WO2010057525A1 - Amorces oligonucléotidiques pour l'indexage nucléotidique de produits d'acp polymorphes et leurs procédés d'utilisation - Google Patents

Amorces oligonucléotidiques pour l'indexage nucléotidique de produits d'acp polymorphes et leurs procédés d'utilisation Download PDF

Info

Publication number
WO2010057525A1
WO2010057525A1 PCT/EP2008/065804 EP2008065804W WO2010057525A1 WO 2010057525 A1 WO2010057525 A1 WO 2010057525A1 EP 2008065804 W EP2008065804 W EP 2008065804W WO 2010057525 A1 WO2010057525 A1 WO 2010057525A1
Authority
WO
WIPO (PCT)
Prior art keywords
polymorphisms
sequence
amplified
sequences
read start
Prior art date
Application number
PCT/EP2008/065804
Other languages
English (en)
Inventor
Sara Botti
Elisabetta Giuffra
Original Assignee
Fondazione Parco Tecnologico Padano
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fondazione Parco Tecnologico Padano filed Critical Fondazione Parco Tecnologico Padano
Priority to PCT/EP2008/065804 priority Critical patent/WO2010057525A1/fr
Publication of WO2010057525A1 publication Critical patent/WO2010057525A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification

Definitions

  • the present invention relates to a new oligonucleotide for use as PCR primer, comprising three different portions, i.e. a portion of a universal primer for automated sequencers, a read start portion and a portion complementary to a region of the target sequence to be amplified, methods for the detection or the identification of polymorphisms or polymorphism patterns of nucleotide sequences amplified by PCR with the said oligonucleotides, methods for detection and analysis of the said polymorphisms or polymorphism patterns and to kits comprising products useful for carrying out the said methods.
  • polymorphisms are widely used and of great interest at least for medical, forensic, genetic, alimentary analysis.
  • polymorphic patterns in determined loci allow the detection of genetic diseases, allow the genotypic characterization of individuals and their recognisability within a species, allow the identification of species in animal and plant families or classes or orders or phyla from tissue or cells samples.
  • the usefulness of polymorphisms analysis is not limited to the above and widens at a very high rate together with the evolution of biotechno logical tools and knowledge. It is of great interest, hence, to easy and speed up the detection and/or the identification of polymorphisms inside a nucleotide sequence and to facilitate as much as possible the analysis of the detected or of the identified polymorphisms.
  • PCR is widely used for the amplification of polymorphic sequences at given loci and provides sufficient material for carrying out sequence analysis also from very low amounts of starting nucleic acid material.
  • automated sequencers further facilitate the work (and improve the health) of the researchers as nucleotide sequences can now be obtained without the use of hazardous denaturing gels and/or radio-labelled nucleotides.
  • Even the genetic banks available online as well as sequence alignments programs freely available online further facilitate the work of the researchers speeding up the detection of known polymorphisms or the identification of new polymorphisms and the analysis of polymorphic patterns in general.
  • nucleotide polymorphisms can be used as genetic markers and/or for the development of new pharmaceutical compounds.
  • polymorphic patterns are characteristics of individuals at certain loci, of species at other loci, of families, of orders and of phyla at even other loci
  • detection, identification and analysis of specific nucleotide polymorphisms or of polymorphic patterns in one or more loci can allow the assessment of paternity or maternity and can provide aid in the identification of criminals.
  • polymorphisms and/or polymorphic patterns at certain loci can allow the identification of different species
  • polymorphisms analysis can also be carried out in order to track food origins and to identify the composition of a certain food product and to verify whether certain products are or are not composed of the claimed material.
  • RFLPs Restriction Fragment Length Polymorphisms
  • triplets polymorphisms as the polymorphisms present in the human X fragile site
  • STRs Short Tandem Repeats polymorphisms
  • SNPs Single Nucleotide Polymorphisms
  • the information is used in one or more sequence alignments against the target sequence and, if needed, against the various amplicons obtained, in order to identify whether polymorphisms, and which polymorphisms are present.
  • the analysis of the sequences and of the possible polymorphisms present therein and of polymorphic patterns when a pool of sequences is under study, is at present a step (or several steps) time consuming and toilsome that cannot be fully automated and requires each time the work of the researcher for determining whether polymorphisms are present and for the screening thereof and the identification of specific polymorphic patterns.
  • oligonucleotides for PCR (especially multiplex PCRs) exist, that renders the sequencing task simpler by the addition, at the 5' of the said primers, of a sequence complementary to universal primers for automated sequencers which allows the use of a single sequencing primer for sequencing the amplified product of a multiplex PCR, as disclosed in EP0832290.
  • the strategy of the primers design and the method used in the present invention enable the user to detect and/or identify and also to analyse nucleotide sequence polymorphisms in the forensic, alimentary, medical and genetic field.
  • the method includes the use of the Polymerase Chain Reaction (PCR) to amplify polymorphic regions of the genome from total cellular DNA and subsequent sequencing of the PCR products and identification of SNPs (Single Nucleotide Polymorphism) or other DNA polymorphisms in samples in which DNA may be also very degraded (e.g. highly processed meat products).
  • PCR Polymerase Chain Reaction
  • SNPs Single Nucleotide Polymorphism
  • the primers herein described are also used in a molecular method for the amplification of small regions of the mitochondrial cytochrome b gene for the identification of 17 fish species in the Scombridae family.
  • the present invention discloses new single stranded oligonucleotides comprising, ordered from 5' to 3', a portion of a universal primer for automated sequencers located at the 5' of said oligonucleotide, a read start portion and a portion complementary to a region of the target sequence to be amplified; a method for the detection of polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a. sequencing nucleotide sequences amplified with one or more pair, forward and reverse, of oligonucleotides according to the description with an automated sequencer using a universal primer comprising said 5 ' portion; b.
  • detecting in said sequences said read start portion c. indexing nucleotides of said amplified sequences, from said detected sequence said read start portion; d. detecting in said indexed sequences polymorphisms or polymorphisms patterns; a method for the analysis of polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a. sequencing nucleotide sequences amplified with one or more pair, forward and reverse, of oligonucleotides according to the description with an automated sequencer using a universal primer comprising said 5 ' portion; b. detecting in said sequences said read start portion; c.
  • indexing nucleotides of said amplified sequences from said read start portion; d. detecting in said indexed sequences polymorphisms or polymorphisms patterns; e. analysing the data obtained at step d; a method for the detection and identification of new polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a. sequencing nucleotide sequences from given samples amplified with one pair, forward and reverse, of oligonucleotides according to the description with an automated sequencer using a universal primer comprising said 5' portion; b. detecting in said sequences said read start portion; c.
  • indexing nucleotides of said amplified sequences from said read start portion; d. detecting in said indexed sequences the presence polymorphisms or polymorphisms patterns in comparison to a reference sequence; e. sequencing nucleotide sequences from the same samples of step a. amplified each with a different pair, forward and reverse, of oligonucleotides according to the description, each pair of oligonucleotides having a different read start, with an automated sequencer using a universal primer comprising said 5 ' portion; f. detecting in said sequences said read start portions; g.
  • indexing nucleotides of said amplified sequences from said read start portions, each sample being recognisable by a specific read start portion; h. identifying in said indexed sequences the polymorphisms or polymorphisms patterns in comparison to a reference sequence and, optionally, i. analysing the data obtained at step h; a method for the detection and identification of new polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a.
  • a software capable of carrying out the methods described above; a computer readable storage support wherein the software above is stored; a kit comprising one or more aliquot of at least two oligonucleotides, forward and respective reverse, oligonucleotides of the invention, and optionally one or more aliquot of a universal primer for automated sequencer wherein said universal primer comprises a region that is complementary to said 5 ' portion.
  • FIGURES Figure Ia represents an example of a PCR primers Cocktail with the primers of the description, said primers comprising three essential portions: a white portion (in the Fw, Forward, and Rw, Reverse, primer) herein named "PUP" (Partial Universal Primer) which is a portion of a universal primer for automated sequencers located at the 5', a dotted portion called RS (Read Start) signal and a gray portion of the gene (or sequence) of interest to be amplified (GOI) and a suitable pair of sequencing primers three portions as well, i.e. a white portion (in the Fw and Rw primer) called UP (Universal Primers), a dotted portion called RS (Read Start) signal and a small gray portion of the gene of interest (GOI).
  • PUP Partial Universal Primer
  • Figure l.b shows the same sequence primers of figure l.a.
