 8, 0.15 M NaCl
- Precipitated proteins were recovered by centrifugation at 10 000 g, 4°C, 20 min, and resuspended in 1/15 volume (compared to the initial extract volume) of extraction buffer. After complete resuspension of proteins, a final centrifugation at 20 000 g, 4°C, 5 min was performed to pellet insolubles and the clear supernatant was recovered.
- Blue Dextran 2000 GE Healthcare Bio-Science Corp., Piscataway, NJ, USA
- Example 1 Domain swapping strategy for RB and/or Esterase domains on influenza subtype stems.
- the RB subdomain of H5/Indo may be replaced by an RB subdomain of Hl , H3 or B HA.
- the resulting chimeric HA provides an SDC H5/Indo to form VLPs and present the RB subdomain comprising immunogenic sites of Hl, H3 or B.
- the H5/Indo RB subdomain may be inserted on an Hl stem (Hl/NC) .
- Figures 15A and 15B illustrate the amino acid sequences at the fusions of the indicated subdomains, and the amino acid sequences of the respective subdomains is provide in Figure 2 (constructs 690, 734, 696 and 691) and Tables 4 (contracts 900 and 745) and 5 (constructs 910, 920 and 930). Amino acid sequences illustrated in Figure 2, and Tables 4 and 5 do not include signal peptide sequences.
- Amino acids 1-92 of SEQ ID NO: 105 are an F'l+El domain of H5/Indo; amino acids 93-259 are the RB head domain of H3/Brisbane; amino acids 260-548 are the E2+F'2 domain of H5/Indo.
- Amino acids 1-92 of SEQ ID NO: 106 are an F' 1+El domain of H5/mdo; amino acids 93-276 are the RB head domain of B/Florida; amino acids 277-565 are the E2+F'2 domain of H5/Indo.
- Amino acids 1-42 of SEQ ID NO: 107 are an N terminal F'l domain of
- amino acids 43-228 are the E1-RB-E2 head domain of H3/Brisbane; amino acids 229-507 are the F'2 domain of H5/Indo.
- Amino acids 1-42 of SEQ ID NO: 108 are an N terminal F'l domain of H5/Indo; amino acids 43-281 are the E1-RB-E2 head domain of B/Florida; amino acids 282- 556 are the F'2 domain of H5/Indo.
- Amino acids 1-42 of SEQ ID NO: 109 are an N terminal F'l domain of
- a junction at this Cys may provide for suitable, or superior, stability to the chimeric HA relative to the native sequence.
- the C-terminus end of the RB provides conserved features: for example, a conserved Ser residue at position -1 and the E2 subdomain starts with a beta-sheet observed in all HA on the alignment (Ha et al. 2002, EMBO J. 21 :865-875; which is incorporated herein by refernce). Therefore, the C-terminus of this RB may be fused to the initiating amino acid of this beta sheet structure of the E2 subdomain.
- disulfide bridge pattern is not changed, or is not substantively changed, for the chimeras comprising RB subdomains of Hl/NC, HlBri, H3/Bri, or B/Flo on an H5/Indo SDC, and for H5/Indo RB subdomain on Hl SDC (total of 6), but a disulfide bridge will be added (bridge #8) on the hybrid HA of B RB on H5 stem. This addition of disulfide bridge should not interfere with the folding of the HA (because it is located within the RB domain and the Cys are adjacent on the sequence), and may be produce a even more stable hybrid HA.
- E2 subdomains of a second influenza type Such an arrangement may present a greater number of amino acids of the second type at the surface of the H5-VLP.
- the HDC of Hl, H3 or B was placed on an H5/Indo SDC, and an HDC of H5/Indo on an Hl/NC SDC (Table 5).
- disulfide bridge #6 of HA type A and #7 in HA type B.
- the junction of the HDC at the C-terminus of the E2 subdomain was defined with another conserved cysteine residue comprising disulfide bridge #6 (the second amino acid of the F '2 subdomain) of influenza type Hl or H3 on an SDC of H5/Indo or for influenza type H5 on an SDC of Hl.
- the junction was established the connection at the first Cysteine comprising of disulfide bridge #4 (located 4 amino acids away on the F '2 subdomain, and conserved among the HAs).
- the resulting chimeras do not exhibit any alteration in disulfide bridge patterns - the H1/H3/H5 hybrid HAs will contain 6 disulfde bridges and the B hybrid will have 7 of them.
- Example 2 Replacement of receptor binding (RB) or receptor binding and esterase (E1-RB-E2) subdomains of H5 A/Indonesia/5/05 with that of Hl A/Brisbane/59/2007: Comparison of expression for chimeric and native forms.
- the whole inactivated virus (WIV) Hl A/Brisbane/59/2007 used as a positive control was detected as multiple bands with a major band at approximately 80 kDa, corresponding to the molecular weight of the precursor HAO of Hl A/Brisbane/59/2007.
- Nicotiana benthamiana plants were infiltrated with AGL1/732, AGL1/733 or
- Example 3 Replacement of receptor binding (RB) subdomain of Hl A/New Caledonia/20/99 with that of H5 A/Indonesia/5/05. Comparison of expression for chimeric and native forms.
- H5 antigenic region was also evaluated.
- Expression cassettes for the expression of the H1/H5 hemagglutinin fusion are represented in Figure 1 and amino acid sequence of the mature fusion protein produced is presented in Figure 2.
- H1/H5 chimeric hemagglutinin To compare the accumulation level of H1/H5 chimeric hemagglutinin with that of its native form, Nicotiana benthamiana plants were infiltrated with AGLl /660 and AGL1/696, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agroinfiltrated leaves, proteins were extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-H5 (Indonesia) polyclonal antibodies.
- Example 4 Replacement of the ectodomain of H5 A/Indonesia/5/05 with that of H3 or B. Comparison of expression for chimeric and native forms.
- H5/H3 and H5/B hemagglutininin fusions are represented in Figure 10 and amino acids at the border of the fusions are presented in Figure 11.
- Accumulation level of H5/B chimeric hemagglutinin (745) was compared with that of native HA B (739) in Nicotiana benthamiana plants.
- Plants were infiltrated with AGL1/739 and AGL1/745, and the leaves were harvested after a six-day incubation period.
- proteins were first extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-B (Florida) polyclonal antibodies.
- H5/H3 chimeric hemagglutinin (737) was compared with that of its native form (736) in Nicotiana benthamiana plants. Plants were infiltrated with AGL1/736 and AGL1/737, and the leaves were harvested after a six-day incubation period. To determine the accumulation level of each HA form in the agroinfiltrated leaves, proteins were extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-H3 (Brisbane) polyclonal antibodies.
- the results obtained indicate that the chimeric HA consisting in the ectodomain from HA B/Florida/4/2006 fused to the transmembrane and cytosolic subdomains from H5 A/Indonesia/5/05 assembles into high molecular weight particles and that the elution profile of these high molecular weight particles is indistinguishable to that of influenza VLPs.
- Example 5 Co-expression of H5/B chimeric hemagglutinin (construct number 747; comprising B/Flo HDC and SDC fused with an H5/Indo TDC) with Hsp70 and Hsp40 in combination with signal peptide modification.
- Hsp40 and Hsp70 in plants and co-expression with influenza hemagglutinins is described in co-pending application PCT/CA2009/000032.
- Cytosolic Hsp70 and Hsp40 construct number R870 of plant origin may also be co-expressed with chimeric hemagglutinins, to increase their accumulation level in plants.
