Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
  • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/156—Polymorphic or mutational markers

Definitions

• the present invention relates to a method for cancer diagnosis and for monitoring cancer treatments based on the analysis of circulating DNA, in particular on the analysis of a specific DNA fragmentation pattern of repetitive elements or multi copy genes identified in body fluid samples.
• Cell free genomic DNA so called circulating DNA, which is present in serum, plasma and other body fluids (i.e. urine, ascites, etc.) at low concentrations (0.2 to 200 ng/ml) is highly degraded (Wang, et al., 2003, Cancer Res., 63 (14): 3966-8).
• circulating DNA e.g. p53, K- ras, EGFR
• p53, K- ras, EGFR tumor specific mutations
• the size of the full-length L1 is about 6.1 kb. Over 500,000 sequences exist in the entire human genome (Cordaux, R., 2008, Proc Natl Sci USA, 105 (49): 19033-4, Epub 2008, Dec 4). The use of methylated or unmethylated L1 in diagnosing, predicting, and monitoring of cancer progression and treatment was disclosed in WO 2008/134596.
• the present invention provides a significant improvement in the sensitivity and specificity of the method for early diagnosis of cancer, diagnosis for recurrence of such cancers and monitoring upon corresponding treatments.
• the invention relates to a method of diagnosis of cancer, comprising the steps of:
• step (b) comparing the DNA fragmentation pattern determined in step (a) with a DNA fragmentation pattern in a reference sample
• the invention relates to a method of monitoring progress or recess of disease in a patient suffering from cancer and being under cancer treatment comprising the steps of:
• step (a) determining a DNA fragmentation pattern of repetitive elements or multi copy genes represented by 4 to 6 fragments of 80 to 500 bp in a body fluid sample isolated from the monitored patient at the end of treatment, (b) comparing the DNA fragmentation pattern determined in step (a) with a DNA fragmentation pattern in a control sample isolated from the same individual before the treatment,
• DNA Serum of aftercare patients is taken before secondary intervention, DNA is isolated and pooled. All aftercare breast cancer patients develop a metastasis in brain or liver several months after blood sampling or are suspected to suffer from metastasis. DNA of healthy controls is isolated but not pooled.
• the DNA-fragmentation is analysed in both groups by LI N E 1 specific real-time PCR as described in Example 2.
• the DNA-fragmentation pattern of the patients differs significantly from the non diseased/healthy control group. In the amplicon range between -150 and -400 bp the relative amount of DNA is significantly increased as compared to non diseased/healthy controls and should be used for diagnosing recurrence. Therefore five or more DNA-amplicons may be measured in that range and used for the calculation of a DNA fragmentation index (DFI).
• DFI DNA fragmentation index
• X-axis DNA amplicon length (bp)
• Y-axis normalized DNA amplicon level.
• DNA of both groups is isolated and analysed by LINE1 specific real-time PCR as described in Example 4.
• the DNA-fragmentation pattern of the patients differs significantly from the non diseased/healthy control group.
• the amplicon range between -150 and -460 bp the relative amount of DNA is increased as compared to non diseased/ healthy controls and should be used for diagnosing recurrence. Therefore five or more DNA- amplicons may be measured in that range and used for the calculation of a DNA fragmen- tation index (DFI).
• DFI DNA fragmen- tation index
• X-axis DNA amplicon length (bp)
• Y-axis normalized DNA amplicon level.
• DNA-amplicons may be measured in the range between 150-780 bp and used for the calculation of a DNA fragmentation index (DFI).
• DFI DNA fragmentation index
• the range between 150 and 460 bp is sufficient and same sensitivity/ specificity is obtained as for the broader range.
• X-axis DNA amplicon length (bp)
• Y-axis normalized DNA amplicon level.
• DNA of both groups is isolated and analysed by LINE1 specific real-time PCR as described in Example 3.
• the DNA-fragmentation pattern of the cancer patients differs sig- nificantly from the control group.
• the relative amount of DNA is increased as compared to diseased control patients. Therefore five or more DNA-amplicons may be measured in the range between 150-460 bp and used for the calculation of a DNA fragmentation index (DFI).
• DFI DNA fragmentation index
• X-axis DNA amplicon length (bp)
• Y-axis normalized DNA amplicon level.
• Figure 3 Comparative ROC plot analysis. Diagnosis of HCC based on the DFI (closed circles) and alfa feto protein method (open circles, dashed line).
• the DFI is estimated by the analysis of five LINE1 fragments (148, 204, 249, 321 , and 463 bp) and computed by using equation [4.1] (see Example 3 for details).
• the area under the ROC plot for the DFI based (closed circles) diagnostic method is -0.89, and for the alfa feto protein (AFP) based (open circles, dashed line) method (i.e. ELISA) -0.75.
• the DFI is computed according to equation [4.1] after recording the relative level of five LINE1 fragments (148, 204, 249, 321 and 463 bp).