  • Figure l.c shows another suitable pair of primers comprising only the: white
  • the PCR primer shall comprise a white UP portion of a length suitable for annealing with the UP sequencing primer.
  • Figure l.d shows a further sequencing primer pair comprising only the: white UP portion (in the Fw and Rw primer) as well as the dotted (Read Start) signal.
  • Figure 2 represent a scheme of the method of the specification in which PCR primers as represented in Figure Ia and sequencing primers as represented in Figure l.b are used for the detection of 17 species of the family Scombridae, the UP and PUP portions of figure 1 are represented by a U succession, the "read start" sequence is represented with a waved line ( • -- ⁇ - -), triangles, crosses, stars, etc represent polymorphic sites.
  • Figure 3 shows an agarose gel with the results of the PCR assay B (see table 3 for oligonucleotides that amplify fragment B) run on DNA from different species in the Scombridae family.
  • Lane 1 to 15 commercially available species of the Scombridae family: lane 1 Thunnus thynnus, lane 2 Thunnus alalunga, lane 3 Katsuwonus pelamis, lane 4 Thunnus albacares, lane 5 Thunnus obesus, lane 6 Scomber colias, lane 7 Scomber japonicus, lane 8 Scomber australasicus, lane 9 Thunnus albacares, lane 10 Thunnus obesus, lane 11 Scomber scombrus, lane 12 Thunnus thynnus, lane 13 Sarda sarda, lane 14 Thunnus albacares, lane 15 Thunnus albacares, lane 16 negative PCR control, lane 17 molecular weight marker (GeneRulerTM lOObp DNA Ladder plus, Fermentas life sciences).
  • the PCR amplicon B from lane 1 to 8 is obtained using DNA extracted from highly processed canned meat in oil
  • the PCR amplicon in lane 9 is obtained using DNA from highly processed canned natural meat
  • the PCR amplicon from lane 10 to 13 is obtained using DNA extracted from fresh fish
  • the PCR amplicon in lane 14 is obtained using DNA extracted from sauce with 6% of Thunnus sp., in lane 15 from sauce with 20% of Thunnus sp.
  • a PCR fragment of 162 bp is visible from lane 1 to 15.
  • Figure 4 shows an agarose gel with the results of PCR assay A+B (see table 5 for oligonucleotides that amplify fragment A+B) run on DNA from different species in the Scombridae family.
  • Lane 3 to 6 commercially available species of the Scombridae family.
  • Lane 1 negative PCR control lane 2 molecular weight marker (GeneRulerTM lOObp DNA Ladder plus, Fermentas life sciences), lane 3 Thunnus albacares, lane 4 Thunnus thynnus, lane 5 Scomber scombrus, lane 6 Thunnus obesus.
  • the PCR amplicon A+B from lane 3 to 6 is obtained using DNA extracted from fresh fish.
  • a PCR fragment of_291 bp is visible from lane 3 to 6.
  • Figure 5 shows an agarose gel with the results of the PCR assay A (see table 7 for oligonucleotides that amplify fragment A) run on DNA from different species in the Scombridae family.
  • Lane 1 to 13 and line 15 are commercially available specie of the Scombridae family: lane 1 Thunnus thynnus, Lane 2 Thunnus alalunga, lane 3 Katsuwonus pelamis, lane 4 Thunnus albacares, lane 5 Thunnus obesus, lane 6 Scomber colias, lane 7 Scomber japonicus, lane 8 Scomber australasicus, lane 9 Thunnus obesus, lane 10 Scomber scombrus, lane 11 Thunnus thynnus, lane 12 Sarda sarda, lane 13 ⁇ x ⁇ rochei, lane 14 sardine, lane 15 Thunnus albacare
  • the PCR amplicon A from lane 1 to 8 is obtained using DNA extracted from highly processed canned meat in oil
  • the PCR amplicon from lane 9 to 13 is obtained using DNA extracted from fresh fish
  • the PCR amplicon in lane 14 and 16 is obtained using DNA extracted from canned sardine in oil
  • the PCR fragment in lane 15 is obtained using DNA extracted from fresh fish.
  • a PCR fragment of 156 bp is visible from lane 1 to 13 and in lane 15.
  • FIG. 6 fragment of sequence of cytochrome b gene of two different species of the Scombridae family. The circles highlight different SNPs that discriminate two different species in the Scombridae family.
  • Figure 7 shows the fragments of the cytochrome b gene amplif ⁇ able with the primers of the invention.
  • Figure 8 shows the genetics details on the amplified fragments.
  • DETAILDE DESCRIPTION OF THE SEQUENCES SEQ ID NOs 1-9, 12-15, 17-24; and 26-30 of the sequence listing are primers for amplification or sequencing of cytochrome b gene of the Scombridae family according to the present description, the sequence being disclosed also in tables 3, 5, 7 and 9; SEQ IDs 10, 11, 16, 25 and 31 are sequencing primers according to the present description, the sequences being disclosed also in tables 4-10.
  • Read start portion (RSP).
  • Read start sequence is a portion of an oligonucleotide, that is a PCR primer, that is located before the region of the primer that is complementary to a portion of a target sequence to be amplified, that allows an easy localisation of the sequence of interest, and an indexing of each nucleotide of the same, in all the amplicons obtained by amplifying with a PCR primer comprising an RSP.
  • the RSP allows the determination of a position immediately downstream said RSP, or a given number of nucleotides downstream said RSP, from which an indexing of the nucleotides of the amplified sequence can be carried out, either by a researcher either by a computer in which a suitable software is installed. Different primer pairs sharing the same read start portion will generate amplified sequences all sharing the same read start.
  • Primer pairs differing in the read start sequence will allow not only a common indexing of amplicons of the same region of interest from different samples, but also the identification, based on the RSP in each amplicon, of the samples from which it derives.
  • the complementary sequence of the read start portion, or complementary read start portion (cRSP), or complementary read start sequence will be present in one of the strands of the amplicon or in the amplified sequence, when oligonucleotides herein provided are used.
  • the read start portion is a sequence of about 4 to 12 bp of length, characterised in that it does not anneal with the target sequence or with the 3' universal primer in case of sequence primer l.c, (see figure l.b) at the PCR conditions to be used.
  • the length and the nucleotide sequence of a RSP or read start sequence can change as explained below, also depending on the length of the GOI (gene (or sequence) of interest to be amplified) and PUP (Partial Universal Primer) portions sequences (see figure l.a).
  • a suitable read start sequence can easily and readily be identified by the skilled person by the use of simple computer programs that enable the user to verify that a sequence does not anneal with the sequences indicated above and, of course with the reverse primer.
  • Programs of said kind are also freely available online (e.g. programs available online such as BioEdit: http://www.mbio.ncsu.edu/BioEdit/BioEdit.html or ClustalX: http://www-igbmc.u- strasbg.fr/BioInfo/ClustalX/Top.html).
  • programs available online such as BioEdit: http://www.mbio.ncsu.edu/BioEdit/BioEdit.html or ClustalX: http://www-igbmc.u- strasbg.fr/BioInfo/ClustalX/Top.html.
  • ClustalX http://www-igbmc.u- strasbg.fr/BioInfo/ClustalX/Top.html.
  • the full sequencing of the entire genome allows the determination of "rare sequences" that could be used as starting points for when a read start sequence is to be designed.
  • Universal primer for automated sequencer Universal primers for automated sequencer are known in the art and (e.g. Universal Forward 20mer 5' GTTGTAAAACGACGGCCAGT 3' and Universal Reverse 20mer 5' CACAGGAAACAGCTATGACC 3' available on http://www.genome.ou.edu/protocol_book/protocol_adxCDE.html).
  • primers are called universal because they can be used to amplify or sequence any insert that is put in the multiple cloning site.
  • Universal primers are really not 'universal' in the sense that they will bind to anything.
  • universal primers are PCR/sequencing primers that bind to a sequence found in many plasmid cloning vectors, most of which are derived from pUC vectors (which in turn come from pBR322). These sequences were defined as good PCR and sequencing sites as they flank the multiple cloning site where an inserted DNA sequence would be put.
  • a universal primer for automated sequencer is an oligonucleotide that does not hybridize, at the PCR conditions to be used, with the sequence to be amplified and is hence unrelated to the target sequence to be amplified.
  • Forward and respective reverse oligonucleotide By forward and respective reverse oligonucleotide the present specification indicates an oligonucleotide pair (PCR primers) specifically designed to amplify a target sequence, hence, given a target sequence, by "forward and respective reverse oligonucleotide", a primers pair (forward and reverse), each specifically designed for use together with the other for the amplification of said target sequence, is intended.
  • Indexing the nucleotides of an amplified sequence is, herein, the process of establishing an access key to each nucleotide of said sequence directly identifying its position.
  • each nucleotide of said sequence is identified by an index, said index being a number, a symbol, and, of course, not being the mere letter indicating the nature of the nucleotide itself (e.g. A T G C U N etc). Symbols (normally letters) customarily used in the art for identifying the chemical nature of a nucleotide are excluded as indexes.
  • the indexing of an amplified sequence could be, by way of example, giving to each amplified nucleotide complementary to the target sequence, the same (position) numbering that the said nucleotide has in the original target sequence, i.e. amplification is carried out on nucleotides 345 to 451 of a target sequence, the indexing can be set so to allow the identification, in the sequences resulting from the amplification, of each amplified nucleotide corresponding to the nucleotide in the target sequence, with the same numbering of the corresponding nucleotide of the target sequence.
  • nucleotidic fragment generated by a PCR amplification.
  • a nucleotide sequence complementary to another sequence is a sequence of polynucloetides related by the sequence to which it is defined as "complementary" via a perfect match by the base- pairing rules.
  • the sequence complementary to the DNA sequence T-C- G-A is A-G-C-T.
  • a given sequence defines its complementary sequence.