- the co-expression may be performed by agroinfiltration of K benthamiana plants with a bacterial suspension containing a mixture (1:1:1 ratio) of AGLl bearing the cassette for the expression of the desired chimeric HA with AGL1/R870 and AGLl/35SHcPro.
- Nicotiana benthamiana plants Plants were infiltrated with AGL1/747, AGL 1/747+AGL 1/443 (empty vector) or AGL1/747+AGL1/R870 (HSP40/HSP70), and the leaves were harvested after a six-day incubation period. To determine the accumulation level of H5/B chimeric HA in the agroinfiltrated leaves, proteins were first extracted from infiltrated leaf tissue and analyzed by Western blotting using anti-B (Florida) polyclonal antibodies.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Pulmonology (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (24)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10791119.0A EP2445928B1 (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| IN650DEN2012 IN2012DN00650A (https=) | 2009-06-24 | 2010-06-25 | |
| DK10791119.0T DK2445928T3 (en) | 2009-06-24 | 2010-06-25 | CHEMICAL INFLUENZA VIRUS-LIKE PARTICLES INCLUDING HEMAGGLUTIN |
| NO10791119A NO2445928T3 (https=) | 2009-06-24 | 2010-06-25 | |
| BRPI1015053A BRPI1015053A2 (pt) | 2009-06-24 | 2010-06-25 | partículas similares a vírus da influenza quiméricas compreendendo hemaglutinina |
| CA2762042A CA2762042C (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| MYPI2011006238A MY182643A (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| AU2010265766A AU2010265766B2 (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| MX2017008008A MX392585B (es) | 2009-06-24 | 2010-06-25 | Particulas similares al virus de la influenza quimericas que comprenden hemaglutinina. |
| MX2011013517A MX349924B (es) | 2009-06-24 | 2010-06-25 | Partículas similares al virus de la influenza quiméricas que comprenden hemaglutinina. |
| US13/380,346 US10272148B2 (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| HK12111105.5A HK1170250B (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| HRP20180706TT HRP20180706T1 (hr) | 2009-06-24 | 2010-06-25 | Kimerna gripa nalik čestici koja sadrži hemaglutinin |
| PL10791119T PL2445928T3 (pl) | 2009-06-24 | 2010-06-25 | Chimeryczne, podobne do wirusa grypy cząsteczki zawierające hemaglutyninę |
| JP2012516452A JP5871796B2 (ja) | 2009-06-24 | 2010-06-25 | ヘマグルチニンを含むキメラインフルエンザウイルス様粒子 |
| SG2011092103A SG176820A1 (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| RU2012101946/10A RU2569195C9 (ru) | 2009-06-24 | 2010-06-25 | Химерные вирусоподобные частицы, содержащие гемагглютинин, сходные с частицами вируса гриппа |
| ES10791119.0T ES2669303T3 (es) | 2009-06-24 | 2010-06-25 | Partículas pseudovíricas quiméricas de influenza que comprenden hemaglutinina |
| CN201080035066.4A CN102482328B (zh) | 2009-06-24 | 2010-06-25 | 包含血凝素的嵌合流感病毒样颗粒 |
| KR1020127001798A KR101377725B1 (ko) | 2009-06-24 | 2010-06-25 | 헤마글루티닌을 포함하는 키메라 인플루엔자 바이러스-유사 입자 |
| NZ597401A NZ597401A (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
| SI201031674T SI2445928T1 (en) | 2009-06-24 | 2010-06-25 | HYPER PARTICULARS, SIMILAR VIRUSES OF GRIPE, WHICH HAVE EXPOSED HEMAGLUTININE |
| IL216937A IL216937A (en) | 2009-06-24 | 2011-12-13 | Chlorotinin-containing influenza virus-like chimeric particles |
| ZA2012/00481A ZA201200481B (en) | 2009-06-24 | 2012-01-20 | Chimeric influenza virus-like particles comprising hemagglutinin |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US22016109P | 2009-06-24 | 2009-06-24 | |
| US61/220,161 | 2009-06-24 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP17152741.9A Previously-Filed-Application EP3228627A1 (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus- like particles comprising hemagglutinin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010148511A1 true WO2010148511A1 (en) | 2010-12-29 |
| WO2010148511A8 WO2010148511A8 (en) | 2011-03-10 |
Family
ID=43385835
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2010/000983 Ceased WO2010148511A1 (en) | 2009-06-24 | 2010-06-25 | Chimeric influenza virus-like particles comprising hemagglutinin |
Country Status (25)
| Country | Link |
|---|---|
| US (1) | US10272148B2 (https=) |
| EP (2) | EP3228627A1 (https=) |
| JP (2) | JP5871796B2 (https=) |
| KR (1) | KR101377725B1 (https=) |
| CN (1) | CN102482328B (https=) |
| AU (1) | AU2010265766B2 (https=) |
| BR (1) | BRPI1015053A2 (https=) |
| CA (1) | CA2762042C (https=) |
| DK (1) | DK2445928T3 (https=) |
| ES (1) | ES2669303T3 (https=) |
| HK (1) | HK1245294A1 (https=) |
| HR (1) | HRP20180706T1 (https=) |
| HU (1) | HUE039100T2 (https=) |
| IL (1) | IL216937A (https=) |
| IN (1) | IN2012DN00650A (https=) |
| MX (2) | MX349924B (https=) |
| MY (1) | MY182643A (https=) |
| NO (1) | NO2445928T3 (https=) |
| NZ (1) | NZ597401A (https=) |
| PL (1) | PL2445928T3 (https=) |
| PT (1) | PT2445928T (https=) |
| SG (1) | SG176820A1 (https=) |
| SI (1) | SI2445928T1 (https=) |
| WO (1) | WO2010148511A1 (https=) |
| ZA (1) | ZA201200481B (https=) |
Cited By (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012083445A1 (en) | 2010-12-22 | 2012-06-28 | Medicago Inc. | Virus like particle production in plants |
| WO2013043729A1 (en) * | 2011-09-20 | 2013-03-28 | Mount Sinai School Of Medicine | Influenza virus vaccines and uses thereof |
| WO2013044390A1 (en) | 2011-09-30 | 2013-04-04 | Medicago Inc. | Increasing virus-like particle yield in plants |
| US20130129761A1 (en) * | 2010-03-30 | 2013-05-23 | Mount Sinai School Of Medicine | Influenza virus vaccine and uses thereof |
| US20140127216A1 (en) * | 2011-02-08 | 2014-05-08 | Temasek Life Sciences Laboratory Limited | Novel expression cassette for efficient surface display of antigenic proteins |
| WO2014085616A1 (en) * | 2012-11-27 | 2014-06-05 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Computationally optimized broadly reactive antigens for h1n1 influenza |
| WO2014153674A1 (en) | 2013-03-28 | 2014-10-02 | Medicago Inc. | Influenza virus-like particle production in plants |