• 1 Patients suffering from hepatocellular carcinoma (HCC);
• 2 Patients suffering from liver cirrhosis, Y-axis: DFI (logarithmic scale).
• Figure 5 Box plot diagram comparing the DNA-fragmentation index in colon carcinoma patients with liver metastasis at the day of liver resection (1 , left hand side), aftercare colon carcinoma patients up to 240 days before surgical or conven- tional treatment (2, middle) of liver metastasis and healthy controls (3, right hand side).
• LINE1 fragments (148, 204, 248, 323 and 463 bp) are analyzed by real time PCR and the DFI is computed according to equation [4.1] as described in Example 4.
• the diagram exemplifies a clear discrimination of cancer patients from non diseased/healthy controls enabling a robust guess for the cut off value (in this example the DFI for diagnosing a relapse is > 200).
• DNA fragmentation pattern i.e. the relative abundance of DNA fragments of different sizes
• repetitive DNA elements e.g. LINE1 , SINE1 , LTR
• multi copy genes e.g. U1 RNA
• a DNA fragmentation pattern is repre- sented by 4 to 6 fragments, more preferred 4, most preferred 5 fragments; in a length range of 50 to 2000 base pairs, more preferably 80 to 1200 base pairs, most preferably 80 to 500 base pairs.
• thresholds cut offs
• a relative level of a DNA fragment is defined by the ratio of the amount of a tested DNA fragment and the amount of the shortest DNA fragment tested).
• the relative levels of the tested DNA fragments are the base for computing a DNA fragmentation index using an appropriate algorithm.
• the optimal size range is for a first fragment (A) 80 - 160 bp, for a second fragment (B') 200 - 220 bp, for a third frag- ment (B) 240 - 260 bp, for a fourth (B") fragment 300 - 380 bp, and for a fifth (C) fragment 400 - 500 bp.
• the identified thresholds define the region in the DNA- fragmentation pattern plot indicative for the diagnosis of cancer.
• the DNA fragments can be derived from the same gene / repetitive element or from different genes (e.g. LINE1. SINE, LINE2, U1 RNA etc.).
• the DNA fragments are in a range of 50 and 2000 base pairs, preferably 80 to 1200 base pairs, most preferred 80 to 500 base pairs.
• DFI DNA fragmentation index
• the invention provides a method of determining whether a tested patient is suffering from cancer.
• a body fluid sample is obtained from the patient to be diagnosed, and the level of DNA fragments of repetitive element(s) and/or multi copy genes, preferably LINE1 , in the sample is determined.
• the level of the DNA fragments of a fragmentation pattern of LINE1 in the sample is compared with a control LINE1 DNA fragmentation pattern derived from a reference sample or a pool of reference samples, and the result of the comparison used to decide whether the subject is likely to be suffering from cancer.
• a reference sample is a sample obtained from a non diseased subject (healthy individual).
• the invention also provides methods of monitoring cancer progression and treatment, as well as methods for predicting the outcome of cancer. These methods involve obtaining a body fluid sample from a patient suffering from cancer to be monitored, determining the level of fragments of repetitive element(s) and/or multi copy genes, preferably LINE1 DNA fragments, in the sample, and comparing it to a LINE1 DNA fragmentation pattern in a control sample from a patient or a pool of patients suffering from the corresponding cancer.
• a control patient may be a different patient suffering from the same type of cancer, or preferably the same patient at a different time point, e.g., at a different cancer stage, or before, during, or after a cancer treatment (e.g. surgery or chemotherapy).
• the method according to the invention surprisingly provides an improved, sustained and/or more effective method of diagnosing of cancer and/or monitoring of cancer treatment, in particular of primary liver cancers (e.g. hepa- tocellular carcinomas), secondary liver cancer derived from primary breast cancer, primary colorectal cancer, colon cancer, lung cancer, breast cancer, ovarian cancer, as well as a general method of monitoring relapse of cancer(s).
• primary liver cancers e.g. hepa- tocellular carcinomas
• secondary liver cancer derived from primary breast cancer e.g. hepa- tocellular carcinomas
• colon cancer e.g. hepa- tocellular carcinomas
• lung cancer e.g. hepa- tocellular carcinomas
• breast cancer e.g. hepa- tocellular carcinomas
• a general method of monitoring relapse of cancer(s) e.g. hepa- tocellular carcinomas
• DNA fragmentation pattern refers to the distribution of DNA fragments.
• the DNA fragments differ in length (i.e. number of base pairs) between 50 and 2000 base pairs.
• the DNA fragmentation pattern can be assessed by various quantitative and semi quantitative methods, especially by DNA amplification (i.e. PCR, LCR, IMDA) and DNA hybridization (i.e. array hybridization) but also by capillary electrophoresis.
• the minimal DNA fragmentation pattern used for diagnosis is represented by at least 4 DNA fragments but not more than 15 fragments differing in length; preferably between 4 and 6 fragments, more preferably 4, and most preferably 5 fragments.
