WO2010018245A1 - Méthode de détection et/ou de quantification d'un acide nucléique substrat - Google Patents

Méthode de détection et/ou de quantification d'un acide nucléique substrat Download PDF

Info

Publication number
WO2010018245A1
WO2010018245A1 PCT/ES2008/070161 ES2008070161W WO2010018245A1 WO 2010018245 A1 WO2010018245 A1 WO 2010018245A1 ES 2008070161 W ES2008070161 W ES 2008070161W WO 2010018245 A1 WO2010018245 A1 WO 2010018245A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
amplification
primer
fluorophore
labeled
Prior art date
Application number
PCT/ES2008/070161
Other languages
English (en)
Spanish (es)
Inventor
Francisco Javier Calvo Macarro
Sonia Rodriguez Gil
Pedro Manuel Franco De Sarabia Rosado
Original Assignee
Biotools Biotechnological & Medical Laboratories, S.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotools Biotechnological & Medical Laboratories, S.A. filed Critical Biotools Biotechnological & Medical Laboratories, S.A.
Priority to PCT/ES2008/070161 priority Critical patent/WO2010018245A1/fr
Publication of WO2010018245A1 publication Critical patent/WO2010018245A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Definitions

  • the present invention relates to a method of detection-quantification and analysis of nucleic acids with at least one primer labeled at its 5 'end with a fluorophore.
  • Said primer has, at the bases adjacent to the marker, at least three guanines or three cytosinases.
  • the method of the invention can present a stage of analysis of denaturation curves, so that it allows the identification of a specific nucleic acid sequence, thus indicating its application among others, in analysis, genotyping and detection of pathogens.
  • Hybridization with labeled oligonucleotides is a method commonly used for the detection, analysis and quantification of nucleic acid sequences.
  • Classic hybridization techniques include “Southern hybridization”, “dot blotting”, trials of gel delay (“gel-shift assays”) and liquid phase incubations.
  • PCR reaction Polymerase chain reaction
  • the PCR technique allows amplification Exponential nucleic acids using: a pair of complementary primers, to two opposite regions of the nucleic acid to be amplified; a mixture of dNTPs and an enzyme with 5'-3 'DNA polymerase activity. Thanks to the use of labeled oligonucleotides in the PCR reaction it is possible to carry out the marking of a specific nucleic acid sequence and its subsequent detection due to the emission of the signal generated by the marking.
  • the sample is subjected to a heat treatment ("melting" reaction).
  • the temperature where the fluorescence signal (Tm) decays or is lost by dissociation of the double stranded nucleic acid allows the identification of the amplified nucleic acid in the PCR reaction (Schütz et al, 1999, BioTechniques 27: 1218-1224). It is possible to determine the Tm of an amplicon by computer programs or experimentally with reference samples.
  • FRET probes are specific hybridization probes. This system consists of two linear ologinucleotides labeled with different fluorophores and a DNA polymerase without exonuclease activity. By hybridizing with the target nucleic acid sequence, the labeled oligonucleotides are faced and close, which triggers an energy resonance transfer (FRET) between one fluorophore and another. The resulting fluorescence signal is directly proportional to the amount of amplified specific nucleic acid. The system also allows to identify mutations in the target sequences because they generate different Tm. - TO -
  • hybridization probes are hairpin probes, so called because they have repeated sequences inverted at their ends allowing them to form a hairpin structure by complementing the inverted regions.
  • An example of this type is the Molecular Beacon probes whose foundation resides in an oligonucleotide with double marking a emitting fluorophore at one of its ends and a blocking fluorophore blocking at the other end.
  • the structure of the unhybridized oligonucleotide shields the fluorescence emitted by the fluorophore, but when the probe hybridizes with the nucleic acid target the oligonucleotide changes its conformation, allowing the fluorophore to be distanced from the shield.
  • the probe By subjecting the heteroduplex formed by the amplicon-probe to a heat treatment the probe is denatured and consequently the fluorescence decreases.
  • a simple mismatch in the formed heteroduplex implies a change in the melting temperature) which allows the genotyping of different sequences once amplified.
  • One factor to consider when designing these probes is that the proximity of certain nucleotide bases (the G effect) in the target sequence inhibits the emission of fluorescence signal (US Pat. No. 2005/0042666 Al).
  • the Taqman probe consists of a linear oligonucleotide with a fluorophore at its 5 'end and a shield at the 3' end. Fluorescence emission occurs after hybridization of the probe with the target sequence, when the fluorophore at the 5 'end is hydrolyzed by the 5'-3' exonuclease activity of the DNA polymerase used in the amplification.
  • LIONPROBES TM probes there are other types of hydrolysis probes LIONPROBES TM probes, protected in the patent with publication number WO2006136621, in these the probe itself acts as a probe and primer at the same time. Its originality lies in the use of a DNA polymerase with 3 '-5' exonuclease error corrective activity. As in the TAQMAN probes in the LIONPROBES TM probes, there is a linear oligo-nucleotide with a double marking at its ends. For the operation of the LIONPROBES TM probes, it is required that one or more bases of the 3 'end be unpaired with respect to the target sequence of the nucleic acid to be amplified.
  • the enzyme corrects the degenerate bases of the probe, so that the 3 'end mareaje is released.
  • the fluorophore shield is separated, the fluorescence signal can be collected and the 3 'end of the oligonucleotide is free for extension, thus acting as a primer.
  • a new method of detection-quantification and identification of nucleic acids is provided by an amplification with oligonucleotides labeled at least 5 'and with G or C bases adjacent to the label.
  • the present method may present a subsequent analysis of melting curves.
  • the present invention relates to a method for the detection and / or quantification of at least one target nucleic acid, in a sample, comprising: o Contacting on a support the substrate nucleic acid / s / s with at least:
  • the difference in fluorescence will be positive , increase, when the double stranded amplified nucleic acid fragments include the guanine sequence; and the fluorescence difference will be negative, a decrease, when the double stranded amplified nucleic acid fragments include the cytosine sequence.
  • the difference in fluorescence detected and / or measured is directly proportional to the amount of amplified substrate DNA.
  • the substrate nucleic acid, target in a sample may come from a previous amplification that occurs consecutively or sequentially on the same detection and / or quantification support and where the primers used in the previous amplification will be of greater base length nucleotide and / or higher content in G / C bases.