| WO2014195920A3 (en) * | 2013-06-06 | 2015-05-28 | Novartis Ag | Influenza virus reassortment |
| US9051359B2 (en) | 2009-03-30 | 2015-06-09 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| WO2015103704A1 (en) * | 2014-01-10 | 2015-07-16 | Medicago Inc. | Cpmv enhancer elements |
| WO2015143567A1 (en) | 2014-03-27 | 2015-10-01 | Medicago Inc. | Modified cpmv enhancer elements |
| US9175069B2 (en) | 2009-05-26 | 2015-11-03 | Icahn School Of Medicine At Mount Sinai | Monoclonal antibodies against influenza virus generated by cyclical administration and uses thereof |
| CN105263516A (zh) * | 2012-12-18 | 2016-01-20 | 西奈山伊坎医学院 | 流感病毒疫苗及其用途 |
| WO2017000074A1 (en) | 2015-07-02 | 2017-01-05 | Medicago Inc. | Jasmonic acid pathway activator |
| WO2017087492A1 (en) * | 2015-11-16 | 2017-05-26 | Kansas State University Research Foundation | Influenza virus vaccine and vaccine platform |
| US9701723B2 (en) | 2010-02-18 | 2017-07-11 | Icahn School Of Medicine At Mount Sinai | Vaccines for use in the prophylaxis and treatment of influenza virus disease |
| US9815873B2 (en) | 2011-03-23 | 2017-11-14 | Medicago Inc. | Method for recovering plant-derived proteins |
| US9908930B2 (en) | 2013-03-14 | 2018-03-06 | Icahn School Of Medicine At Mount Sinai | Antibodies against influenza virus hemagglutinin and uses thereof |
| JP2018110581A (ja) * | 2018-01-25 | 2018-07-19 | インスティテュート・フォー・リサーチ・イン・バイオメディシンInstitute For Research In Biomedicine | A型インフルエンザウイルス中和抗体及びその使用法 |
| JP2020048568A (ja) * | 2019-11-22 | 2020-04-02 | インスティテュート・フォー・リサーチ・イン・バイオメディシンInstitute For Research In Biomedicine | A型インフルエンザウイルス中和抗体及びその使用法 |
| US10736956B2 (en) | 2015-01-23 | 2020-08-11 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccination regimens |
| WO2020181354A1 (en) | 2019-03-14 | 2020-09-17 | Mitsubishi Tanabe Pharma Corporation | Endogenous plant expression enhancer |
| US10815294B2 (en) | 2011-07-18 | 2020-10-27 | Institute For Research In Biomedicine | Neutralizing anti-influenza A virus antibodies and uses thereof |
| US11254733B2 (en) | 2017-04-07 | 2022-02-22 | Icahn School Of Medicine At Mount Sinai | Anti-influenza B virus neuraminidase antibodies and uses thereof |
| US11266734B2 (en) | 2016-06-15 | 2022-03-08 | Icahn School Of Medicine At Mount Sinai | Influenza virus hemagglutinin proteins and uses thereof |
| US11390878B2 (en) | 2011-09-30 | 2022-07-19 | Medicago Inc. | Increasing protein yield in plants |
| EP4146241A1 (en) | 2020-05-08 | 2023-03-15 | Academia Sinica | Chimeric influenza vaccines |
| US11826419B2 (en) | 2009-09-22 | 2023-11-28 | Medicago Inc. | Method of preparing plant-derived VLPs |
| US12104196B2 (en) | 2018-06-27 | 2024-10-01 | Aramis Biotechnologies Inc. | Influenza virus hemagglutinin mutants |
| US12157763B2 (en) | 2021-10-01 | 2024-12-03 | Academia Sinica | Antibody specific to spike protein of SARS-CoV-2 and uses thereof |
| US12180491B2 (en) | 2018-03-14 | 2024-12-31 | Aramis Biotechnologies Inc. | Plant expression enhancer |
| US12257298B2 (en) | 2021-04-12 | 2025-03-25 | Academia Sinica | Coronavirus vaccine |
| US12318485B2 (en) | 2023-04-08 | 2025-06-03 | Rock Biomedical, Inc. | Methods and compositions for targeted delivery by polymersomes |
| US12364746B2 (en) | 2018-06-21 | 2025-07-22 | Icahn School Of Medicine At Mount Sinai | Mosaic influenza virus hemagglutinin polypeptides and uses thereof |
| US12384811B2 (en) | 2019-04-05 | 2025-08-12 | Academia Sinica | Sialidase-resistant saccharide and method of making and using the same |
| US12467058B2 (en) | 2013-03-28 | 2025-11-11 | Aramis Biotechnologies Inc. | Influenza virus-like particle production in plants |
| US12508235B2 (en) | 2023-04-08 | 2025-12-30 | Rock Biomedical, Inc. | Methods and compositions for dendritic cell targeting nano-delivery |
| US12545718B2 (en) | 2019-04-24 | 2026-02-10 | Icahn School Of Medicine At Mount Sinai | Anti-influenza B virus neuraminidase antibodies and uses thereof |
| US12545941B2 (en) | 2023-05-17 | 2026-02-10 | Rock Biomedical, Inc. | MGAT1 deficient cells and uses thereof |
| US12607406B2 (en) | 2016-11-08 | 2026-04-21 | Academia Sinica | Recombinant virus, composition comprising the same, and uses thereof |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2615372A1 (en) * | 2007-07-13 | 2009-01-13 | Marc-Andre D'aoust | Influenza virus-like particles (vlps) comprising hemagglutinin |
| EP2238253B1 (en) | 2007-11-27 | 2012-09-12 | Medicago Inc. | Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin |
| DK2294202T3 (en) * | 2008-07-08 | 2015-08-31 | Medicago Inc | SOLUBLE RECOMBINANT INFLUENZA ANTIGENES |
| HRP20180706T1 (hr) | 2009-06-24 | 2018-06-01 | Medicago Inc. | Kimerna gripa nalik čestici koja sadrži hemaglutinin |
| CN105233302B (zh) * | 2014-07-10 | 2018-10-19 | 中国人民解放军军事医学科学院生物工程研究所 | 一种流感血凝素糖蛋白多聚物纳米颗粒的制备方法 |
| KR101755114B1 (ko) * | 2015-09-08 | 2017-07-06 | 건국대학교 산학협력단 | 여러 클레이드의 고병원성 조류인플루엔자 h5 바이러스에 대한 넓은 항체 반응을 유도하는 키메릭 바이러스 유사입자 백신 |
| CN109073639B (zh) * | 2016-02-03 | 2022-04-01 | Cg探索股份有限公司 | 具有异源表位和/或改变的成熟切割位点的流感血凝素的组合物 |
| US20220267382A1 (en) * | 2019-09-20 | 2022-08-25 | Academia Sinica | Chimeric hemagglutinin protein and a vaccine composition comprising the same |
Citations (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US4962028A (en) | 1986-07-09 | 1990-10-09 | Dna Plant Technology Corporation | Plant promotors |
| US5036006A (en) | 1984-11-13 | 1991-07-30 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5100792A (en) | 1984-11-13 | 1992-03-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues |
| US5232833A (en) | 1988-09-14 | 1993-08-03 | Stressgen Biotechnologies Corporation | Accumulation of heat shock proteins for evaluating biological damage due to chronic exposure of an organism to sublethal levels of pollutants |
| US5428147A (en) | 1983-04-15 | 1995-06-27 | Mycogen Plant Science, Inc. | Octopine T-DNA promoters |
| US5625136A (en) | 1991-10-04 | 1997-04-29 | Ciba-Geigy Corporation | Synthetic DNA sequence having enhanced insecticidal activity in maize |