• the minimal DNA fragmentation pattern for diagnosis is evaluated by recording the DNA fragments in size between 80 and 500 bp (see Figure 1A, 1 B, 1 C and Figure 2).
• the DNA fragmentation pattern is recorded in a disease positive and a clinical relevant disease negative control cohort.
• a disease positive and a clinical relevant disease negative control cohort For optimal discrimination of the two cohorts at least 4 DNA fragments differing in length, preferably between 4 and 6 fragments, more preferred 4, and most preferred 5 fragments, are compared.
• a DNA fragmentation pattern of cancer subjects is regarded as "substantially different", if a difference of the DNA fragmentation pattern when compared to the clinical cohort (obtained by the analysis of the DNA fragmentation pattern in a reference sample or several reference samples) is statistically significant (i.e. p ⁇ 0.05).
• Statistical significance is analyzed by computing a mean DNA-fragmentation index and its standard deviation for each patient / healthy subject and comparing the DFI of two or more groups (i.e. cancer versus control) using standard statistical methods (i.e. Student's t-test etc.).
• the difference of the mean DNA-fragmentation index of two samples is interpreted as unequivocally different, if the difference is at least two times the mean standard deviation of these two samples.
• petitive elements also known as “repetitive sequences” defines sequences, wherein a particular DNA partial sequence is repeated at least four times. Repetitive elements account for at least 50% of the human genome. Two types of such elements are encompassed: (1 ) tandem repeats (i.e. microsatellites) and (2) transposable elements (i.e. short and long interspersed elements: SINESs and LINEs), the latter repre- senting 90% of the overall human repetitive sequences. Three LINE families, LINE1 , LINE2, and LINE3 account for 20% of the human genome. Among those families only LINE1 (L1 ) is capable of transposition and is most abundant (accounts for approximately 17% of human DNA).
• multicopy genes relates to gene sequences with an approximate number of at least 8 copies, e.g. U1 RNA.
• body fluid refers to any body fluid in which a cellular DNA or cells (e.g., cancer cells) may be present, including, without limitation, blood, serum, plasma, urea, bone marrow, cerebral spinal fluid, peritoneal/pleural fluid, pleural effusions, lymph fluid, spinal fluid, ascite, serous fluid, sputum, lacrimal fluid, stool, saliva and urine.
• Body fluid samples can be obtained from a patient using any of the methods known in the art.
• sample refers to a biomaterial comprising the above defined “body fluid”.
• the sample can be isolated from a patient or another subject by means of methods including “invasive” or “non-invasive” methods. Invasive methods are generally known to the skilled artisan and comprise, for example, isolation of the sample by means of puncturing, surgical removal of the sample from the opened body or by means of endoscopic instruments. Minimally invasive and non-invasive methods are also known to the person skilled in the art.
• minimally invasive refers to methods generally known for obtaining patient sample material that do preferably not require anesthesia, can be rou- tinely accomplished in a physician office or clinic and are either not painful or only nominally painful.
• the most common example of a minimally invasive procedure is venupunc- ture.
• the "non-invasive" methods do not require penetrating or opening the body of a patient or subject through openings other than the body openings naturally present such as the mouth, ear, nose, rectum, urethra, and open wounds.
• the term "reference sample” refers to a sample that serves as an appropriate control to evaluate the differential DNA fragmentation pattern according to the invention in a given sample isolated from a patient diagnosed for cancer; the choice of such appropriate reference sample is generally known to the person skilled in the art.
• reference samples include samples isolated from a non-diseased organ or tissue or cell(s) or body fluids of the same patient or from another subject, wherein the non-diseased organ or tissue or cell(s) or body fluid is selected from the group consisting of tissue or cells, blood, or the samples described above.
• the reference sample may also include a sample isolated from a non-diseased organ or tissue or cell(s) of a different patient, wherein non-diseased tissue or cell(s) is selected from the sample group listed above.
• the reference may include samples from healthy donors, preferably matched to the age and sex of the patient.
• control sample refers to a sample that serves as an appropriate positive control to evaluate the differential DNA fragmentation pattern according to the invention in a given sample isolated from a patient monitored for cancer; the choice of such appropriate control sample is generally known to the person skilled in the art.
• control samples include samples isolated from a diseased organ or tissue or cell(s) or body fluids of the same patient (at a different point in time) or from another subject, wherein the diseased organ or tissue or cell(s) or body fluid is selected from the group consisting of tissue or cells, blood, or the samples described above.
