GB2435326A

GB2435326A - Heteroduplex analysis of non-human analytes

Info

Publication number: GB2435326A
Application number: GB0603012A
Authority: GB
Inventors: Elliot Bland
Original assignee: CELL ANALYSIS Ltd
Current assignee: CELL ANALYSIS Ltd
Priority date: 2006-02-15
Filing date: 2006-02-15
Publication date: 2007-08-22
Also published as: GB0603012D0

Abstract

Use of heteroduplex analysis for the taxonomic identification of a biological non-human analyte in a sample. Methods and kits for the taxonomic identification of non-human analytes, such as micro-organisms including viruses (eg. HIV), bacteria, fungi, or plants or foodstuffs, comprising obtaining a sample of a nucleic acid comprising a polymorphism from said non-human analyte, fragmenting said nucleic acid and combining the population of nucleic acid fragments with a synthetic nucleotide construct which forms duplexes with the nucleic acid fragments such that duplexes of different conformations are formed dependent upon the presence of the polymorphism and separating the duplexes to identify the taxomomic designation of the analyte. Alternatively claimed are synthetic DNA constructs for use in induced heteroduplex generator (IHG) analysis which correspond to a known polymorphic site in a genomic DNA which comprise either (i) the wild-type and the mutant base or (ii) neither the wild type or mutant base.

Description

TAXONOMIC IDENTIFICATION

The present invention relates to the taxonomic identification of an unknown biological sample, and particularly, although not exclusively, to methods of identifying andlor discriminating between biological organisms in a sample. The invention extends to diagnostic testing methods of taxonomic identification using heteroduplex analyses techniques, which involve the use of induced Heteroduplex Generator (IHG) constructs. The invention extends to test kits for carrying out such identification methods, and also to improved designs of such IHG constructs used in these methods.

There is a constant need in the art for providing improved methods for carrying out fast and accurate taxonomic identification of organisms (animal, plant or microbioligical) contained within unknown biological samples. For example, in the field of food technology, there is a requirement to be able to quickly analyse in a qualitative and quantitative manner an unknown foodstuff, in order to accurately determine the composition of the foodstuff to ensure that it contains the correct ingredients. This is referred to as food authentication. By way of example, a food distributor may label a fish product as having a specified proportion of codfish, and offer the foodstuff to a supermarket for sale. However, the fish product may in fact contain a lower concentration of codfish than as marked on the product, and may contain a large proportion of another, inferior fish, for example, haddock. Hence, the supermarket may wish to analyse, and authenticate the foodstuff offered to them by the distributor to ensure that it contains the marked ingredients before purchasing.

Similar problems exist with other foodstuffs, which may contain no meat or fish, but which may contain a vegetable, such as rice. There is a need to be able to determine and authenticate the precise composition of such vegetarian dishes prior to purchase. in addition, economic adulteration is known to exist in which superior and hence, expensive foodstuffs are replaced with inferior and, hence, cheaper foodstuffs.

For example, basmati rice carries a premium and therefore unscrupulous producers may wish to replace it with an inferior rice. The same problem applies to meat and other vegetables such as potato. Hence, in the field of food authentication, there is a considerable need to provide improved analysis methods for taxonomic identification in an unknown test sample.

Another example where taxonomic identification of an unknown biological sample is required is in the field of micro-organism diagnostics. For example, there may be a need to determine whether a patient is infected with a wild-type form or a mutant form of a specific virus (e.g. HIV-l) or bacterium (Salmonella). The mutant form of the micro-organism may be a drug-resistant strain, whereas the wild-type form may be a drug-sensitive strain. It would be a significant advantage for the patient, if it were possible to quickly and accurately determine in a quantitative and qualitative manner the type and level of infection of micro-organism, as effective treatment regimes may then be devised.

Currently used methods for taxonomic identification, such as RFLP analysis, tend to be slow and often inaccurate, which may lead to incorrect identification of organism in the sample. For example, Microsatellite analysis requires a high-resolution gel or capillary electrophoresis. However, inheritance of microsatellites is unclear. Furthermore, providing synthetic controls is expensive as repeat sequences can be hundreds of base pairs long.

Hence, it is an object of the present invention to obviate or mitigate one or more of the problems of the prior art, whether identified herein or elsewhere, and to provide an improved method for carrying out taxonomic identification of an unknown biological sample.

The inventors of the present invention focussed their research on the use of heteroduplex analysis techniques, as they believed that such techniques may be used to solve the problem set out above. Heteroduplex DNA is double-stranded DNA in which the base sequences of each strand of DNA are not completely complementary with each other. Heteroduplexes form when two, almost complementary, pieces of single-stranded DNA (ssDNA) come together in a controlled heat-cool cycle. The non-complementary nature of the double-stranded DNA (dsDNA) leads to mismatching of DNA bases, which in turn leads to a change in conformational structure of the DNA from a straight piece of dsDNA (i.e. a homoduplex) to one of a kinked piece of dsDNA (i.e. a heteroduplex). When run on electrophoretic-based equipment, this heteroduplex has a greater virtual' weight than the original homoduplex. For example, a Factor V Leiden test kit piece of DNA is 146bp long, yet when run as a heteroduplex, it runs at virtual' weight of about 500-700bp. Hence virtual' weight refers to how heavy the heteroduplex appears compared to a DNA ladder on a electrophoretic graph, be it a gel or electronic measurement.

The use of heteroduplexes to analyse genetic abnormalities in humans is known in the art. A DNA sample is first taken from a subject being tested. Especially designed primers are then used in a PCR reaction to amplify up a target sequence in the DNA sample. After PCR, a controlled heating and cooling step is then used to induce heteroduplex formation and aid in the identification of patients who are either homozygous wild-type, homozygous mutant, or heterozygous for a genetic mutation.

GB 2,280,266 B discloses the use of heteroduplex analysis for investigating genetic abnormalities (polymorphisms) in human patients, for example, for diagnosing phenylketonuria. The method involves the use of an induced heteroduplex generator (IHG), which enables the identification of patients who are homozygous and heterozygous for the disease being investigated. IHGs are synthetic DNA sequences homologous to a genomic sequence but containing deliberate nucleotide deletions, insertions or substitutions at positions vicinal to a known mutation site within that genomic sequence. The IHG is designed such that it can be amplified using the same PCR primers as the target sequence in the genomic DNA. Following PCR amplification, the products from genomic DNA and from the IHG are then mixed together, then denatured using heat, and then re-hybridised by slow cooling.

This generates DNA heteroduplexes in which one strand is genomic (either wild-type or mutant) and the other is IHG.

These two types of heteroduplex are referred to as "wild-type + IHG" heteroduplexes, and "mutant + IHG" heteroduplexes. The heteroduplexes are then separated using gel electrophoesis in order to determine the presence or absence of the polymorphism or mutation, and hence, determine the patients' genetic predisposition to the disease being diagnosed. Dependent on whether the genomic strand contains the normal or the mutant sequence, the conformation of the heteroduplex will differ, resulting in different and characteristic electrophoretic mobilities of the two different forms. The deliberate deletion/insertion]substitutjon in the IHG is known as an "amplifier" or "identifier", which exaggerates the conformational difference between "wild-type + IHG" heteroduplexes, and "mutant + IHG" heteroduplexes. GB 2,280,266 B discloses the use of IHG molecules having an identifier, which consists of either the wild-type (genomic base) or the corresponding mutant base of a polymorphic site.

As shown in Figure 1, when in dsDNA form, cytosine only pairs with guanine, while thymine will only pair with adenine. This is due, in part, because of the electrophilic/nucleophilic charges upon each of the bases. Cytosine and guanine each have three functional groups available with charges. Hence, when orientated in the correct manner, they can form three hydrogen bonds (as indicated by... in Figure 1).

Adenine and thymine have two functional groups with charges available. Hence, when orientated in the correct position, they form two hydrogen bonds. When DNA, which has a negatively charged backbone, is placed under electrophoretic conditions, it is drawn towards the positive electrodes of the gel. Hence, when the DNA bases are unpaired in electrophoretic conditions, they form charged functional groups, which, in part, dictate how the electrophoretic mobilities between the "wild-type + IHG" and "mutant + IHG" heteroduplexes differ, as the number of unpaired bases will be different between wild-IHG and mutant-IHG heteroduplexes.

It will be appreciated that a key aspect of heteroduplex analyses is the sequence of the IHG, and its identifier. While computer modelling may be used to try to predict the best identifier in the IHG to use against any given mutation in a given sequence, what is predicted in theory does not often result in optimum results. The inventors of the present invention have realised that there are a number of factors which need to be considered when designing a suitable IHG:- (i) The size of the PCR target region in the genomic DNA; (ii) The positions of both primer sequences for genomic amplification; (iii) The placement of the 5' and 3' extremes of the PCR target region relative to the mutation site; (iv) The nature of the identifier to be introduced into the IHG (i.e. (v) The placement of the identifier relative to the mutation site (5' or 3', immediately adjacent or one or more nucleotides away, or overlapping); (vi) The size of the identifier itself (e.g. 3 nucleotides, 4 nucleotides, 5 nucleotides etc); and (vii) The inclusion of either the normal nucleotide or the mutant at the position within the THG corresponding to the mutation site in the genomic sequence.

Hence, it will be appreciated that there are many factors, which need to be taken into consideration when designing a suitable IHG for use in heteroduplex analysis of an unknown sample of DNA. In addition, there is a need to provide specific IHGs for examining different polymorphisms in different genes. Furthermore, there is a need to improve the design of the IHG used to improve band separation between different samples under test. Increased separation means that shorter gels can be used, and that shorter running times are required.

From the foregoing, it will be appreciated that IHGs have been applied in heteroduplex analysis for the diagnosis of genetic disorders in man. However, to date, no-one has considered using IHG constructs with heteroduplex analysis for taxonomic identification of an unknown biological sample, i.e. for identifying and discriminating between different species of an organism (either plant, animal, bacterial or viral), or for identifying and discriminating between different individual variants of a specific species of organism in an unknown sample.

The inventors of the present invention therefore focussed their research on the use of heteroduplex analyses of polymorphic sites or regions in different genes of a variety of organisms to see if it would be possible to identify and discriminate between different species, and also to discriminate between individual variants of such species in an unknown biological sample or analyte. The inventors chose a number of different species of organisms for their investigations such as, animals, plants, fungi, bacteria, and virus etc. To their surprise, they found that it was possible to carry out taxonomic identification using heteroduplex analysis, and to identify and discriminate between different species or variants of animals (e.g. fish and birds, chicken and turkey, and dogs), plants (e.g. rice), bacteria (e.g. Salmonella) and viruses (e.g. HIV) in an unknown sample.

Hence, according to a first aspect of the present invention, there is provided a method for the taxonomic identification of a non- human biological analyte, the method comprising the steps of:- (i) obtaining a sample of nucleic acid from a biological non-human analyte, the nucleic acid comprising a polymorphism which is indicative of the taxonomic designation of the analyte; (ii) forming a population of nucleic acid fragments from the sample; (iii) combining the population of nucleic acid fragments with a population of a synthetic nucleotide construct, which construct is adapted to form duplexes with the nucleic acid fragments, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid fragments dependent on the presence of the polymorphism at a known variable nucleotide or sequence of nucleotides within the nucleic acid sample under examination, (iv) permitting duplex formation within the combined populations in step (iii); (v) separating the duplexes formed in step (iv); and (vi) identifying the taxonomic designation of the analyte, based on the results in step (v).

The method according to the first aspect involves the use of heteroduplex analysis to carry out the taxonomic identification of the analyte organism under examination. GB 2,280,266B and GB 2,338,062B only specifically disclose methods for using heteroduplex analysis for the diagnosis of genetic disorders in man.

However, these documents do not disclose using heteroduplex analysis for taxonomic identification of an unknown non-human biological sample analyte. Hence, in a further aspect, there is provided use of heteroduplex analysis for the taxonomic identification of a biological non-human analyte in an unknown sample. Hence, advantageously, and surprisingly, the method according to invention provides fast and accurate taxonomic identification of the biological non-human analyte in an unknown sample, such that the taxonomic designation of the analyte may be determined.

Speciation via genetic analyses is not generally available, and it very time-consuming. In particular, until now, all genetic speciation was presumed to be via RFLP analysis of the genome. Furthermore, until recently, speciation using a few key polymorphisms has not been possible. Hence, the inventors believe that the method according to the first aspect of the invention could not have been predicted from the prior art, and therefore represents an inventive step.

By the term "taxonomic identification", we mean the determination of the biological designation of the non-human analyte organism, or the effective discrimination between the biological designations of at least two different non-human analyte organisms. This may also be referred to as taxonomic classification'.

By the term "biological designation", we mean the domain, kingdom, phylum, class, order, family, genus, or species, or sub-species of the analyte under investigation.

Hence, suitably, the method of the first aspect may be used to identify or discriminate the domain of the analyte, more suitably, the kingdom, even more suitably, the phylum, and still more suitably, the class of the non-human biological analyte under investigation. Preferably, the method may be used to identify or discriminate the order of the analyte, more preferably, the family, even more preferably, the genus, and most preferably, the species of the non-human biological analyte. It is also prefened that the method may be used to identify or discriminate between varieties of individuals of a species of the same non-human biological analyte.

Surprisingly, the method according to the first aspect may be used to identify or discriminate between a very wide variety of organisms. Hence, advantageously, heteroduplex analysis is not solely limited to investigating humans as in the prior art.

For example, preferred biological analytes include animals (except humans), plants, fungi, bacteria, and viruses. Hence, the biological analyte, which may be identified using the method according to the first aspect may be independently selected from a group consisting of:-animals; plants; fungi; bacteria; and viruses.

By the term "polymorphism", we refer to the co-existence, within a population, of more than one form of a gene or a portion thereof (e. g. an allelic variant), at a frequency too high to be explained by recurrent mutation alone. A portion of a gene of which there are at least two different forms consisting of two different nucleotide sequences (i.e. a wild-type and a mutant form) is referred to as a "polymorphic region of a gene". Furthermore, a specific genetic sequence at a polymorphic region of a gene is an allele. The term "allele" refers to the different sequence variants found at different polymorphic sites in the nucleic acid sample obtained from the analyte. A polymorphic region may be a single nucleotide (a single nucleotide polymorphism, or SNP), the identity of which differs in different alleles.

However, a polymorphic region may also be several nucleotides long.

The nucleic acid sample obtained in step (i) of the method may comprise RNA. However, it is preferred that the nucleic acid sample comprises DNA. The nature of the step (i) for obtaining the sample of nucleic acid will greatly depend on the nature of the biological non- human analyte under investigation. As mentioned herein, the analyte may comprise an animal (except human), plant, fungus, bacterium, andlor virus. Hence, the skilled technician will know how to obtain a suitable sample of nucleic acid from each of these various sources in step (i). For example, if the nucleic acid sample is obtained from a non-human animal, such as a mammal, the nucleic acid may be obtained from blood cells. Other sources of nucleic acid suitable for use with the method include hair follicles, skin, etc. The nucleic acid may be isolated by any appropriate method for example by the rapid salting out method described by Miller et al (Nucl. Acids Res. 16: 121 5). Alternatively, DNA may be isolated as eDNA from mRNA by reverse transcription.

The nucleic acid may be isolated from a plant using the methods described in Mahuku GS "A simple extraction method suitable for PCR-based analysis of plant, fungal, and bacterial DNA", Plant Molecular Biology Reporter (1): 71-81 MAR 2004.

The nucleic acid may also be isolated from a plant using the methods described in Tapia-Tussell R et al., Molecular Biotechnology 31(2): 137-139 OCT 2005. The nucleic acid may be isolated from a virus using the methods described in Vignoli et al, Research in Virology 146 (2): 159-162 MAR-APR 1995.