  • the substrate nucleic acid / n may have origin in animal or plant biological samples, cell cultures, food, water, soil or air samples.
  • the primers of the invention labeled are going to Tuar as a probe and primer of the amplification reaction. Its design must allow the corresponding 5 'end marking and the adjacent guanines or cytosines to be incorporated into the produced nucleic acid and that the mismatched bases as well as the 3' marking if they exist are corrected and cleaved.
  • the signal emission by the 5 'marking will depend on the amount of nucleic acid formed and the passage from double strand to single strand when denatured.
  • the primer sequence may or may not include mismatched bases at its 3 'end with respect to the target nucleic acid sequence. As for the mareaje of the primer this may be single or double.
  • the 5 'end of the primer or its proximities will always be marked, while the second marking is alternative but if it exists it will be located in the mismatched bases of the 3' end of the primer so that it is cleaved by an enzyme with 3 '-5' exonuclease activity (error corrector).
  • the term "simple marking” refers to a fluorescent molecule (fluorophore) that can be used to give a detectable or quantifiable signal.
  • the double marking consists of a fluorophore and a fluorescence blocker called a screener.
  • the fluorophore may be located at the 5 'end or as internal marking, in the vicinity of the 5' end.
  • the shield if present, is located at the mismatched bases of the 3 'end or at the 3' end of the probe complementary to the mismatched bases of the labeled primer.
  • the methodology of the invention refers to changes in efficiency in fluorescence emission during the accumulation or dissociation / binding of the two chains of the previously labeled nucleic acids. It has been observed that fluorescence emission by a fluorophore-labeled primer depends largely on the nucleotide sequence adjacent to the fluorophore.
  • (C) generate significant changes in the fluorescence signal emission: a) when the labeled nucleic acid meets at least three guanines adjacent to the fluorophore and is in a single chain, these nucleotides are capable of blocking the fluorescence emission , but they lose that property once the single chain nucleic acid hybridizes with its complementary chain.
  • This characteristic allows the increase in fluorescence in each amplification cycle to be monitored as the double stranded nucleic acid accumulates, b) when the labeled nucleic acid encounters at least three cytosines adjacent to the fluorophore and is in a single strand, these Nucleotides are not able to block fluorescence emission, but they lose that property once the single chain nucleic acid hybridizes with its complementary chain. This feature allows the fluorescence decrease to be monitored in each amplification cycle as the double stranded nucleic acid accumulates.
  • the characteristics of sections a) and b) can be exploited during the melting reaction in which the nucleic acid obtained is subjected to a heat treatment that produces its denaturation.
  • fluorescence of a large majority of commercial fluorophores can be inhibited or modified by the nucleotide sequence of the labeled primer.
  • fluorophores include fluorescein such as FAM, JOE, TET and VIC; fluorescein conjugates na-cyanine; bispyrromethane-boron-difluor derivatives (BODIPY); rhodamines such as ROX and HEX; Alexa Fluor 488 fluorophore; Oregon Green fluorophores; Erythrosins and eosins.
  • an enzyme with 3'-5'-exonuclease error-correcting activity is mentioned, in addition to an enzyme with 5'-3 'polymerase activity in primers with single or double-headed dizzying and mismatched bases at its 3 'ends and in the case of primers with simple dyeing and without mismatched bases, only the competition of an enzyme with 5' -3 'polymerization activity would be necessary.
  • thermostable enzymes on the market that couple the 3 '-5' exonuclease-corrective error activity to a polymerase activity (DNA polymerase proofreading, Pfu).
  • the basic components necessary for the application of the invention are the substrate nucleic acid, one or more labeled primers, a mixture of dNTPs necessary for the nucleic acid extension reaction, at least one enzyme with DNA polymerase activity, an enzyme with 3'-5 'exonuclease-corrective error activity or an enzyme that couples both activities, buffers suitable for the functioning of the enzyme or enzymes and primers with polarity opposite to the labeled primers.
  • the 3 'missing end of the primers can be labeled with blockers that react with the OH group such as phosphate or protect the bonds of the unpaired bases of the primers (bonds not phosphodiester) so that the enzyme exonuclease activity.
  • the primers can be labeled with different fluorophores thus allowing to distinguish the generated signal.
  • the amplification reaction is carried out coupled to a real-time device that allows monitoring the fluorescence emission in each amplification cycle and in this way the amplifications of the nucleic acids in each amplification cycle can be observed.
  • the equipment can also be programmed to make a Melting curve where the temperature increases or decreases every half second approximately depending on how it has been programmed, and which reflects the changes in fluorescence intensity. Once the melting temperature of the nucleic acid is reached, the fluorescence rapidly varies which allows the amplified DNA to be identified.
  • An application of the invention is the detection-quantification and identification of nucleic acids by using one or more primers labeled with the same fluorophore or with different fluorophores.
  • the strategies used would involve the alternative use of specifically designed primers.
  • a first strategy consists in the design of a primer labeled with a 5 'emitting fluorophore with at least three guanines (the fluorescence of the tide will decrease when the amplified nucleic acid is denatured) or three cytosines (the fluorescence of the tide will increase when the nucleic acid amplified is denatured) adjacent to the fluorophore and without mismatched bases at its 3 'end.
  • the second strategy consists of a primer labeled with a 5 'emitting fluorophore with at least three guanines (the fluorescence of the marking will decrease when the amplified nucleic acid is denatured) or three cytosines (the fluorescence of the marking will increase when the amplified nucleic acid is denatured ) adjacent to the fluorophore and with bases mismatched at its 3 'end or adjacent bases with respect to the substrate DNA with which it hybridizes, and that these bases are cleaved and corrected by an enzyme with 3'-5' nuclease activity. With opposite polarity. And a DNA polymerase enzyme or a mixture of enzymes that include the 3'-5 'exonuclease-corrective error activity.
  • a third strategy similar to the previous ones consists of a 5'-labeled primer with an emitting fluorophore together with a sequence of guanines and / or cytosines and with mismatched bases and a mating that acts as a shield (quencher), of the fluorescence of the emitting fluorophore at the 3 'end.
  • a primer with opposite polarity.
  • a DNA polymerase enzyme or a mixture of enzymes that include the 3 '-5' exonuclease-corrective error activity.
