WO2010018245A1

WO2010018245A1 - Method for detection and/or quantification of a nucleic acid substrate

Info

Publication number: WO2010018245A1
Application number: PCT/ES2008/070161
Authority: WO
Inventors: Francisco Javier Calvo Macarro; Sonia Rodriguez Gil; Pedro Manuel Franco De Sarabia Rosado
Original assignee: Biotools Biotechnological & Medical Laboratories, S.A.
Priority date: 2008-08-12
Filing date: 2008-08-12
Publication date: 2010-02-18

Abstract

The present invention relates to a method of detection-quantification and analysis of nucleic acids having at least one primer labelled at its 5’ extremity with a fluorophore. Said primer presents, in the bases adjacent to the label, at least three guanines or three cytosines. These bases modify the fluorescent signal and said modification is utilised for detection of the nucleic acid. The method of the invention may provide a stage of analysis of denaturation curves such as to permit identification of a specific sequence of nucleic acids, its application consequently being indicated in analysis, genotyping and detection of pathogens, among others.

Description

METHOD FOR DETECTION AND / OR QUANTIFICATION OF AN ACID

NUCLEICO SUBSTRATO

DESCRIPTION

OBJECT OF THE INVENTION

The present invention relates to a method of detection-quantification and analysis of nucleic acids with at least one primer labeled at its 5 'end with a fluorophore. Said primer has, at the bases adjacent to the marker, at least three guanines or three cytosinases.

These bases, when incorporated into the nucleic acid generated in the amplification, will modify the fluorescence signal and said modification will be used for the detection of the nucleic acid.

The method of the invention can present a stage of analysis of denaturation curves, so that it allows the identification of a specific nucleic acid sequence, thus indicating its application among others, in analysis, genotyping and detection of pathogens.

BACKGROUND OF THE INVENTION

Hybridization with labeled oligonucleotides is a method commonly used for the detection, analysis and quantification of nucleic acid sequences. Classic hybridization techniques include "Southern hybridization", "dot blotting", trials of gel delay ("gel-shift assays") and liquid phase incubations.

Frequently hybridization is followed or preceded by the PCR reaction ("polymerase chain reaction"). The PCR technique (Saiki et al, Science, 230, 1350-1354, 1985, Mullís et al, US patents US 4, 683, 195, US 4, 683, 202 and US 4, 800, 159) allows amplification Exponential nucleic acids using: a pair of complementary primers, to two opposite regions of the nucleic acid to be amplified; a mixture of dNTPs and an enzyme with 5'-3 'DNA polymerase activity. Thanks to the use of labeled oligonucleotides in the PCR reaction it is possible to carry out the marking of a specific nucleic acid sequence and its subsequent detection due to the emission of the signal generated by the marking.

Most of the equipment associated with Real Time PCR technology incorporates a fluorescence reader into the thermal cycler. These devices are designed to measure, at any time, the fluorescence emitted in each of the vials where the PCR is performed. Numerous technologies have been developed and patented that make it possible to detect, quantify and analyze nucleic acids in Real Time PCR. According to their specificity, the strategies developed can be classified into two groups: non-specific fluorescent intercalating agents and specific probes for a given nucleic acid sequence.

Compounds known as Sybr Green I

(Pat.No. US 6, 174, 670), Bebo (TATAA) and Bromide of Ethidium (Pat. No. US 5, 944, 056) are intercalating agents fluorescent tes that bind to the double stranded nucleic acid, generating a fluorescent signal that increases proportionally to the amplification of the nucleic acids in the PCR reaction. Said compounds may bind to the specific nucleic acid amplified in the PCR reaction, to the dimer of the primers and to other nonspecific products generated in the course of the PCR reaction. The existence of nonspecific amplification signals in the PCR reaction leads to an overestimation of the starting concentration of the specific nucleic acid present in the sample. In order to identify and differentiate the amplified nucleic acids in the PCR reaction, the sample is subjected to a heat treatment ("melting" reaction). The temperature where the fluorescence signal (Tm) decays or is lost by dissociation of the double stranded nucleic acid allows the identification of the amplified nucleic acid in the PCR reaction (Schütz et al, 1999, BioTechniques 27: 1218-1224). It is possible to determine the Tm of an amplicon by computer programs or experimentally with reference samples.