It will be appreciated that the nucleic acid comprises the polymorphism under examination, which is indicative of the taxonomic designation of the analyte organism. Hence, the sample of nucleic acid preferably comprises at least that part of the relevant gene containing the polymorphism. This may be a part of the gene ultimately coding for a region of the functional protein (i.e. an exon). However, it is known that some mutations in introns can cause disease problems, and hence, the inventors believe that some organisms may be differentiated by polymorphisms in their intron sequences. Hence, the nucleic acid may comprise an intervening part of the gene, which is not responsible for coding the functional protein (e.g. an intron), but which may nevertheless affects transcription and translation.

It will be appreciated that in order to increase the efficiency of the method according to the invention, it is essential that a population of nucleic acid fragments are formed from the sample obtained in step (i). Hence, the method comprises step (ii), which comprises amplifying the nucleic acid before step (iii), and subsequent analysis thereof. Suitable amplification techniques used in step (ii) will be known to the skilled technician, such as cloning, polymerase chain reaction (PCR), polymerase chain reaction of specific alleles (PASA), polymerase chain ligation, nested polymerase chain reaction, and the like. It is preferred that step (ii) comprises use of the PCR reaction, and involves the use of suitable primers. Any appropriate oligonucleotide primers may be employed. The primers should be suitable for amplification of the specific nucleotide locus in the nucleic acid sample under investigation.

Following the formation of the population of the nucleic acid fragments in step (ii), the method according to the invention comprises combining the population with the synthetic nucleotide construct. The method according to the first aspect involves the careful design of a synthetic nucleotide construct, also referred to herein an Induced Heteroduplex Generator (IHG), which is then used in step (iii) of the method.

This is so that when duplexes are allowed to form in step (iv) of the method, different molecular conformations are formed between the said construct and the nucleic acid fragments dependent on the polymorphism in the nucleic acid sample being investigated. These different molecular conformations are then separated in step (v).

The synthetic nucleotide construct (or IHG) used in step (iii) of the method preferably comprises synthetic DNA, because this will form the most stable duplexes with DNA fragments containing the nucleic acid under investigation. Where the synthetic construct is a DNA construct, the population of the synthetic DNA construct used in step (iii) of the method may be formed using PCR, preferably employing the same primers as used in step (ii) for forming the population of the nucleic acid sample under investigation. However, different primers may be used providing the resultant amplified population of construct is capable of forming the necessary duplexes with the nucleic acid fragments in step (iv) of the method.

In the PCR reaction, cycles of DNA denaturation, primer annealing and synthesis of the resultant DNA segment defined by the 5' ends of the primers is repeated as many times as is necessary to amplify the nucleic acid under examination (or the construct) until sufficient amounts are available for step (iv) of the method to allow duplexes to form. Amplification of the nucleotide sequence under investigation and the construct may be conducted simultaneously in a mixed PCR or in separate PCR reactions.

The primers are preferably labelled for facilitating the comparison between the results of the separation of the duplexes in step (v) of the method. For example, the primers may be labelled with a directly detectable tag, for example a radionucleotide.

An example of a suitable radionucleotide includes 32P or 35P, a fluorescent compound such as fluorescein, an enzyme such as a horseradish peroxidase or alkaline phosphatase, with biotin or digoxigenin. Most preferred labels comprise use of HEX (Hexachlorofluorescein), TET (Tetrachlorofluorescein), or FAM (carboxyfluorescein) The two primers may have the same or different labels.

Before formation of a population of the construct (for example by using the PCR), for use in step (iii) of the method, the construct must first be synthesised.

Typically, the construct is synthesised from multiple synthetic oligonucleotides, for example. Once synthesised, it may be cloned in a suitable host, for instance an Ml 3 phage. The amplified nucleic acid fragments and the amplified construct obtained from mixed PCR or separate PCRs are heated (mixed PCR) or mixed and heated (separate PCR5) to permit separation of the amplified product into single stranded nucleic acid which is then allowed to re-anneal under suitable annealing conditions to form the duplexes.

While investigating the method according to the invention, the inventors have appreciated that a crucial and non-obvious aspect of the invention was in the correct design of the construct prior to use in step (iii) of the method, and in particular, the specific sequence of the identifier therein. The inventors therefore carried out involved investigations in designing a preferred strategy for designing the synthetic construct, and this is described in detail in Examples 1-7. The inventors believe that their research required significant inventive endeavour to produce an optimum strategy, which is summarised in Figure 9.

The Examples describe how the IHG may be designed to match-up with the bases in the wild-type DNA, or with the bases in the mutant, or with both the wild-type and mutant base, or it may be designed to match with neither. Hence, the IHG may comprise both the mismatch of the insertion and the mismatch of the mutation such that bases in between these two mis-matches may be forced apart, i.e. this constitutes the different molecular conformation. While the inventors do not wish to be bound by any hypothesis, they believe that as these bases are forced apart in the duplexes formed in step (iv) of the method, they contribute to the net charge of the dsDNA fragment, and will thereby dictate as to the new virtual' weight of the fragment, thereby enabling effective separation of the duplexes in step (v) of the method.

The synthetic construct used in accordance with the invention may comprise at least one deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s), which is/are either (a) opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid of the analyte under examination and/or (b) contiguous with a nucleotide which is opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid of the analyte under examination. It will be appreciated that this at least one deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) may be referred to as the identifier sequence'. The identifier sequence is adapted to induce heteroduplex formation to allow differentiation therebetween.

By the term "opposite", we mean that, in the resultant duplex between the analyte nucleic acid fragment strand and the synthetic construct strand formed in step (iv) of the method, the deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) is/are in the position(s) in the synthetic construct strand corresponding to the variable nucleotide(s) under examination.

By the term "contiguous", we mean a portion of the synthetic construct strand may be a single nucleotide in contact with the nucleotide opposite the variable nucleotide(s), or may be a nucleotide sequence, preferably, no more than 20 bases in length, in which one of the end nucleotides is in contact with the nucleotide opposite the variable nucleotide(s).

The nucleotide substitution(s) and/or deletion(s) and/or insertion(s) contained in the sequence of the construct may be made either (a) relative to the wild-type of the nucleic acid sequence under examination so that, in the duplexes formed between the nucleic acid fragments and the construct in step (iv) of the method, there is created a deliberate or controlled mismatch when the nucleotide sequence contains a mutation from the wild type; or (b) relative to a mutant of the nucleotide sequence under examination so that, in the duplexes formed between the nucleic acid fragments and the construct, there is created a deliberate or controlled mismatch when the nucleotide sequence is either wild type or another (different) mutant. Hence, if the construct is constructed to be most similar to wild-type, then when it is cross-matched with the mutant, it would have an extra mismatch aside from the insert/deletion.

The nucleotide sequence of the synthetic construct may comprise a deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) contiguous with the nucleotide, which may be opposite the known variable nucleotide or sequence of nucleotides. The nucleotide sequence of the synthetic construct may comprise deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) opposite the known variable nucleotide or sequence of nucleotides.

Preferably, the synthetic construct comprises nucleotide substitution(s) and deletion(s), which are both opposite and contiguous with the mutation. The inventors of the invention have found that asequence of between 1 and 15 substitutions/deletions/insertions substantially adjacent the position of the polymorphism in the nucleotide acid sequence under investigation provides optimum separation in step (v) of the method. Hence, preferably, the synthetic construct comprises between 1 and 15 substitutions/deletions/insertions substantially adjacent the position of the polymorphism in the nucleic acid sequence under investigation.

However, preferably, the synthetic construct comprises between 1 and 10, and more preferably, between 1 and 7 substitutions/deletions/insertions substantially adjacent the position of the polymorphism in the nucleotide sequence under investigation.

Most preferably, the synthetic construct comprises between 2 and 5, and most preferably, 2, 3, 4, or 5 substitutions/deletions/insertions substantially adjacent the position of the polymorphism in the nucleic acid under investigation. In a most preferred embodiment, the construct comprises 4 substitutions/deletions/insertions substantially adjacent the position of the polymorphism in the nucleic acid sequence under investigation. The inventors have found that in some embodiments, it is especially preferred for the construct to comprise an insertion.

As described in the Examples, the inventors have also found that that when designing an effective IHG construct, serious inventive consideration of the charges of the bases (this applies to all bases (C, G, T, and A), but C and G have the greatest associated charge) and has to be given to a number of factors, as identified as 1-7 in Example 2. It will be appreciated from Figure 1, that, due to their greater number of associated charges, the bases guanine and cytosine have a greater effect when placed in electrophoretic conditions. Guanine and adenine have net positive charges, with guanine having a greater positive charge than adenine. Cytosine and thymine have net negative charges, with cytosine having a greater negative charge than thymine. When these bases are unpaired in electrophoretic conditions, DNA, which has a negatively charged backbone, it is drawn towards the positive electrodes.

The difference between the "wild-type + IHG" and "mutant + IHG" heteroduplexes will be one or more unpaired bases. When compared, the heteroduplex that gains mismatched/unpaired guanines and adenines will have an increased virtual' weight, because the positive charges of guanine and adenine will lower the overall charge of the DNA heteroduplex fragment. However, the heteroduplex that gains mismatchedlunpaired cytosines and thymines will have a lowered virtual' weight, due to these bases adding to the overall negative charge of the DNA fragment.

Therefore, the inventors realised from the investigations described in Examples 1 and 2, that the use of guanine and cytosine groups as inserts/deletions/substitutions results in surprisingly better separation in step (v), for example, when run on an electropheretic gel, due to their greater net available charge.

Hence, it is most preferred that the construct comprises a guanine and/or cytosine insertion or deletion substantially adjacent the position of the polymorphism in the nucleotide sequence under investigation. It is therefore preferred that the construct comprises I and 7 guanine or cytosine insertions/deletions substantially adjacent the position of the polymorphism in the nucleotide sequence under investigation. Most preferably, the synthetic construct comprises between 2 and 5 guanine or cytosine insertions/deletions, and most preferably, 2, 3, 4, or 5 guanine or cytosine insertions/deletions substantially adjacent the position of the polymorphism in the nucleotide sequence under investigation. In a most preferred embodiment, the construct comprises 4 guanine or 4 cytosine insertions/deletions substantially adjacent the position of the polymorphism in the nucleotide sequence under investigation.

The insertion or deletion be positioned between 1-15 bases away from the position of the polymorphism in the nucleotide sequence under investigation.

Preferably, the insertion or deletion is positioned between 1-10 bases, more preferably, between 1-5 bases, and even more preferably, between 1-3 bases away from the position of the polymorphism in the nucleotide sequence under investigation.

Therefore, in one preferred embodiment, the construct preferably comprises three guanine or cytosine bases that are two bases from the position of the polymorphism in the nucleotide sequence under investigation. In another preferred embodiment, the construct preferably comprises four guanine or cytosine bases that are two bases from the position of the polymorphism in the nucleotide sequence under investigation. In another preferred embodiment, the construct preferably comprises five guanine or cytosine bases that are two bases from the position of the polymorphism in the nucleotide sequence under investigation. The inventors have surprisingly found that use of such preferred constructs results in the greatest difference in "virtual" weight resulting in maximum separation in step (v) of the method. This increased difference in weight improves the separation between the heteroduplexes meaning shorter gels and shorter gel running times may be used.

The inventors investigated still further improved modifications of the design of the IHG construct and, in particular, the identifier sequence therein. Example 6 and Figure 10 clearly shows that a significant improvement in heteroduplex separation is seen if the IHG includes either (i) the wild-type base and the mutant base of the polymorphism, or (ii) neither.

Hence, it is especially preferred that the synthetic construct used in the method of the invention comprises an identifier sequence, which comprises either (i) the wild-type base and the mutant base of the polymorphic site; or (ii) neither the wild-type base nor the mutant base of the polymorphic site.

The inventors were most surprised at this finding. Previous research into use of IHG technology teaches the reader that use of an IHG construct having either the wild-type or the mutant base should be used, but not both or certainly not neither.

Previous IHG research use wild or mutant at the SNP site, and teach that this leads to one heteroduplex having more mismatching than the other. However, the inventors of the present invention have found that by using either both base (mutant and wild-type) or neither, keeps the number of mismatches the same but the insert/deletionlsubstitution moves relative to the SNP site.

The method of the invention extends to the simultaneous identification of more than one polymorphism in the sample of nucleic acid derived from the biological non-human analyte. A plurality of polymorphisms in the same sample may be referred to as a polymorphism pattern. The method of taxonomic identification according to the invention may be carried out, wherein the sequence of the construct is such that duplexes of different molecular conformation are formed between the construct and the nucleic acid fragments dependent upon the presence or absence of polymorphisms at two or more known variable nucleotides and/or sequences of nucleotides within the sequence of the sample under examination.

Hence, in such embodiments of the method, it is preferred that the synthetic construct comprises deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) corresponding to at least two known polymorphisms in the nucleotide sequence, and preferably corresponding to all of the known polymorphisms in the nucleotide sequence. It should be appreciated that the extent of deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) should not be so great that duplex formation between the nucleic acid fragments and the construct is not possible.

In addition, the construct may also include a deliberate deletion or a series of deletions, at a position distal from polymorphic sites in the nucleotide sequence under investigation, and this may be in addition to any deletion adjacent to a mutation site.

The inventors believe that this will have the effect of permitting better electrophoretic separation of heteroduplexes from homoduplexes.

It is especially preferred that the synthetic construct comprises a deletion of 1-bases substantially adjacent the position of the polymorphism in the nucleic acid sequence under investigation, and more preferably, a deletion of 1-10 bases.

Preferably, the synthetic construct comprises a deletion of 1-7 bases, and more preferably, 2-4 bases, substantially adjacent the position of the polymorphism in the nucleic acid sequence under investigation. Preferably, the deletion is between about 5-bases from the position of the polymorphism, and more preferably, between about 7-20 bases from the position of the polymorphism. It is most preferred that the deletion is between about 10-12 bases away from the position of the polymorphism.

Hence, in a most preferred embodiment of the method, it is preferred that the synthetic construct comprises an identifier sequence, which comprises either both the wild-type base and the mutant base, or neither. In addition, the preferred construct comprises an insertion of 4 guanine residues about 2 or 3 bases from the identifier sequence. Furthermore, the preferred construct comprises a deletion of 2-4 bases at a distance of about 10-12 bases away from the polymorphic site. The inventors have surprisingly found that an IHG construct having all of the features exhibits excellent heteroduplex separation, and therefore is most advantageous for carrying out the IHG analysis method according to the invention.

In step (iv) of the method, duplexes are preferably allowed to form between the coding and non-coding strands of nucleic acid, be they from the sample of nucleic acid under examination, or from the synthetic construct. In particular, a proportion of the duplexes so formed will be mismatched hybrids between sense and anti-sense strands of partially homologous sequences (i.e. "heteroduplexes"), which may be formed either in cis or trans orientations, or in both cis and trans orientations.

In step (v) of the method, the heteroduplexes formed are preferably separated according to their molecular conformation, which affects their apparent, but not actual, molecular weight (i.e. their virtual weight). Separation may be achieved by any electrophoretic-based equipment, for example, electrophoresis or capillary electrophoresis, which will be known to the skilled technician. Hence, preferably, step (v) of the method comprises the use of electrophoresis to separate the duplexes formed in step (iv). Preferably, the separation may be carried out on a gel, which does not fully denature the nucleic acid, such as a non-denaturing polyacrylamide gel, non-denaturing capillary electrophoresis. The electrophoresis is preferably conducted under conditions, which effect a desired degree of resolution of the duplexes. A degree of resolution that separates duplexes that differ in "apparent or virtual size", resulting from their different molecular conformations, by a minimum of about 2bp, more preferably, 5bp, and most preferably, 10 bp is preferred. The heteroduplexes may therefore be "shifted" away from the homoduplexes in the separation step (v) by introducing one or more deliberate deletions in the construct as described above. This has the effect of retarding the mobilities of all heteroduplexes within the gel. Size markers may also be run on the gel to permit estimation of the apparent size of duplexes.