• control sample may also include a sample isolated from a diseased organ or tissue or cell(s) of a different patient, wherein diseased tissue or cell(s) is selected from the sample group listed above.
• control may include samples from diseased donors, preferably matched to the age and sex of the patient.
• a "patient” refers to a human or animal, including all mammals such as primates (particularly higher primates), sheep, dog, rodents (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbit, and cow, dead or alive.
• the subject is a human.
• the subject is an experimental animal or animal suit- able as a disease model.
• the patient is either suffering from cancer, preferably liver cancer (hepatocellular carcinoma), secondary liver cancer, breast cancer, colon cancer, lung cancer, prostate cancer, gastric cancer, ovarian cancer, including also relevant at risk groups for developing cancer (i.e. patients suffering from liver cirrhosis, patients with genetic predisposition for developing cancer, and aftercare patients), subject to analysis, preventive measures, therapy and/or diagnosis in the context of a disorder according to the invention.
• cancer preferably liver cancer (hepatocellular carcinoma), secondary liver cancer, breast cancer, colon cancer, lung cancer, prostate cancer, gastric cancer, ovarian cancer, including also relevant at risk groups for developing cancer (i.e. patients suffering from liver cirrhosis, patients with genetic predisposition for developing cancer, and aftercare patients), subject to analysis, preventive measures, therapy and/or diagnosis in the context of a disorder according to the invention.
• cancer refers to a disease or disorder characterized by uncontrolled division of cells and the ability of these cells to spread, either by direct growth into adjacent tissue through invasion, or by implantation into distant sites by metastasis.
• Ex- emplary cancers include, but are not limited to, carcinoma, adenoma, lymphoma, leukemia, sarcoma, mesothelioma, glioma, gerrainoma, choriocarcinoma, prostate cancer, lung cancer, breast cancer, colorectal cancer, gastrointestinal cancer, bladder cancer, pancreatic cancer, endometrial cancer, ovarian cancer, melanoma, brain cancer, testicular cancer, kidney cancer, skin cancer, thyroid cancer, head and neck cancer, liver cancer includ- ing primary (i.e.
• cancer includes primary and secondary tumour sites.
• the cancer is primary and secondary liver cancer, colorectal cancer, breast cancer, prostate cancer, lung cancer, ovarian cancer, gastric cancer, bladder cancer and kidney cancer.
• liver cancer within the meaning of the invention includes carcinomas in the liver, preferably hepatocellular carcinoma (HCC), metastases in liver originated from any organ (e.g. colon, breast), cholangiocarcinoma, in which epithelial cell components of the tissue are transformed resulting in a malignant tumor identified according to the stan- dard diagnostic procedures as generally known to a person skilled in the art.
• HCC hepatocellular carcinoma
• metastases in liver originated from any organ (e.g. colon, breast)
• cholangiocarcinoma in which epithelial cell components of the tissue are transformed resulting in a malignant tumor identified according to the stan- dard diagnostic procedures as generally known to a person skilled in the art.
• HCC hepatocellular carcinoma
• metastases in liver originated from any organ (e.g. colon, breast)
• cholangiocarcinoma in which epithelial cell components of the tissue are transformed resulting in a malignant tumor identified according to the stan- dard diagnostic procedures
• precancerous lesions are preferably also included such as those characterized by increased hepatocyte cell size (the "large cell” change), and those characterized by decreased hepatocyte cell size (the “small cell” change) as well as macro regenerative (hyperplastic) nodules (Anthony, P. in MacSween et al, eds. Pathology of the Liver. 2001 , Churchill Livingstone, Edinburgh).
• disorder according to the invention encompasses cancer as defined above, for example liver cancer, preferably HCC.
• treatment within the meaning of the invention refers to a treatment that preferably cures the patient from a disorder according to the invention and/or that improves the pathological condition of the patient with respect to one or more symptoms associated with the disorder, preferably 3 symptoms, more preferably 5 symptoms, most preferably 10 symptoms associated with the disorder on a transient, short-term (in the order of hours to days), long-term (in the order of weeks, months or years) or permanent basis, wherein the improvement of the pathological condition may be constant, increasing, decreasing, continuously changing or oscillatory in magnitude as long as the overall effect is a significant improvement of the symptoms compared with a control patient.
• LINE1 DNA may exist as either “cellular” or “acellular” DNA in a subject. "Acellular" or “acellular” DNA in a subject. "Acellular”
• DNA refers to DNA that exists outside a cell in a body fluid of a subject or the isolated form of such DNA.
• Cellular DNA refers to DNA that exists within a cell or is isolated from a cell.
• acellular DNA in a body fluid sample is separated from cells by cell sedimentation, precipitated in alcohol, and dissolved in an aqueous solution.