  • a portion complementary to a region of the target sequence to be amplified means that the said portion of the primer perfectly matches a defined number of consecutive nucleotides of the sequence of interest to be amplified or its complementary strand.
  • Polymorphisms pattern or polymorphic pattern By polymorphisms pattern or polymorphic patters it is intended that, with reference to a given nucleotide sequence, more than one single nucleotidic variation can be present at one or mere site (ex. more than one SNP), each possible combination of the said polymorphisms is intended as a polymorphic pattern.
  • different species can often be recognised by the fact that they exhibit, in a certain sequence, a certain number of SNPs, each specie presenting characteristics SNPs, i.e. a specie specific polymorphisms pattern or polymorphic pattern.
  • Detection of, or, detecting polymorphisms or polymorphisms patterns is intended as detecting known polymorphisms or polymorphisms patterns as well as detecting (i.e. detecting the existence of) new polymorphisms or polymorphisms patterns.
  • a correct assessment with reference to a given sequence, of new polymorphisms or polymorphisms patterns is herein defined as identifying new polymorphisms or polymorphisms patterns.
  • Analysing data obtained (by the detection of, or, detecting polymorphisms or polymorphisms patterns).
  • the analysis of the data obtained by the detection or by detecting polymorphisms or polymorphisms patterns is intended as an elaboration of said data such as establishing a genotype, using said data for confronting them against known polymorphisms or polymorphisms pattern (i.e.
  • the amplified sequences display polymorphisms or polymorphisms patterns corresponding to the polymorphisms or polymorphisms patterns of a given individual, or of a given species, family, order, class or phylum, or corresponding to polymorphisms or polymorphisms patterns known to be linked to a specific disease, or to identify new genetic markers for a given pathology, etc.). Also, confrontation of the data with a reference sequence can allow detection of the presence of new polymorphisms or polymorphisms patterns, or a punctual identification of each of said new polymorphisms or polymorphisms patterns.
  • Computer readable storage support By computer readable storage support it is intended any support suitable for the storage of software that allow the installation of said software on a computer, e.g. CD, DVD, TAPES, USBPen, EPROM, disks, hard disks, etc. and/or the software can be downloadable from a network.
  • Complex food matrix herein defines a foodstuff product containing a certain natural product (i.e. meat, fish, vegetable etc.) wherein said product has been processed (i.e. smoked, cooked, fractioned etc.).
  • a complex food matrix related to tuna could contain tuna, little tunny, false albacore, mackerels, pelamyd, i.e. derivatives form all species of the Scombridae family in the form of canned fish, in water or in oil, in the form of pastes, smoked slices, salami, pates, sauces etc.
  • Primer cocktail By primer cocktail it is intended a mix of different primer pairs to be used in the same PCR amplification, an example is given by primer pairs capable of selectively amplifying a given allele of a polymorphic sequence, a primer cocktail in this case could be represented by primer pairs, used in the same amplification process, each pair amplifying, when present in the target sequence, a specific polymorphism.
  • nucleotides letter code convention in the present specification according to the standard nucleotide translation conventions, when a nucleotide is indicated with the letter Y, a pyrimidine, i.e. C or T are indicated, when the letter R is used, it indicates a purine, i.e. A or G.
  • the oligonucleotides of the description comprise, ordered from 5' to 3' a portion at the 5', of a universal primer for automated sequencers, a read start portion and a portion complementary to a region of the target sequence to be amplified.
  • the three portions indicated above can also be directly linked one to another, optionally, restriction fragment sites or other sites of interest can be introduced into the oligonucleotides, preferably in upstream the read start portion.
  • the region of the universal primer for automated sequencers has at least two functions; the first one is to elongate the oligonucleotide at the 5', thus elongating the amplified fragment.
  • This elongation can have also two effects, the first effect is to elongate amplified fragments rendering their size a bit larger, the effect being quite useful when short fragments are amplified as short fragments are, in general, more difficult to sequence.
  • the first base after the sequence primer is legible, but in real experimentation, technical limitations of the automated sequencer do not normally allow to read the sequence up to at least the first 16 bp.
  • the second effect is that elongation can enable the user to increase the distance from the last nucleotide at the 3' of the sequencing primer and the start of the region of interest where a SNPs or other polymorphisms might be positioned.
  • the sequencing primer will be long enough also if it does not overlap completely (i.e. is shorter) at the 3' with the universal primer region of the oligonucleotide of the invention.
  • About 15 bp of complementary sequence between the 5' PCR primer and 3' sequence primer is a suitable embodiment of the invention.
  • the presence of the portion of the universal primer for automated sequencing can be also used to further elongate the amplified fragment and to obtain a more reliable sequencing.
  • the sequencing step is usually carried out by further amplifying the amplified fragments using suitable primers, an unlabelled deoxyribonucleotide (dNTPs) mix and labelled dideoxyribonucleotides in order to obtain stopped products each time a dideoxyribonucleotide is inserted in the amplified fragment, thus obtaining, at the end of the PCR amplification a pool of fragments, each labelled at the last nucleotide (each nucleotide having a different marker) that can be purified and automatically read by the sequencer.
  • dNTPs deoxyribonucleotide
  • Elongation of the amplified fragment can often provide a more reliable sequencing as the smallest fragments are often lost in the above mentioned purification.
  • the region at the 5 ' of the oligonucleotide of the invention will be conveniently designed in order to consist of the nucleotides located near the 3' (or including the 3') of the universal primer in order to obtain a longer product in the PCR reaction for sequencing.
  • a sequence in the amplicon suitable for annealing with a universal primer for automated sequencers renders the sequencing step very simple especially when a cocktail of primers is used in the PCR amplification preceding the sequencing PCR (which is quite common when polymorphism analysis is performed).
  • the 5' portion of the oligonucleotides herein described allows the sequencing of several different amplicons originated from different oligonucleotide pairs (the oligonucleotides being oligonucleotides of the invention) with one single kind of primer in a single sequencing process.
  • the universal primer will not hybridize at the PCR annealing conditions with the target sequence, the length of the portion of universal primer in the oligonucleotide herein described will vary, form about 5 to about 10-15-20 nucleotides depending whether the sequencing primer is designed according to figure l.b, l.c, or l.d.
  • the sequencing primer also comprises the read start portion or even some nucleotide complementary to the sequence to be amplified (that could be in a multiplex in which no polymorphisms are expected in the first nucleotides of the amplified sequence)
  • 5 -10 nucleotides of the universal primer will be sufficient at the 5' of the oligonucleotide herein described, if the sequencing primer comprises only the universal primer sequence and the read start, than the number of nucleotides of the universal primer sequence in the oligonucleotides herein described will be increased to a number of about 10-20 in order to provide a better annealing at the sequencing step, the same applies when the sequencing primer consists only of a universal primer sequence.
  • the read start portion and the region complementary to a part of the sequence to be amplified are preferably directly bound to each other.
  • the direct contact within the complementary read start portion and the amplified sequence complementary to the sequence of interest in the amplicon renders the indexing of the amplified target sequence easier.
  • the presence of the read start sequence in the oligonucleotides herein described allows the indexing of the nucleotides complementary to the sequence of interest in all amplicons.
  • the presence of a common read start sequence in all different amplicons undoubtedly fastens the procedures for reading and interpreting the amplified sequences obtained.
  • the presence of an easy to detect common sequence in all amplicons even allows the automation of the sequence indexing, of the collection and interpretation of the data obtained from all amplicons.
  • the oligonucleotides comprising the read start portion herein described will introduce in all the amplicon a read start sequence whose effect is practically exerted on each amplified sequence of interest.
  • the presence in all amplicons of a known read start sequence will allow also automation of the indexing of the sequence as a start point for indexing can be established in all amplicons following the read start sequence.
  • the first nucleotide of the amplified sequence that will be indexed will be located downstream the read start sequence.
  • This indexing can be easily performed with a computer using a software capable of recognising a predetermined read start sequence in the sequenced amplicon (the software can also be capable of sequencing and, during or after sequencing recognising the read start sequence in the amplicon) and setting the program for assigning a given indexing group of symbols.
  • the program can be set so to index the nucleotides located immediately downstream the read start sequence in the amplicon automatically assessing the numbering from 87 to 212 to the amplicon.