  • a fourth strategy that consists of a 5 'labeled primer with at least three guanines or cytosines adjacent to the fluorophore and with mismatched bases at its 3' end.
  • a probe labeled at its 3 'end with a fluorescence shielding agent from the previous primer mating and in its sequence exhibits perfect complementarity with the 3' end of the labeled primer which prevents its degradation by the 3 '-5' exonuclease activity -corrector of errors of at least one DNA polymerase required in this system and at the same time Lia fluorescence of primer primer.
  • a primer with opposite polarity a primer with opposite polarity.
  • the primer labeled with a fluorophore at the 5 'end and / or the oligonucleotide labeled with a quencher at the 3' end and of perfect complementarity may have modifications in the binding of their bases by non-phosphodiester bonds and / or inclusion of bases analogs and / or spacers.
  • the primer labeled with a emitting fluorophore at the 5 'end may have a tail of G or C bases at its 5' end that are not complementary to the substrate DNA sequence but that are incorporated into the DNA fragment amplified by the activity DNA polymerase.
  • sequence of guanines or cytosines adjacent to the fluorophore of the labeled primer may or may not be complementary to the substrate nucleic acid which facilitates its design.
  • the other aspect of the invention includes a step after the stage of amplification of denaturation curve analysis, "melting curves", of amplified nucleic acids, or of amplified nucleic acid, this analysis is carried out by measuring the change in the fluorescence signal from the emitting fluorophore incorporated in the different previously amplified DNA fragments, when they pass from double strands to single strands or vice versa.
  • an analysis can be performed simultaneously by selecting the corresponding primers where at least one of them for each target nucleic acid is labeled at the 5 'end with emitting fluorophores that emit at different wavelengths.
  • one of the primers is common for at least two target nucleic acids and is labeled with a 5'-end emitting fluorophore.
  • At least one of the primers for each target nucleic acid may be labeled at the 5 'end with the same fluorophore.
  • each of the primers labeled at the 5 'end with the same fluorophore has G or C sequences adjacent to the 5' end, the denaturation curves of the amplified DNA fragments where the G sequence has been incorporated will be negative and in the case of cytosines it will be positive
  • Another improvement of the invention is that the new design allows amplifying and identifying sequences within a conserved nucleic acid zone that has previously been amplified.
  • a second amplification will be carried out using as a substrate the amplicon obtained in the first amplification.
  • This second amplification is carried out by one or more primers with simple marking at its 5 'end, or internally, with the fluorophores already mentioned and with primers of opposite polarity. Primers with double marking may also be used; A fluorophore end 5 'and end 3' has mismatched bases marked with the shield.
  • the Tm of the primers marked and primers with opposite polarity of the second amplification must differ at least 10 0 C above or below the Tm of the primers of the first amplification.
  • genotypes or SNPs will be differentiated by differences in the Tm according to the length - G + C content or the guanine / cytosine sequence adjacent to the fluorophore, while in the second case, each genotype or SNP will correspond to a fluorophore, detecting Fluorescence changes with each particular fluorophore.
  • the labeled primer of the second amplification hybridizes perfectly in the area where the nucleic acid base change appears. If an enzyme with error corrective activity 3 '-5' is used, the mutation should be located in the vicinity of the 5 'end of the labeled primer to prevent its error correction activity.
  • fluorescence changes due to the passage of double strands to single strands or vice versa of the labeled DNA are more pronounced according to the number and position of guanine and cytosine residues near fluorophore.
  • guanine residues when the amplified nucleic acid is denatured, the intensity of the Adjacent fluorophore decreases, while if near the fluorophore there are cytosine residues when the amplified nucleic acid is denatured the fluorescence intensity increases. Factor that must be taken into account when designing.
  • kits developed with the present invention may be used for the detection, quantification and identification of nucleic acids. Its design will include primers labeled according to the present invention and an appropriate DNA polymerase or enzyme mixture. There may also be kits in which the invention is applied indirectly, with the participation of other techniques such as Taqman probes, Molecular Beacon, interfering agents (Sybr Green, Bebo, Boxto ...) and LIONPROBES TM probes. In these cases the kit will be used for the analysis and identification of nucleic acids.
  • kits developed include labeled primers, primers of opposite polarity to the probe, an enzyme DNA polymerases or mixture of enzymes that include or not 3 '-5' exonuclease-corrective error activity and the reagents necessary to perform amplification (buffer , dNTPs, magnesium ions, PCR adjuvants).
  • kits of the present invention have primers detect viral target nucleic acids, and preferably the viral target nucleic acid is a human oncogenic Papillomavirus.
  • FIGS.1A, 1B, 1C, 1D, 1E, 1F, 1G and IH show the hybridization of the oligonucleotides labeled with the substrate DNA.
  • the mismatches of the labeled oligo-nucleotides are indicated in italics with respect to the substrate DNA (lower part).
  • FIGS.2A, 2B, 2C, 2D, 2E, 2F, 2G and 2H correspond to the Melting curves converted to temperature peaks (FAM channel) of FIGS.1.
  • FIGS.3A, 3B and 3C show the amplification results, the melting curve and the temperature peaks in fluorescence graphs (FAM channel) in the case of using Plasmodium falciparum as substrate DNA and a probe labeled at its 5 'end with 6FAM followed by a sequence of guanines.
  • FIGS.3D, 3E and 3F show the amplification results, the melting curve and the temperature peaks in fluorescence graphs (FAM channel) in the case of using Plasmidium falciparum as substrate DNA and a probe marked at its end 5 'with 6FAM followed by a cytosine sequence.
  • FIGS.4A, 4B and 4C show the amplification results, the melting curve and the temperature peaks in fluorescence graphs (FAM channel) in the case of using different types of human papillomavirus and a probe as substrate DNA marked at its 5 'end with 6FAM and at its 3' end with TAMRA followed by a sequence of cytosines.
  • FIGS.4D, 4E and 4F show the amplification results, melting curve and temperature peaks in fluorescence graphs (FAM channel) in the case of using total human DNA and a probe labeled at its 5 'end as substrate DNA with 6FAM and at its 3 'end with TAMRA followed by a guanine sequence.
  • FIG.5A are the results of Real-time amplification of a conserved region of different substrate DNA in fluorescence graphs (FAM channel) versus a number of cycles in different cases.