| US6403865B1 (en) | 1990-08-24 | 2002-06-11 | Syngenta Investment Corp. | Method of producing transgenic maize using direct transformation of commercially important genotypes |
| US6420548B1 (en) | 1999-10-04 | 2002-07-16 | Medicago Inc. | Method for regulating transcription of foreign genes |
| US20040002061A1 (en) * | 2002-02-13 | 2004-01-01 | Yoshihiro Kawaoka | Signal for packaging of influenza virus vectors |
| US7125978B1 (en) | 1999-10-04 | 2006-10-24 | Medicago Inc. | Promoter for regulating expression of foreign genes |
| WO2007135480A1 (en) | 2006-05-22 | 2007-11-29 | Plant Bioscience Limited | Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants |
| WO2008151440A1 (en) | 2007-06-15 | 2008-12-18 | Medicago Inc. | Modifying glycoprotein production in plants |
| WO2009009876A1 (en) | 2007-07-13 | 2009-01-22 | Medicago Inc. | Influenza virus-like particles (vlps) comprising hemagglutinin produced within a plant |
Family Cites Families (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS62501263A (ja) | 1984-11-29 | 1987-05-21 | スクリツプス クリニツク アンド リサ−チ フアウンデ−シヨン | 脱グリコシル化ウイルス糖タンパク質に関連するポリペプチド類および抗体 |
| DE69213804T2 (de) | 1991-03-28 | 1997-03-27 | Rooperol Na Nv | Zusammensetzungen von Phytosterolen mit Phytosterolinen als Immunmodulatoren |
| US6326470B1 (en) | 1997-04-15 | 2001-12-04 | The Penn State Research Foundation | Enhancement of accessibility of cellulose by expansins |
| US5762939A (en) | 1993-09-13 | 1998-06-09 | Mg-Pmc, Llc | Method for producing influenza hemagglutinin multivalent vaccines using baculovirus |
| GB9414118D0 (en) | 1994-07-13 | 1994-08-31 | Axis Genetics Ltd | Modified plant viruses as vectors of heterologous peptides |
| AU6504796A (en) | 1995-07-20 | 1997-02-18 | Washington State University Research Foundation | Production of secreted foreign polypeptides in plant cell culture |
| US6042832A (en) | 1996-08-28 | 2000-03-28 | Thomas Jefferson University | Polypeptides fused with alfalfa mosaic virus or ilarvirus capsid proteins |
| US20010006950A1 (en) | 1998-02-11 | 2001-07-05 | Juha Punnonen | Genetic vaccine vector engineering |
| US6489537B1 (en) | 1998-08-07 | 2002-12-03 | The Trustees Of The University Of Pennsylvania | Phytochelatin synthases and uses therefor |
| WO2000009725A2 (en) | 1998-08-11 | 2000-02-24 | Biosource Technologies, Inc. | Method for recovering proteins from the interstitial fluid of plant tissues |
| WO2000020557A2 (en) | 1998-10-07 | 2000-04-13 | Boyce Institute For Plant Research At Cornell University | Gemini virus vectors for gene expression in plants |
| US6287570B1 (en) | 1998-11-23 | 2001-09-11 | Patricia L. Foley | Vaccine against swine influenza virus |
| FR2791358B1 (fr) | 1999-03-22 | 2003-05-16 | Meristem Therapeutics | Promoteurs chimeriques d'expression, cassettes d'expression, plasmides, vecteurs, plantes et semences transgeniques les contenant et leurs methodes d'obtention |
| CA2365592C (en) * | 1999-04-29 | 2011-11-15 | Zeneca Limited | Herbicide resistant plants comprising epsps |
| WO2002074795A2 (en) | 2001-01-18 | 2002-09-26 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Oligomeric complexes of chimeric proteins with enhanced immunogenic potential |
| CN1997734A (zh) * | 2002-02-13 | 2007-07-11 | 威斯康星旧生研究基金会 | 包装流感病毒载体的信号 |
| WO2003068163A2 (en) | 2002-02-14 | 2003-08-21 | Novavax, Inc. | Optimization of gene sequences of chimeric virus-like particles for expression in insect cells |
| KR101070518B1 (ko) | 2002-03-19 | 2011-10-05 | 스티칭 디엔스트 랜드보위쿤디그 온데조에크 | 식물에서의 gntⅲ 발현 |
| ES2224792B1 (es) | 2002-06-28 | 2007-02-16 | Era Plantech, S.L. | Produccion de peptidos y proteinas por acumulacion de cuerpos proteicos derivados de reticulos endoplasmico en plantas. |
| ATE473271T1 (de) | 2003-05-05 | 2010-07-15 | Thompson Boyce Plant Res | Vektoren und zellen zur herstellung von aus transgenen pflanzen gewonnenen immunprotektiven zusammensetzungen |
| NZ542933A (en) | 2003-05-05 | 2009-08-28 | Dow Agrosciences Llc | Stable immunoprophylactic and therapeutic compositions derived from transgenic plant cells and methods for production |
| US7566458B2 (en) | 2003-06-16 | 2009-07-28 | Medimmune, Llc | Influenza hemagglutinin and neuraminidase variants |
| US8592197B2 (en) | 2003-07-11 | 2013-11-26 | Novavax, Inc. | Functional influenza virus-like particles (VLPs) |
| US7226781B1 (en) | 2003-07-24 | 2007-06-05 | Belyaev Alexander S | Chaperone expression genomes |
| ATE541938T1 (de) | 2005-04-29 | 2012-02-15 | Univ Cape Town | Expression viraler proteine in pflanzen |
| EP1909829A4 (en) | 2005-07-19 | 2009-11-11 | Dow Global Technologies Inc | RECOMBINANT GRIP VACCINES |
| US7871626B2 (en) | 2005-08-04 | 2011-01-18 | St. Jude Children's Research Hospital | Modified influenza virus for monitoring and improving vaccine efficiency |
| EP1945250A4 (en) | 2005-08-16 | 2010-05-19 | Hawaii Biotech Inc | RECOMBINANT SUBUNIT VACCINE AGAINST INFLUENZA |
| JP5714799B2 (ja) | 2005-10-18 | 2015-05-07 | ノババックス インコーポレイテッド | 機能的インフルエンザウイルス様粒子(vlp) |
| AU2007215080A1 (en) | 2006-02-13 | 2007-08-23 | Fraunhofer Usa, Inc. | Influenza antigens, vaccine compositions, and related methods |
| US7993655B2 (en) | 2006-04-21 | 2011-08-09 | Dow Agrosciences Llc | Vaccine for avian influenza and methods of use |
| US8778353B2 (en) | 2006-05-01 | 2014-07-15 | Technovax, Inc. | Influenza virus-like particle (VLP) compositions |
| US9511134B2 (en) | 2006-05-18 | 2016-12-06 | Epimmune Inc. | Inducing immune responses to influenza virus using polypeptide and nucleic acid compositions |
| US20070286873A1 (en) | 2006-05-23 | 2007-12-13 | Williams John V | Recombinant Influenza H5 Hemagluttinin Protein And Nucleic Acid Coding Therefor |
| WO2008005777A2 (en) | 2006-06-30 | 2008-01-10 | Novavax, Inc. | Methods of enhancing protein incorporation into virus like particles |
| US20080233150A1 (en) | 2006-11-16 | 2008-09-25 | Gale Smith | Respiratory syncytial virus-virus like particle (vlps) |
| US7730950B2 (en) | 2007-01-19 | 2010-06-08 | Halliburton Energy Services, Inc. | Methods for treating intervals of a subterranean formation having variable permeability |