FRET probes (US Pat. No. 6, 174, 670) are specific hybridization probes. This system consists of two linear ologinucleotides labeled with different fluorophores and a DNA polymerase without exonuclease activity. By hybridizing with the target nucleic acid sequence, the labeled oligonucleotides are faced and close, which triggers an energy resonance transfer (FRET) between one fluorophore and another. The resulting fluorescence signal is directly proportional to the amount of amplified specific nucleic acid. The system also allows to identify mutations in the target sequences because they generate different Tm. - TO -

Another type of hybridization probes are hairpin probes, so called because they have repeated sequences inverted at their ends allowing them to form a hairpin structure by complementing the inverted regions. An example of this type is the Molecular Beacon probes whose foundation resides in an oligonucleotide with double marking a emitting fluorophore at one of its ends and a blocking fluorophore blocking at the other end. The structure of the unhybridized oligonucleotide shields the fluorescence emitted by the fluorophore, but when the probe hybridizes with the nucleic acid target the oligonucleotide changes its conformation, allowing the fluorophore to be distanced from the shield. This physical separation between the two results in the emission of a fluorescence signal by the fluorophore. Like the FRET probes, in the hairpin probes the DNA polymerase used does not show 5 '-3' or 3 '-5' exonuclease activity. Another variant of this technology is the first Scorpion probes (Withcombe et al, 1999 Nature Biotechnology 17: 804-807), in which the oligonucleotide labeled when changing conformation acts as a probe and primer for the amplification reaction.

Within the hybridization probes but with a slightly different operation from those described above are the Simpleprobe probes (US Pat. No. 6, 635, 427 B2). In this case, the analysis and identification of nucleic acids is carried out after the amplification reaction, by means of a melting curve. Its design involves the use of an oligonucleotide labeled by a linker at its 5 'or 3' end with a fluorophore. The physical characteristics of the linker allow fluorescence to be emitted only when the probe is hybridized with the target sequence of the previously amplified nucleic acid. (Nazarenko et al, 2002, Nucleic Acids Research 30: 2089-2195). By subjecting the heteroduplex formed by the amplicon-probe to a heat treatment the probe is denatured and consequently the fluorescence decreases. A simple mismatch in the formed heteroduplex implies a change in the melting temperature) which allows the genotyping of different sequences once amplified. One factor to consider when designing these probes is that the proximity of certain nucleotide bases (the G effect) in the target sequence inhibits the emission of fluorescence signal (US Pat. No. 2005/0042666 Al).

Other specific probes are Taqman probes

(U.S. Pat. No. 5,691,146), these are defined as hydrolysis probes as they require the excision of one of the probe dips for operation. The Taqman probe consists of a linear oligonucleotide with a fluorophore at its 5 'end and a shield at the 3' end. Fluorescence emission occurs after hybridization of the probe with the target sequence, when the fluorophore at the 5 'end is hydrolyzed by the 5'-3' exonuclease activity of the DNA polymerase used in the amplification.

There are other types of hydrolysis probes LIONPROBES ™ probes, protected in the patent with publication number WO2006136621, in these the probe itself acts as a probe and primer at the same time. Its originality lies in the use of a DNA polymerase with 3 '-5' exonuclease error corrective activity. As in the TAQMAN probes in the LIONPROBES ™ probes, there is a linear oligo-nucleotide with a double marking at its ends. For the operation of the LIONPROBES ™ probes, it is required that one or more bases of the 3 'end be unpaired with respect to the target sequence of the nucleic acid to be amplified. When the probe hybridizes with the nucleic acid target, the enzyme corrects the degenerate bases of the probe, so that the 3 'end mareaje is released. When the fluorophore shield is separated, the fluorescence signal can be collected and the 3 'end of the oligonucleotide is free for extension, thus acting as a primer.

In the present invention a new method of detection-quantification and identification of nucleic acids is provided by an amplification with oligonucleotides labeled at least 5 'and with G or C bases adjacent to the label. The present method may present a subsequent analysis of melting curves. This new system will provide advantages such as greater specificity and extension of the applications of use, over some known techniques of amplification, detection and quantification of nucleic acids.

DESCRIPTION OF THE INVENTION

The present invention relates to a method for the detection and / or quantification of at least one target nucleic acid, in a sample, comprising: o Contacting on a support the substrate nucleic acid / s / s with at least:

_• a primer, forward or reverse, marked with a emitting fluorophore at the 5 'end, and having at least three G bases or three C bases at the six nucleotides that follow the base marked with the emitted fluorophore Sr.

_• a primer with opposite polarity

_• an enzyme with DNA polymerase activity

or the amplification of the previous mixture

or the detection and / or measurement of the change in the fluorescence signal due to the accumulation of amplified nucleic acid fragments in a double-chain state where the emitting fluorophore and the sequence of G or C have been incorporated, the difference in fluorescence will be positive , increase, when the double stranded amplified nucleic acid fragments include the guanine sequence; and the fluorescence difference will be negative, a decrease, when the double stranded amplified nucleic acid fragments include the cytosine sequence.

The difference in fluorescence detected and / or measured is directly proportional to the amount of amplified substrate DNA.

The substrate nucleic acid, target in a sample, may come from a previous amplification that occurs consecutively or sequentially on the same detection and / or quantification support and where the primers used in the previous amplification will be of greater base length nucleotide and / or higher content in G / C bases.

The substrate nucleic acid / n may have origin in animal or plant biological samples, cell cultures, food, water, soil or air samples.