The results of the separation conducted in step (v) of the method of the invention may be compared with the results of one or more similar separations conducted on duplexes formed using steps (i) to (iv) above with the same synthetic nucleotide construct, and a population of nucleic acid fragments bearing a nucleotide sequence corresponding to the said nucleotide sequence under examination, but taken from one or more different samples of DNA or RNA. This enables polymorphisms in any of the nucleic acid samples to be detected and compared.

The inventors have realised that prior art methods using heteroduplex analysis involve writing the JUG construct to have the same bases as the mutant. However, surprisingly, the inventors have also now found that substantially increased separation can be achieved by writing' the IHG construct to the base of greatest value, even if that is the wild-type sequence, as described above. Furthermore, if this is coupled to an insert/deletion of similar charge, as described above, for example, inserting cytosines and writing the IHG to the cytosine, then even better separation is observed.

Hence, when the mismatch happens there will be an increase in unpaired cytosine residues, and therefore guanine residues in the complementary strand, resulting in improved separation in step (v) of the method.

The distribution, i.e. the resolution pattern, of the heteroduplexes in step (v) of the method will be allele-specific. Hence, step (vi) of the method comprises inspection of the results of the separation of the duplexes in step (v), i.e. the resolution pattern formed by the duplexes, in order to identify the taxonomic designation of the analyte. Accordingly, the resolution pattern or PCR fingerprint may then be visualised. Where a PCR primer has been labelled, this label may be revealed. A substrate carrying the separated labelled duplexes is preferably contacted with a reagent, which detects the presence of the label. Where the PCR primers were not labelled, the substrate bearing the PCR fingerprint may be contacted with, for example, ethidium bromide and the nucleic acid fragments visualised under ultraviolet light. Alternatively, the heteroduplexes may be visualised with silver staining.

Preferably, the method comprises use of an agent that is adapted to enhance the separation characteristics between the homoduplexes and the heteroduplxes formed in step (iv). Examples of a suitable agent comprises a maleimide, and preferably, bis-maleimide. Preferably, the agent is added to the combination of populations of nucleic acids under investigation and synthetic nucleotide constructs prior to duplex formation. Alternatively, the agent may be added after duplexes have formed.

The relative molecular conformation of the duplexes is thus determined in step (vi), in this embodiment, as a pattern of bands representing the duplexes which migrate different distances from the origin on the gel, dependent on their relative molecular conformation as defined in step (iii). This may then be compared with the relative molecular conformation of duplexes resulting from a similar exercise (using the same construct) conducted on a nucleotide sequence of a second sample of nucleic acid.

The method according to the invention may be used to investigate a second sample of nucleic acid from a biological non-human analyte. Hence, the method may ascertain the relative molecular conformation of the duplexes obtained between the two samples, and therefore whether nucleotide sequences of a second sample of nucleic acid are the same as the first sample, or not. Hence, the relative molecular conformation in respect of the second sample of the nucleic acid (preferably, DNA) may be obtained using the same conditions as are employed to obtain the relative molecular conformation in respect of the first nucleic acid sample. Preferably, the same primers are used. Similarly, separation of the resulting duplexes in step (v) of the method need not be carried out in an identical fashion provided it is possible to assess the relative correspondence of the molecular conformation of the duplexes resulting from amplification of each sample.

The second sample of nucleic acid may be analysed according to the method simultaneously with or at a different time to analysis of the first nucleic acid sample.

It will be appreciated that a plurality of samples nucleic acid from a biological non-human analyte may be analysed. The relative molecular conformation determined for each sample investigated may be stored in a computer or on a computer readable data carrier. A computer database may therefore be generated containing the relative molecular conformation distribution patterns for different samples investigated.

It will be appreciated that the method according to the first aspect of the invention has great utility for identifying the taxonomic designation of a non-human biological analyte sample. The inventors have therefore designed a series of test kits, which may be used to carry out the method of the invention, which are described in

Examples 8-14.

Hence, according to a second aspect of the invention, there is provided a taxonomic identification test kit for identifying the taxonomic designation of a biological non-human analyte, which kit comprises:- (a) at least two oligonucleotide primers suitable for use in PCR, and capable of annealing to complementary sequences at respective ends of a sample of nucleic acid sequence to be examined, which sample is obtained from a non-human analyte; (b) a synthetic nucleotide construct capable of forming duplexes with the nucleic acid sequence under examination, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid sequence under examination dependent upon the presence of a polymorphism at a known variable nucleotide or sequence of nucleotides within the sequence under examination; and optionally, (c) a control DNA andlor control PCR amplification product.

Preferred features of the synthetic construct may be defined as in the first aspect. Hence, the synthetic nucleotide construct may comprise one or more deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) (i.e. an identifier sequence) which is/are (i) opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination and/or (ii) contiguous with a nucleotide which is opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

The synthetic construct may comprise any of (i) a 3 or 4 or 5 Guanine/Cytosine base insertion; (ii) either both the wild-type base and the mutant base, or neither; and (iii) a deletion of about 1-7 bases about 5-50 bases from the polymorphic site. Preferably, the construct comprises (i), (ii) and (iii).

The primers may be labelled as defined in respect of the first aspect. The control PCR amplification product may also be labelled. Preferably, the test kit comprises at least one of the following:-a heat-stable DNA polymerase; dATP, dCTP, dGTP and dTTP or analogue thereof; appropriate biological buffers and cofactors; or a database comprising the relative molecular conformation and gel mobilities of DNA fragments generated by PCR amplification and heteroduplex formation between selected DNA samples and the construct.

Examples of suitable nucleotide analogues include dUTP, iso-guanine (iG), and 5'-methyl-cytosine (iC).

It will be appreciated that the method according to the first aspect or the kit according to the second aspect may be used to identify or discriminate between a wide variety of organisms. For example, preferred biological analytes include animals (except humans), plants, fungi, bacteria, and viruses. Hence, the biological analyte, which may be identified using the method according to the first aspect may be independently selected from a group consisting of:-animals; plants; fungi; bacteria; and viruses.

The inventors have found that accurate taxonomic identification may be achieved by investigating a polymorphic area or polymorphism pattern of the analyte being investigated. For example, when the method of the invention is used to identify animals, a preferred polymorphic area may comprise a gene encoding a cytochrome, ribosome, or mitochondrial DNA. For example, when the method is used to identify plants, a preferred polymorphic area may comprise a gene encoding a chioroplast. For example, when the method is used to identify bacteria, a preferred polymorphic area may comprise a gene encoding a 16S ribosomal subunit. For example, when the method is used to identify a virus, a preferred polymorphic area may comprise a gene encoding a protease enzyme.

By way of example, where the analyte is an animal, it may comprise any mammal, for example, any veterinary animal, such as, a horse, cow, sheep.

A preferred animal may comprise a mammal, for example, any mammal, which may have veterinary applications, such as a horse, cattle (bovine), sheep, pigs, dogs, and cats. For example, as described in Example 14, dogs (Canisfamiliaris) are known to suffer from a canine mutation, which causes congenital stationary night blindness. Hence, the method according to the first aspect or the kit according to the second aspect may be used to detect for this polymorphism. Example 14 provides details of preferred PCR primers, preferred nucleotide constructs, and preferred controls for use in a test kit for detecting the canine mutation.

Another preferred animal, which may be identified using the method of the first aspect or with the kit of the second aspect may comprise a bird. The bird may be a chicken or a turkey. For example, as described in Example 13, chickens and turkeys may be distinguished by designing synthetic constructs suitably adapted to form heteroduplexes based on the polymorphism shown. Hence, the method according to the first aspect or the kit according to the second aspect may be used to detect for this polymorphism to detect chickens or turkeys, or to distinguish between these two species. Example 13 provides details of preferred PCR primers, preferred nucleotide constructs, and preferred controls for use in a test kit for detecting chickens or turkeys.

Another preferred animal, which may be detected using the method according to the first aspect or with the kit of the second aspect may be a fish, as described in Example 9. For example, a preferred fish, which may be identified using the method may comprise Oncorhynchus spp, such as Oncorhynchus mykiss, Oncorhynchus clarki, or Oncorhynchus tshaviytscha. Another preferred fish may comprise Salmo salar, Fontinalis antipyretica, or Gadus macrocephalus. Other preferred fish may comprise Tuna sp. e.g Thunnus albacares (Yellowfin tuna). The taxanomic identification is Family (scombridae)>subfamily (scombrinae)>tribe (Thunnini). It is also preferred that the fish under investigation may be flatfish, ie. classification (Pleuronectoidei), and most preferably, Parophrys vetula. Sturgeon fish are also preferred, i.e. family> Acipenseridae.

For example, as described in Example 9, O.mykiss and S.salar may be distinguished by designing synthetic constructs suitably adapted to form heteroduplexes based on the polymorphism shown. Hence, the method according to the first aspect or the kit according to the second aspect may be used to detect for this polymorphism to detect O.mykiss or S.salar, or to distinguish between these two species. Example 9 provides details of preferred PCR primers, preferred nucleotide constructs, and preferred controls for use in a test kit for detecting O.mykiss or S.salar.

Examples of suitable plants, which the method of the first aspect or the kit of the second aspect may be used to identify as analyte include rice (see Example 12), potato, fruits, barley, maize, sunflower, olives, nuts, and grapes.

For example, as described in Example 12, rice species Japonica and Indica may be distinguished by designing synthetic constructs suitably adapted to form heteroduplexes based on the polymorphism given. Hence, the method according to the first aspect or the kit according to the second aspect may be used to detect for this polymorphism to detect Japonica or Indica, or to distinguish between these two species. Example 12 provides details of preferred PCR primers, preferred nucleotide constructs, and preferred controls for use in a test kit for detecting Japonica or Indica.

The inventors therefore envisage that the method according to the first aspect or the kit according to the second aspect may be used for food authentication, for example, for determining the precise composition of various foodstuffs. Hence, in a third aspect, there is provided a method of analysing a foodstuff, the method comprising carrying out steps (i) to (vi) of the method according to the first aspect, on a foodstuff analyte sample.

The foodstuff may comprise any type of foodstuff, which may require authentication, for example, fish, plant or meat material.

Furthermore, in a fourth aspect, there is provided a foodstuff authentication test kit, wherein the kit is as defined in the second aspect, and comprises primers for detecting fish, meat or plant material.

Preferred primers for the kit of the fourth aspect are provided in the Examples.

The inventors envisage that an important use of the method of the first aspect or the kit of the second aspect will be for investigating bacteria or viruses, either from a food source or from a patient, which may be a human.

Examples of bacteria, which may be detected with the method of the first aspect or the kit of the second aspect include Salmonella, Staphylococcus (e.g. S.areus), Clostridium sp., Pseudomonas sp., Helicobactor sp., Bacillus sp., Enterobacker sp., Serratia sp.

For example, as described in Example 11, it is possible to detect and distinguish between Salmonella sp., which are Quinoline resistant or sensitive by designing synthetic constructs suitably adapted to form heteroduplexes based on the polymorphism given. Hence, the method according to the first aspect or the kit according to the second aspect may be used to detect for this polymorphism to detect Salmonella enterica and quinoline resistance therein. Example 11 provides details of preferred PCR primers, preferred nucleotide constructs, and preferred controls for use in a test kit for detecting Salmonella enterica and quinoline resistance therein.

Examples of viruses, which the method of the first aspect or the kit of the second aspect may be used to identify include HIV, Human papilloma virus, Influenza sp. hepatitis virus, and tuberculosis.

For example, as described in Example 10, it is possible to detect and distinguish between HIV-I strains, which may be resistant to a drug, for example, AZT. The kit described includes suitably designed synthetic constructs that are adapted to form heteroduplexes based on the polymorphism given. Hence, the method according to the first aspect or the kit according to the second aspect may be used to detect for this polymorphism to detect for HIV-l AZT resistance. Example 10 provides details of preferred PCR primers, preferred nucleotide constructs, and preferred controls for use in a test kit for detecting HIV-I AZT resistance.

Hence, the inventors envisage that the method according to the first aspect or the kit of the second aspect may be used for testing the type and level of infection of a micro-organism in a sample.

Hence, in a fifth aspect, there is provided a method of detecting a micro-organism in a sample, the method comprising carrying out steps (i) to (vi) of the method according to the first aspect, on a sample.

The sample may be derived from a test subject, which may be a human or animal. For example, the sample may be a blood, tissue, hair or urine sample, in which a micro-organism may be found. The micro-organism may be a bacterium or a virus.

Furthermore, in a sixth aspect, there is provided a micro-organisms detection kit, wherein the kit is as defined in the second aspect, andcomprises a synthetic nucleotide construct adapted to form heteroduplexes for detecting a micro-organism.

Preferred primers for the kit according to the sixth aspect are provided in the

Examples.

Hence, in further independent aspects of the invention, there are provided kits for carrying out IHG diagnostics to detect the various polymorphisms indicated in the separate examples. Hence, in further independent aspects, there are provided methods and kits for detecting and distinguishing between species of plants (e.g. rice); animals (e.g. fish, dogs, chickens, or turkeys); bacteria (e.g. Salmonella); and viruses (e.g. HIV).

The inventors believe that the feature of using a synthetic IHG construct which comprises either (i) both the wild-type base and the mutant base, or (ii) neither, referred to herein as the both bases rule', so significantly improves the degree of separation between heteroduplexes, that this in itself a very important finding.

Hence, in a seventh aspect, there is provided an IHG synthetic DNA construct for use in IHG analysis, the construct comprising at least one nucleotide position, which corresponds to a known polymorphic site in a genomic DNA sequence, characterised in that the construct comprises an identifier sequence, which comprises either (i) the wild-type base and the mutant base of the polymorphic site; or (ii) neither the wild-type base nor the mutant base of the polymorphic site.

The synthetic construct of the seventh aspect may be defined as in the various embodiments of the first aspect, which for brevity will not be repeated here. However, the skilled technician will appreciate that construct according to the seventh aspect may comprise any of the preferred features of the construct as defined in accordance with the first aspect. Hence, for example, the synthetic construct may comprise (i) a 3 or 4 or 5 Guanine/Cytosine base insertion; andlor (ii) a deletion of about 1-7 bases about 5-50 bases from the polymorphic site. Preferably, the construct comprises (i), and (ii). Preferably, the identifier sequence comprises at least one nucleotide substitution, deletion andlor insertion relative to the genomic sequence.

The inventors believe that the construct may be used in any type of IHG analytical method, including medical, or diagnostic, or speciation uses etc. Hence, in an eighth aspect, there is provided a method of IHG analysis comprising use of the IHG synthetic DNA construct according to the seventh aspect.

It should be appreciated that the method according to the eighth aspect preferably comprises the use of the IHG construct according to the seventh aspect to identify a polymorphism in any test subject, which may include any organism, including human, plant, animal, bacterial, or viral. Hence, the method of the eighth aspect is not limited to non-human test subjects.

The invention also provides a method for forming induced heteroduplexes between a target gene sequence and an IHO molecule according to the seventh aspect of the invention, which corresponds to said target gene sequence, the method comprising:- (i) providing a population of the IHG molecule according to the seventh aspect; (ii) providing a population of the target gene sequence; and (iii) combining the respective populations of (i) and (ii) under conditions suitable for heteroduplex formation.

The populations of IHG molecule and target gene sequence may be provided by any suitable amplification technique, such as PCR. The resultant heteroduplex may be separated or resolved by electrophoresis, and then subsequent analysis.