  • FAM channel fluorescence graphs
  • dashed lines the negative that has amplified an unspecified product is represented.
  • FIG. 5B corresponds to the Melting curve with the temperature peaks (FAM channel) of FIG. 5A.
  • FIG.6A shows the real-time amplification in fluorescence graphs (FAM channel) with respect to the number of cycles of two DNAs that belong to two Plasmodium species that are P. falciparum (represented by a continuous line) and P. malariae (represented by a broken line).
  • FIG.6B is the graph of the Melting curve with the temperature peaks (FAM channel) of FIG.6A.
  • FIG. 7A is the fluorescence plot (JOE channel) versus number of amplification cycles of a conserved region of the Plasmodium genome with four types of species (P. falciparum, P. malariae, P. ovale and P. vivax) .
  • FIG.7B corresponds to the Melting curves converted to temperature peaks (FAM channel) of the second amplification that the first amplification of FIG.7A had used as a substrate.
  • the agarose gel analysis of the products obtained in the second amplification is shown on the right side of FIG. 7B.
  • FIG. 8A shows a fragment of the wild-type sequence of the rpo ⁇ gene of Mycobacterium tuberculosis (MTB).
  • FIG. 8B is the sequence of the rpo ⁇ gene of MTB with the mutation in codon 516 (depicted at the top).
  • FIG.8C are possible mutations in codon 526.
  • FIG.8D are mutations in codon 531. Bold specific MTB primers are shown in bold.
  • FIG. 9A shows the results of real-time amplification of a fragment of the rpo ⁇ gene specific to MTB in fluorescence plots (JOE channel) versus number of cycles.
  • the substrate DNAs used were a plasmid with MTB DNA without mutations in the rpo ⁇ gene
  • FIG. 9B are the temperature peaks (FAM channel) of the products obtained in the second amplification that have used as a substrate the products obtained in the first amplification of FIG. 9A.
  • the labeled oligonucleotides shown in Figures 1 they were synthesized by Applied Biosystems (double tide) and DNA-Technology A / S (single tide).
  • the probes are of varying sizes, different nucleotide sequence, single or double tides and different orientations.
  • the reporter in all probes is located at its 5 'ends and the fluorescent molecule is 6FAM (6-carboxyfluorescein).
  • the probe In the case where the probe is doubly labeled with a 5 'end and a 3' end quencher, its sequence has mismatches of bases at the 3 'end or adjacent bases when hybridizing with the substrate nucleic acid ( Nucleotides shown in italics in Figures 1) and consequently the 3'-5 'nuclease activity of the Pfu polymerase, used in all experiments, releases the quencher from the probe.
  • Substrate DNAs vary according to the probe used.
  • the probe of FIG. IA (Plasmprobe) uses a conserved region of the genome of Plasmodium falciparum (GenBank Access # M19172) as template DNA and relies on a primer (Plasmrev2) for the development of Real-Time amplification.
  • the substrate DNA of the probes of FIG. IB (531ML), FIG. IC (531ML3) and FIG. IF (rpoMLF2) is a species of Mycobacterium tuberculosis with a mutation in its genome located on codon 531 that confers resistance to the antibiotic rifampicin (GenBank Access # EF628318).
  • the primer with polarity opposite to the probes is in the case of 531ML and 531ML3, Trev and for the rpoMLF2 probe it is 531R.
  • FIG. ID and IE the template DNA is the same as in FIG. AI but the primer is different.
  • the primer of FIG. ID (FaIMLFl probe) is Mrev3 and the primer of FIG. IE (FaIMLRl probe) is Mfor.
  • the Mecalf probe of FIG. IG uses a conserved region of the genome of the Staphylococcus aureus bacterium (GenBank Access # AB236888) as substrate DNA It confers resistance to antibiotics derived from methicillin and its corresponding primer is Mecar2.
  • the substrate DNA of the probe of FIG. IH the substrate DNA of the probe of FIG. IH
  • BHIVLF is a control plasmid (pHIV-Control) that has cloned a cDNA fragment preserved in the genome of HIV type I virus (Acrometrix Panel HIV-I) and its primer is RTR-BIV.
  • Tm melting temperature
  • FaIMLFl 5 '6FAM AGGCAGCAGGCGC 3' SEQ ID NO: 6
  • Mrev3 5 'TCCCACCAT TCCAAT TACA 3' SEQ ID NO: 7
  • FaIMLRl 5 '6FAM TCCCACCATTCCAATTACA 3' (SEQ ID NO: 8)
  • BHIVLF 5 '6FAM AAAGAAAAGGGGGGATTGGGGGGTCA 3' (SEQ ID NO: 14)
  • the amplification mixtures in each case were carried out with the Biotools Pfu DNA polymerase kit (Bio-tools B&M Labs, Madrid, Spain), including in the O 'lU / ⁇ l mixture of Pfu DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl 2 , probe (0.2 ⁇ M ) and primer (0'3 ⁇ M) being the final reaction volume of 20 ⁇ l.
  • the amplification of the corresponding substrate DNA with an amount of approximately 50,000 copies was tested with each amplification mixture and the specific probe and primer pair, as well as a control without
  • the Real-Time amplification equipment that was used was the Gene 3000 Rotor.
  • the amplification cycles and subsequent melting curve programmed in the equipment were the same in all amplification mixtures except in the step where the probe and the primer hybridize with the DNA substrate (in English called step of "annealing"), which was different according to the Tm of the probe and the primer used in the amplification.
  • the amplification cycles and the melting curve cycles are as follows:
  • FALMLFl (FIG.2D) AGGCAGC 5 1,2,3,5,6 ++
  • FALMLRl (FIG.2E) TCCCACC 5 1,2,3,5,6 + rpoMLF2 (FIG.2F) AGCCAGC 5 1,2,3,5,6 +
  • the temperature peak of the Melting curve, represented in Figures 2A-2H, of each PCR product amplified with the probe-primer pair corresponds approximately (the composition of the buffer and the use of possible PCR additives in the mixture of amplification vary the Tm of the product) with the Tm of the amplified product predicted with specialized programs such as Aliele ID 2.0 and Primer Express 1.0. (Table 3).
  • the substrate DNA was a conserved region of the Plasmodium species: P. falciparum (GenBank Access # M 19172).
  • the first probe carries a simple fluorescent marking (5'6FAM), acts as a primer in the amplification reaction and has a 100% homology with the conserved region of Plasmodium falciparum. Within the six nucleotides that follow the nucleotide that carries the reporter together, there are three guanines in positions 2,3 and 6. In this way as the nucleic acid is generated in the amplification, through the probe, a increase in fluorescence signal. In addition, the generated nucleic acid can undergo a negative change in fluorescence signal by double Strand to single strand.
  • the probe designed as described below was FaIMLFl (SEQ ID NO: 6).
  • the reverse primer in the opposite direction to the FaIMLFl probe) that hybridizes perfectly (100% homogenous) with the conserved region of Plasmodium falciparum was Mrev3 (SEQ ID NO: 7).
  • the second probe carries a simple fluorescent marking (5'6FAM), acts as a primer in the amplification reaction and has a 100% homology with the conserved region of Plasmodium falciparum.
  • 5'6FAM simple fluorescent marking
  • cytosines in positions 2,3,4 and 6.
  • the forward primer (in the direction set to the FaIMLRl probe) that hybridizes perfectly (100% homology) with the conserved region of Plasmodium falciparum was Mfor (SEQ ID NO: 9).