• Methods for extracting cellular DNA from body fluid samples are also well known in the art (Sambrook, J. and Russel, D.W., 2001 , Preparation and analysis of eukaryotic genomic DNA.
• the invention relates to a method of diagnosis of cancer, comprising the steps of:
• step (a) determining a DNA fragmentation pattern of repetitive elements or multi copy genes represented by 4 to 6 fragments of 80 to 500 bp in a body fluid sample isolated from a patient suspected to have cancer, (b) comparing the DNA fragmentation pattern determined in step (a) with a
• the invention relates to a method of monitoring progress or recess of disease in a patient suffering from cancer and being under cancer treatment comprising the steps of: (a) determining a DNA fragmentation pattern of repetitive elements or multi copy genes represented by 4 to 6 fragments of 80 to 500 bp in a body fluid sample isolated from the monitored patient at the end of treatment,
• step (b) comparing the DNA fragmentation pattern determined in step (a) with a DNA fragmentation pattern in a control sample isolated from the same indi- vidual before the treatment,
• the DNA fragmentation pattern is represented by 5 fragments.
• the DNA fragmentation pattern represented by 5 fragments comprises a first fragment in a range between 80 and 160 bp, a second fragment in a range between 200 and 220 bp, a third fragment in a range between 240 to 260 bp, a fourth fragment in a range between 300 and 380 bp and a fifth fragment in a range between 400 and 500 bp.
• One of the preferred embodiments of the repetitive element is LINE1 , SINE1 or LTR and of the multi copy gene is U1 RNA.
• the most preferred embodiment of the repetitive element is LINE1.
• the body fluid is blood, serum, plasma, urine, bone marrow, peritoneal fluid, or cerebral spinal fluid.
• the body fluid is serum or plasma.
• a preferred embodiment of cancer is liver, breast, colon, colorectal, lung, prostate, ovarian or gastric cancer. Further preferred embodiment of liver cancer is primary or sec- ondary liver cancer. The most preferred embodiment of liver cancer is hepatocellular carcinoma (HCC).
• HCC hepatocellular carcinoma
• Example 1 Methods of sample analysis and DNA fragment pattern selection.
• DFI DNA fragmentation index
• Qiagen MinElute Virus Vacuum kit Cat. No. 57714, Qiagen, Hilden, Germany
• Frozen plasma samples (2 - 2.5 ml) are processed using the Qiagen MinElute Virus Spin kit (Cat. No. 57704, Qiagen, Hilden, Germany) following the instructions of the manufacturer (
• Isolated DNA present in a total volume of up to 20 ⁇ l, is quantified using the Pi- coGreen assay (Cat. No. P1 1496, Invitrogen, Carlsbad, CA, USA) following the instructions of the manufacturer (revised version 20-December-2005 / MP07581 ).
• the standard curve ranges from 1 to 100 ng human genomic DNA per ml (Applied Biosystems, Foster City, CA, USA).
• Step (3) Quantification of DNA fragments by real-time PCR
• Step (4) Data evaluation and fragment pattern selection For each individual patient the level of each tested gene fragment is normalized to the shortest gene fragment tested. To compare different patients or risk groups the mean level of the normalized gene fragment and its standard deviation is estimated for each amplicon size and each group. To obtain the DNA fragmentation pattern the mean nor- malized DNA amplicon level is plotted versus the amplicon size (see Figures 1A, 1 B, 1 C and 2). For each indication of interest the DNA fragmentation pattern is compared to a clinical relevant control cohort (see Figures 1A, 1 B, 1 C and 2). The clinical relevant control cohort presents the clinical subgroups which have to be discriminated by the diagnostic assay (e.g. liver cirrhosis vs.
• the diagnostic assay e.g. liver cirrhosis vs.
• the DNA-fragmentation pattern of the disease groups shows a significant deviation form the clinical relevant control group in hepatocellular carcinoma, metastatic breast cancer and metastatic colon carcinoma.
• different characteristics of the DNA-fragmentation pattern curve i.e. differences and changes of the slope of the curve, area under the curve
• the slope of the DNA fragmentation pattern curve of HCC patients between amplicon size 149 and 463 bp differs significantly from the pattern of liver cirrhosis patients. Therefore, the region between amplicon size 149 and 463 bp is chosen for selection of a DNA-fragment pattern to diagnose HCC.
• a similar region is selected for the diagnosis of breast cancer and breast cancer recurrence (see Example 2, Figure 1 A), as well as colon carcinoma and colon carcinoma recurrence (see Example 4, Figure 1 B & 1 C).
• the comparison of diseased patient and control donors indicates significant differences in the DNA fragmentation pattern. Therefore optimal diagnosis (high sensitivity and specificity) is obtained by the combination of the observed differences rather than using a single discriminator. This advantage is of importance when early or minimal residual disease status has to be diagnosed rather than highly advanced disease.
• DNA fragmentation index is further used to compare diseased and control patients and to define a threshold level (cut off level) for diagnosing cancer, to monitor treatment response as well as disease progression.