In a yet further aspect, there is also provided a kit comprising an IHG synthetic molecule according to the seventh aspect, suitable primers for IHG analysis, and optionally, a control DNA sequence.

All of the features described herein (including any accompanying claims, abstract and drawings), andlor all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.

For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying diagrammatic drawings, in which:-Figure 1 shows the chemical structure and base pairing of the DNA bases, cytosine, guanine, thymine and adenine; Figure 2 shows results of gel electrophoresis for MTHFR cross-match; Figure 3 shows results of PAGE for MTHFR cross-match; Figure 4 shows results of gel electrophoresis for AATPI*S cross-match; Figure 5 shows results of PAGE for AATPI*S cross-match; Figure 6 shows results of gel electrophoresis of using IHG1 (left), and results using IHGE2 (right) in Example 3; Figure 7 shows results of gel electrophoresis of using IHG1, IHG2, IHG3, IHGE4, and IHGE5 in Example 4; Figure 8 shows results of gel electrophoresis of using IHG in Example 5; Figure 9 shows a flow chart summarising the protocol used for designing an IHG; Figure 10 shows results of gel electrophoresis of using IHG on Fanconi anemia

IVS4+4 in Example 7;

Figure 11 shows results of gel electrophoresis of using IHG on fish (O.mykiss & S.salar) and veterinary animals (chicken and turkey) in Examples 9 and 13; Figure 12 shows results of gel electrophoresis of using IHG on AZT resistance in

Example 10;

Figure 13 shows results of gel electrophoresis of using IHG on bacteria (Salmonella enterica) and quinoline resistance in Example 11; Figure 14 shows results of gel electrophoresis of using IHG on plants (rice) in

Example 12; and

Figure 15 shows results of gel electrophoresis of using IHG on animal mutations (dogs) in Example 13.

Examples

The inventors carried out a series of analyses (Examples 1 and 2) and experiments to investigate how the design of Induced Heteroduplex Generators (IHG) may be improved for use in heteroduplex analysis (Examples 3-7). Once they had devised an improved strategy for IHG design, they demonstrated that it is possible to carry out taxonomic identification (Examples 8-14) and discrimination in various species. The inventors went on to develop kits that can identify different species of various organisms, such as different species/variants of animal, including fish (Example 9), anti AIDS drug AZT resistance in humans (Example 10), bacteria (Example 11), plants (Example 12), veterinary animals (Example 13), and mutations in other animals (Example 14).

As described in Example 10, the inventors designed a kit, which could be used to identify viruses, such as HIV-1, that was sensitive to the anti-HIV drug AZT (i.e. wild-type HIV-1), and also strains of HIV-1 that had developed resistance to AZT (mutant HIV-l). As described in Example 11, the inventors designed a kit, which could be used to identify bacteria, such as Salmonella enterica, that was sensitive to the anti-bacterial agent, quinolone (i.e. wild-type Salmonella), and also strains of Salmonella that had developed resistance to quinolone (mutant Salmonella). As described in Example 12, the inventors developed a kit that could be used to identify between different species of plant, such as rice (Oryza sativa). As described in Example 13, the inventors developed a kit that could be used to identify between different species of chicken and turkey, and in Example 14, the inventors developed a kit that could be used to identify the canine night blindness mutation.

Initially, two IHG kits were chosen by the inventors to demonstrate the effect of positive and negative unpaired bases up IHG movement; (i) MTHFR; and (ii) AATPI*S. These two kits show how a synthetic construct according to the invention behaves differently to either a wild-type or mutant/variant strand of DNA. Fluorescent primers were used to elucidate IHG movement.

Example I -MTHFR

MTHFR Cross-Match (5, 1 0-Methylenetetrahydrofolate reductase (677 C>T)) Referring to Figure 2, there are shown the MTHFR Cross- Match results of gel electrophoresis, in which:-Lane 3: Fluorescent forward primer on wild gene Lane 4: Fluorescent forward primer on mutant gene Lane 5: Fluorescent forward primer on heterozygous genes Lane 6: Fluorescent reverse primer on wild gene Lane 7: Fluorescent reverse primer on mutant gene Lane 8: Fluorescent reverse primer on heterozygous genes Lane 11: Fluorescent forward primer on IHG cross-matched with wild gene Lane 12: Fluorescent forward primer on IHG cross-matched with mutant gene Lane 13: Fluorescent forward primer on IHG cross-matched with heterozygous gene Lane 14: Fluorescent reverse primer on IHG cross-matched with wild gene Lane 15: Fluorescent Forward primer on IHG cross-matched with mutant gene Lane 16: Fluorescent Forward primer on IHG cross-matched with heterozygous gene Lane 23: Ladder/Marker The following sequences apply:-Wild shows a normal piece of DNA. The primer binding area's are underlined and IHG has a deletion (which is highlighted on the wild and mutant [Bold, underlined and italic]). Mutant shows the diseased form of the DNA. The base which is mutated in this disease is in bold. The IHG is most similar to the wild as it has a C' base which has a greater influence than the T' base of the mutant.

Wild control (lO6bp):

GCTGACCTGAAGCACTTGAAGGAGGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTT

GAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCA

Mutant control (lO6bp)

GCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTT

GAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCA

IHG (lO3bp)

GCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGCCGATTTCATCATCACGCAGCTTTTCTTTGAG

GCTGACACATTCTTCCGCTTTGTGAAGGCATGCA

Fluorescent forward "wild + IHG" will have the following bases unpaired GAG.

Fluorescent forward "mutant + IHG" will have the following bases unpaired/miss-paired GAGT -these are the bases mismatched/unpaired on the mutant strand.

G -this is the base mismatched on the complementary IHG strand.

Fluorescent reverse "wild + IHG" will have the following bases unpaired CTC.

Fluorescent reverse "mutant + IHG" will have the following bases unpaired/miss-paired CTCA -these are the bases mismatched/unpaired on the mutant strand.

C -this is the base mis-matched on the complementary IHG strand.

Fluorescent forward "IHG + wild" will have the following bases unpaired CTC.

Fluorescent forward "IHG + mutant" will have the following bases unpaired/miss-paired CTCA -these are the bases mismatched/unpaired on the mutant strand.

C -this is the base mis-matched on the complementary IHG strand.

Fluorescent reverse "IHG + wild" will have the following bases unpaired GAG.

Fluorescent forward IHG + Wild will have the following bases unpaired/miss-paired The difference between the wild (lane 3) and mutant (lane 4) with forward fluorescent primers is the addition of the miss-paired T and G (to the mutant, lane 4).

As can be seen from the PAGE picture (Figure 3), this has resulted in the mutant's virtual weight increasing, as the addition of the G base increases the positive charge of the heteroduplex and thus retarding its movement through the gel. The same phenomenon is occurring between lanes 14 and 15.

The difference between the wild (lane 6) and mutant (lane 7) with reverse fluorescent primers is the addition of the miss-paired A and C (to the mutant, lane 7).

As can be seen from the PAGE picture (Figure 3), this has resulted in the mutant's virtual weight decreasing as the addition of the C base increases the negative charge of the heteroduplex and thus accelerating its movement through the gel. The same phenomenon is occurring between lanes 11 and 12.

Examt,le 2 -AATP1*S AA TPI*S Cross-Match (Alpha 1 antitrypsin PIS (A>T change on the second base for the codon (G1u264 leading to a Val amino acid instead)).

Further details are provided at:-http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id= 107400 Referring to Figure 4, there are shown the AATPI*S Cross-Match results of gel electrophoresis, in which:-Lane 10: Ladder/Marker Lane 17: Fluorescent forward primer on wild gene Lane 18: Fluorescent forward primer on mutant gene Lane 19: Fluorescent forward primer on heterozygous genes Lane 20: Fluorescent reverse primer on wild gene Lane 21: Fluorescent reverse primer on mutant gene Lane 22: Fluorescent reverse primer on heterozygous genes Lane 28: Fluorescent forward primer on IHG cross-matched with wild gene Lane 29: Fluorescent forward primer on IHG cross-matched with mutant gene Lane 30: Fluorescent forward primer on IHG cross-matched with heterozygous gene Lane 31: Fluorescent reverse primer on IHG crossmatched with wild gene Lane 32: Fluorescent Forward primer on IHG cross-matched with mutant gene Lane 33: Fluorescent Forward primer on IHG cross-matched with heterozygous gene The following sequences apply:-Wild control (125bp)

GCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGCTACAGCACCT

GGAAAATGAACTCACCCACGATATCATCACCAGTTCCTGGTGGACAG

Mutant control (125bp)

GCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGCTACAGCACCT

GGTAAATGAACTCACCCACGATATCATCACCAGTTCCTGGAPTGGACAGAA

IHG (128bp)

GCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGCTACAGCACCT

Fluorescent forward wild + IHG will have the following bases unpaired TTT.

Fluorescent forward mutant + IHG will have the following bases unpaired TTT T -this base is on the opposite strand and mismatches with the mutant T. Fluorescent reverse wild + IHG will have the following bases unpaired AAA.

Fluorescent reverse mutant + IHG will have the following bases unpaired AAA A -this base is on the opposite strand and mismatches with the mutant T. Fluorescent forward IHG + wild will have the following bases unpaired AAA.

Fluorescent forward IHG + mutant will have the following bases unpaired AAA A -this base is on the opposite strand and mismatches with the mutant T. Fluorescent reverse IHG + wild will have the following bases unpaired TTT.

Fluorescent forward IHG + Wild will have the following bases unpaired TTT T this base is on the opposite strand and mismatches with the mutant 1.

The difference between the wild (lane 17) and mutant (lane 18) with forward fluorescent primers is the addition of the miss-paired T and I (to the mutant, lane 18).

As can be seen from the PAGE picture (Figure 5), this has resulted in the mutant's virtual weight increasing as the addition of the T bases increases the negative charge of the heteroduplex and thus accelerating its movement through the gel. The same phenomenon is occurring between lanes 31 and 32.

The difference between the wild (lane 20) and mutant (lane 21) with reverse fluorescent primers is the addition of the miss-paired A and A (to the mutant, lane 21).

As can be seen from the PAGE picture (Figure 5), this has resulted in the mutant's virtual weight decreasing as the addition of the A bases increases the negative charge of the heteroduplex and thus retarding its movement through the gel. The same phenomenon is occurring between lanes 28 and 29.

The above results in Figures 2-5, display the effect of positive (G and A) and negatively (C and T) charged bases. Superior separation is achieved when unpaired/miss-paired bases involve bases with greater charge (i.e. G or C), as these will have greater effect upon the retardationlacceleration of the fragment during electrophoresis. Therefore the tailoring of inserts/deletions/miss-pairings between IHGs and DNA fragments/genes will increase the separation and subsequent resolution in diagnosis of mutations.

The inventors realised that other considerations also have to be made when designing a suitable IHG. Bases between the base(s) of interest and the inserted/deletedlrearranged bases near to the site of interest can also be disrupted. e.g.

IHG7 cross-matched with wild and mutant DNA Wild DNA TGGACA---GCGTCCAT IHG7 (comp) ACCTGTGGGCGCAGGTA unpaired bases= GGG IHG7 TGGACACCCGCGTCCAT unpaired bases= CCC Wild DNA (comp). ACCTGT---CGCAGGTA Mutant DNA TGGACA---GTGTCCAT GT IHG7 (comp) ACCTGTGGGCGCAGGTA unpaired bases= GGGCG IHG7 TGGACACCCGCGTCCAT unpaired bases= CCCGC Mutant DNA(comp) ACCTGT---CACAGGTA A The above shows how an IHG (which in this case is designed to match-up with the bases in the wild DNA, but it can be designed to match up with the bases in the mutant OR it can be designed to match with neither), has both the mismatch of the insertion and the mismatch of the mutation that bases in between can also be forced apart. These bases also forced apart will contribute to the net charge of the dsDNA fragment and will contribute to the new virtual weight of the fragment.

Thus, when designing an effective IHG, the inventors believe that consideration of the charges has to be given to:- (i) the bases inserted/deleted/re-arranged; (ii) the size of the insert/deletion/rearrangement, as this determines the approximate virtual' size of the heteroduplexes; (iii) the base that one wishes to be mismatched (i.e. does one design the IHG to be most similar to the wild-type, or the mutant, both or neither); (iv) how far from the mutation point does one place the insert/deletion/rearranged bases; (v) which bases may also be disrupted between the insert/deletion/rearranged bases and the mutation point mismatch; (vi) combinations of all of the above, in terms of charge as a difference between the types assayed; (vii) is the mutation area centralised with regards to the fragment -generally the more central the better as the charges can affect the fragment more effectively.

Example 3 -Substitution mutations In the following sequences, the following applies:-Mutation Insert is where the DNA kinks to allow for the mismatching The following are some examples of IHG's designed for substitution mutations (i.e where a base or bases have been substituted for a different base/bases,

AAT-PIS

Wild control (125bp):

GCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGCTACAGCACCT

Mutant control (125bp)

GCTGATGAATACCTGGGCATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGCTACAGCACCT

IHG1 (128bp)

GCTGATGAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGCTACAGCACCT IHGE2

GCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGCTACAGCACCT

IHG_1 was the original design. However, the separation between wild and mutant was small, and this was mainly due to the insert being small. Refening to Figure 6, there is shown a gel of AATPI*S DNA fragments cross-matched with IHG_l. The first lane shows the ladder, the second lane shows the wild (normal) DNA, the third lane shows the mutant DNA, the fourth lane shows the heterozygote, and the fifth lane shows another heterozygote DNA.

In the second gel picture, the AATPI*S DNA fragments are cross-matched with the improved IHG_E2. The first lane shows wild DNA, the second shows mutant and the third heterozygous.

As can be seen, the separation is much improved over the previous design method. This allows for use of a shorter gel and also shorter gel running times to achieve far more efficient separation. These are significant advantages over previous IHG separation experiments.

In terms of the overall charge difference between the wild and mutant when hybridised with the IHG, below, there are shown short sections of the DNA fragment that is formed in the heteroduplex. The unpaired bases are shown to the left of the DNA fragment to aid visualisation of the bases (and thus the charges) involved in the heteroduplex. As can be seen, IHG1 was based around a triple A insertion which carries only a small charge per base when mismatched.

Wild DNA AAACTACAGCACCT---GGAAAATGAA II-iGl (COrnp)TTTGATGTCGTGGATTTCCTTTTACTT unpaired bases= TTT Il-iGi AAACTACAGCACCTAAAGGAA.AA unpaired bases= AAA Wi 1dDNA (comp) TTTGATGTCGTGGA---CCTTTT Mutant DNA AAACTACAGCACCT---GGTAAP.TGAA GGT IHG1 (COmp)TTTGATGTCGTGGATTTCCTTTTACTT unpaired bases= TTTCCT IHG1 AAACTACAGCACCTAAAGGAAAA unpaired bases= AA.AGGA MutantDNA (comp) TTTGATGTCGTGGA---CCATTT CCA The difference between the charges of wild and mutant are: with wild there are only the inserted bases mismatching (AAA or ITT), whilst with the mutant there are the inserted bases (AAAITTT) plus the mismatched bases of the point mutation (AA/TT). The bases in between are unlikely to also be disrupted as the insert (AAA!TTT) is relatively small (3bp).

Wild DNA AAACTACAGCACCTGGAA----AATGAA CT IHGE2 (comp) TTT--TGTCGTGGACCTTCCCCTTACTT unpaired bases=CCCC II-IG_E2 AAA--ACAGCACCTGGAAGGGGAA unpaired bases= GGGG Wild DNA (comp) TTTGATGTCGTGGACCTT----TT GA Mutant DNA AAP.CTACAGCACCTGGTA----AATGAA CT TA IHGE2 (comp) TTT--TGTCGTGGACCTTCCCCTTACTT unpaired bases=TTCCCC II-IGE2 AAA--ACAGCACCTGGAAGGGGAA unpaired bases =AAGGGG MutantDNA (comp) TTTGATGTCGTGGACCAT----TT GA AT This additional insertion/deletion (in this case a CT deletion upstream from the mutation point) away from the immediate mutation point and insertion has increased separation further as it has added to the charge disruption of the DNA fragment.