  • This automated indexing will allow also a fast computer analysis of specific nucleotides of interest in case one or more polymorphisms are expected in the amplicon, or, if polymorphisms are to be identified in a given amplicon, the indexing will allow direct comparison within different amplicons without the need of aligning each amplicon on a sequence database as each nucleotide of interest will be indexed and hence identifiable.
  • the oligonucleotides of this description can be used even as primers for the construction of a cDNA library, a read start region will render the analysis of the clones obtained much more easy to make.
  • PCR primers comprising different portions complementary to a part of the sequence of interest and a different read start sequence.
  • the PCR primers that amplify a portion A of a polymorphic region will comprise the read start signal A in the forward primer and A' in the reverse primer
  • the PCR primers that amplify a portion B of a region will comprise the read start signal B in the forward primer and B' in the reverse primer and so on. It is possible to index different amplicons using different read start.
  • the read start portion of the oligonucleotide herein provided is an nucleotide sequence, which sequence of bases is invented following some criteria: like the universal primer, it does not hybridize with the sequence to be amplified at the PCR conditions established by the researcher and is hence unrelated to the target sequence to be amplified, it does not hybridize with the universal primer either at the PCR conditions established by the researcher and is hence unrelated to the universal primer too.
  • the CG-content should be considered in order to obtain nearly similar melting temperatures for the PCR primers forward and reverse.
  • the length of the read start sequence can vary from about 4 to 12 nucleotides depending on whether the sequencing primer is designed according to figure l.b or l.d and on the length of the portion of the PCR primers that is complementary to the region or gene of interest.
  • the read start sequence in the forward PCR primers will be different from that in the reverse PCR primers.
  • the read start portion in the forward sequence primer will be the same as the read start portion in the 5 ' of amplicon that must be amplified and viceversa.
  • the single stranded oligonucleotide described may comprise one or more polymorphism in order to anneal only to the complementary sequence comprising the same.
  • the polymorphisms comprised in the oligonucleotide can be one or more SNP, although other polymorphisms can be used and the oligonucleotide region complementary to a region of the target sequence or flanking the target sequence can be designed in order to comprise the said other polymorphisms.
  • the sequence of the oligonucleotide will be written using also Y and R letters to indicate that, in fact, for each of the said letters 2 possible oligonucleotides can be synthesised and used, when each possible nucleotide at an SNP site provides the researcher with useful indication (i.e. a certain SNP is present in Thunnus albacares and not in Katsuwonus pelamis) oligonucleotides representing each possible combination will be used in order to detect all polymorphisms present in the amplified sample.
  • nucleotide in the sequence listing two sequences are provided, supposing a y at position 13 from the 5' of the oligonucleotide sequence, that will indicate a sequence in which the nucleotide 13 from the 5' is a c, and another sequence in which the nucleotide 13 from the 5' is a t and so on.
  • the three portions of the oligonucleotide herein described are not particularly limited in their length, of course a skilled person will know the average length of PCR oligonucleotides acceptable as primers (averagely between 15 and 50 nucleotides), the length of each portion will vary, as already said above, as indicated in figure 1 , for what concerns the 5 ' region, depending on the sequencing primer to be used.
  • the length of the PCR and sequence primers contributes to the cost of a PCR: the cost for the synthesis of an oligonucleotide that is ⁇ 35 bases in length is usually cheaper than the cost for the synthesis of an oligonucleotide that is >35 bases in length.
  • the length of the primers should be considered for cheaper PCR reaction.
  • the length of the universal primer region will be from about 5 to about 20 nucleotides identical to the universal primer and will comprise the 3' of the universal primer used.
  • the region complementary to the target sequence or a flanking sequence thereof is of at least 15.
  • the oligonucleotides of the invention can be used also as PCR sequencing primers, as shown in Tables 4, 6, 8 and 10.
  • the length of the universal primer region will be closer to about 20 nucleotides, the read start sequence length remains unchanged and the length of the region complementary to the target sequence to be amplified or to a flanking region thereof will be more close to the about 5 nucleotides values as exemplified in the tables and drawn in Figure l.a and l.b.
  • the read start sequence will preferably be of a length comprised between 4 and 12 nucleotides, whereas the region complementary to the target sequence or to a flanking region thereof will be of about 15 to 30 nucleotides.
  • oligonucleotides for PCR are usually of a size between 15 and 50 nucleotides
  • the relative sizes of each portion (universal primer, read start, complementary to target) of the oligonucleotides herein described will preferably give, when added up, a final product (the oligonucleotide of the invention) not shorter than about 15 nucleotides and not longer than about 50 nucleotides, by way of example, the oligonucleotide could comprise a region of 13 nucleotides of universal primer, a read start of 5 nucleotides and a region complementary to a part of the target sequence of 15 nucleotides.
  • the oligonucleotides for PCR amplification can be selected in the group consisting of SEQ ID NO: 1-9, 12-15, 17-
  • oligonucleotides enable, in particular, the detection of several species or specie variants of the Scombridae family in foods supposed to comprise tuna.
  • fragment B 162 bp fragment
  • the PCR conditions are described in example 6 table 12
  • the reference gene that used is DQ080287 from Thunnus albacares, said fragment is not indicated in the art as a region to be amplified for detecting the presence of a given Scombridae species or intraspecies variant in a sample.
  • the sequences listed above amplify a fragment "B" (as defined above) of the gene.
  • the amplified fragments were sequenced with the oligonucleotides listed in table 4, SEQ ID NO:10 and SEQ ID NO:11.
  • the variable region in fragment B used to discriminate the species in the Scombridae family is from nucleotide 404 to 498 nucleotide.
  • the comparison of the amplified sequences used to set up the assays showed that 36 positions were variable ones. In tables 15 and 16 the diagnostic positions are indicated.
  • the nucleotide sequence of the variable region in fragment B of the sample in exam is compared to the same region in the different 17 species of Scombridae family (see table 15 and 16).
  • the species and the variant intraspecies are identified when an exact match is found. In a small percentage of cases (two cases), there can be, when only fragment B is amplified, some possible misidentif ⁇ cations that do not allow an exact identification of the species or of the intraspecies variants.
  • TMAC2 Thunnus maccoyii
  • TTHYl TTHYl
  • TTHY2 TTHY3, TTHY4
  • TTHY5 TTHY5
  • fragment A plus or A+ of the above mentioned gene fragments A, A plus, B and A+B are defined in the specification. If in position 375 there is a G the species is Thunnus thynnus, however, if in position 375 there is an A the species is Thunnus maccoyii. There is also a rare haplotype of Thunnus albacares (TALB4), present in only 2% of the sequences of Thunnus albacares deposited in public database up to now that can be confused with Thunnus obesus (TOBEl) that was never found by the present inventors. However, to exclude any chance of doubt it is necessary to analyse the SNP in position 330 in fragment A: if there is a G the species is Thunnus albacares, if instead there is an A the species is Thunnus obesus.
  • the results obtained by the method of the invention allow the identification of polymorphisms identifying from 15 to 17 species depending on the variants that are present for the species above.
  • the primers of Table 3 will be sufficient for the identification of 17 species, in rare cases a further indication is given in fragment A+B (SNPs table 15) or in the fragment A+ or A plus (Table 15 or 17) as identified below.
  • fragment A+B can be amplified, or a fragment called A+ is amplified, the reverse primer for the amplification of A+ is shifted of a few bases downstream with respect to the reverse primer for the amplification of fragment A, that allows the detection of a rare SNP that is located in a region complementary to the reverse primer for A and not to the reverse primer for A+ that is downstream said SNP and allows amplification and discrimination of it.
  • fragment A+B 291 bp fragment
  • Said fragment comprises fragment B that is not indicated in the art as a region to be amplified for detecting the presence of a given Scombridae specie or intraspecies variant in a sample.
  • the sequences listed above amplify a fragment A+B, this fragment was obtained from nearly 59% of the samples amplified from canned tuna, but an amplicon of 291 bp was obtained from all fresh fish or frozen fresh fish samples tested. This fragment is longer than fragment B and can provide further information.
  • the amplified fragments were sequenced with the oligonucleotides of table 6, SEQ ID NO: 16 and SEQ ID NO:11.
  • the variable region in fragment A+B used to discriminate the species in the Scombridae family is from nucleotide 273 to nucleotide 498.
  • the analysis of the alignment of the sequences used to set up the assays showed that 84 positions were variable ones. In table 15 the diagnostic positions are indicated.
  • the nucleotide sequence of the variable region in fragment A+B is compared to the same region in the different 17 species of the Scombridae family (see table 15).
  • the species and the variant intraspecies (or haplotype) is identified when an exact match is found. In this case all species are immediately identified without an additional test.