• a DNA fragmentation index is used in an empiric algorithm the area under the curve as well as ratios and differences of normalized levels of gene fragments/amplicons are used in order to compute a DNA fragmentation index (DFI).
• the DNA fragments used for the calculation of the DFI are selected from the DNA fragmentation pattern of comparing clinical relevant groups (i.e. dis- eased versus control). In the example for diagnosing HCC the fragments are selected in the range between 148 and 463 bp (see Example 3). For three fragments the DFI is computed according to equation [1].
• DFI 3 F(B) norm /F(A) norm x F(B) norm /F(C) norm x (F(B) norm - F(C) norm ) [1 ]
• DFI 4 F(B) norm /F(A) norm x F(D) norm /F(A) norm x F(B) norm /F(C) n orm x F(D) norm /F(C) n orm x (F(B) norm - F(C) norm ) x (F(D) norm - F(C) norm ) [2 ⁇
• DFI n DNA fragmentation index calculated using n fragments A, B, C, D indicate four different amplicon sizes with the order A ⁇ B ⁇ C ⁇ D...
• F(A), F(B), F(C), F(D), F(X) relative concentration of fragment A, B, C, D, and X, respectively, per ml body fluid
• F(A) norm F(A) normalized to F(A), i.e. 1.
• F(B) norm , F(C) norm , F(D) norm : F(B), F(C), and F(D), respectively, normalized to F(A) X 1 , X 2 ...X n indicate different amplicon sizes with the order X 1 ⁇ X 2 ⁇ ... ⁇ X n
• DFI area Area x F(B) norm /F(C) norm [4]
• fragments for optimal DFI calculation are selected after recording of the DNA-fragmentation pattern by comparing a disease positive and a clinical relevant dis- ease negative control cohort (see plot normalized DNA amplicon level versus. DNA amplicon size).
• the minimal DNA fragmentation pattern for cancer patient diagnosis records three DNA fragments: 1 ) F(A): a short DNA fragment between 80 and 150 bp in length
• F(B) a DNA fragment between 200 and 270 bp in length
• F(C) a DNA fragment between 360 and 500 bp in length
• DNA fragmentation pattern and subsequently the DFI can be deter- mined also by using SINE, U 1 RNA, beta-actin or other repetitive elements or multi copy genes.
• SINE SINE
• U 1 RNA U 1 RNA
• beta-actin other repetitive elements or multi copy genes.
• specific primers are designed, covering the same range of amplicon sizes. However, minor deviations in amplicon sizes (e.g. ⁇ 15 bp) due to primer design are negligible.
• Table 1 Primer sequences for LINE1. Start/ end indicate the position of the first and last base of the primer annealing site with LINE1. R: reverse primer; F: forward primer. For primer combinations see Table 2. primer primer ID primer sequence 5'->3' start end length (bp) direction
• OrBi-219 GGTTTGAATGTCCTCCCGTA 1073 1092 20 r
• OrBi-223 GCCCAGGCTTGCTTAGGTA 452 470 19 f
• OrBi-226 TCCTGAGGCTTCTGCATTCT 1215 1234 20 r
• Table 2 LINE1 fragments analyzed by real-time PCR. Primers designed for amplification of different amplicon sizes (bp). For primer sequences see Table 1. amplicon
• Example 2 Relapse diagnosis of metastatic breast cancer by DNA-fragmentation analysis.
• LINE1 fragments with indicated bp length are analyzed (see Table 2), normalized, and plotted (see Figure 1 B).
• the DNA fragmentation pattern (see Figure 1A) of pooled breast cancer sera indicates an increased level of DNA fragments between 200 and 400 bp as compared to healthy controls.
• the DNA fragmentation index (DFI) is computed for each patient/pool according to equation [2] (using LINE1-B, LINE1-C, LINE1-E and LINE1-F, see Table 2) as well as equation [4] (using LINE1-B, LINE1-C, LINE1-D, LINE1-E and LINE1-F, see Table 2).
• the mean DFI 4 (equation [2]) for healthy control is 0.02 ⁇ 0.01 compared to 0.64 for the breast cancer pool; thus indicating a potential cut off around 0.1.
• the mean DFI area is computed for the area between 148 and 323 bp and is 146 ⁇ 77 and 300.5 for non diseased/healthy controls and the breast cancer pool, respectively. A potential cut off may be around 200.
• the computation of the mean DFI area for the area between 148 and 463 bp results in 193 ⁇ 82 and 449 for non diseased/healthy controls and the breast cancer pool, respectively. This results demonstrates a significantly improved discrimination/diagnosis of cancer (e.g. me- tastatic breast cancer) when compared to methods known in the prior art.
• the mean DFI area is computed to be 63 ⁇ 22 and 855 for non diseased/healthy controls and the breast cancer pool, respectively.
• a cut off for the DFIa r ea around 150 for diagnosing (metastatic) breast cancer is suggested.
• the inclusion of curve characteristics for the diseased group stepwise improves the power of discrimination of the two cohorts.
• Example 3 Diagnosis of hepatocellular carcinoma by DNA-fragmentation analysis.
• the DNA fragmentation pattern of patients with liver cirrhosis (at-risk patients) and patients with HCC is recorded as indicated in Example 1 ).
• LINE1 fragments with indicated sizes are analyzed (see Table 2), normalized, and plotted (see Figure 2).
• Figure 2 shows a significantly different curve of the DNA fragmentation pattern of HCC patients as compared to at risk patients suffering from liver cirrhosis. Therefore, the diagnosis of HCC may be obtained by recording the DNA fragmentation pattern in the indicated range of 148 to 783 bp, but at least between 148 and 463 bp and comparison with the DNA- fragmentation pattern of patients with liver cirrhosis and/or chronic hepatitis C.