An example of where several different IHGs have been tried is glycogen storage disease I (Arg83Cys), i.e. the 83 amino residue is replaced with a cysteine residue due to a mutation from a cytosine residue in the wild-type DNA to a thymine in the mutant DNA. In the following sequences, a mutation is shown in bold and an insert is shown as bold/underline.

Wild DNA TGGACAGCGTCCAT Mutant DNA TGGACAGTGTCCAT IHG1 TGGACAAAAGTGTCCAT I I-iG2 TGGACTTTTAGTGTCCAT IHG3 TGGACAGTGTAAA.ACCAT IHG4 TGGACAGTGTCAAAACAT I HG5 TGGACATGTCCGTGTCCAT IHG6 TGGACAGCCCGTCCAT I HG7 TGGACACCCGCGTC CAT Following polymerase chain reaction (PCR) with the appropriate primers, the following sequences are generated. The above samples will exist as the original DNA combined with its complementary strand (dsDNA):-Wild DNA TGGACAGCGTCCAT Wild DNA (comp). ACCTGTCGCAGGTA Mutant DNA TGGACAGTGTCCAT Mutant DNA (comp) ACCTGTCACAGGTA IHG1 TGGACAAAAGTGTCCAT IHG1 (comp) ACCTGTTTTCACAGGTA I HG2 TGGACTTTTAGTGTCCAT IHG2 (comp) ACCTGAAAATCACAGGTA IHG3 TGGACAGTGTAAAACCAT IHG3 (camp) ACCTGTCACATTTTGGTA I I-iG4 TGGACAGTGTCAAAACAT IHG4 (comp) ACCTGTCACAGTTTTGTA IHG5 TGGACATGTCCGTGTCCAT IHG5 (comp) ACCTGTACAGGCACAGGTA When cross-matching an IHG with a wild/mutant/patient DNA, the heat-cool cycle separates the dsDNA into ssDNA. during the controlled cooling cycle the ssDNA comes back together with a complementary strand. A proportion of the strands coming back together will be one strand of wild/mutant/patient DNA and an almost complementary strand of IHG. In the cases of wild/mutant/patient DNA combining with almost complementary IHG, there will be instances of mismatching. Bases in between the mutation point and possibly forced apart by IHG inserts/deletions and mismatching are indicated in italics.

IHG1 cross-matched with wild and mutant DNA:-Wild DNA TGGACA---GCGTCCAT GC IHG1 (comp) ACCTGTTTTCACAGGTA unpaired bases= TTTCA IHG1 TGGACAAA.AGTGTCCAT unpaired bases= AAAGT Wild DNA (camp). ACCTGT---CGCAGGTA CG Mutant DNA TGGACA---GTGTCCAT unpaired bases= TTT IHG1 (camp) ACCTGTTTTCACAGGTA IHG1 TGGACAAAAGTGTCCAT unpaired bases= AAA Mutant DNA (camp) ACCTGT---CACAGGTA IHG2 cross-matched with wild and mutant DNA:-Wild DNA TGGAC----AGCGTCCAT AGC IHG2 (camp) ACCTGAAAATCACAGGTA unpaired bases= AAAATCA IHG2 TGGACTTTTAGTGTCCAT unpaired bases= TTTTA Wild DNA (camp). ACCTG----TCGCAGGTA TCG Mutant DNA TGGAC----AGTGTCCAT IHG2 (camp) ACCTGAAAATCACAGGTA unpaired bases= AAAA IHG2 TGGACTTTTAGTGTCCAT unpaired bases= TTTT Mutant DNA (camp) ACCTG----TCACAGGTA IHG3 cross-matched with wild and mutant DNA:-Wild DNA TGGACAGCGT----CCAT CGT IHG3 (camp) ACCTGTCACATTTTGGTA unpaired bases= ACATTTT IHG3 TGGACAGTGTAAAACCAT unpaired bases= TG7AA.A Wild DNA (comp). ACCTGTCGCA-----GGTA GCA Mutant DNA TGGACAGTGT----CCAT IHG3 (comp) ACCTGTCACATTTTGGTA unpaired bases= TTTT IHG3 TGGACAGTGTAAAACCAT unpaired bases= AAAA Mutant DNA (comp) ACCTGTCACA----GGTA IHG4 cross-matched with wild and mutant DNA:-Wild DNA TGGACAGCGTC----CAT CGTC IHG4 (comp) ACCTGTCACAGTTTTGTA unpaired bases= ACATTT II-1G4 TGGACAGTGTCAkAACAT unpaired bases= TGTCAAA.A Wild DNA (comp). ACCTGTCGCAG----GTA GCAG Mutant DNA TGGACAGTGTC----CAT IHG4 (comp) ACCTGTCACAGTTTTGTA unpaired bases= TTTT IHG4 TGGACAGTGTCAAAACAT unpaired bases= AAAA Mutant DNA (comp) ACCTGTCACAG----GTA IHGS cross-matched with wild and mutant DNA:-Wild DNA TGGACA GCGTCCAT GC IHG5 (comp) ACCTGTACAGGCACAGGTA unpaired bases= ACAGGCA IHG5 TGGACATGTCCGTGTCCAT unpaired bases= TGTCCC Wild DNA (comp). ACCTGT CGCAGGTA CG Mutant DNA TGGACA GTGTCCAT IHG5 (comp) ACCTGTACAGGCACAGGTA unpaired bases= ACAGG IHG5 TGGACATGTCCGTGTCCAT unpaired bases= TGTCC Mutant DNA (comp) ACCTGT CACAGGTA During this mismatching there are unpaired bases. These unpaired bases and the change in the number/type of unpaired bases between a wild and mutant DNA are one of the overriding factors in determining how efficient the separation between a wild and mutant DNA sample is. The actual outcome from these IHGs is shown in Figure 7.

IHG I produces too many bands because it is an A' insert which happens to be next to an A residue. This means when forming the heteroduplex there is more than one outcome of which A residue will be left out'. By simply swapping this A' insert to a T' insert (IHG2), one has removed the possibility of more than one heteroduplex being formed. IHG3 and IHG4 show how moving an insert can effect how the heteroduplex behaves. Separation is decreased as the insert moves from 2bp away to 3bp away. IHG5 has a 5bp insert made up of mainly negative bases (TGTCC) lbp away from the point mutation.

Hence, the inventors believe that one of the main things to consider when designing an IHG, is the potential difference in overall heteroduplex charge between wild and mutant. To do this it is important to look at the additional bases that are mismatched (either on the wild or mutant based heteroduplexes -depending on whether the IHG was designed to be closer to the wild or mutant).

So in the case of Glycogen storage disease (GSD) IHG5 discussed above, the insert (TGTCC) will be mismatched for both wild and mutant. However, the IHG is a designed (in this case but not all cases) to be similar to the mutant (in some cases you may design the IHG to be similar to neither at the point of interest). The mutant heteroduplex will have just the insert mismatched (TGTCC and ACAGG for the reverse complement), whilst the wild will have the insert and the base of interest mismatched C' mismatching with A' (and G' mismatching with T' -reverse complement). This is also likely to disrupt the single base in-between the insert and base or interest C' (and G for the reverse complement), and will lead to a greater change in overall charge of the DNA fragment.

In the case of GSD IHG5, the insert could have been positioned lbp either side of the point mutation as the bases on either side are G' residues. However, if one of the bases either side was a low value base (i.e. A' or T') then it would be best to place the insert on the side with the high value base (G' or C'). If one side were to have a G' base and the other a C' base, then the following considerations would be needed. The final two bases of the insert are C' residues, which would mean that potentially more than 1 heteroduplex formation could occur. However, this can be circumvented by inserting the complementary pairs for the insert (TGTCC changes to ACAGG), which should allow only one heteroduplex formation.

The other significant aspect to consider is whether the bases, whichare mismatched in the most mismatched heteroduplex (mutant in this case) work with one another. An example of this would be MTHFR (C>T change) as in Example 1:-

TCTGCGGGAGCCGATTTC

To the right of the point mutation (C) is a C' followed by G', this means that a G or C insert cannot be used as there will be multiple heteroduplex formations. An A' or T' insert could be used, but in general C' and G' inserts are better options as they have a level of attraction (and therefore a stronger repulsion when mismatched).

Thus in the case of the MTHFR as described in Example 1, the insert would be best placed to the left of the point mutation a quadruple C' insert to the right of the G (lbp away from point mutation) would seem appropriate. Also note that the single nucleotide polymorphism (SNP), if from a C' to a T' base change, both bases are negative but the base in-between is positive (G' which might be separated from the opposing C' by the mismatching either side of it) this leaves the point mutation, when mismatched there are a C' and T'.

Thus, the additional bases outside of the insert in the mutant heteroduplex are C' C' G' and T'. When looked at collectively, the G' will be cancelled out by one of C' residues, which means a strong' + weak' increase in the negative charge of the DNA fragment. The opposite will be true of the complementary strands. Hence, there will be two bases pulling' in the same direction which should lead to a clear separation between wild and mutant. An additional insert/deletion (generally 2-3bp) further away from the mutation point and insert/deletion can also aid separation of the different DNA types assayed.

Example 5 -IHG Design -Use of an addition and deletion in an IHG The inventors believe that it is possible to make successful IHG's using the insertion of T or C residues. Furthermore, they believe that they can make successful IHG's using mixed' bases.

Also, the inventors have noted that separation of DNA bands is markedly improved when combining both an insertion and a deletion either side of the base of interest, e.g. Haemochromatosis C282Y.

Wild control (ll5bp):

CTGGGGATGGGACCTACCAGGGCTGGATCCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATC

GTGCCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATC

Mutant control (ll5bp) CTGGGGATGGGACCTACCAGGGCTGGATCCTTGGCTGTACCCCCTGGGGGAGCAGAGAT.AC

GTACCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATC

IHG (llGbp) Am deleted from Here

CTGGGGATGGGACCTACCAGGGCTGGATCCTTGGCTGTACCCCCTGGGGGAGCAGAGATCGTG

CGGGGCAGGTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATC

Referring to Figure 8, there is shown an electrophoresis gel, which shows the effect of using an IHG having both an insertion and a deletion. This additional deletion (along with the 4xG insertion) results in a dramatic difference between the virtual weight of the Wild-IHG heteroduplex (which behaves as a 700bp product) and the Mutant-IHG heteroduplex (which behaves as a -270bp product).

Example 6 -IHG Design -Inclusion of both wild and mutant bases, or neither Previously, IHGs have most closely mimicked either the wild type or mutant sequences, and this resulted in the cross-matched heteroduplex having a greater degree of miss-match to only one of the available alleles (e.g. if designed to mimic the wild type at the mutation site, when cross-matched with a mutant, there would be an extra miss-matched base). The inventors of the present realised that improved separation may be achieved by including both wild and mutant bases adjacent to one another, or neither. Having both or neither has the effect of causing both the wild type-IHG and Mutant-IHG heteroduplexes to have the same degree of miss-matching.

However, it does cause the insertion/deletion to move' relative to the mismatched base at the SNP site. Unexpectedly, this greatly improved the separation characteristics between wild-IHG and mutant-IHG heteroduplexes.

Example 7 -Protocol for designing IHG The inventors have designed a method for improved design of the IHG for use in heteroduplex analysis. The guiding principle behind IHG design is to use the respective charge (and level of charge) of the 4 nucleotide bases to cause a change in the overall charge of the heteroduplex fragment. Thus, the insertion/deletion/mismatch of the IHG relative to the mutated or polymorphic area should be designed so that the difference between the types that can be assayed are maximised.

The nucleotide bases, when mismatched, have the following charge.

G and A have a positive charge. G has a greater positive charge than A. C and T have a negative charge. C has a greater negative charge than T. A and T are roughly equal in terms of their charge strength.

G and C are roughly equal in terms of their charge strength.

Thus, A's and G's will influence the apparent mobility (or virtual weight) of the heteroduplex fragment in the opposite direction to T's and C's. Also, it shouldbe borne in mind that the complementary heteroduplexes will contain opposite mismatched bases and will thus influence the apparent mobility in the opposite direction.

The following protocol is a guide through designing an IHG for a:--Deletion or insertion mutation (A) -Deletion and insertion mutation (i) -Species identification and multiple mutations within a single IHG (I) Furthermore, the inventors believe that an IHG can be designed to identify species* or subspecies* or something else (for example, virus species -e.g. drug resistance in HIV). *Including animals, plants, bacteria, fungi, viruses, etc., and for this reason, kits have been developed to demonstrate this (Examples 8-14). Key:

gcatca normal bases C mutant bases or point of mutation GGGG inserted bases acagg deleted bases (lower case, bold & italic) corresponding mismatch 1) The first decision for IHG design is whether to write the IHG to the wild or mutant base. e.g. should the IHG match up best with the wild or mutant? The decision should primarily be based on relative strength of the base charge (the stronger base charge is chosen). If the relative charge strength is similar then the decision should be based on matching it best to the overall charge of the insert/deletion/mismatch.

Thus: If the base change is A or T > G or C, then the G/C base would be copied. However, if the base change is C>G or A>T, then the decision should be based upon matching the charge to the insert/deletionlmismatch. Thus, if the mismatched bases from the insertion/deletion are, for example, mainly/all G's or A's then the base at the mutation point should G or A. If the bases mismatched by the insertion/deletion are mainly C's or T's, then the base at the mutation point should be C or T. In circumstances where there are more than two possible bases at a single location, the following applies:-Y231X (C/T>A) IHG

AGTTGATTCCCATCCCCGGGAT

T' was chosen as the base to copy, and the reason behind this are based on the fundamentals above.

By choosing T' as the mimicked base: 1MG TCAACTAAGGGTAGGGGCCCTA Wild T AGTTGATT---ATCCCCGGGAT

IHG TCAACTAAGGGTAGGGGCCCTA

Wild C AGTTGATT---ACCCCCGGGAT 1MG TCAACTAAGGGTAGGGGCCCTA Mutant A AGTTGATT---AACCCCGGGAT The wild T only has the insertion mismatched. Wild C has an additional C and A mismatched. However, C has a more powerful charge and thus will create a net negative charge, which will reduce the mismatched G's positive charge. Mutant A has two A's mismatched which will both add to the overall positive charge within the mismatched area.

In the case of FGFR3 exon 8 gly380arg, i.e. FGFR3 exon 8 gly380arg mutation results in achondroplasia (a type of dwarfism), there are one wild (G) and two mutants (A or C) found: Wild G TCCTCAGCTACGG----GGTGGGCTT

I HG AGGAGTCGATGCCGGGGCCACCCGA

Mutant A TCCTCAGCTACAG----GGTGGGCTT II-{G AGGAGTCGATGCCGGGGCCACCCGAA Mutant C TCCTCAGCTACCG----GGTGGGCTT

IHG AGGAGTCGATGCCGGGGCCACCCGAA

In this example, the IHG is matched to the wild G', thus upon mismatching with the mutant A the mismatched C cancels out the small positive charge of the A. When mismatched with the mutant C' there are two C's which greatly increase the negative charge.

2) Choosing bases to insert/delete Will the sequence either side of the mutation point allow a G or C insertion? Ideally, it is preferred not to place the insert next to an identical base. The insert may be 1 -7bp away, but preferably, 4-5bp, and most preferably located at least 2bp away from the mutated base.