| WO2008148104A1 (en) | 2007-05-25 | 2008-12-04 | Novavax, Inc. | Novel vlps derived from cells that do not express a viral matrix or core protein |
| KR100964462B1 (ko) | 2007-07-10 | 2010-06-16 | 성균관대학교산학협력단 | 형질전환 식물 유래의 조류독감 바이러스 백신 및 그 제조방법 |
| US20110059130A1 (en) | 2007-08-20 | 2011-03-10 | Fraunhofer Usa, Inc. | Prophylactic and therapeutic influenza vaccines, antigens, compositions and methods |
| EP2238253B1 (en) * | 2007-11-27 | 2012-09-12 | Medicago Inc. | Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin |
| GB0800272D0 (en) | 2008-01-08 | 2008-02-13 | Plant Bioscience Ltd | Protein expression systems |
| SG187500A1 (en) | 2008-01-21 | 2013-02-28 | Medicago Inc | Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin |
| DK2294202T3 (en) | 2008-07-08 | 2015-08-31 | Medicago Inc | SOLUBLE RECOMBINANT INFLUENZA ANTIGENES |
| MX370690B (es) | 2008-07-18 | 2019-12-19 | Medicago Inc | Epitopo de inmunizacion de nuevo virus de la influenza. |
| JP5785080B2 (ja) | 2008-08-27 | 2015-09-24 | アリゾナ・ボード・オブ・リージェンツ・フォー・アンド・オン・ビハーフ・オブ・アリゾナ・ステイト・ユニバーシティArizona Board Of Regents For And On Behalf Of Arizona State University | 植物におけるワクチン及びモノクローナル抗体治療薬の高レベル迅速生産のためのdnaレプリコン系 |
| WO2010042551A2 (en) | 2008-10-06 | 2010-04-15 | Genvault Corporation | Methods for providing cellular lysates from cell wall-containing samples |
| WO2010077712A1 (en) | 2008-12-09 | 2010-07-08 | Novavax, Inc. | Bovine respiratory syncytial virus virus-like particle (vlps) |
| HRP20180706T1 (hr) | 2009-06-24 | 2018-06-01 | Medicago Inc. | Kimerna gripa nalik čestici koja sadrži hemaglutinin |
| PH12012500565B1 (en) | 2009-09-22 | 2018-01-12 | Medicago Inc | Method of preparing plant-derived proteins |
-
2010
- 2010-06-25 HR HRP20180706TT patent/HRP20180706T1/hr unknown
- 2010-06-25 SI SI201031674T patent/SI2445928T1/en unknown
- 2010-06-25 NO NO10791119A patent/NO2445928T3/no unknown
- 2010-06-25 DK DK10791119.0T patent/DK2445928T3/en active
- 2010-06-25 SG SG2011092103A patent/SG176820A1/en unknown
- 2010-06-25 US US13/380,346 patent/US10272148B2/en active Active
- 2010-06-25 KR KR1020127001798A patent/KR101377725B1/ko active Active
- 2010-06-25 JP JP2012516452A patent/JP5871796B2/ja active Active
- 2010-06-25 AU AU2010265766A patent/AU2010265766B2/en active Active
- 2010-06-25 NZ NZ597401A patent/NZ597401A/xx unknown
- 2010-06-25 CA CA2762042A patent/CA2762042C/en active Active
- 2010-06-25 IN IN650DEN2012 patent/IN2012DN00650A/en unknown
- 2010-06-25 PT PT107911190T patent/PT2445928T/pt unknown
- 2010-06-25 ES ES10791119.0T patent/ES2669303T3/es active Active
- 2010-06-25 MX MX2011013517A patent/MX349924B/es active IP Right Grant
- 2010-06-25 BR BRPI1015053A patent/BRPI1015053A2/pt not_active Application Discontinuation
- 2010-06-25 MX MX2017008008A patent/MX392585B/es unknown
- 2010-06-25 WO PCT/CA2010/000983 patent/WO2010148511A1/en not_active Ceased
- 2010-06-25 HU HUE10791119A patent/HUE039100T2/hu unknown
- 2010-06-25 EP EP17152741.9A patent/EP3228627A1/en not_active Ceased
- 2010-06-25 EP EP10791119.0A patent/EP2445928B1/en active Active
- 2010-06-25 PL PL10791119T patent/PL2445928T3/pl unknown
- 2010-06-25 CN CN201080035066.4A patent/CN102482328B/zh active Active
- 2010-06-25 MY MYPI2011006238A patent/MY182643A/en unknown
-
2011
- 2011-12-13 IL IL216937A patent/IL216937A/en active IP Right Grant
-
2012
- 2012-01-20 ZA ZA2012/00481A patent/ZA201200481B/en unknown
-
2014
- 2014-04-02 JP JP2014076395A patent/JP6141228B2/ja active Active
-
2018
- 2018-04-10 HK HK18104650.3A patent/HK1245294A1/en unknown
Patent Citations (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5428147A (en) | 1983-04-15 | 1995-06-27 | Mycogen Plant Science, Inc. | Octopine T-DNA promoters |
| US5036006A (en) | 1984-11-13 | 1991-07-30 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US5100792A (en) | 1984-11-13 | 1992-03-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues |
| US4945050A (en) | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US4962028A (en) | 1986-07-09 | 1990-10-09 | Dna Plant Technology Corporation | Plant promotors |
| US5232833A (en) | 1988-09-14 | 1993-08-03 | Stressgen Biotechnologies Corporation | Accumulation of heat shock proteins for evaluating biological damage due to chronic exposure of an organism to sublethal levels of pollutants |
| US6403865B1 (en) | 1990-08-24 | 2002-06-11 | Syngenta Investment Corp. | Method of producing transgenic maize using direct transformation of commercially important genotypes |
| US5625136A (en) | 1991-10-04 | 1997-04-29 | Ciba-Geigy Corporation | Synthetic DNA sequence having enhanced insecticidal activity in maize |
| US6420548B1 (en) | 1999-10-04 | 2002-07-16 | Medicago Inc. | Method for regulating transcription of foreign genes |
| US7125978B1 (en) | 1999-10-04 | 2006-10-24 | Medicago Inc. | Promoter for regulating expression of foreign genes |
| US20040002061A1 (en) * | 2002-02-13 | 2004-01-01 | Yoshihiro Kawaoka | Signal for packaging of influenza virus vectors |
| US20090311669A1 (en) * | 2002-02-13 | 2009-12-17 | Wisconsin Alumni Research Foundation | Signal for packaging of influenza virus vectors |
| WO2007135480A1 (en) | 2006-05-22 | 2007-11-29 | Plant Bioscience Limited | Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants |
| WO2008151440A1 (en) | 2007-06-15 | 2008-12-18 | Medicago Inc. | Modifying glycoprotein production in plants |
| WO2009009876A1 (en) | 2007-07-13 | 2009-01-22 | Medicago Inc. | Influenza virus-like particles (vlps) comprising hemagglutinin produced within a plant |
Non-Patent Citations (75)
| Title |
|---|
| ALTSCHUL ET AL., J. MOL BIOL, vol. 215, 1990, pages 403 - 410 |
| AN ET AL., PLANT J., vol. 10, 1996, pages 107 - 121 |
| AOYAMA, T.; CHUA, N.H., PLANT J., vol. 2, 1997, pages 397 - 404 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995 |
| BILANG ET AL., GENE, vol. 100, 1991, pages 247 - 250 |
| BILODEAU ET AL., PLANT CELL, vol. 14, 1994, pages 125 - 130 |
| BRANDSTATTER, I.; KIEBER, J.J., PLANT CELL, vol. 10, 1998, pages 1009 - 1019 |
| CADDICK, M.X. ET AL., NATURE BIOTECH., vol. 16, 1998, pages 177 - 180 |