• the DNA- fragmentation pattern of HCC patients differs most significantly from the control group between 204 and 463 bp.
• the area under the ROC plot for AFP is 0.75 ⁇ 0.09 which indicates that a DNA-fragmentation-pattern based diagnosis is superior, independently how many LINE1 fragments are used (see Table 4).
• box plot analysis Figure 4 the differentiation of cancer (i.e. HCC) and at-risk patients (i.e. cirrhosis) by DNA fragmentation pattern analysis becomes obvious.
• the DNA fragmentation of HCC patients differs significantly from the control cohort of patients suffering from liver cirrhosis (see Figure 2).
• the superiority of the DNA fragmentation pattern analysis as diagnostic tool as compared to AFP analysis, and the improvement by multi-DNA fragment analysis is clearly recognizable.
• An optimal algorithm may represent the differences (i.e. sign and magnitude) and the changes (i.e. infliction point) of the slope of the DNA fragmentation pattern by combining appropriate fragment ratios and differences of the relative fragment levels.
• the general equation [3] (equation [1] and [2] are derived from the general equation [3] for 2 and 3 DNA fragments, respectively) and the equations [4] and [4.1] are given as examples for such algorithms.
• the DNA fragmentation pattern in these groups is recorded and analysed as indicated in Example 1 and 2.
• the same LINE1 fragments as used for the diagnosing HCC in at risk patents suffering from liver cirrhosis may be used for diagnosing HCC in at risk patients suffering from chronic hepati- tis C or B.
• Table 4 Comparing 2, 3, 4 and 5 LINE1 fragment based HCC diagnosis. Four and five fragment based diagnostic methods are superior to two and three fragment based methods as indicated by the increase of the area under the ROC plot.
• Table 5 Comparing 2, 3, 4 and 5 LINE1 fragment based HCC diagnosis. Four and five fragment based diagnostic methods are superior to two and three fragment based approaches as indicated by the comparison of mean and 95% confidence intervals of the two patient groups. The observed difference is of advantage for the definition of the cut off value.
• the DFI is computed as indicated in Table 4.
• Example 4 Relapse diagnosis of metastatic colon cancer by DNA-fragmentation analysis.
• LINE1 fragments with amplicon length between 148 and 783 bp are quantified by real time PCR, normalized, plotted and finally a DNA fragmentation index (DFI) is computed.
• the serum derived DNA fragmentation pattern of healthy donors is compared with the serum derived DNA fragmentation pattern of colon carcinoma patients at two different time points and different clinical stages:
• liver surgery (named group 1 )
• the DNA fragmentation index (DFI) is computed for both colon cancer groups using equation [4.1]. Accordingly a DFI threshold for disease free subjects, based on the non diseased/healthy control group, is estimated to approximately 100. A DFI of 200 may already indicate a relapse.
• the box plot in Figure 6 compares the DFI (equation [4.1 ]) of group 1 patients and group 2 patients and non diseased/healthy controls. Both patient groups can be optimally separated from the healthy control group. The observed differ- ences are statistically significant. In both clinical situations the sensitivity and specificity of the method is 100% (ROC plot not shown). These results indicate that the developed method is appropriate to monitor cancer patients (i.e.
• colon carcinoma, breast, cancer, prostate cancer, lung cancer etc. for relapse diagnosis in order to achieve early diagnosis.
• This method may also be used as a surrogate marker of tumour response to new treatments.
• the diagnostic method may also be used as a marker for diagnosis of a primary tumour.
• Table 6 Comparing the diagnostic power of a five- vs. a two- DNA -fragment- based assay.
• Example 5 Surrogating therapy response of cancer treatment by DNA fragmenta- tion analysis.
• the serum derived DNA fragmentation pattern of a cancer patient before and at the end of an anti-cancer treatment is recorded in triplicates. Subsequently from samples at both time points the mean DNA fragmentation index and its standard deviation is calculated. The mean DNA-fragmentation indexes in samples of both time points are compared with each other. A difference of the mean DNA-fragmentation indexes greater than two times the mean standard deviation is interpreted as unequivocally different. If the DNA- fragmentation index has unequivocally increased after treatment the patient is classified as non-responder. Responders are characterized by an unequivocal decrease of the DNA-fragmentation index at the end of the treatment. A difference of the DNA- fragmentation index which is not unequivocally different indicates no change and can be interpreted as stable disease.
• a clinical validation of the use of the DNA-fragmentation index as a surrogate for treatment response can be obtained by the correlation of the DNA-fragmentation index derived classification with the clinical outcome and/or with tumour-imaging data.