If the sequence does allow a G or C insert then go to #3 If the sequence doesn't allow for a G/C insert, e.g. t ctagqgcgcAgccatgc then go to #4 3) G/C insert Generally a 4/5xG or 4/5xC insertion should be used. The greater the number of mismatched bases the heavier, in general, the fragments will behave. Depending on the sequence either side of the mutation point, the insertion should be at least lbp away. The insert shouldn't have an identical base either side of it, i.e. don't insert G bases next to another G base as in some cases it can lead to multiple banding. E.g.

Correct CTGCGGGACCCCGCCGATTTCAT Correct CTGCGGGCCCCAGCCGATTTCAT Correct CTGCGGGAGCCGCCCCATTTCAT Incorrect CTGCGGGAGGGGGCCGATTTCAT Incorrect CTGCGGGGGGGAGCCGATTTCAT Incorrect CTGCGGGAGCCGGGGGATTTCAT Incorrect CTGCGGGAGCCGGGGGATTTCAT Incorrect CTGCGGGAGCCCCCCGATTTCAT The above incorrect versions may lead to extra bands being formed, which will cause analysis to be more difficult.

Where possible the inserted bases should be similar in charge to the base selected at the mutation point (e.g if the mutation is T>G, and G is copied for the IHG, then if possible the insertion/deletion should be G's andlor A's). This way the unpaired bases exposed will be of similar charge and thus will add together in their effect rather than cancel each other out.

Where possible there should be a G or C base between the insert and mutation point. E.g. CATGAGGGGCTGAGCA If this has not lead to sufficient separation go to #7 4) A deletion of mainly G's or C's should be the next option.

Is there a run of 5 bases, 4 of which are the same charge (and mainly G or C) starting from 1-2bp away from the mutation point? Or a run of 4bp of the same charge starting from 1-2bp away from the mutation point. Preferably the end' bases of the deleted area should be different to the bases immediately either side of them.

e.g. tctagggcgcAgcgcatgc or GATCCCTGGaacjirCGAGCAATA or CTRaCAGCGAC If yes then go to #5 If not the go to #6 5) Delete 4-5bp As an insertion on a IHG is in effect the same as a deletion (one of the DNA strands has a few bases less that the opposite strand) a deletion should be as similar to the bases normally inserted to create a similar effect. Thus

TCTagggCGCAGCGCATGC (agggc is deleted) Generally, the bases deleted should be of the same charge. If 4 bases are deleted, then all 4 should be of similar charge, if 5 are deleted 4 should be of similar charge. E.g a 4 bases deletion should either contain A's and G's OR T's and C's. If this has not lead to sufficient separation go to #7.

6) Insert 5x14x A or T Insert 4 or 5x A or T at least lbp away (2bp is preferable)

GCGCGCGCCGCGCG

Example:

GCGCGAAAACGCTGCGCG

GCGCGCGCTGAAAACGCG

GCGCGTTTTCGCTGCGCG

GCGCGCGCTGTTTTCGCG

If this has not lead to sufficient separation go to #7 7) Additional deletion/insertion.

An additional deletion/insertion (2-3bp) can improve the separation further. If the previous step has resulted in an insertion, then for this stage a deletion should be applied and vica versa. The additional deletionlinsert should be on the opposite side of the mutation point to the previous insertion/deletion. It should be based approximately 7-lObp away from the mutation point.

If possible deleted 2-3bp of the same charge. e.g.

TATGGGGCGAGGCATCtG A) Deleted or Inserted base(s) The IHG can be matched to either the wild or mutant DNA. Is the deletion or insertion mutation single or multiple base? -If a single base, go to B -If a multiple base, go to F B) Can a run of G's or C's be inserted at least lbp away? Will the sequence either side of the mutation point allow a G or C insertion? Ideally not placing the insert next to an identical base. The insert should be 4-5bp and preferably located at least 2bp away (but it can be 1 -7bp away).

-If yes, go to C -Ifno, go to D C) insert 4x or 5x G or C bases.

Generally a 4/5xG or 4/5xC insertion should be used. The greater the number of mismatched bases the heavier, in general, the fragments will behave. Depending on the sequence either side of the mutation point, the insertion should be at least lbp away. The insert shouldn't have an identical base either side of it, i.e. don't insert G bases next to another G base as in some cases it can lead to multiple banding.

If this has not lead to sufficient separation go to J. D) Delete 4-5bp If there is a run of 4-5bp, l-2bp away from the mutation point of mainly the same charge (e.g G's and A's OR C's and T's), then these could be deleted from the IHG. If 4 bases are deleted then all 4 should be of similar charge, if 5 are deleted 4 should be of similar charge. Thus, TCTagggCGCAGCGCATGC (agggc is deleted) -If this has not lead to sufficient separation go to J. -If this is not possible then go to E. E) Insert 5x/4x A or T Insert 4 or 5x A or T at least 1 bp away (2bp is preferable)

GCGCGCGCCGCGCG

Example:

GCGCGAAAACGCTGCGCG

GCGCGCGCTGAAAACGCG

GCGCGTTTTCGCTGCGCG

GCGCGCGCTGTTTTCGCG

If this has not lead to sufficient separation go to J F) Multiple base deletion or insertion mutations The starting point for the IHG design should be the DNA type with the most number of bases. e.g. Wild

TGTGCCGCCACCTGAT

Mutant

TGTGCCACCTGAT

Thus the IHG would be (before extra insertions/deletions were applied):

TGTGCCGCCACCTGAT

Go to G. G) Will the sequence either side of the mutation allow for a G/C insert? Without placing it next to an identical base -If yes, go to H. -Ifno, go to I H) Insert a run of G's or C's immediately adjacent to the mutation point? Will the sequence either side of the mutation point allow a G or C insertion? Ideally not placing the insert next to an identical base. The insert should be 2-Sbp. If the mutation is a 3bp deletion or insertion then a minimum 2bp insertion will be needed, if the mutation is a 2bp deletion or insertion then a minimum 3bp insertion will be needed.

The insert shouldn't have an identical base either side of it, i.e. don't insert G bases next to another G base as in some cases it can lead to multiple banding.

If this has not lead to sufficient separation go to J. I) Insert 5x/4x A or T Insert 4 or 5x A or T at least 1 bp away (2bp is preferable)

GCGCGCGCCGCGCG

Example:

GCGCGAAAACGCTGCGCG

GCGCGCGCTGAAAACGCG

GCGCGTTTTCGCTGCGCG

GCGCGCGCTGTTTTCGCG

If this has not lead to sufficient separation go to J. J) Additional deletion/insertion.

An additional deletion/insertion (2-3bp) can improve the separation further. If the previous step has resulted in an insertion then for this stage a deletion should be applied and vica versa. The additional deletionlinsert should be on the opposite side of the mutation point to the previous insertion/deletion. It should be based approximately 7-1 Obp away from the mutation point.

If possible deleted 2-3bp of the same charge. e.g.

TATGGGGCGAGGCATCtG ffjeletion and Insertion mutation Occasionally there are mutations where there is a number of bases deleted and a number (not necessarily the same number) inserted.

e.g. Bloom 2281 (6bp deletion/7bp insertion) Wild control:

TACATATCTGACAGGTGAT

Mutant control:

TACATTAGATTCCAGGTGAT IHG:

TACATATCATTAAACAGGTGAT IHGE3

TACATATGGTGAT

Heteroduplexes

WILD TACATATCTG ACAGGTGAT

IHG ATGTATAG--TAATTTGTCCACTA

MUTANT TACATTAGATT CCAGGTGAT

IHG ATGTATAGTAATTT--GTCCACTA

WILD TACATATCTGACAGGTGAT

IHG E3 ATGTATA CCACTA

MUTANT TACATTAGATTCCAGGTGAT

IHGE3 ATGTA---TA----CCACTA i) Remove all mutated bases (deleted or inserted) bases from IHG. In cases such as these the number of bases inserted in the IHG will be little or none, it is best to remove completely the bases in question.

e.g. for Bloom IHG design went along as follows:-Wild control:

TACATATCTGACAGGTGAT

Mutant control:

TACATTAGATTCCAGGTGAT

Thus, for the IHG it is best to remove the bases that are deletedlinserted in either DNA type.

Thus=> TACAT CAGGTGAT ii) Give the IHG some constant mismatching.

-The next step is to give the IHG some constant mismatching. Therefore, by removing another additional 2bp immediately adjacent (the bases C and A are a better choice than the A and T to the right of the mutation point) to the mutation site will give the IHG a constant 2bp mismatch,

TACAT CAGGTGAT

Becomes

TACAT -GGTGAT

iii) Find and insert I or 2 bases common to both forms of the DNA. If it is possible, try and find I or 2 bases adjacent to one another in the mutation site that appear in both forms of the DNA.

Wild control:

TACATATCTGACAGGTGAT

Mutant control:

TACATTAGATTCCAGGTGAT

Thus the IHG becomes: TACAT -AT GGTGAT (TACATATGGTGAT) The mutated bases are deleted because of the major differences between the wild and mutant type (with the deletionlinsertion being substantially different). When they hybridise with the IHG, the bases in this region act as inserts compared to the IHG, because the wild and mutant are different they have different inserts (compared to one another), thus they will behave differently to one another.

Inclusion of Both Wild Type and Mutant Bases The following worked example with Fanconi anemia IVS4+4 demonstrates the significant advantage of this IHG over previous designs including a 4A deletion, a 4A insertion and a 3C insertion.

Wild control (II 9bp):

CACTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTTAA

AAATGTGAGTATTTAAAATTTATCACTTTTGAAATGTTTAATGCTGTGT

GCCATCAGCAAAAAGAG

Mutant control (1 l9bp):

CACTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTTI

AAATGTGTGTATTTAAAATTTATCACTTTTGAAATGTTTAATGCTGAA

GCCATCAGCAAAAAGAG

IHG (11 Sbp): 4A deletion

CACTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTT

AAATGTGTGTATTTAAAATTTATCACTTTTGAAATGTTTAATGCTGAA

GCCATCAGCAAAAAGAG

IHG El (123bp): 4A insertion

CACTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTT

AAATAAAAGTGTGTATTTAAAATTTATCACTTTTGAAATGTTTAATGCTGA

ATGTGCCATCAGCAAAAAGAG

IHG E2 (122bp): 3C insertion

CACTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTTAA

AAATGTGAGCCCTATTTAAAATTTATCACTTTTGAAATGTTTAATGCTG

TGTGCCATCAGCAAAAAGAG

I HG E3 (1 22bp): inclusion of wild and mutant base and a 4C insert

CACTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTTAA

AAATGTGATGCCCCTATTTAAAATTTATCACTTTTGAAATGTTTAATGCTG

AATGTGCCATCAGCAAAAAGAG

When cross-matched with IHG E3 the following occurs: (see Figure 10) Wild AAAAATGTGA-G----TATTTAAAA IHGE3 TTTTTACACTACGGGGATAAATTTT Mutant AAAAATGTG-TG----TATTTAAAA IHG_E3 TTTTTACACTACGGGGATAAATTTT Referring to Figure 10, in this example, with regard to the wild-IHG heteroduplex, there is a lbp gap between the miss-matched base and the 4 base insertion. In the mutant-IHG heteroduplex there is a 2bp gap between the miss-match and the 4 base insertion.

In effect, by using both wild and mutant bases, the insertedldeleted bases become mobile' with respect to the nucleotide(s) of interest, which in-turn significantly enhance the separation achieved between a wild and mutant heteroduplex. The inventors believe this was very surprising as previous IHG methods suggest that using a 4 A residue insertion or deletion would be effective. However, the worked example shows that this results in poor separation for discrimination of wild and mutant alleles.

However, the use of a 4 C/G residue insertion as described herein has improvedlenhance separation characteristics compared to previous patents. The use of the 4 CIG insertion alongside the inclusion of both wild and mutant bases adjacent to one another at the site of interest has increased separation further. As heteroduplexes are almost entirely judged on their separation of wild and mutant, the inventors believe that this presents a significant inventive step over previously published JHG methods.

The above section sets out a protocol to assist in the design of a suitable IHG for use in the method according to the invention. Referring to Figure 9, there is shown a flow-chart, which summarises the protocol. Figure 9 illustrates the questions and answers one must ask depending on whether the IHO should have a substitution mutation (left hand side of Figure 9) or deletion or insertion mutation (right hand side ofFigure9).

Example 8 -Species identification Based on the conclusions drawn from the results of the previous examples in the design of the IHG, the inventors have developed kits that can identify or discriminate different species and variants of animal (inc fish and birds), bacteria and viruses, etc. III) Species Identification Polymorphic regions (polymorphic bases shown in bold) that can be used to identify species generally have many bases, which vary from species to species.

IHG's for these polymorphic areas can have insertions and deletions carefully placed that will cause each species to have a different heteroduplex formed. Care should be taken to not overload' the IHG with insertions and deletions as the heteroduplex will not form if the difference is too great. Hence, not every polymorphic base will need a corresponding insertionldeletion.

A variety of deletions and insertions should be used. H HHowever, a limit of around 4-5 insertionldeletions should be set for a single fragment of l00-l4Obp.

IV) Polymorphic bases in close proximity (4-6bp away from each other) Where there are two polymorphic bases that are in close proximity to one another, it is preferred to use a deletionlinsertion between the two bases as the best choice.

e.g. tccctaCCCCgtagct V) bases almost adjacent to one another (2-3bp apart) If the gap is too close (i.e. less than 4bp between the polymorphic bases), then a deletion of the bases in between should be considered. Hopefully, the overall positive/negative charge in this local area will be changed differently depending on what polymorphism is present.

Example 9 -Identification of fish This Example illustrates how heteroduplex analysis may be used to differentiate between different species of fish. This may be required, for example, for authenticating food sources, and to quantitatively confirm the fish components of the food. For example some fish species, such Atlantic salmon, carry a price premium and thus can be subject to economic fraud whereby a lesser' fish is sold as a premium IS fish. The example demonstrates a kit comprising IHG's can be used to identify between closely related species.

DNA can be obtained from fresh, frozen, smoked, processed or partially cooked fish. Briefly, tissue (200mg) is finely chopped, placed in 3O0tl of lysis buffer (0.1M Tris HCI pH7.6, 0.1M NaCI, 0.OIM EDTA, 0.1%SDS) with 375tg of proteinase K and incubated for 2 hours at 55 C. The tissue lysate was mixed with an equal volume of 7.5M ammonium acetate and solid tissue removed with a 15 minute centrifuge at 14,000g. DNA was precipitated from the supernatant by the addition of 4p.I of linear polyacrylamide and 2.5 volumes of ethanol. DNA was stored in DNase/RNase free water.

The following is an example of an IHG fish speciation kit to differentiate rainbow trout (Oncorhynchus Mykiss) and Atlantic salmon (Salmo Salar). PCR is carried out in a 30tl reaction of PCR buffer (10mM Tris HC1 ph8.9, 50mM KC1, 0.1% Triton), 2.5mM MgCI, 0.5mM dNTPs, 0.5mM each primer (TACTCTGATTACCCAGACGCCTA, TCTCAAAGAATAAATAGGAACATAATTACAGC) and 1U of Taq polymerase.

For a typical test, four reaction tubes are required containing either test DNA (60- 600ng) or 2.5tM IHG oligomer (TACTCTGATTACCCAGACGCCTATACACTGTGJAACACGGGGTGTATCCT

CAATCGGATCCCTTGTATCCCTACCCCGTAGCQWWTGTAATTATGTTCCT

ATTTATTCTTTGAGA) or 2.5tM rainbow trout control oligomer (TACTCTGATTACCCAGACGCCTATACACTGTGAAACACTGTATCCTCAAT

CGGATCCCTTGTATCCCTAGTAGCTGTAATTATGTTCCTATTTATTCTTTGA

GA) or 2.5tM Atlantic salmon control oligomer (TACTCCGACTACCCAGACGCCTACACACTCTGAAACACTATCTCCTCJT

CGGATCTCTTATCTCCTTAGTCGCTGTAATTATGTTCCTGTTTATTCTTTGA GA).