| CHIBA ET AL., VIROLOGY, vol. 346, 2006, pages 7 - 14 |
| COPELAND ET AL., J. VIROL, vol. 79, 2005, pages 6459 - 6471 |
| CORNEJO ET AL., PLANT MOL. BIOL., vol. 29, 1993, pages 637 - 646 |
| CORPET F., NUCL. ACIDS RES., vol. 16, no. 22, 1988, pages 10881 - 10890 |
| CRAWFORD ET AL., VACCINE, vol. 17, 1999, pages 2265 - 74 |
| D'AOUST M-A ET AL.: "Influenza virus-like particles produced by transient expression in Nicotiana benthamiana induce a protective immune response against a lethal viral challenge in mice", PLANT BIOTECHNOL. J., vol. 6, no. 9, December 2008 (2008-12-01), pages 930 - 940, XP002598510 * |
| D'AOUST M-A ET AL.: "The production of hemagglutinin-based virus-like particles in plants: a rapid, efficient and safe response to pandemic influenza", PLANT BIOTECH. J., vol. 8, no. 5, June 2010 (2010-06-01), pages 607 - 619, XP002598511 * |
| DARVEAU ET AL., METHODS IN NEUROSCIENCE, vol. 26, 1995, pages 77 - 85 |
| DEBLOCK ET AL., PLANT PHYSIOLOGY, vol. 91, 1989, pages 694 - 701 |
| DT. DENNIS, DH TURPIN, DD LEFEBRVE, DB LAYZELL: "Plant Metabolism, 2d Ed.", 1997, ADDISON-WESLEY, LANGMANS LTD., article MIKI; IYER: "Fundamentals of Gene Transfer in Plants", pages: 561 - 579 |
| FLANDORFER A ET AL.: "Chimeric Influenza A Viruses with a Functional Influenza B Virus neuraminidase or Hemagglutinin", J. VIROL., vol. 77, no. 17, September 2003 (2003-09-01), pages 9116 - 9123, XP008149449 * |
| FRUGIS ET AL., PLANT MOLECULAR BIOLOGY, vol. 40, 1999, pages 397 - 408 |
| GAMBLIN ET AL., SCIENCE, vol. 303, 2004, pages 1838 - 1842 |
| GARCIA-SASTRE ET AL., BIOLOGICALS, vol. 23, 1995, pages 171 - 178 |
| GATZ, C., ANN. REV. PLANT PHYSIOL. PLANT MOL. BIOL., vol. 48, 1997, pages 89 - 108 |
| GATZ, C.; LENK, I.R.P., TRENDS PLANT SCI., vol. 3, 1998, pages 352 - 358 |
| GEIERSON; COREY: "Plant Molecular Biology, 2d Ed.", 1988 |
| GUERCHE ET AL., PLANT SCIENCE, vol. 52, 1987, pages 111 - 116 |
| GUPTA ET AL., NUCLEIC ACIDS RESEARCH, vol. 27, 1999, pages 370 - 372 |
| HA ET AL., EMBO J., vol. 21, 2002, pages 865 - 875 |
| HARTL, FU, NATURE, vol. 381, 1996, pages 571 - 579 |
| HATZIIOANNOU ET AL., HUMAN GENE THERAPY, vol. 10, 1999, pages 1533 - 1544 |
| HOLTORF ET AL., PLANT MOL. BIOL., vol. 29, 1995, pages 637 - 646 |
| HORIMOTO T ET AL.: "Generation of Influenza A Viruses with Chimeric (Type A/B) Hemagglutinins", J. VIROL., vol. 77, no. 14, July 2003 (2003-07-01), pages 8031 - 8038, XP002518114 * |
| HORSCH ET AL., SCIENCE, vol. 227, 1985, pages 1229 - 1231 |
| HOWELL ET AL., SCIENCE, vol. 208, 1980, pages 1265 |
| ITO T. ET AL., VIROLOGY, vol. 227, 1997, pages 493 - 499 |
| JOHANSSON, VACCINE, vol. 17, 1999, pages 2073 - 80 |
| KAKIMOTO, T., SCIENCE, vol. 274, 1996, pages 982 - 985 |
| KAPILA ET AL., PLANT SCIENCE, vol. 122, 1997, pages 101 - 108 |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73 |
| LI ET AL., J. VIROL, vol. 79, 2005, pages 10003 - 1002 |
| LIN ET AL., CELL STRESS AND CHAPERONES, vol. 6, 2001, pages 201 - 208 |
| LIU; LOMONOSSOFF, J. VIROL METH, vol. 105, 2002, pages 343 - 348 |
| LIU; LOMONOSSOFF, JOURNAL OF VIROLOGICAL METHODS, vol. 105, 2002, pages 343 - 348 |
| MACARIO, A.J.L., COLD SPRING HARBOR LABORATORY RES., vol. 25, 1995, pages 59 - 70 |
| MANDEL ET AL., PLANT MOL. BIOL., vol. 29, 1995, pages 995 - 1004 |
| MANIATIS ET AL.: "Molecular Cloning (A Laboratory Manual", 1982, COLD SPRING HARBOR LABORATORY |
| MEDEIROS R ET AL., VIROLOGY, vol. 289, 2001, pages 74 - 85 |
| METT V ET AL.: "A plant-produced influenza subunit vaccine protects ferrets against virus challenge Influenza Other Respi.", VIRUSES, vol. 2, no. 1, January 2008 (2008-01-01), pages 33 - 40, XP008130054 * |
| NAKAHARA ET AL., NUCLEIC ACIDS RESEARCH, vol. 36, 2008, pages D368 - D371 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| NEUHAUSE ET AL., THEOR. APPL GENET., vol. 75, 1987, pages 30 - 36 |
| ODELL ET AL., NATURE, vol. 313, 1985, pages 810 - 812 |
| OLSEN ET AL., VACCINE, vol. 15, 1997, pages 1149 - 56 |
| PARSELL, D.A.; LINDQUIST, S., ANN. REV. GENET., vol. 27, 1993, pages 437 - 496 |
| PEARSON; LIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| QUAN ET AL., J. VIROL, vol. 81, 2007, pages 3514 - 3524 |
| RASK ET AL., J. PLANT PHYSIOL., vol. 152, 1998, pages 595 - 599 |
| ROWE ET AL., VIRUS NEUTRALIZATION TITERS MAY BE OBTAINED SEVERAL WAYS, 1973 |
| SAINSBURY ET AL., PLANT BIOTECHNOLOGY JOURNAL, vol. 6, 2008, pages 82 - 92 |
| SAINSBURY ET AL., PLANT PHYSIOLOGY, vol. 148, 2008, pages 1212 - 1218 |
| SAINT-JORE-DUPAS ET AL., TRENDS BIOTECHNOL, vol. 25, 2007, pages 317 - 23 |
| SALTER, M.G. ET AL., PLANT JOURNAL, vol. 16, 1998, pages 127 - 132 |
| SAMBROOK; RUSSELL: "Molecular Cloning: A Laboratory Manual, 3rd edition", 2001 |
| SCHEID ET AL., MOL. GEN. GENET., vol. 228, 1991, pages 104 - 112 |
| SKEHEL; WILEY, ANN REV BIOCHEM, vol. 69, 2000, pages 531 - 69 |
| SKEHEL; WILEY, ANN REV BIOCHEM., vol. 69, 2000, pages 531 - 569 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| TOUKACH ET AL., NUCLEIC ACIDS RESEARCH, vol. 35, 2007, pages D280 - D286 |
| TSUJI M, CELL MOL LIFE SCI, vol. 63, 2006, pages 1889 - 98 |
| ULMASOV, T. ET AL., PLANT CELL, vol. 9, 1997, pages 1963 - 1971 |
| VOINNET ET AL., THE PLANT JOURNAL, vol. 33, 2003, pages 949 - 956 |
| WEISSBACH; WEISSBACH: "Methods for Plant Molecular Biology", 1988, ACADEMY PRESS, pages: 421 - 463 |
| WILEY ET AL., ANNU. REV BIOCHEM, vol. 56, 1987, pages 365 - 394 |
| XU, PLANT PHYSIOL., vol. 106, 1994, pages 459 - 467 |
| ZHANG ET AL., PLANT CELL, vol. 3, 1991, pages 1155 - 1165 |
Cited By (86)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9849172B2 (en) | 2009-03-30 | 2017-12-26 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| US9051359B2 (en) | 2009-03-30 | 2015-06-09 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| US9175069B2 (en) | 2009-05-26 | 2015-11-03 | Icahn School Of Medicine At Mount Sinai | Monoclonal antibodies against influenza virus generated by cyclical administration and uses thereof |
| US11826419B2 (en) | 2009-09-22 | 2023-11-28 | Medicago Inc. | Method of preparing plant-derived VLPs |