  • the sequences listed above amplify a fragment A (as defined above) of the gene.
  • the amplified fragments were sequenced with the oligonucleotides of table 8, SEQ ID NO: 25 and SEQ ID NO: 16.
  • variable region in fragment A used to discriminate the species in the Scombridae family is from nucleotide 273 to nucleotide 363, the SNPs of interest are indicated in Table 15 and 17.
  • the variable region in fragment A allows, as described above, to discriminate the rare haplotype TALB4 from TOBEl
  • region amplified in fragment A is the same region amplified by Bottero et al. 2007, but the primers are modified in order to identify all species and variant intraspecies.
  • the oligonucleotides in Table 9 i.e. SEQ ID NO 12-15 and 26-30, amplify a 151 bp fragment (herein called "fragment A+"), from bp 253 to 403, of the mitochondrial cytochrome b gene of the Scombridae family (reference sequence indicated above)., Said fragment being larger than the fragment A indicated above.
  • the sequences listed above amplify a fragment A+ (as defined above) of the gene , the SNPs of interest are indicated in Table 15 and 17.
  • the amplified fragments were sequenced with the oligonucleotides of table 10, SEQ ID NO: 16 and SEQ ID NO:31.
  • variable region in fragment A+ is used to discriminate the species in the Scombridae family is from nucleotide 273 to nucleotide 381.
  • the variable region in fragment A+ allows, as described above, to discriminate some variants of Thunnus thynnus from TMAC2 and the rare haplotype TALB4 from TOBEl.
  • fragments A+ and B can be amplified separately (long fragments are less likely to be amplif ⁇ able in processed food samples as the DNA is more degraded) and the information obtained will be the one obtainable form fragment A+B but the use of the oligonucleotides of table 3 and of the oligonucleotides in table 9 instead of the oligonucleotides of table 5, allows the amplification of smaller informative fragments that are more likely to be amplif ⁇ able in processed food samples.
  • the present description also discloses a method for the detection of polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a. sequencing nucleotide sequences amplified with one or more pair, forward and reverse, of oligonucleotides of the invention, with an automated sequencer using a primer comprising, at the 3', said universal primer portion or collecting nucleotide sequences thus obtained; b. detecting in said sequences said read start sequence; c. indexing nucleotides of said sequences from said detected start sequence; d. detecting in said indexed sequences polymorphisms or polymorphisms patterns.
  • step a sequences amplified with primer pairs of the invention are submitted to an automated sequencing i.e. to the above described PCR with a sequencer using a primer comprising, at the 3', the afore mentioned universal primer portion and to the read out by the automated sequencer of the labelled fragment obtained by the sequencing PCR, or with any of the primers as exemplified in figure 1.
  • the sequencing can be part of the detection method but the method can be carried out also starting from sequences obtained by any means for sequencing or by an automated sequencer having a software independent from the software described below.
  • the software can be capable of carrying out the automated sequencing, storing the sequences and so on, or, the sequences of the amplified fragments as described in step a. can be obtained separately, and processed by the software for carrying out the method above.
  • step b the read start sequence present into the primers of the invention is detected either manually or by a computer using a software capable of detecting said sequence in the amplicons.
  • step c the nucleotides of the amplified sequence are indexed starting from a given position downstream the read start portion (or read start sequence). If the sequence complementary to the sequence of interest is adherent, i.e. immediately downstream without spacing nucleotides, to the read start portion, than the indexing can begin at the nucleotide immediately downstream the read start sequence. If another known sequence is inserted, in the primer, within the read start portion and the sequence complementary to the target sequence to be amplified, than the indexing could also be shifted immediately downstream said inserted sequence, unless, the user wants, for some reason to start the indexing from the inserted sequence. The presence of the read start, also allows the user to shift the indexing start further downstream (i.e.
  • nucleotides after the read start sequence x nucleotides after the read start sequence
  • said software capable of detecting and localising the read start sequence is also capable of indexing the following nucleotides at a predetermined indexing start that can be from nucleotide 1 after the read start sequence to nucleotide x after the read start sequence, x, being obviously an integer.
  • the method of the invention enables the user to easily individuate a nucleotide in the indexed amplified sequence, independently from the number of primer pairs used and is particularly handy in case of amplifications with a cocktail of primers.
  • a read start is useful in any amplified sequence, the possibility of rapidly and even automatically scanning a pool of amplicons and of identifying in each of said amplicons a common read start sequence is, as evident to any skilled person, extremely useful.
  • the presence of a read start sequence common to all the amplicons allows an automation of the indexing of the sequence that usually needs the intervention of a skilled person.
  • a software can be easily designed to recognise one or more read start sequences and to detect one of more of said read start sequences in a group of amplicons according with the settings selected by the user.
  • each group of amplicons to be sequenced and indexed in the same reaction will share the same read start sequence.
  • the indexed sequence thus obtained it will be very easy to detect the presence or absence of a given polymorphism in a given position or even to easily localise and identify the existence of new polymorphisms in a target sequence by mere comparison of each nucleotide having a given index number where new polymorphisms are searched, or by immediate checking out of which nucleotide is present at a given index, in order to verify whether a given polymorphism is present at a given site and what polymorphism is present at said given site.
  • the oligonucleotides of the invention also enable an easy and fast identification (herein intended also as characterisation) of newly detected polymorphisms or polymorphism patterns.
  • a cocktail of primers comprising a read start sequence, in order to detect the presence or absence and to identify known polymorphisms in a sample, allows a direct indexing of the amplified sequences based on the read start sequence, and allows hence, to compare directly given indexes without the need of performing a sequence alignment.
  • the oligonucleotides of this description can be also used in a method for the detection and the identification of new polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a. sequencing nucleotide sequences from given samples amplified with one pair, forward and reverse, of oligonucleotides according to the description with an automated sequencer using a universal primer comprising said 5' portion; b. detecting in said sequences said read start portion; c. indexing nucleotides of said amplified sequences, from said read start portion; d. detecting in said indexed sequences the presence polymorphisms or polymorphisms patterns in comparison to a reference sequence; e.
  • sequences will be obtained on the products of an amplification by PCR with the oligonucleotides of this description will be carried out on all the samples to be tested (this can be useful, by way of example, when the aim of the research is to identify a disease gene, or to identify within a gene known to be related with a disease, possible polymorphisms or polymorphic patterns related to the disease).
  • the firs PCR reaction will have been carried out with the same oligonucleotide pair of the description on all samples (samples could be DNAs from healthy individuals and from patients having a given disease or from patients having a given disease only, or from groups of individuals with a different phenotype etc.).
  • the nucleotides of the sequences will be indexed after detection of the read start sequence as explained above, hence, also by means of suitable software as explainer above.
  • the result of the indexing and of the comparison of each indexed nucleotide against a reference sequence e.g. a wild type sequence present in healthy individuals having the same indexes will show the presence of different nucleotides at a particular index, if present. If differences are present, a further step of sequencing nucleotide sequences from the same samples of step a.
  • each pair of oligonucleotides having a different read start will allow the same indexing as above, with the difference that, due to the different read start for each sample, the results can be punctually related to a given samples. This allows a characterisation of each sample and hence will indicate whether a given new polymorphism detected or a given polymorphic pattern is significantly related to a certain disease or to a certain phenotype etc.
  • the method for the detection/identification of new polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a. sequencing nucleotide sequences from different samples each sample being amplified with a different pair, forward and reverse, of oligonucleotides according to the description and each pair of oligonucleotides having a different read start, with an automated sequencer using a universal primer comprising said 5 ' portion; b. detecting in said sequences said read start portions; c. indexing nucleotides of said amplified sequences, from said read start portions, each sample being recognisable by a specific read start portion; d. identifying in said indexed sequences the polymorphisms or polymorphisms patterns in comparison to a reference sequence; Hence, the preliminary steps for the simple detection of the presence or absence of polymorphisms can be avoided.