The PCR parameters are 94 C for 30 sec, 55 C for 30 sec and 72 C for 30 sec for 30 cycles with a final extension of 72 C for 5 minutes. To obtain cross-matched products, equal volumes (5tl) of PCR products from test DNA and IHG oligomer were mixed and heated to 95 C for two minutes, cooled to 60 C at 1 C/sec, held at 60 C for 1 minute, cooled to 45 C at 0.1 C/sec, held at 45 C for 1 minute and cooled to a final temperature of 6 C. Control cross-matched products for rainbow trout and Atlantic salmon were obtained by mixing IHG PCR product with either the amplification product of rainbow trout or Atlantic salmon oligomers. Cross-matched products were separated by 15% polyacrylamide gel electrophoresis in lx TBE at a temperature of 10-15 C.

The banding patterns in the gels were visualised by a suitable fluorescent DNA intercalator dye (e.g. ethidium bromide). The results are shown in Figure 11, which show the different bands produced by the IHG between the two species of fish.

Example 10 -Detection of anti-viral drug resistance The following is an example of an IHG to detect resistance to the reverse transcriptase inhibitor drug, azidothymidine (AZT) in Human immunodeficiency virus 1 (HIV-1).

Human peripheral blood mononuclear cells (PBMC) from infected patients can be used a source of viral DNA. PBMCs are separated from whole blood by Ficoll-Hypaque gradient centrifugation. The cells (106) are suspended in an extraction buffer (125m1) containing 0.1mg/mi proteinase K, 0.05% Nonidet P-40 and 0.05% Tween 20 and incubated at 60 C for 30 minutes after which the proteinase K is inactivated at 100 C for 30 minutes. PCR amplification reactions are performed on the cell lysate. PCR is carried out in a 30m1 reaction of PCR buffer (10mM Tris HC1 pH 8.9, 50mM KCI, 0.1% Triton), 2.5mM MgC1, 0.5mM dNTPs, 0.5mM each primer (TGGCCCAAAAGTTAAACAATG, AGGTTTTCAGGCCCAATTTTTG) and 1U of Taq polymerase.

For a typical test, five reaction tubes are required containing either test viral DNA (6m1 lysate) or 2.5mM IHG oligomer (TGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCA

TTAGTAGAAATTTGTACAGACCCGACTTGGAAAAGGAAGGGAAAATTTCA

AAAATTGGGCCTGAAAATCC) or 2.5mM AZT sensitive (wild type) oligomer (TGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCA

TTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAA

TTGGGCCTGAAAATCC), or 2.5mM AZT resistant (type T) oligomer (TGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCA

TTAGTAGAAATTTGTACAGAGTTGGAAAAGGAAGGGAAAATTTCAAJAT TGGGCCTGAAAATCC) or 2.5mM AZT resistant (type C) oligomer

(TGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCA

TTAGTAGAAATTTGTACAGAGCTGGAAAAGGAAGGGAAAATTTCAAAAAT

TGGGCCTGAAAATCC).

The PCR parameters are 94 C for 30 sec, 55 C for 30 sec and 72 C for 30 sec for 30 cycles with a final extension of 72 C for 5 minutes. To obtain cross-matched products, equal volumes (5m1) of PCR products from test HIV lysate and IHG oligomer were mixed and heated to 95 C for two minutes, cooled to 60 C at 1 C/sec, held at 60 C for 1 minute, cooled to 45 C at 0. 1 C/sec, held at 45 C for 1 minute and cooled to a final temperature of 6 C. Control cross-matched products for sensitive and resistant strains of HIV were obtained by mixing IHG PCR product with either the amplification product of wild type or type T or type C oligomers.

Heterogeneous patterns were obtained by cross-matching IHG with wild type and type T or with wild type and Type C. Cross-matched products were separated by 15% polyacrylamide gel electrophoresis in lx TBE at a temperature of 10 -15 C. The banding patterns in the gels were visualised by a suitable fluorescent DNA S intercalator dye, as shown in Figure 12, which clearly shows the differences in bands produced using the above kit, and that discrimination is easily possible.

Example 11 -identification of bacteria and drug resistance in bacteria The following is an example of an IHG bacterial drug resistance test to differentiate quinolone sensitive and resistance strains of Salmonella enterica.

PCR is carried out in a 30m1 reaction of PCR buffer (10mM Tris HC1 ph8.9, 50mM KCI, 0.1% Triton), 2.5mM MgCI, 0.5mM dNTPs, 0.5mM each primer (TGTCGTTGGTGACGTAATCG,CCATCCACCAGCATGTAACG) and 1 U of Taq polymerase.

For a typical test, four reaction tubes are required containing either test bacterial DNA (60-600ng) or 2.5mM IHG oligomer (TGTCGTTGGTGACGTAATCGGTAAATACCATCCCCACGGCGATTTCGCAG

TGTATGTACGGGGACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTA

CATGCTGGTGGATGG), or 2.5mM quinolone sensitive control oligomer (TGTCGTTGGTGACGTAATCGGTAAATACCATCCCCACGGCGATTTCGCAG

TGTATGACACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTACATGC

TGGTGGATGG) or 2.5mM quinolone resistant control oligomer (TGTCGTTGGTGACGTAATCGGTAAATACCATCCCCACGGCGATTTCGCAG

TGTATTACACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTACATGC

TGGTGGATGG).

The PCR parameters are 94 C for 30 sec, 55 C for 30 sec and 72 C for 30 sec for 30 cycles with a final extension of 72 C for 5 minutes. To obtain cross-matched products, equal volumes (Sml) of PCR products from test bacterial DNA and IHG oligomer were mixed and heated to 95 C for two minutes, cooled to 60 C at 1 C/sec, held at 60 C for 1 minute, cooled to 45 C at 0.1 C/sec, held at 45 C for 1 minute and cooled to a final temperature of 6 C. Control cross-matched products for quinolone resistant and sensitive strains were obtained by mixing IHG PCR product with either the amplification product of resistant or sensitive oligomers. Cross-matched products were separated by 15% polyacrylamide gel electrophoresis in lx TBE at a temperature of 10-15 C.

The banding patterns in the gels were visualised by a suitable fluorescent DNA intercalator dye, as shown in Figure 13. This shows the kit may be used to distinguish between quinolone sensitive and resistance strains of Salmonella enterica.

Example 12 -identification of plants (rice) The following is an example of an IHG rice speciation test to differentiate Oryza sativa Japonica and Indica species.

DNA was extracted from 5g of rice grains by using the Phytopure pant DNA extraction kit (Amersham Biosciences). PCR is carried out in a 30m1 reaction of PCR buffer (10mM Tris HCI ph8.9, 50mM KC1, 0.1% Triton), 2.5mM MgCl, 0.5mM dNTPs, 0.5mM each primer (GCAAAGCCACATCTTATTGTCAC, TTGTGGTGGAACAGGTGGTG) and 1U of Taq polymerase.

For a typical test, four reaction tubes are required containing either test rice DNA (60-600ng) or 2.5mM IHG oligomer (GCAAAGCCACATCTTATTGTCACTTCCATCTCATTCTCCTAATTGTCATCA

CTAGCTTCTAGCTAGCTTAATTAATTAGGGATTAGCCATGGCGGAGGAGA

AGCACCACCACCACCTGTTCCACcACAA), or 2.5mM Japonica control oligomer (GCAAAGCCACATCTTATTGTCACTTCCATCTCATTCTCCTAATTGTCATCA

CTAGCTTCTAGCTAGCTTAATTAATTAATTAGCCATGGCGGAGGAGAAGC

ACCACCACCACCTGTTCCACCACAA) or 2.5mM Indica control oligomer (GCAAAGCCACATCTTATTGTCACTTCCATCTCATTCTCCTAATTGTCATCA

CTAGCTTCTAGCTAGCTTAATTAATTAGCCATGGCGGAGGAGAAGCACCA

CCACCACCTGTTCCACCACAA).

The PCR parameters are 94 C for 30 sec, 55 C for 30 sec and 72 C for 30 sec for 30 cycles with a final extension of 72 C for 5 minutes. To obtain cross-matched products, equal volumes (5m1) of PCR products from test rice DNA and IHG oligomer were mixed and heated to 95 C for two minutes, cooled to 60 C at 1 C/see, held at 60 C for 1 minute, cooled to 45 C at 0.1 C/see, held at 45 C for 1 minute and cooled to a final temperature of 6 C. Control cross-matched products for Japonica and Indica were obtained by mixing IHG PCR product with either the amplification product of turkey or chicken oligomers. Cross-matched products were separated by 15% polyacrylamide gel electrophoresis in lx TBE at a temperature of 10-15 C. The banding patterns in the gels were visualised by a suitable fluorescent DNA intercalator dye, as shown in Figure 14. The results clearly show that the kit may be used to distinguish between the two types of rice species.

Example 13 -identification of a veterinary animal The following is an example of an IHG poultry speciation test to differentiate chicken (Gallus) and turkey (Meleagris gallopavo). DNA can be obtained from fresh, frozen, processed or partially cooked meat using commercially available kits or by phenol chloroform extraction. Briefly, tissue (25mg) is finely chopped, placed in a small volume of lysis buffer (0.IM Tris HCI pH7.6, 1.OM NaCl, 0.04M EDTA, 0.2%SDS) with lOmg/ml of proteinase K and incubated for 16 hours at 40 C. The tissue lysate was mixed with an equal volume of Tris buffered phenol and the upper aqueous phase collected after centrifugation at 1600g for 10 minutes. This was repeated until the aqueous phase appeared clear at which stage extraction with an equal volume of chloroformlisoamyl alcohol was performed. DNA was precipitated by the addition of 0.5 volume of 7.5M ammonium acetate and 2 volumes of ethanol.

DNA was stored in DNase/RNase free water.

PCR is carried out in a 30m1 reaction of PCR buffer (10mM Tris HC1 ph8.9, 50mM KCI, 0.1% Triton), 2.5mM MgC1, 0.5mM dNTPs, 0.5mM each primer (CAAATATCATTCTGAGGGGC, AAGAATCGGGTAAGGGTTGG) and 1U of Taq polymerase. For a typical test, four reaction tubes are required containing either test DNA (60-600ng) or 2.5mM IHG oligomer (CAAATATCATTCTGAGGGGCTACCGTCATCACAAACCTATTCTCAGCAAT

CCCCTACGGGGGATCTGGACACACCCTAGTAGAGTGAGCCTGAGGGGGAT

TCTCAGTCGACAACCCAACCCTTACCCGATTCTT), or 2.5mM chicken control oligomer (CAAATATCATTCTGAGGGGCCACCGTTATCACIACCTATTCTCAGCpT

TCCCTACATTGGACACACCCTAGTAGAGTGAGCCTGAGGGGGATTTTCAG

TCGACAACCCAACCCTTACCCGATTCTT) or 2.5mM turkey control oligomer (CAAATATCATTCTGAGGGGCTACCGTCATCACAAACCTATTCTCAGCAAT

CCCCTACATTGGTCAAACCCTAGTAGAATGGGCCTGAGGGGGATTCTCAG

TAGACAACCCAACCCTCACCCGATTCTT).

The PCR parameters are 94 C for 30 see, 55 C for 30 sec and 72 C for 30 sec for 30 cycles with a final extension of 72 C for 5 minutes. To obtain cross-matched products, equal volumes (5 ml) of PCR products from test DNA and IHG oligomer were mixed and heated to 95 C for two minutes, cooled to 60 C at 1 C/sec, held at 60 C for 1 minute, cooled to 45 C at 0.1 C/sec, held at 45 C for 1 minute and cooled to a final temperature of 6 C. Control cross matched products for chicken and turkey were obtained by mixing IHG PCR product with either the amplification product of turkey or chicken oligomers. Cross-matched products were separated by 15% polyacrylamide gel electrophoresis in lx TBE at a temperature of 10 -15 C. The banding patterns in the gels were visualised by a suitable fluorescent DNA intercalator dye, as shown in Figure 11. The results clearly show that the kit may be used to distinguish between chicken and turkey.

Example 14 -Detection of animal mutations The following is an example of an IHG canine mutation test to detect congenital stationary night blindness (Canisfamiliaris).

Animal DNA was extracted from whole blood using a commercially available kit. DNA was stored in DNase/RNase free water.

PCR is carried out in a 30m1 reaction of PCR buffer (10mM Tris HC1 pH 8.9, 50mM KC1, 0.1% Triton), 2.5mM MgC1, 0.5mM dNTPs, 0.5mM each primer (ATTACTACGCCTGCACGGAGA, GTGAGCGGTGGCTCCATT) and 1U of Taq polymerase. PCR is carried out in a 3Oml reaction of PCR buffer (10mM Tris HCI ph8.9, 50mM KCI, 0.1% Triton), 2.5mM MgC1, 0.5mM dNTPs, 0.5mM each primer (CAAATATCATTCTGAGGGGc, AAGAATCGGGTAAGGGTTGG) and IU of Taq polymerase. For a typical test, four reaction tubes are required containing either test DNA (60-600ng) or 2.5mM IHG oligomer (GAAGATTACTACGCCTGCACGGAGACCAACTTCATTACAAAGAGGTTAAT

CCTGAGACCCTGGAGACAATTAAGCAGGTTGATCTCTGCAACTACGTCTCT

GTCAATGGAGCCACCGCTCAC), or 2.5mM wild type control Canis familiaris oligomer (GAAGATTACTACGCCTGCACGGAGACCAACTTCATTACAAAGATTAATCC

TGAGACCCTGGAGACAATTAAGCAGGTTGATCTCTGCAACTACGTCTCTGT

CAATGGAGCCACCGCTCAC) or 2.5mM mutant type Canis familiaris control 01 igomer (GAAGATTACTACGCCTGCACGGAGACCAACTTCATTACAAAGATTAATCC

TGAGACCCTGGAGACAATTAAGCAGGTTGATCTCTGCAACTACGTCTCTGT

CAATGGAGCCACCGCTCAC).

The PCR parameters are 94 C for 30 sec, 55 C for 30 sec and 72 C for 30 sec for 30 cycles with a final extension of 72 C for 5 minutes. To obtain cross-matched products, equal volumes (5m1) of PCR products from test DNA and IHG oligomer were mixed and heated to 95 C for two minutes, cooled to 60 C at 1 C/see, held at 60 C for 1 minute, cooled to 45 C at 0.1 C/sec, held at 45 C for 1 minute and cooled to a final temperature of 6 C. Control cross-matched products for wild type and mutant type Canis familiaris were obtained by mixing IHG PCR product with either the amplification product of wild type or mutant type oligomers. Crossmatched products were separated by 15% polyacrylamide gel electrophoresis in lx TBE at a temperature of 10 -15 C. The banding patterns in the gels were visualised by a suitable fluorescent DNA intercalator dye, as shown in Figure 15. The results clearly show that the kit may be used to distinguish between dogs which have the mutation and those which do not.

Summary

In summary, the inventors have devised not only a new surprisingly effective use for IHG analysis of polymorphisms, i.e. speciation of non-human organisms, but they have also devised a series of inventive improvements to IHG analysis in general, which may be applied to any use of the IHG diagnostic method.

1) Speciation: a. Speciation via genetic analysis did not appear in literature until the late 90's, and certainly not using IHG diagnostic kits; b. Until 2005, all genetic speciation was presumed to be via RFLP analysis of a genome, and was not thought possible using IHG diagnostic kits; c. Speciation via a few key polymorphisms has not been previously mentioned, and was not thought possible using IHG diagnostic kits; and d. The inventors believe that they have solved a scientific problem in a non-obvious manner.