| US11833200B2 (en) | 2009-09-22 | 2023-12-05 | Medicago Inc. | Method of preparing plant-derived proteins |
| US9701723B2 (en) | 2010-02-18 | 2017-07-11 | Icahn School Of Medicine At Mount Sinai | Vaccines for use in the prophylaxis and treatment of influenza virus disease |
| US9708373B2 (en) | 2010-03-30 | 2017-07-18 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccine and uses thereof |
| US20130129761A1 (en) * | 2010-03-30 | 2013-05-23 | Mount Sinai School Of Medicine | Influenza virus vaccine and uses thereof |
| US10179806B2 (en) | 2010-03-30 | 2019-01-15 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| WO2012083445A1 (en) | 2010-12-22 | 2012-06-28 | Medicago Inc. | Virus like particle production in plants |
| US20140127216A1 (en) * | 2011-02-08 | 2014-05-08 | Temasek Life Sciences Laboratory Limited | Novel expression cassette for efficient surface display of antigenic proteins |
| US10202617B2 (en) * | 2011-02-08 | 2019-02-12 | Temasek Life Sciences Laboratory Limited | Expression cassette for efficient surface display of antigenic proteins |
| US9815873B2 (en) | 2011-03-23 | 2017-11-14 | Medicago Inc. | Method for recovering plant-derived proteins |
| US10815294B2 (en) | 2011-07-18 | 2020-10-27 | Institute For Research In Biomedicine | Neutralizing anti-influenza A virus antibodies and uses thereof |
| CN104185476A (zh) * | 2011-09-20 | 2014-12-03 | 西奈山医学院 | 流感病毒疫苗及其应用 |
| US10131695B2 (en) | 2011-09-20 | 2018-11-20 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| EP2758075B1 (en) * | 2011-09-20 | 2023-05-03 | Icahn School of Medicine at Mount Sinai | Influenza virus vaccines and uses thereof |
| JP2018110585A (ja) * | 2011-09-20 | 2018-07-19 | アイカーン スクール オブ メディシン アット マウント サイナイ | インフルエンザウイルスワクチン及びその使用 |
| CN108164602A (zh) * | 2011-09-20 | 2018-06-15 | 西奈山医学院 | 流感病毒疫苗及其应用 |
| WO2013043729A1 (en) * | 2011-09-20 | 2013-03-28 | Mount Sinai School Of Medicine | Influenza virus vaccines and uses thereof |
| EP4241785A3 (en) * | 2011-09-20 | 2023-09-27 | Icahn School of Medicine at Mount Sinai | Influenza virus vaccines and uses thereof |
| EP2758075A4 (en) * | 2011-09-20 | 2015-05-20 | Sinai School Medicine | INFLUENZA VIRUS VACCINES AND USES THEREOF |
| AU2012312529B2 (en) * | 2011-09-20 | 2018-01-04 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| JP2014530003A (ja) * | 2011-09-20 | 2014-11-17 | モウント シナイ スクール オフ メディシネ | インフルエンザウイルスワクチン及びその使用 |
| US20150132330A1 (en) * | 2011-09-20 | 2015-05-14 | Mount Sinai School Of Medicine | Influenza virus vaccines and uses thereof |
| CN116162175A (zh) * | 2011-09-20 | 2023-05-26 | 西奈山伊坎医学院 | 流感病毒疫苗及其应用 |
| EP3626733A1 (en) | 2011-09-30 | 2020-03-25 | Medicago Inc. | Increasing virus-like particle yield in plants |
| WO2013044390A1 (en) | 2011-09-30 | 2013-04-04 | Medicago Inc. | Increasing virus-like particle yield in plants |
| US11155581B2 (en) | 2011-09-30 | 2021-10-26 | Medicago Inc. | Increasing virus-like particle yield in plants |
| US11390878B2 (en) | 2011-09-30 | 2022-07-19 | Medicago Inc. | Increasing protein yield in plants |
| AU2013352179B2 (en) * | 2012-11-27 | 2017-12-21 | University Of Pittsburgh - Of The Commonwealth System Of Higher Education | Computationally optimized broadly reactive antigens for H1N1 influenza |
| WO2014085616A1 (en) * | 2012-11-27 | 2014-06-05 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Computationally optimized broadly reactive antigens for h1n1 influenza |
| US9566328B2 (en) | 2012-11-27 | 2017-02-14 | University of Pittsburgh—of the Commonwealth System of Higher Education | Computationally optimized broadly reactive antigens for H1N1 influenza |
| US10017544B2 (en) | 2012-11-27 | 2018-07-10 | University of Pittsburgh—of the Commonwealth System of Higher Education | Computationally optimized broadly reactive antigens for H1N1 influenza |
| US9309290B2 (en) | 2012-11-27 | 2016-04-12 | University of Pittsburgh—of the Commonwealth System of Higher Education | Computationally optimized broadly reactive antigens for H1N1 influenza |
| EP2934581A4 (en) * | 2012-12-18 | 2016-11-02 | Icahn School Med Mount Sinai | INFLUENZA VIRUS VACCINES AND USES THEREOF |
| US10583188B2 (en) | 2012-12-18 | 2020-03-10 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| EP4154907A1 (en) * | 2012-12-18 | 2023-03-29 | Icahn School of Medicine at Mount Sinai | Influenza virus vaccines and uses thereof |
| US10137189B2 (en) | 2012-12-18 | 2018-11-27 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| US9968670B2 (en) | 2012-12-18 | 2018-05-15 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| AU2013362935B2 (en) * | 2012-12-18 | 2018-10-04 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| CN105263516A (zh) * | 2012-12-18 | 2016-01-20 | 西奈山伊坎医学院 | 流感病毒疫苗及其用途 |
| US9371366B2 (en) | 2012-12-18 | 2016-06-21 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccines and uses thereof |
| US10544207B2 (en) | 2013-03-14 | 2020-01-28 | Icahn School Of Medicine At Mount Sinai | Antibodies against influenza virus hemagglutinin and uses thereof |
| US9908930B2 (en) | 2013-03-14 | 2018-03-06 | Icahn School Of Medicine At Mount Sinai | Antibodies against influenza virus hemagglutinin and uses thereof |
| US10358652B2 (en) | 2013-03-28 | 2019-07-23 | Medicago Inc. | Influenza virus-like particle production in plants |
| WO2014153674A1 (en) | 2013-03-28 | 2014-10-02 | Medicago Inc. | Influenza virus-like particle production in plants |
| EP3626827A1 (en) | 2013-03-28 | 2020-03-25 | Medicago Inc. | Influenza virus-like particle production in plants |
| US12467058B2 (en) | 2013-03-28 | 2025-11-11 | Aramis Biotechnologies Inc. | Influenza virus-like particle production in plants |
| US11085049B2 (en) | 2013-03-28 | 2021-08-10 | Medicago Inc. | Influenza virus-like particle production in plants |
| WO2014195920A3 (en) * | 2013-06-06 | 2015-05-28 | Novartis Ag | Influenza virus reassortment |
| CN105722976A (zh) * | 2013-06-06 | 2016-06-29 | 诺华股份有限公司 | 流感病毒重配 |
| US10329537B2 (en) | 2013-06-06 | 2019-06-25 | Seqirus UK Limited | Influenza virus reassortment |