  • the amplification mixtures both for the FaIMLFl probe (0.3 ⁇ M ) - Mfor primer (0.3 ⁇ M ) and for the FaIMLRl probe (0.3 ⁇ M ) - Mrev3 primer (0.3 ⁇ M ), were performed with the Biotools Pfu DNA Polymerase II kit
  • the Real Time amplification equipment used was the Gene 3000 Rotor.
  • the amplification cycles and subsequent melting curve were as follows:
  • Figure 3B shows the melting curve and Figure 3C shows the temperature peaks of The four samples tested only in the samples with substrate DNA show a temperature peak that corresponds to the Tm of the amplified product (Table 4).
  • the melting curve shows a decrease in fluorescence when the nucleic acid is denatured because the reporter fluorophore is bound to a sequence of 6 guanines at positions 2,3 and 6.
  • Figure 3E shows the melting curve and Figure 3F shows the temperature peaks of The four samples tested. Mues ⁇ only in DNA substrate after a peak temperature corresponding to the Tm of the amplified product appears. (Table 5).
  • the results of the amplification fluorescence curves and melting curves match the expected behavior of the reporter fluorophore (in this case 6FAM).
  • the fluorophore followed by a Guanine sequence is in single strand mode, the fluorescence intensity is blocked, unlike if the fluorophore is followed by a cytosine sequence.
  • double strand mode the fluorescence intensity increases in the case of the fluorophore followed by a Guanine sequence while with a cytosine sequence the fluorescence intensity decreases.
  • the substrate DNAs were different types of
  • Human papillomavirus type 6 (GenBank Access # AF092932.1), type 52 (GenBank Access # X74481.1), type 11 (GenBank Access # M14119.1), type 44 (GenBank Access # U31788.1), type 45 ( GenBank Access # X74479.1), type 31 (GenBank Access # J04353.1), type 39 (GenBank Access # M62849.1), type 56 (GenBank Access # X74483.1), type 16 (GenBank Access # K02718.1 ), type 59 (GenBank Access # X77858.1), type 33 (GenBank Access # M12732.1), type 70 (GenBank Access # U21941.1), type 18 (GenBank Access # AY262282.1), type 35 (Access GenBank # M74117.1), type 58 (GenBank Access # D90400.1) and human DNA (GenBank Access # AC104389.8).
  • the human Papillomavirus detection probe was designed with a double fluorescent marking (5'6FAM - 3'TAMRA), acts as a primer in the amplification reaction and has a tail of 5 nucleotide bases at its 5 'end with 4 cytosines in positions 1,2,3 and 5 that are not complementary to the substrate DNA sequence but are incorporated into the DNA fragment amplified by the DNA polymerase enzyme activity.
  • the probe also shows mismatches in the last two nucleotides of its 3 'end. In this way, the nucleic acid generated in the amplification, through the probe, can undergo a change in fluorescence signal from double strand to single strand, which allows a melting curve to be obtained and an increase in fluorescence when denatured. the specific product amplified.
  • the probe designed as described above was ONlLA (SEQ ID NO: 16, 5 '6FAM-CCCGCTGTCAAAAACCGTTGTGTCCCT-3' TAMRA).
  • the reverse primer (in the opposite direction to the ONlLA probe) that hybridizes with a conserved region of the most widespread human Papillomavirus types in the world population, was 0N2RA (SEQ ID NO: 0N2RA (SEQ ID NO: 0N2RA (SEQ ID NO: 0N2RA (SEQ ID NO: 0N2RA (SEQ ID NO: 0N2RA (SEQ ID NO: 0N2RA (SEQ ID NO: 0N2RA
  • the detection probe of a region of the human ⁇ -globin gene carries a double fluorescent tide
  • 5'6FAM-3'TAMRA acts as a primer in the amplification reaction and shows mismatches in the last two nucleotides of its 3 'end.
  • nucleotides that follow the nucleotide that carries the reporter fluorophore and that hybridize perfectly with the substrate DNA there are four guanines in positions 1,2,3 and 6.
  • the nucleic acid generated in the amplification by means of the probe, you can experience a change in fluorescence signal from double strand to single strand, which allows you to perform a melting curve and obtain a decrease in the fluorescence signal when the specific PCR product is denatured.
  • the probe designed as described above was SGlob (SEQ ID NO: 18, 5'6FAM-GGGCAGTCATTAAGTCAG GCA-3 'TAMRA).
  • the reverse primer (in the opposite direction to the SGlob probe) that hybridizes perfectly (100% homology) with the conserved region of the human ⁇ -globin gene was GlobRev (SEQ ID NO: 19, 5 'CATATTCCAAGTTTACTAAG AGC 3') •
  • the mixture detection- amplification for quantification and identification of Human Papillomavirus oncogenic was performed with the kit Biotools Pfu DNA polymerase III (Biotools), including in O'lU / .mu.l Pfu DNA polymerase mixture of, 0'025U / ⁇ l Tth DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl2, 0.5M Betaine (adjuvant to increase specificity), 1% Tween, ONlLA probe (0.2 ⁇ M ) and ON2RA primer (0 ' 2um) with a final volume of 20 ⁇ l reaction.
  • Biotools Biotools
  • the amplification mixture for the detection-quantification and identification of ⁇ -globin was performed with the Biotools Pfu DNA polymerase IV kit (Biotools), including in the O'lU / ⁇ l mixture of Pfu DNA polymerase, 0.025U / ⁇ l of Tth DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl 2.5 0.5M, 1% Tween, SGlob probe (0.3 ⁇ M ) and GlobRev primer (0.4 ⁇ M ) being the final volume of the reaction of 20 ⁇ l.
  • Biotools Biotools
  • the Real-Time amplification equipment used was the Gene 3000 Rotor, the Gene 6000 Rotor and the 7500 Real Time.
  • the homology of the ONlLA probe and the reverse ON2RA primer with the types of human Papillomavirus necessary for specific amplification by PCR is only fulfilled by the following oncogenic types (indicated from highest to lowest homology): 33 (I), 31 (J), 58 (K), 16 (L), 35 (M), 18 (N) and 52 (0). (Table 6).
  • HPV Human Papilloma Virus
  • the melting curve is shown in Figure 4B and the temperature peaks of the twenty-two samples tested are shown in Figure 4C. In the positive control and in the HPC ONC samples that amplify a temperature peak appears that corresponds to the Tm of the specific amplified product. (Table 8).
  • Figure 4D shows the amplification of a region of the ⁇ -globin gene of the same substrate DNA that includes the different types of human Papillomavirus that in turn contain cellular genomic DNA from the extraction-purification of each sample and where its amplifications are similar to the amplification of the Positive Control 5 x 10e4 copies ( ⁇ G2). (Table 9). TABLE 9
  • the melting curve is observed in Figure 4E and the temperature peaks after amplification of the ⁇ -globin gene region of the human Papillomavirus substrate DNAs are shown in Figure 4F. In all the samples a temperature peak appears like that of the Positive Control.
  • results of the amplification of human Papillomavirus types 33, 31, 58, 16, 35, 18 and 52 are consistent with the highest homology percentages of the ONlLA probe and the ON2RA primer.
  • results of the amplification of a conserved region of the ⁇ -globin gene in each substrate DNA indicates that the extraction from the same volume of blood was very homogeneous because they had similar quantifications all the samples.