2)4/5/6 x C/G insert This was a case of inventing a single rule that would cover all SNP's.

3) Additional deletionlinsert upstream/downstream of SNP This further improved the C/G insert rule, leading to greater separation of heteroduplexes, which was totally unexpected and therefore inventive.

3) Inclusion of both the mutant and wild-type base in the IHG or neither a) It is inventive and non-obvious to use an IHG comprising both the wt and mutant bases, or neither bases. The previous IHG publications lead the reader into believing that either wild or mutant base should be used, but not both or certainly not neither.

b) The previous patents use wild or mutant at the SNP site as it will lead to one heteroduplcx having more mismatching than the other.

c) The both bases' rule of the present invention keeps the number of mismatches the same but the insert moves relative to the SNP site.

d) To include both bases at the site makes the insert/deletion/substitution a mobile' insert/deletionlinsert with respect to the SNP in question.

Claims

CLAIMS

1. A method for the taxonomic identification of a non-human biological analyte, the method comprising the steps of: (i) obtaining a sample of nucleic acid from a biological non-human analyte, the nucleic acid comprising a polymorphism which is indicative of the taxonomic designation of the analyte; (ii) forming a population of nucleic acid fragments from the sample; (iii) combining the population of nucleic acid fragments with a population of a synthetic nucleotide construct, which construct is adapted to form duplexes with the nucleic acid fragments, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid fragments dependent on the presence of the polymorphism at a known variable nucleotide or sequence of nucleotides within the nucleic acid sample under examination; (iv) permitting duplex formation within the combined populations in step (iii); (v) separating the duplexes formed in step (iv); and (vi) identifying the taxonomic designation of the analyte, based on the results in step (v).

2. The method of claim 1 wherein the biological analyte is independently selected from a group consisting of non-human animals; plants; fungi; bacteria; and viruses.

3. The method of any of the previous claims wherein the nucleic acid sample comprises DNA.

4. The method of any of the previous claims wherein step (ii) of forming a population of nucleic acid fragments from the sample comprises use of a PCR reaction.

5. The method of any one of the previous claims wherein the synthetic nucleotide construct comprises DNA.

6. The method of claim 5 wherein the synthetic nucleotide construct comprises a directly detectable tag.

7. The method of claim 6 wherein the directly detectable tag is a radionucleotide or a fluorescent compound.

8. The method of claim 7 wherein the fluorescent compound is hexachiorofi uorescein, tetrachiorofi uorescein or carboxyfluorescein.

9. The method of any one of the previous claims wherein the synthetic nucleotide construct comprises at least one deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s), which is/are either (a) opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination and/or (b) contiguous with a nucleotide which is opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

10. The method of claim 9 wherein the nucleotide substitution(s) and/or deletion(s) and/or insertion(s) contained in the sequence of the synthetic nucleotide construct may be made either (a) relative to the wild-type sequence of the variable nucleotide or sequence of nucleotides of the nucleic acid sequence under examination; or (b) relative to a mutant sequence of the variable nucleotide or sequence of nucleotides of the nucleic acid sequence under examination.

11. The method of claim 9 or 10 wherein the synthetic nucleotide construct comprises nucleotide substitution(s) and/or deletion(s) and/or insertion(s) which are both (a) opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination; and (b) contiguous with a nucleotide which is opposite to a known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

12. The method of any one of claims 9 to 11 wherein the synthetic nucleotide construct comprises between I and 15 substitution(s) and/or deletion(s) andlor insertion(s) substantially adjacent the position of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

13. The method of claim 12 wherein the synthetic nucleotide construct comprises 4 substitution(s) and/or deletion(s) and/or insertion(s) substantially adjacent the position of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

14. The method of any one of claims 9 to 13 wherein the synthetic nucleotide construct comprises at least one deliberate nucleotide insertion.

15. The method of any one of claims 12 to 14 wherein the synthetic nucleotide construct comprises one or more guanine and/or cytosine insertion(s) or deletion(s) substantially adjacent the position of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

16. The method of claim 15 wherein the synthetic nucleotide construct comprises 4 guanine or 4 cytosine insertions or deletions positioned substantially adjacent the position of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

17. The method of claim 15 wherein at least one of the insertions or deletions is positioned between I and 15 nucleotide bases from the position of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

18. The method of any one of claims 15 or 17 wherein the synthetic nucleotide construct comprises 3, 4 or 5 guanine andlor cytosine insertions or deletions that are two nucleotides from the position of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

19. The method of any one of the previous claims wherein the synthetic nucleotide construct comprises either (a) both the wild-type sequence and the mutant sequence of the variable nucleotide or sequence of nucleotides of the nucleic acid sequence under examination; or (b) neither the wild-type sequence and the mutant sequence of the variable nucleotide or sequence of nucleotides of the nucleic acid sequence under examination.

20. The method of any one of the previous claims wherein the synthetic nucleotide construct is adapted such that duplexes with different molecular conformation are formed between the construct and the nucleic acid fragments dependent on the presence or absence of polymorphisms at two or more known variable nucleotides and/or sequence of nucleotides within the nucleic acid sequence under examination.

21. The method of claim 20 wherein the synthetic nucleotide construct comprises deliberate nucleotide substitution(s) andlor deletion(s) andlor insertion(s) which is/are either (a) opposite to at least two known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination and/or (b) contiguous with a nucleotide which is opposite to at least two known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

22. The method of claim 21 wherein the synthetic nucleotide construct comprises deliberate nucleotide substitution(s) and/or deletion(s) and/or insertion(s) which is/are either (a) opposite to all of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination andlor (b) contiguous with a nucleotide which is opposite to all of the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

23. The method of any one of the previous claims wherein the synthetic nucleotide construct comprises a deliberate series of deletions at a position distal to a known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

24. The method of claim 23 wherein the synthetic nucleotide construct comprises a deletion of between 1 to 7 nucleotides at a position of about 5 to 50 nucleotides to the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

25. The method of claim 24 wherein the synthetic nucleotide construct comprises a deletion of between 2 to 4 nucleotides at a position of 10 to 12 nucleotides from the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

26. The method of any one of the previous claims wherein the synthetic nucleotide construct comprises: (i) either (a) both the wild-type sequence and the mutant sequence of the variable nucleotide or sequence of nucleotides of the nucleic acid sequence under examination; or (b) neither the wild-type sequence and the mutant sequence of the variable nucleotide or sequence of nucleotides of the nucleic acid sequence under examination; and, (ii) an insertion of 4 guanine residues positioned 2 to 3 nucleotides from the position of the nucleic acid sequence of(ii); and, (iii) a deletion of 2 to 4 nucleotides at a position of 10 to 12 nucleotides from the known variable nucleotide or sequence of nucleotides within the nucleic acid sequence under examination.

27. The method of any one of the previous claims wherein step (v) comprises separating the duplexes according to their molecular conformation.

28. The method of claim 27 comprising the use of electrophoresis.

29. The method of any one of the previous claims comprising the use of an agent adapted to enhance the separation characteristics of the duplexes formed in step (iv).

30. The method of claim 29 wherein said agent is added to the sample of nucleic acid and synthetic nucleotide construct before or after duplex formation in step (iv).

31. The method of claim 29 or 30 wherein said agent comprises a maleimide.

32. The method of any one of the previous claims comprising the step of comparing the results obtained in step (v) to the results obtained when the method is performed on a second or more sample(s) of nucleic acid.

33. Use of heteroduplex analysis for the taxonomic identification of a biological non-human analyte in an unknown sample.

34. A taxonomic identification test kit for identifying the taxonomic designation of a non-human biological analyte, which kit comprises: (a) at least two oligonucleotide primers suitable for use in PCR, and capable of annealing to complementary sequences at respective ends of a sample of nucleic acid sequence to be examined, which sample is obtained from a non-human analyte; (b) a synthetic nucleotide construct capable of forming duplexes with the nucleic acid sequence under examination, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid sequence under examination dependent upon the presence of a polymorphism at a known variable nucleotide or sequence of nucleotides within the sequence under examination; and optionally, (c) a control DNA andlor control PCR amplification product.

35. The kit of claim 34 wherein the synthetic nucleotide construct comprises the synthetic nucleotide construct as defined in relation to any one of claims 5 to 26.

36. The kit of claim 34 or 35 comprising at least one of the following components: a heat-stable DNA polyrnerase; dATP, dCTP, dGTP and dTTP or analogue thereof; appropriate biological buffers and cofactors; a database comprising the relative molecular conformation and gel mobilities of DNA fragments generated by PCR amplification and heteroduplex formation between selected DNA samples and the synthetic nucleotide construct.

37. The method or kit of any one of the previous claims wherein where the non-human biological analyte is an animal then the polymorphism indicative of the taxonomic designation of the sample is present in a cytochrome, ribosome or mitochondrial gene.

38. The method or kit of any one of claims I to 36 wherein where the non-human biological analyte is a plant then the polymorphism indicative of the taxonomic designation of the sample is present in a chioroplast gene.

39. The method or kit of any one of claims I to 36 wherein where the non-human biological analyte is a bacterium then the polymorphism indicative of the taxonomic designation of the sample is present in a gene encoding a 16S ribosomal subunit.

40. The method or kit of any one of claims 1 to 36 wherein where the non-human biological analyte is a virus then the polymorphism indicative of the taxonomic designation of the sample is present in a gene encoding a protease enzyme.

41. The method or kit of any one of claims 1 to 36 for detecting a polymorphism indicative of canine congenital stationary night blindness comprising a synthetic nucleotide construct having the nucleotide sequence:

GAAGATTACTACGCCTGCACGGAGACCAACTTCATTACAAAGAGGTTAAT

CCTGAGACCCTGGAGACAATTAAGCAGGTTGATCTCTGCAACTACGTCTC

TGTCAATGGAGCCACCGCTCAC

42. A method of analysing a foodstuff, the method comprising the steps: (i) obtaining a sample of nucleic acid from a foodstuff analyte sample, the nucleic acid comprising a polymorphism which is indicative of the taxonomic designation of the analyte; (ii) forming a population of nucleic acid fragments from the sample; (iii) combining the population of nucleic acid fragments with a population of a synthetic nucleotide construct, which construct is adapted to form duplexes with the nucleic acid fragments, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid fragments dependent on the presence of the polymorphism at a known variable nucleotide or sequence of nucleotides within the nucleic acid sample under examination, (iv) permitting duplex formation within the combined populations in step (iii); (v) separating the duplexes formed in step (iv); and (vi) identifying the taxonomic designation of the analyte, based on the results in step (v).

43. A foodstuff authentication test kit, which kit comprises: (a) at least two oligonucleotide primers suitable for use in PCR, and capable of annealing to complementary sequences at respective ends of a sample of nucleic acid sequence to be examined, which sample is obtained from a foodstuff (b) a synthetic nucleotide construct capable of forming duplexes with the nucleic acid sequence under examination, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid sequence under examination dependent upon the presence of a polymorphism at a known variable nucleotide or sequence of nucleotides within the sequence under examination; and optionally, (c) a control DNA and/or control PCR amplification product.

44. The method or kit of any one of claims ito 36, 42 and 43 for identification of a biological analyte as chicken or turkey comprising a synthetic nucleotide construct having the nucleotide sequence:

CAAATATCATTCTGAGGGGCTACCGTCATCACAAACCTATTCTCAGCAATC

CCCTACGGGGGATCTGGACACACCCTAGTAGAGTGAGCCTGAGGGGGATT

CTCAGTCGACAACCCAACCCTTACCCGATTCTT

45. The method or kit of any one of claims 1 to 36, 42 and 43 for identification of a biological analyte as Oncorhynchus inykiss or Salino salar comprising a synthetic nucleotide construct having the nucleotide sequence:

TACTCTGATTACCCAGACGCCTATACACTGTGAAACACGGGGTGTATCCTC

AATCGGATCCCTTGTATCCCTACCCCGTAGCQWWTGTAATTATGTTCCTA

TTTATTCTTTGAGA

46. The method or kit of any one of claims 1 to 36, 42 and 43 for identification of a biological analyte as Oryza sativa subsp. Japonica or 0. sativa subsp. Indica comprising a synthetic nucleotide construct having the nucleotide sequence:

GCAAAGCCACATCTTATTGTCACTTCCATCTCATTCTCCTAATTGTCATCA

CTAGCTTCTAGCTAGCTTAATTAATTAGGGATTAGCCATGGCGGAGGAGA

AGCACCACCACCACCTGTTCCACCACAA

47. A method of detecting a micro-organism in a sample, the method comprising the steps of: (i) obtaining a sample of nucleic acid from a non-human biological analyte, the nucleic acid comprising a polymorphism which is indicative of the taxonomic designation of the analyte; (ii) forming a population of nucleic acid fragments from the sample; (iii) combining the population of nucleic acid fragments with a population of a synthetic nucleotide construct, which construct is adapted to form duplexes with the nucleic acid fragments, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid fragments dependent on the presence of the polymorphism at a known variable nucleotide or sequence of nucleotides within the nucleic acid sample under examination, (iv) permitting duplex formation within the combined populations in step (iii); (v) separating the duplexes formed in step (iv); and (vi) identifying the taxonomic designation of the analyte, based on the results in step (v).

48. A micro-organism detection kit, which kit comprises: (a) at least two oligonucleotide primers suitable for use in PCR, and capable of annealing to complementary sequences at respective ends of a sample of nucleic acid sequence to be examined, which sample is obtained from a micro-organism; (b) a synthetic nucleotide construct capable of forming duplexes with the nucleic acid sequence under examination, the sequence of the construct being such that duplexes of different molecular conformation are formed between the construct and the nucleic acid sequence under examination dependent upon the presence of a polymorphism at a known variable nucleotide or sequence of nucleotides within the sequence under examination; and optionally, (c) a control DNA andlor control PCR amplification product.

49. The method or kit of any one of claims ito 36, 47 and 48 for identification of a biological analyte as a Quinoline resistant or sensitive Salmonella sp comprising a synthetic nucleotide construct having the nucleotide sequence:

TGTCGTTGGTGACGTAATCGGTAAATACCATCCCCACGGCGATTTCGCAGT

GTATGTACGGGGACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTAC

ATGCTGGTGGATGG

50. The method or kit of any one of claims 1 to 36, 47 and 48 for identification of a biological analyte as a azidothymidine resistant or sensitive HIV-1 virus stain comprising a synthetic nucleotide construct having the nucleotide sequence:

TGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCA

TTAGTAGAAATTTGTACAGACCCGACTTGGAAAAGGAAGGGAAAATTTCA

AAAATTGGGCCTGAAAATCC

51. An IHG synthetic DNA construct for use in IHG analysis, the construct comprising at least one nucleotide position, which corresponds to a known polymorphic site in a genomic DNA sequence, characterised in that the construct comprises an identifier sequence, which comprises either (i) the wild-type base and the mutant base of the polymorphic site; or (ii) neither the wild-type base nor the mutant base of the polymorphic site.

52. The IHG synthetic DNA construct of claim 51 wherein said construct comprises the nucleotide sequence defined in relation to any one of claims 19 to 26, 41, 44, 45, 46, 49 or 50.

53. A method of IHG analysis comprising use of the IHG synthetic DNA construct according to claim 51 or 52.

54. A method for forming induced heteroduplexes between a target gene sequence and an IHG molecule according to claim 51 or 52, which corresponds to said target gene sequence, the method comprising:- (i) providing a population of the IHG molecule according to claim 51 or 52; (ii) providing a population of the target gene sequence; and (iii) combining the respective populations of (i) and (ii) under conditions suitable for heteroduplex formation.

55. A kit comprising an IHG synthetic molecule according to claim 51 or 52, suitable primers for IHG analysis, and optionally, a control DNA sequence.