| US11884929B2 (en) | 2014-01-10 | 2024-01-30 | Medicago Inc. | CPMV enhancer elements |
| WO2015103704A1 (en) * | 2014-01-10 | 2015-07-16 | Medicago Inc. | Cpmv enhancer elements |
| US11441150B2 (en) | 2014-01-10 | 2022-09-13 | Medicago Inc. | CPMV enhancer elements |
| WO2015143567A1 (en) | 2014-03-27 | 2015-10-01 | Medicago Inc. | Modified cpmv enhancer elements |
| US10563213B2 (en) | 2014-03-27 | 2020-02-18 | Medicago Inc. | Modified CPMV enhancer elements |
| US10736956B2 (en) | 2015-01-23 | 2020-08-11 | Icahn School Of Medicine At Mount Sinai | Influenza virus vaccination regimens |
| WO2017000074A1 (en) | 2015-07-02 | 2017-01-05 | Medicago Inc. | Jasmonic acid pathway activator |
| WO2017087492A1 (en) * | 2015-11-16 | 2017-05-26 | Kansas State University Research Foundation | Influenza virus vaccine and vaccine platform |
| US11266734B2 (en) | 2016-06-15 | 2022-03-08 | Icahn School Of Medicine At Mount Sinai | Influenza virus hemagglutinin proteins and uses thereof |
| US12233123B2 (en) | 2016-06-15 | 2025-02-25 | Icahn School Of Medicine At Mount Sinai | Influenza virus hemagglutinin proteins and uses thereof |
| US11865173B2 (en) | 2016-06-15 | 2024-01-09 | Icahn School Of Medicine At Mount Sinai | Influenza virus hemagglutinin proteins and uses thereof |
| US12607406B2 (en) | 2016-11-08 | 2026-04-21 | Academia Sinica | Recombinant virus, composition comprising the same, and uses thereof |
| US11254733B2 (en) | 2017-04-07 | 2022-02-22 | Icahn School Of Medicine At Mount Sinai | Anti-influenza B virus neuraminidase antibodies and uses thereof |
| US12030928B2 (en) | 2017-04-07 | 2024-07-09 | Icahn School Of Medicine At Mount Sinai | Anti-influenza B virus neuraminidase antibodies and uses thereof |
| JP2018110581A (ja) * | 2018-01-25 | 2018-07-19 | インスティテュート・フォー・リサーチ・イン・バイオメディシンInstitute For Research In Biomedicine | A型インフルエンザウイルス中和抗体及びその使用法 |
| US12180491B2 (en) | 2018-03-14 | 2024-12-31 | Aramis Biotechnologies Inc. | Plant expression enhancer |
| US12364746B2 (en) | 2018-06-21 | 2025-07-22 | Icahn School Of Medicine At Mount Sinai | Mosaic influenza virus hemagglutinin polypeptides and uses thereof |
| US12104196B2 (en) | 2018-06-27 | 2024-10-01 | Aramis Biotechnologies Inc. | Influenza virus hemagglutinin mutants |
| US12139511B2 (en) | 2018-06-27 | 2024-11-12 | Aramis Biotechnologies Inc. | Influenza virus hemagglutinin mutants |
| US12428661B2 (en) | 2018-06-27 | 2025-09-30 | Aramis Biotechnologies Inc. | Influenza virus hemagglutinin mutants |
| WO2020181354A1 (en) | 2019-03-14 | 2020-09-17 | Mitsubishi Tanabe Pharma Corporation | Endogenous plant expression enhancer |
| US12384811B2 (en) | 2019-04-05 | 2025-08-12 | Academia Sinica | Sialidase-resistant saccharide and method of making and using the same |
| US12545718B2 (en) | 2019-04-24 | 2026-02-10 | Icahn School Of Medicine At Mount Sinai | Anti-influenza B virus neuraminidase antibodies and uses thereof |
| JP2020048568A (ja) * | 2019-11-22 | 2020-04-02 | インスティテュート・フォー・リサーチ・イン・バイオメディシンInstitute For Research In Biomedicine | A型インフルエンザウイルス中和抗体及びその使用法 |
| JP2022061986A (ja) * | 2019-11-22 | 2022-04-19 | インスティテュート・フォー・リサーチ・イン・バイオメディシン | A型インフルエンザウイルス中和抗体及びその使用法 |
| US12178870B2 (en) | 2020-05-08 | 2024-12-31 | Academia Sinica | Chimeric influenza vaccines |
| EP4146241A4 (en) * | 2020-05-08 | 2024-06-05 | Academia Sinica | CHIMERIC INFLUENZA VACCINES |
| EP4146241A1 (en) | 2020-05-08 | 2023-03-15 | Academia Sinica | Chimeric influenza vaccines |
| US12257298B2 (en) | 2021-04-12 | 2025-03-25 | Academia Sinica | Coronavirus vaccine |
| US12157763B2 (en) | 2021-10-01 | 2024-12-03 | Academia Sinica | Antibody specific to spike protein of SARS-CoV-2 and uses thereof |
| US12318485B2 (en) | 2023-04-08 | 2025-06-03 | Rock Biomedical, Inc. | Methods and compositions for targeted delivery by polymersomes |
| US12508235B2 (en) | 2023-04-08 | 2025-12-30 | Rock Biomedical, Inc. | Methods and compositions for dendritic cell targeting nano-delivery |
| US12545941B2 (en) | 2023-05-17 | 2026-02-10 | Rock Biomedical, Inc. | MGAT1 deficient cells and uses thereof |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2010265766B2 (en) | Chimeric influenza virus-like particles comprising hemagglutinin | |
| CA2707235C (en) | Recombinant influenza virus-like particles (vlps) produced in transgenic plants expressing hemagglutinin | |
| EP2570484A1 (en) | Influenza virus-like particles (VLPS) comprising hemagglutinin | |
| EP3626733B1 (en) | Increasing virus-like particle yield in plants | |
| WO2010006452A1 (en) | New influenza virus immunizing epitope | |
| RU2569195C9 (ru) | Химерные вирусоподобные частицы, содержащие гемагглютинин, сходные с частицами вируса гриппа | |
| HK1200179B (en) | Increasing virus-like particle yield in plants | |
| HK1170250B (en) | Chimeric influenza virus-like particles comprising hemagglutinin | |
| HK1183324A (en) | Influenza virus-like particles (vlps) comprising hemagglutinin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080035066.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10791119 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2011/013517 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2762042 Country of ref document: CA Ref document number: 2010265766 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012516452 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20127001798 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 650/DELNP/2012 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012101946 Country of ref document: RU Ref document number: 2010791119 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2010265766 Country of ref document: AU Date of ref document: 20100625 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13380346 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI1015053 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: PI1015053 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: PI1015053 Country of ref document: BR Kind code of ref document: A2 Effective date: 20111226 |