  • the methods of the invention hence allows, at a first stage the detection of a polymorphism or of a polymorphic pattern by a first comparison of each nucleotides having a given index on all amplicons obtained with a single PCR reaction (or more
  • the software cited above will easily compare each nucleotide having a given index of the indexed sequences against a given target sequence or even with each other, immediately providing a tool (i.e. the index) to identify the position or the relative position of a polymorphism, or to identify the presence or absence of a given polymorphism at a given site.
  • a tool i.e. the index
  • the description also discloses a method for the analysis of polymorphisms or polymorphisms patterns of nucleotide sequences amplified by PCR comprising the steps of: a. sequencing nucleotide sequences amplified with one or more pair, forward and reverse, of oligonucleotides according to the description with an automated sequencer using a universal primer comprising, at the 3', said universal primer portion; b. detecting in said sequences said read start sequence; c. indexing nucleotides of said sequences from said detected start sequence; d. detecting in said indexed sequences polymorphisms or polymorphisms patterns; e. analysing, as above indicated, the data obtained at step d.
  • the method of the invention allows the detection of up to 17 Scombridae species in complex food matrices.
  • Table 1 shows a summary of the molecular works published in the scientific journals aimed to identify different species in the Scombridae family.
  • the first column lists the molecular methods used by the authors; the second column shows the length of the amplified fragments.
  • the third column is the name of the analysed gene.
  • the fourth column indicates the number of species identified.
  • the fifth column contains some "critical note" of the method, and the last column lists the author's name and the year of the publication. Table 1.
  • PCR Terol et al. 2002
  • PCR-SSCP Rehbein et al. 98
  • real-time PCR Lipez et al. 2005, Dalmasso et al. 2007, Quintero et al. 98
  • PCR and multiplex primer extension assay PER o SNAP SHOT Bottero et al 2007
  • Some methods are extremely laborious (e.g. PCR-RFLP, PCR-SSCP) and their automation is impossible. Other ones (e.g. Real-time PCR) can distinguish just a few species.
  • the method recently developed by Dalmasso et al. 2007, can discriminate 4 species belonging to the Scombridae family. The primers and the probes sequences have not been published. However, this method does not allow to discriminate the K. pelamis species which may be used as fake Tuna by fraud.
  • the method developed by Bottero et al. 2007, can distinguish only 5 species among which is K. pelamis, works on complex food matrices, but does not entirely allow for intraspecies variability, therefore it is not able to identify and discriminate some variants.
  • Terol et al. 2002 can distinguish only three species of the Scombridae family and moreover, the size of the amplified fragment (528 bp) makes it inapplicable to complex food matrices (it works only on fresh and frozen meat). So, in order to amplify canned tuna, three PCR reactions, which amplify three overlapping fragments that constitute the original 528 bp sequence, are described. The method of Hunseld et al.
  • the amplified fragment does not discriminate two important commercial species such as Thunnus thynnus and Thunnus albacares.
  • the amplified fragment is too short (59 bp, primers excluded) and cloning is a necessary step to obtain a sequence of the amplicon.
  • PCR-RFLP PCR-RFLP
  • a region of the cytochrome b gene is amplified in different species (max. 6 species of the Scombridae family, according to the published works), then the amplified fragment is digested by various restriction enzymes and the band pattern obtained, characteristic of a certain species, is displayed on gel.
  • the amplified fragments digested by the enzymes are displayed on acrylamide gel as this type of gel provides a higher resolution than agarose gel.
  • the preparation of the acrylamide gel takes longer then the preparation of the agarose gel and is more dangerous for the operator.
  • acrylamide is a strong neurotoxin which is easily absorbed by the skin when it is not yet polymerized.
  • the method herein described is designed in such a way to be applied to transformed products in which DNA is very degraded.
  • the amplified fragments with the method can be directly sequenced with no loss of information for the bases at the edge of the amplicon of the amplified gene fragment: the primers were designed to create a region between the primers, used for the sequence reaction, and the region of the cytochrome b of interest, for the discrimination of the species.
  • the primers contain the "read start” region which is a determined sequence of bases which, being present in the primers, will be present in all the amplicons.
  • Such region can be used by a dedicated software, as already indicated, which allows the automated indexing of the amplicons sequences thus making the sequence results analysis easier and faster.
  • This method so far, allows to discriminate 17 species of Scombridae family but can be implemented, by designing further suitable oligonucleotides according to the invention, to detect all the 24 commercialized species.
  • Table 2 lists the species in the Scombridae family identified with the method described in this invention. In the first column is the scientific name of each species, the second column lists the common name from the website fish base (http://www.fishbase.org), in the last column is the Italian specie name from ichthyic commercial list.
  • Table 2 this table lists the fish species in the Scombridae family identified by the method herein disclosed.
  • the Scombridae family comprises 54 salt-water fish species, belonging to the
  • a “primer's cocktail” is used in the first amplification reaction (PCR-I) performed on a small region of the cytochrome b gene (MT-CYB), which is in all species.
  • the PCR-I primers were designed according to the description and where tuned for two purposes: 1) Introduce a sequence "read start” signal which would allow direct indexing (even automated indexing) of the nucleotides of the amplified sequences thus making the results analysis easier and faster, 2) Increase the length of the amplified fragment so that the amplicon could be easily sequenced.
  • PCR- 1 a single pair of universal primers, comprising the universal primer region at the 5' of the oligonucleotides for amplification (herein also defined as PCR- 1) is used in the sequencing amplification reaction (herein also defined PCR-2).
  • the method of the invention can be carried out using the primer groups listed in the following tables.
  • the oligonucleotides according to the description can be used to amplify fragment B of the mitochondrial cytochrome b gene in the Scombridae family, fragment A+B, fragment A or A plus.
  • the species identification in the Scombridae family is from canned tuna or from other samples where DNA is degraded the best choice to identify the species is to amplify fragment B.
  • TMAC2 and some variants of Thunnus tynnus it is necessary to amplify also fragment A plus.
  • the PCR primers and the PCR reaction conditions described in this invention are able to amplify all species and variant intraspecies both for fragment B and for fragment A plus.
  • Fragment B allows a better discrimination of species and variant intraspecies than fragment A.
  • fragment A+B which obviously contains all information of fragments B and A+B.
  • Table 3 discloses the oligonucleotides that amplify fragment B (i.e. bp382-521) of the Scombridae mitochondrial cytochrome b gene.
  • Table 4 discloses primers suitable for sequencing the amplicons obtained by the amplification of complex food matrix comprising material deriving from Scombridae family, with the oligonucleotides of table 3.
  • Primers consisting of the sole universal primer can be used, in this case the oligonucleotides of Table 2 can be elongated at the 5' with further nucleotides of the universal primer.
  • Table 5 discloses the oligonucleotides that amplify fragment A+B (i.e. bp253-521) of the Scombridae mitochondrial cytochrome b gene.
  • Table 6 that follows, discloses primers suitable for sequencing the amplicons obtained by the amplification of complex food matrix comprising material deriving from Scombridae family with the oligonucleotides of table 5, primers consisting of the sole universal primer can be used, in this case the oligonucleotides of Table 5 can be elongated at the 5' with further nucleotides of the universal primer.
  • Table 7 discloses the oligonucleotides that amplify fragment A (i.e. bp253-386) of the Scombridae mitochondrial cytochrome b gene.
  • Table 8 that follows, discloses primers suitable for sequencing the amplicons obtained by the amplification of complex food matrix comprising material deriving from Scombridae family with the oligonucleotides of table 7, primers consisting of the sole universal primer can be used, in this case the oligonucleotides of Table 7 can be elongated at the 5' with further nucleotides of the universal primer.
  • Table 10 discloses primers suitable for sequencing the amplicons obtained by the amplification of complex food matrix comprising material deriving from Scombridae family with the oligonucleotides of table 9, primers consisting of the sole universal primer can be used, in this case the oligonucleotides of Table 9 can be elongated at the 5' with further nucleotides of the universal primer.
  • the description also discloses software capable of carrying out the methods described above.
  • the software will comprise procedures and steps for a. receiving as an input one or more nucleotide sequence, or performing an automated sequencing with a primer comprising, at the 3', said universal primer portion and, storing and/or processing the received or obtained sequences; b. detecting the read start portion in each of said sequences; c. indexing the nucleotides of each the amplified sequences as indicated above in the description of the method for detecting polymorphisms or polymorphic patterns, starting from the read start sequence detected; d.