Priority Applications (9)

Applications Claiming Priority (2)

Publications (1)

Family

ID=41087367

Family Applications (1)

Country Status (10)

Cited By (17)

Families Citing this family (2)

Citations (2)

• 2010
  • 2010-03-12 JP JP2012502549A patent/JP2012521772A/ja not_active Withdrawn
  • 2010-03-12 NZ NZ595993A patent/NZ595993A/xx not_active IP Right Cessation
  • 2010-03-12 AU AU2010230417A patent/AU2010230417B2/en not_active Ceased
  • 2010-03-12 EP EP10709480A patent/EP2414540A1/en not_active Withdrawn
  • 2010-03-12 CA CA2757131A patent/CA2757131A1/en not_active Abandoned
  • 2010-03-12 SG SG2011066479A patent/SG174401A1/en unknown
  • 2010-03-12 WO PCT/EP2010/053152 patent/WO2010112316A1/en active Application Filing
  • 2010-03-12 RU RU2011143425/10A patent/RU2011143425A/ru not_active Application Discontinuation
  • 2010-03-12 CN CN2010800157614A patent/CN102369299A/zh active Pending
  • 2010-03-12 US US13/262,363 patent/US20120021428A1/en not_active Abandoned

Patent Citations (2)

Non-Patent Citations (24)

Also Published As

Similar Documents

Legal Events