  • results obtained indicate that with the new probe design it is possible to quantify nucleic acids and specifically discriminate similar DNA substrate by the homology of the hybridization sequence. In turn, the analysis is improved to rule out false positives due to amplification of non-specific products or possible contamination.
  • LIONPROBRES TM designed as described in the present invention in order to identify possible nonspecific products generated in the amplification, by means of a melting curve.
  • the Lion probe tested carries a double fluorescent tide (5 '6FAM-3' TAMRA), acts as a primer in the amplification reaction and has mismatches in the last two nucleotides of its 3 'end. Within the six nucleotides that follow the nuleotide that has the reporter attached, there are three Gs in positions 1,2,5 and two Cs in positions 3,6. In this way the nucleic acid generated in the amplification, by means of the Lion probe I tested, you can experience a change in fluorescence signal from double strand to single strand.
  • the substrate DNA was the same conserved region of three Plasmodium species: P. falciparum (Access GenBank # M19172), P.malariae (Access GenBank # M54897) and P. ovale (Access GenBank # L48987)
  • Plasm-rev2 (SEQ ID NO: 2).
  • the LIONPROBRES TM probe designed as described above was Plasmprobe (SEQ ID NO: 1).
  • the amplification mixture was performed with the Biotools Pfu DNA polymerase kit (Biotools), including in the O'lU / ⁇ l mixture of Pfu DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl2, Plasmprobe probe (0.2 ⁇ M) and Plasmrev2 primer (0.3 ⁇ M) being the final reaction volume of 20 ⁇ l.
  • Biotools Biotools
  • the amplification mixture was performed with the Biotools Pfu DNA polymerase kit (Biotools), including in the O'lU / ⁇ l mixture of Pfu DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl2, Plasmprobe probe (0.2 ⁇ M) and Plasmrev2 primer (0.3 ⁇ M) being the final reaction volume of 20 ⁇ l.
  • the Real-Time amplification equipment used was the Gene 3000 Rotor.
  • the amplification cycles and subsequent melting curve cycles were as follows:
  • samples with the substrate DNA of each Plasmodium species begin to amplify between cycles 15 and 25 (Ct), while samples without substrate DNA amplify unspecific products or contamination from cycle 40. (Table 11).
  • Control without DNA3 42 '66 U The melting curve converted to temperature peaks of the six samples tested is shown in Figure 5B. In samples without DNA a peak of lower temperature appears than in samples with substrate DNA corresponding to the amplified nonspecific nucleic acid.
  • the Control without DNA3 (represented by dashed line in FIG. 5B) has the two temperature peaks which means that it has suffered contamination by the substrate DNA.
  • the Tm of the specific nucleic acid amplified from the substrate DNA is approximately 3 ° C greater than the Tm of the non-specific product. (Table 12).
  • the results of the melting curve are consistent with the analysis of the 2% agarose gel stained with Ethidium Bromide as seen in FIG. 5A.
  • the presence in the gel of the amplification bands of ll ⁇ pb in the first three samples with substrate DNA (P, Q, R) is consistent with the size expected in the amplification.
  • the amplification bands of approximately 80 bp in the gel belong to the nonspecific products of the Control samples without DNA (S, T).
  • the last lane of the gel corresponds to the Control without DNA3 (U) and two amplification bands can be observed, one corresponding to the nonspecific product and the other band to contamination with the substrate DNA. This confirms the results shown in the melting curve.
  • the substrate DNAs were two species of Plasmodium: P. falciparum (Access GenBank # M19172) and P.malariae (Access GenBank # M54897).
  • the LIONPROBES TM probe was the same as in the
  • the primer was Malrev2 (SEQ ID NO: 20, 5'-TGCTGGC ACCAGACTTGCCCTCCA-3 ').
  • the primer (with polarity opposite the probe) hybridizes perfectly (100% homology) with the two Plasmodium species.
  • the amplification mixture was performed with the Biotools Pfu DNA polymerase kit (Biotools), including in the O'lU / ⁇ l mixture of Pfu DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl2, Plasmprobe probe (0.2 ⁇ M) and Malrev2 primer (0.3 ⁇ M), the final reaction volume being 20 ⁇ l.
  • Biotools Biotools Pfu DNA polymerase kit
  • the Real Time amplification equipment used was the Gene 3000 Rotor.
  • the amplification cycles and subsequent melting curve were as follows:
  • Figure 6B shows the melting curve converted to temperature peaks of the three samples tested.
  • the peak temperature of the sample with P substrate DNA. falciparum is approximately 1 ° C less than the sample with DNA substrate of P.malariae. These results are due to the different content of G + C and the size amplified with each Plasmodium species.
  • the Control without DNZ sample has no temperature peak that matches the amplification results. (Table 13).
  • the substrate DNAs were three species of Plasmodium: P. falciparum (Access GenBank # 1419172), P.malariae (Access GenBank # M54897) and P. ovale (Access GenBank # L48987).
  • the Lion probe used in the first amplification for the quantification and detection of the conserved area of Plasmodium was Pprobe2 (SEQ ID NO: 21, 5'VIC-GGGTATTGGCCTAACATGGCTATGACGGGCT-S 'TAMRA).
  • the last two bases of the 3 'end of the probe are not homologous to the substrate DNA so the enzyme with 3' -5 'error-correcting exonuclease activity releases the mismatched bases and the quencher (TAMRA) so that the reporter (VIC) can emit fluorescence in each amplification cycle at the same time that the nucleic acid is generated in the PCR.
  • Plasmodium was Malrev2. This primer has 100% homology with the substrate DNA.
  • the substrate DNAs were those produced in the first amplification.
  • a labeled oligonucleotide and a primer with opposite polarity were used for amplification.
  • the labeled oligonucleotide was FaIMLFl (SEQ ID NO: 6) which has the 6FAM molecule labeled at its 5 'end and has a 100% homology with the substrate DNAs produced in the first amplification that come from the three Plasmodium species.
  • the primer was Mrev3 (SEQ ID NO: 7) which is only 100% homologous with the P substrate DNA.
  • the Tm of the probes and primers are different so that the two amplifications can develop consecutively with different temperature cycles. Also the sizes of the nucleic acids obtained in each amplification are different, the product of the second amplification being smaller than that of the first amplification, which allows the incubation times at the temperatures of the steps of the second amplification to be minors (Table 14)
  • the amplification mixture was performed with the Biotools Pfu DNA polymerase II kit (Biotools), including in the O'lU / ⁇ l mixture of Pfu DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl 2 , 1 '25M Betaine (adjuvant to increase specificity), Pprobe2 probe (0.2 ⁇ M ), Malrev2 primer (0.3 ⁇ M ), FaIMLFl probe (0.3 ⁇ M ) and Mrev3 primer (0.3 ⁇ M) being the final volume of the reaction of 20 ⁇ l.
  • Biotools Biotools
  • the Real Time amplification equipment used was the Gene 3000 Rotor.
  • the amplification cycles and subsequent melting curve were as follows:
  • the Melting curve is shown in Figure 7B converted to temperature peaks after the second amplification of the four samples tested. Only in the sample with DNA substrate of P. falciparum ( ⁇ ) a temperature peak appears confirming the specificity of the Mrev3 primer with P. falciparum and not with the other Plasmodium species.
  • the expected Tm of the lOlpb product generated in the second amplification from P DNA. falciparum is 81.9 ° C and the Tm obtained from the melting curve is 77.6 ° C.
  • results obtained indicate that it is possible to detect and quantify different substrate DNAs that have common conserved regions in their genome by means of a LIONPROBES TM probe and a primer.
  • labeled oligonucleotides designed as described in the present invention and an additional primer, it is possible to identify a substrate DNA specifically from the amplification of a common conserved region of different substrate DNAs by A second amplification and a melting curve.
  • the substrate DNAs were five species of Mycobacterium tuberculosis: plasmid with unmodified rpo ⁇ gene (prpo-WT), plasmid with Asp516Val mutation within the rpo ⁇ gene (prpo-516), plasmid with His526Asp mutation within the rpo ⁇ gene (prpo-526A), His526Tyr mutation plasmid within the rpo ⁇ gene (prpo-526T) and Ser531Leu mutation plasmid (prpo-531) within the rpo ⁇ gene. Fragments of the rpo ⁇ gene inserted in the PCR 2.1 TOPO vector (Invitrogen) in each case are shown in Figures 8.
  • FIG. 8A represents the sequence of the prpo-WT insert (SEQ ID NO. 31).
  • FIG. 8B shows the mutation of an adenine (A) by a thymine (T) in the prpo-516 insert (SEQ ID NO. 32).
  • FIG. 8C SEQ ID NO. 33
  • there are two mutations a change of a T for a cytosine (C) corresponding to the insert of prpo-526T and a change of a guanine (G) for a C which is the insert of prpo-526A.
  • FIG. 8D contains a mutation of a T by a C belonging to the insert of prpo-531.
  • the LIONPROBES TM probe used in the first amplification for the quantification and detection of the rpo ⁇ gene fragment of all the plasmids described above was TBS (SEQ ID NO: 22.5 'VIC-AGGAGTTCTTCGG CACCAGCCCA-3' TAMRA).
  • the penultimate base of the 3 'end of the probe is not homologous to the substrate DNAs, so the enzyme with 3' -5 'error-correcting exonuclease activity releases the mismatched bases and the quencher (TAMRA) with which the reporter (VIC) it can emit fluorescence in each amplification cycle at the same time that the nucleic acid is generated in the PCR.
  • TAMRA quencher
  • VIC reporter
  • the primer with polarity opposite to the LIONPROBES TM TBS probe used in the first amplification for quantification and detection of the rpo ⁇ gene fragment was TBR (SEQ ID NO: 23.5 '-TGCACGTCGCGGACCTCCA-3'). This primer has 100% homology with the substrate DNAs.
  • the substrate DNAs were those produced in the first amplification.
  • a labeled oligonucleotide and primers with opposite polarity were used for amplification.
  • the labeled oligonucleotide was rpoMLF2 (SEQ ID NO: 10) which has the 6FAM molecule labeled at its 5 'end and has a 100% homology with the substrate DNAs produced in the first amplification that come from the five plasmids.
  • the primers were: 516R (SEQ ID NO: 24, 5'- GGTTGTTCTGGACCATG-3 ') which is only 100% homologous with the prpo-516 plasmid, 526Rl (SEQ ID NO: 25, 5'- CGCTTGTAGGTCAACC-3' ) that it is only 100% homologous with plasmid prpo-526T, 526R2 (SEQ ID NO: 26, 5'-CGCTTGTCGGTC AACC-3 ') that is only 100% homologous with plasmid prpo-526A and 531R (SEQ ID NO: 11) which is only 100% homologous with the prpo-531 plasmid.
  • Mutations with other substrate DNAs are located in the middle or near the 5 'end of the primer sequence, in this way the enzyme with 3'-5' error-correcting exonuclease activity cannot release the unpaired base and there is no amplification unless there is DNA substrate with sequence complementary to the primer with 100% homology.
  • the Tm of the probes and primers are different so that the two amplifications can develop consecutively with different temperature cycles. Also the sizes of the nucleic acids obtained in each amplification are different, the products of the second amplification being smaller than that of the first amplification which allows the incubation times at the temperatures of the second amplification steps to be smaller. . (Table 15).
  • the amplification mixture was performed with the Biotools Pfu DNA polymerase II kit (Biotools), including in the 0'lU / ⁇ l mixture of Pfu DNA polymerase, reaction buffers, 200 ⁇ M dNTPs, 4mM MgCl 2 , 1 '25M Betaine, TBS probe (0.2 ⁇ M ), TBR primer (0.3 ⁇ M ), rpoMLF2 probe (0.3 ⁇ M ), 516R primer (0.3 ⁇ M ), 526Rl primer (0' 3 ⁇ M), primer 526R2 (0.3 ⁇ M) and primer 531R (0.3 ⁇ M) with a final volume of 20 ⁇ l reaction.
  • Biotools Biotools
  • the amplifications of the five plasmids (prpo) with an amount of approximately 50,000 copies were tested, as well as a control without substrate DNA.
  • the Real Time amplification equipment used was the Gene 3000 Rotor.
  • the amplification cycles and subsequent melting curve were as follows:
  • Amplification II 5 sec at 97 ° C, 5 sec at 52 ° C,
  • the results of the melting curve agree with the specific identification of the samples tested.
  • the primers only amplify the specific plasmid whose sequence is completely complementary to the primer sequence. In this way each primer amplifies only in the presence of the specific plasmid generating different PCR products according to the plasmid used as substrate DNA. These PCR products and consequently the plasmids tested can be identified by their Tm.
  • the results obtained indicate that by amplifying a specific region of several substrate DNAs that contain common external sequences, it is possible to identify internal mutations, point changes or SNPs (single nucleotide polymorphisms) in the sequence, specific to each substrate DNA , through a second amplification and a melting curve using labeled oligonucleotides designed as described in the present invention, and primers homologous in sequence to each mutation to be identified.
  • Each amplified substrate DNA that has a mutation recognized by one of the primers can be differentiated according to the temperature peak obtained in the melting curve.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une méthode de détection-quantification et d'analyse d'acides nucléiques à l'aide d'au moins une amorce marquée à son extrémité 5' à l'aide d'un fluorophore. Ladite amorce présente, au niveau des bases adjacentes au marqueur, au moins trois guanines ou trois cytosines. Lesdites bases modifient le signal de fluorescence et cette modification est utilisée pour détecter l'acide nucléique. La méthode de l'invention peut présenter une étape d'analyse de courbes de dénaturation, de sorte qu'elle permet d'identifier une séquence spécifique d'acides nucléiques, son utilisation étant ainsi indiquée entre autres, dans l'analyse, le génotypage et la détection d'agents pathogènes.
PCT/ES2008/070161 2008-08-12 2008-08-12 Méthode de détection et/ou de quantification d'un acide nucléique substrat WO2010018245A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/ES2008/070161 WO2010018245A1 (fr) 2008-08-12 2008-08-12 Méthode de détection et/ou de quantification d'un acide nucléique substrat