  • the software comprises means for inputting and/or storing known polymorphisms, so to obtain a polymorphism database to be used for a subsequent recognition thereof; f. recognising the known polymorphism, within such database, providing a report with the results (i.e.
  • polymorphism X equals species, disease, or other, Y
  • the software can further provide a set of features (specific nucleotides, frequency%) of the unknown detected polymorphism, and means for storing such set of features in the said database.
  • the read start sequence of the invention can overcome the need of aligning the amplified sequences. It is clear that the user might chose to use the said read start also as a tool for a better and faster alignment, as the read start sequence, although providing a new tool for sequence analysis, does not forbid the use of the indexed sequence in more standard ways. Hence the indexed sequences can be used both in the method of the invention and in a more classic method, without need of carrying out two different amplifications.
  • a computer readable storage support wherein the software above is stored can be any kind of computer-readable storage support suitable for storing a software, such as CD, DVD, TAPES, USBPen, EPROM, disks, hard disks, etc.. It is to be understood that the method of the invention can be provided as a service through a web-service via an online connection and/or the software can be downloadable from a network.
  • kits comprising one or more aliquot of at least two, forward and respective reverse oligonucleotides for PCR of the description, and optionally one or more aliquot of a sequencing primer comprising, at the 3', the said universal primer portion
  • the kit can comprise the oligonucleotides of one or more of the following groups: SEQ ID NO: 1-9; SEQ ID NO: 12-15, 2, 7, 8, 9; SEQ ID NO: 12-15 and 17-24 and/or SEQ ID NO: 12-15, 26-30.
  • sequencing primer selected, respectively, in the groups of: SEQ ID NO 10 and 11, SEQ ID NO 16 and 11, SEQ ID NO 25 and 16 and/or SEQ ID 16 and 31 may be comprised in the kit.
  • the kit may comprise the computer readable storage support wherein the software described above is stored, the said support being capable, when used, of running the said software on a computer.
  • Table 15 shows all the SNPs identifiable by the oligonucleotides of the invention in an indexed matrix, in the fragment "A+B", and, individually in fragment A, A plus and B.
  • the first column indicates the species in letters and the arbitrary name of the polymorphism identified (letters plus numbers), the first line indicates the indexing of each specific nucleotide of the amplicons, the SNPs indicated by the bold characters are identified in the A fragment (up to nucleotide 363 included), the SNPs indicated by the normal characters (up to 403 included), summed to the SNPs in bold are identified in fragment A plus, the SNPs indicated by the underlined characters (from nucleotide 402 to 498 included) are identified in fragment B. AU the SNPs listed in the table are identified in fragment "A+B".
  • nucleotide 402 is shown only in plain text to indicate that it is comprised in fragment A plus, the underlining has not been used for this position but 402 is comprised as well in fragment B.
  • Table 16 shows the SNPs identified by fragment B.
  • the first column indicates the species in letters and the arbitrary name of the polymorphism identified (letters plus numbers), the first line indicates the indexing of each specific nucleotide of the amplicons.
  • Position 402 is shared by fragment A plus as shown also in Table 15 and 17
  • Table 17, below, indicates the SNPs identified by fragments A and A plus.
  • the first column indicates the species in letters and the arbitrary name of the polymorphism identified (letters plus numbers), the first line indicates the indexing of each specific nucleotide of the amplicons, the SNPs indicated by the bold characters are identified in the A fragment (up to nucleotide 363 included), the SNPs indicated by the normal characters (up to 402 included), summed to the SNPs in bold are identified in fragment A plus
  • Each primer in the cocktail used in PCR-I is made up of 3 parts: i) one part complementary to the cytochrome b gene (MT-CYB, represented in Figure 2 by a continuous line with symbols, e.g. triangles, crosses, stars, etc. to distinguish a primer from the others) ii) one part is the "read start" sequence (represented in Figure 2 by a waved ' ⁇ ' line,) iii) one part is a universal primer sequence (represented in Figure 2 by a U succession, UUUU)
  • the "read start” signal is useful as it inserts a region in the amplicon sequence which is the same in the amplicon of each of the 17 species and can be used to make the results analysis easier.
  • a dedicated software application (not yet available but easy to develop) may be used to read a specific set of SNPs at a determined point of the amplicon. For instance, from a fasta output of the amplicon' s sequence, the software will be able to extrapolate the SNPs positions at different points and output a combination of SNPs associated to the name of the species and the intraspecies variant.
  • Thunnus Thynnus and Thunnus maccoyii the information of two regions of the gene are combined by performing two assays.
  • Fragment B amplifies 95 bp (without primers) of the cytochrome b gene, the amplification product obtained by PCR-I is 162 bp long including the primers length, the amplification product obtained by PCR-2 is 192 bp long including the primers length.
  • Fragment A+B amplifies 226 bp (without primers) of the cytochrome b gene, the amplification product obtained by PCR-I is 291 bp long including the primers length, the amplification product obtained by PCR-2 is 320 bp long including the primers length.
  • Fragment A+ amplifies 151 bp (without primers) of the cytochrome b gene, the amplification product obtained by PCR-I is 174 bp long including the primers length, the amplification product obtained by PCR-2 is 203 bp long including the primers length.
  • Example 3 a Analysis of fresh or slightly processed (DNA not much degraded) samples
  • Fragment A+B is the longest (and obviously the most informative) and allows to better discriminate the intraspecies variability. From highly processed samples (e.g. tuna sauces or some tinned tuna in oil) it is not possible to get an amplification product of fragment A+B. In facts, according to literature data, it is possible to obtain an amplification product with the size of fragment A+B (Pardo et al. 2004) by means of "nested" PCR. b. Analysis of highly processed food matrices (DNA much degraded)
  • fragment B (more informative than fragment A) is amplified.
  • some variants e.g. Thunnus thynnus and Thunnus maccoyi ⁇
  • the clean DNA used as PCR template can be obtained with two different commercial kit:
  • GREES DNA KIT FOOD General Rapid Easy Extraction System DNA Kit, Incura s.r.L, code: IC-02-0095
  • GREES DNA KIT FOOD General Rapid Easy Extraction System DNA Kit, Incura s.r.L, code: IC-02-0095
  • IC-02-0095 is a rapid kit for DNA genomics extraction from food matrices. Ten samples can be processed in 2 hours. Following the manufacturer's instructions you can obtain 1-1,5 ⁇ g total from 350 mg of initial sample. Good quality DNA with an OD 260/280 ratio of 1.9 to 2 is measured with NanoDrop® ND- 1000 Spectrophotometer.
  • Wizard ® Magnetic DNA Purification System for food is a less fast kit for DNA genomics extraction from food matrices. Ten samples can be processed in 3,5 hours. Following the manufacturer's instructions you can obtain 4,5-7,5 ⁇ g total from 350 mg of initial sample. The quality of DNA is worse than quality of DNA obtained with GREES DNA KIT FOOD: the OD 260/280 ratio are 1.5 to 1,7 measured with NanoDrop® ND- 1000 Spectrophotometer. Table 11 : number of sequences used to set up the assays for each specie Specie abbreviation/ Number of sequence in public database used to set up the assays
  • sequences were aligned with clustalW multiple alignment.
  • the primers were designed in order to recognize all the species and the intraspecies variant.
  • Amplicon B reaction conditions, PCR component and primers
  • Table 12 reaction conditions and component of the PCR which amplify the fragment B.
  • the amplifications condition were as follow: 95°C for 15 min, then 35 cycles of 95°C for 45 s, 60 0 C for 1 min and 72°C for 45 s, followed by 72°C for 10 min with a final hold at 4°C.
  • Table 3 discloses the sequences of the primers used to amplify the fragment B. Species identification was achieved by sequencing and indexing the nucleotides of the amplicons as described above. The primers are given in Table 4 and sequencing standard protocol has been used to sequence fragment B.
  • Amplicon A+B reaction conditions, PCR component and primers Table 13: reaction conditions and component of the PCR which amplify the fragment A+B.
  • the amplifications condition were as follow: 95°C for 15 min, then 20 cycles of 94°C for 1 min, 56,7°C for 50 sec and 72°C for 45 s, then other 18 cycles of 94°C for 1 min, 55°C for 50 sec and 72°C for 45 s followed by 72°C for 10 min with a final hold at 4°C.
  • Table 5 discloses the sequences of the primers used to amplify the fragment A+B.
  • Species identification was achieved by sequencing and indexing the nucleotides of the amplicons as described above.
  • the primers are given in Table 6 and sequencing standard protocol was used to sequence amplicon A+B.
  • Amplicon A or A+ reaction conditions, PCR component and primers
  • Table 14 _reaction conditions and component of the PCR which amplify the fragment A.
  • the amplifications condition were as follow: 95°C for 15 min, then 20 cycles of 94°C for 1 min, 56,7°C for 50 sec and 72°C for 45 s, then other 18 cycles of 94°C for 1 min, 55°C for 50 sec and 72°C for 45 s followed by 72°C for 10 min with a final hold at 4°C.
  • Table 7 discloses the sequences of the primers used to amplify the fragment A.
  • Species identification was achieved by sequencing and indexing the nucleotides of the amplicons as described above.
  • the primers are given in Table 8 and sequencing standard protocol was used to sequence amplicon A.
  • Table 9 discloses the sequences of the primers used to amplify the fragment
  • Species identification was achieved by sequencing and indexing the nucleotides of the amplicons as described above.
  • the primers are given in Table 10 and sequencing standard protocol was used to sequence amplicon A plus.