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/ES2008/070161 WO2010018245A1 (fr) 2008-08-12 2008-08-12 Méthode de détection et/ou de quantification d'un acide nucléique substrat

Publications (1)

Publication Number Publication Date
WO2010018245A1 true WO2010018245A1 (fr) 2010-02-18

Family

ID=40220114

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2008/070161 WO2010018245A1 (fr) 2008-08-12 2008-08-12 Méthode de détection et/ou de quantification d'un acide nucléique substrat

Country Status (1)

Country Link
WO (1) WO2010018245A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012024642A1 (fr) * 2010-08-20 2012-02-23 Life Technologies Corporation Dosage d'amplification en chaîne par polymérase en temps réel utilisant des amorces à double marquage de transfert d'énergie par résonance de fluorescence

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001073118A2 (fr) * 2000-03-29 2001-10-04 Lgc (Teddington) Limited Balise d'hybridation et methode de detection et discrimination rapides de sequences
WO2002014555A2 (fr) * 2000-08-11 2002-02-21 University Of Utah Research Foundation Sondes oligonucleotidiques simples, marquees
US20030003486A1 (en) * 1999-11-16 2003-01-02 Atto-Tec Gmbh Dye-labeled oligonucleotide for labeling a nucleic acid molecule
WO2004050917A1 (fr) * 2002-11-29 2004-06-17 Cha Wellbeings Co., Ltd. Amorces communes et procede de detection de genotypes divers du papillomavirus humain par pcr
WO2005047468A2 (fr) * 2003-11-06 2005-05-26 University Of Nevada, Reno Procedes ameliores pour la detection et la mesure de sequences d'acides nucleiques specifiques
WO2006074222A2 (fr) * 2005-01-03 2006-07-13 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Amorce pour la detection d'acide nucleique
US20070292868A1 (en) * 2005-06-16 2007-12-20 Biotools Biotechnological & Medical Laboratories, S.A. Nucleic Acid Detection Method Involving the Direct Generation of a Measurable Signal

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030003486A1 (en) * 1999-11-16 2003-01-02 Atto-Tec Gmbh Dye-labeled oligonucleotide for labeling a nucleic acid molecule
WO2001073118A2 (fr) * 2000-03-29 2001-10-04 Lgc (Teddington) Limited Balise d'hybridation et methode de detection et discrimination rapides de sequences
WO2002014555A2 (fr) * 2000-08-11 2002-02-21 University Of Utah Research Foundation Sondes oligonucleotidiques simples, marquees
WO2004050917A1 (fr) * 2002-11-29 2004-06-17 Cha Wellbeings Co., Ltd. Amorces communes et procede de detection de genotypes divers du papillomavirus humain par pcr
WO2005047468A2 (fr) * 2003-11-06 2005-05-26 University Of Nevada, Reno Procedes ameliores pour la detection et la mesure de sequences d'acides nucleiques specifiques
WO2006074222A2 (fr) * 2005-01-03 2006-07-13 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Amorce pour la detection d'acide nucleique
US20070292868A1 (en) * 2005-06-16 2007-12-20 Biotools Biotechnological & Medical Laboratories, S.A. Nucleic Acid Detection Method Involving the Direct Generation of a Measurable Signal

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CROCKETT ANDREW O ET AL: "Fluorescein-labeled oligonucleotides for real-time PCR: Using the inherent quenching of deoxyguanosine nucleotides", ANALYTICAL BIOCHEMISTRY, ACADEMIC PRESS INC. NEW YORK, vol. 290, no. 1, 1 March 2001 (2001-03-01), pages 89 - 97, XP002200212, ISSN: 0003-2697 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012024642A1 (fr) * 2010-08-20 2012-02-23 Life Technologies Corporation Dosage d'amplification en chaîne par polymérase en temps réel utilisant des amorces à double marquage de transfert d'énergie par résonance de fluorescence

Similar Documents

Publication Publication Date Title
Li et al. Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA
US10590474B2 (en) Methods for true isothermal strand displacement amplification
JP2011514163A5 (fr)
US20240229169A1 (en) Assay for detecting closely-related serotypes of human papillomavirus (hpv)
KR101961642B1 (ko) 절단된 상보적인 태그 절편을 이용한 표적 핵산 서열 검출 방법 및 그 조성물
CN104805218A (zh) 基于lamp和分子信标检测hpv16和18的反应体系和方法
US20140017692A1 (en) Method and kit for detecting target nucleic acid
CA2479045A1 (fr) Methode d'amplification-hybridation destinee a detecter et classifier le pvh
Oh et al. Polymerase chain reaction‐based fluorescent Luminex assay to detect the presence of human papillomavirus types
WO2012009813A1 (fr) Procédés de détection de polymorphismes génétiques à l'aide de la température de fusion de complexes sonde—amplicon
CN110945140A (zh) 通过聚合酶链式反应对目标dna进行检测和基因分型的分子指纹法
US10975423B2 (en) Methods for true isothermal strand displacement amplification
WO2010018245A1 (fr) Méthode de détection et/ou de quantification d'un acide nucléique substrat
EP4118232A1 (fr) Procédés d'empreinte moléculaire pour détecter et génotyper différentes cibles d'arn par réaction en chaîne de la polymérase à transcription inverse en une seule réaction
CN115491435A (zh) 用于大规模人群中病毒病原体筛查的快速且样本特异性混合和检测方法
Kuo et al. Identification of pan-orthopoxvirus, monkeypox-specific and smallpox-specific DNAs by real-time PCR assay
JP6999645B2 (ja) 核酸の増幅及び検出／定量の効率を改良するためのヘルパーオリゴヌクレオチド
JP2007282512A (ja) セルフアニーリング形成を阻害する方法およびその用途
CN107447048B (zh) DVE强弱毒Real time PCR鉴别诊断的引物、探针及试剂盒
JP2009533063A5 (fr)
KR101170442B1 (ko) 수인성 원생동물을 검출하기 위한 중합효소연쇄반응의프라이머 및 프로브, 및 이를 이용한 검출키트 및 방법
MX2009007788A (es) Iniciadores y sondas para la amplificacion y deteccion molecular de arn del virus de la influenza tipo a h1n1 brote 2009.
BR112012020470B1 (pt) Ensaio multiplex, grupo de sonda e kit para detectar a presença ou ausência de múltiplos sorotipos de um organismo papilomavírus humano (hpv) em uma amostra biológica

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08875582

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08875582

Country of ref document: EP

Kind code of ref document: A1