Abstract

La présente invention porte sur un nouvel oligonucléotide destiné à être utilisé comme amorce d'ACP, comprenant trois parties différentes, à savoir une partie complémentaire à des amorces universelles pour des séquenceurs automatisés, une partie de début de lecture et une partie complémentaire à une région de la séquence cible devant être amplifiée. L'invention porte également sur des procédés pour la détection de polymorphismes ou de profils de polymorphisme de séquences nucléotidiques amplifiées par ACP avec lesdits oligonucléotides, sur des procédés pour la détection et l'analyse desdits polymorphismes ou profils de polymorphisme et sur des kits comprenant des produits utiles pour mettre en œuvre lesdits procédés.
PCT/EP2008/065804 2008-11-19 2008-11-19 Amorces oligonucléotidiques pour l'indexage nucléotidique de produits d'acp polymorphes et leurs procédés d'utilisation WO2010057525A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP2008/065804 WO2010057525A1 (fr) 2008-11-19 2008-11-19 Amorces oligonucléotidiques pour l'indexage nucléotidique de produits d'acp polymorphes et leurs procédés d'utilisation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2008/065804 WO2010057525A1 (fr) 2008-11-19 2008-11-19 Amorces oligonucléotidiques pour l'indexage nucléotidique de produits d'acp polymorphes et leurs procédés d'utilisation

Publications (1)

Publication Number Publication Date
WO2010057525A1 true WO2010057525A1 (fr) 2010-05-27

Family

ID=40445293

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/065804 WO2010057525A1 (fr) 2008-11-19 2008-11-19 Amorces oligonucléotidiques pour l'indexage nucléotidique de produits d'acp polymorphes et leurs procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2010057525A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104834833A (zh) * 2014-02-12 2015-08-12 深圳华大基因科技有限公司 单核苷酸多态性的检测方法及装置
WO2016146968A1 (fr) * 2015-03-17 2016-09-22 Salisbury Nhs Foundation Trust Procédé pcr

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996041012A1 (fr) * 1995-06-07 1996-12-19 Genzyme Corporation Sequence d'amorce universelle pour une amplification multiplex de l'adn
WO2001006012A1 (fr) * 1999-07-14 2001-01-25 Packard Bioscience Company Acides nucleiques modifies et utilisations associees
WO2007037678A2 (fr) * 2005-09-29 2007-04-05 Keygene N.V. Criblage a haut debit de populations mutagenisees

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996041012A1 (fr) * 1995-06-07 1996-12-19 Genzyme Corporation Sequence d'amorce universelle pour une amplification multiplex de l'adn
WO2001006012A1 (fr) * 1999-07-14 2001-01-25 Packard Bioscience Company Acides nucleiques modifies et utilisations associees
WO2007037678A2 (fr) * 2005-09-29 2007-04-05 Keygene N.V. Criblage a haut debit de populations mutagenisees

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BOTTERO ET AL: "Differentiation of five tuna species by a multiplex primer-extension assay", JOURNAL OF BIOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 129, no. 3, 13 April 2007 (2007-04-13), pages 575 - 580, XP022027147, ISSN: 0168-1656 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104834833A (zh) * 2014-02-12 2015-08-12 深圳华大基因科技有限公司 单核苷酸多态性的检测方法及装置
WO2016146968A1 (fr) * 2015-03-17 2016-09-22 Salisbury Nhs Foundation Trust Procédé pcr
CN107406891A (zh) * 2015-03-17 2017-11-28 索尔兹伯里Nhs信托基金会 Pcr方法
JP2018507706A (ja) * 2015-03-17 2018-03-22 ソールズベリー エヌエイチエス ファウンデーション トラスト Ｐｃｒ方法
AU2016231995B2 (en) * 2015-03-17 2021-07-15 Salisbury Nhs Foundation Trust PCR method
CN107406891B (zh) * 2015-03-17 2022-06-24 索尔兹伯里Nhs信托基金会 Pcr方法
US11499182B2 (en) 2015-03-17 2022-11-15 Salisbury Nhs Foundation Trust PCR method

Similar Documents

Publication Publication Date Title
Idrees et al. Molecular markers in plants for analysis of genetic diversity: a review
EP0534858B1 (fr) Amplification sélective des fragments de restriction: procédé général pour le "fingerprinting" d'ADN
JP5452021B2 (ja) ハイスループットａｆｌｐ系多型検出法
Cuenca et al. Assignment of SNP allelic configuration in polyploids using competitive allele-specific PCR: application to citrus triploid progeny
Lateef DNA marker technologies in plants and applications for crop improvements
Bazakos et al. A SNP-based PCR–RFLP capillary electrophoresis analysis for the identification of the varietal origin of olive oils
JP5729897B2 (ja) 非黒毛和種か否かを鑑定する方法及びキット
JP2004526453A (ja) ヌクレオチド分析のための方法および組成物
Yamagata et al. Selection criteria for SNP loci to maximize robustness of high-resolution melting analysis for plant breeding
CA3029167A1 (fr) Methode de production d'une banque d'adn et methode d'analyse d'adn genomique a l'aide d'une banque d'adn
Premkrishnan et al. In silico RAPD priming sites in expressed sequences and iSCAR markers for oil palm
Rikimaru et al. A method for discriminating a Japanese brand of chicken, the Hinai-jidori, using microsatellite markers
WO2010057525A1 (fr) Amorces oligonucléotidiques pour l'indexage nucléotidique de produits d'acp polymorphes et leurs procédés d'utilisation
JP2005027518A (ja) 塩基多型の検出方法
AU2005314732B2 (en) Method for identifying gene with varying expression levels
KR101351990B1 (ko) 한우 동일성검사를 위한 단일염기다형성 및 그의 용도
US7026115B1 (en) Selective restriction fragment amplification: fingerprinting
CN105695615A (zh) 一种用BccI鉴定人乳腺癌RAD51基因rs7180135多态性的方法
CN112111579B (zh) 滩羊源性成分的鉴别方法
KR101330398B1 (ko) 근육 특이적 마이크로 ＲＮＡ－１ 영역의 ＳＮＰｓ를 이용한 돼지의 육질 향상 여부 확인용 ＤＮＡ 단편 표지인자
JP6962593B2 (ja) コシヒカリの判別方法
JP4650420B2 (ja) 塩基判定方法及び塩基判定用キット
GB2435326A (en) Heteroduplex analysis of non-human analytes
CN117757952A (zh) 一种绵羊全基因组45k snp液相芯片及其应用
Shepherd et al. Monitoring of fluorescence during DNA melting as a method for discrimination and detection of PCR products in variety identification

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08875336

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08875336

Country of ref document: EP

Kind code of ref document: A1