The primers of the invention labeled are going to Tuar as a probe and primer of the amplification reaction. Its design must allow the corresponding 5 'end marking and the adjacent guanines or cytosines to be incorporated into the produced nucleic acid and that the mismatched bases as well as the 3' marking if they exist are corrected and cleaved. The signal emission by the 5 'marking will depend on the amount of nucleic acid formed and the passage from double strand to single strand when denatured.

The primer sequence may or may not include mismatched bases at its 3 'end with respect to the target nucleic acid sequence. As for the mareaje of the primer this may be single or double. The 5 'end of the primer or its proximities will always be marked, while the second marking is alternative but if it exists it will be located in the mismatched bases of the 3' end of the primer so that it is cleaved by an enzyme with 3 '-5' exonuclease activity (error corrector).

In the present invention the term "simple marking" refers to a fluorescent molecule (fluorophore) that can be used to give a detectable or quantifiable signal. The double marking consists of a fluorophore and a fluorescence blocker called a screener. The fluorophore may be located at the 5 'end or as internal marking, in the vicinity of the 5' end. The shield, if present, is located at the mismatched bases of the 3 'end or at the 3' end of the probe complementary to the mismatched bases of the labeled primer.

The methodology of the invention refers to changes in efficiency in fluorescence emission during the accumulation or dissociation / binding of the two chains of the previously labeled nucleic acids. It has been observed that fluorescence emission by a fluorophore-labeled primer depends largely on the nucleotide sequence adjacent to the fluorophore.

Guanine residues (G), or cytosine residues

(C) generate significant changes in the fluorescence signal emission: a) when the labeled nucleic acid meets at least three guanines adjacent to the fluorophore and is in a single chain, these nucleotides are capable of blocking the fluorescence emission , but they lose that property once the single chain nucleic acid hybridizes with its complementary chain. This characteristic allows the increase in fluorescence in each amplification cycle to be monitored as the double stranded nucleic acid accumulates, b) when the labeled nucleic acid encounters at least three cytosines adjacent to the fluorophore and is in a single strand, these Nucleotides are not able to block fluorescence emission, but they lose that property once the single chain nucleic acid hybridizes with its complementary chain. This feature allows the fluorescence decrease to be monitored in each amplification cycle as the double stranded nucleic acid accumulates. The characteristics of sections a) and b) can be exploited during the melting reaction in which the nucleic acid obtained is subjected to a heat treatment that produces its denaturation.

The fluorescence of a large majority of commercial fluorophores can be inhibited or modified by the nucleotide sequence of the labeled primer. Among these fluorophores are those that include fluorescein such as FAM, JOE, TET and VIC; fluorescein conjugates na-cyanine; bispyrromethane-boron-difluor derivatives (BODIPY); rhodamines such as ROX and HEX; Alexa Fluor 488 fluorophore; Oregon Green fluorophores; Erythrosins and eosins.

As for the enzymes involved in the invention, an enzyme with 3'-5'-exonuclease error-correcting activity is mentioned, in addition to an enzyme with 5'-3 'polymerase activity in primers with single or double-headed dizzying and mismatched bases at its 3 'ends and in the case of primers with simple dyeing and without mismatched bases, only the competition of an enzyme with 5' -3 'polymerization activity would be necessary. There are thermostable enzymes on the market that couple the 3 '-5' exonuclease-corrective error activity to a polymerase activity (DNA polymerase proofreading, Pfu).

The basic components necessary for the application of the invention are the substrate nucleic acid, one or more labeled primers, a mixture of dNTPs necessary for the nucleic acid extension reaction, at least one enzyme with DNA polymerase activity, an enzyme with 3'-5 'exonuclease-corrective error activity or an enzyme that couples both activities, buffers suitable for the functioning of the enzyme or enzymes and primers with polarity opposite to the labeled primers.

To prevent the formation of primer dimeros and improve the specificity of the system, the 3 'missing end of the primers can be labeled with blockers that react with the OH group such as phosphate or protect the bonds of the unpaired bases of the primers (bonds not phosphodiester) so that the enzyme exonuclease activity.

The primers can be labeled with different fluorophores thus allowing to distinguish the generated signal. The amplification reaction is carried out coupled to a real-time device that allows monitoring the fluorescence emission in each amplification cycle and in this way the amplifications of the nucleic acids in each amplification cycle can be observed. The equipment can also be programmed to make a Melting curve where the temperature increases or decreases every half second approximately depending on how it has been programmed, and which reflects the changes in fluorescence intensity. Once the melting temperature of the nucleic acid is reached, the fluorescence rapidly varies which allows the amplified DNA to be identified.

An application of the invention is the detection-quantification and identification of nucleic acids by using one or more primers labeled with the same fluorophore or with different fluorophores. The strategies used would involve the alternative use of specifically designed primers.

A first strategy consists in the design of a primer labeled with a 5 'emitting fluorophore with at least three guanines (the fluorescence of the tide will decrease when the amplified nucleic acid is denatured) or three cytosines (the fluorescence of the tide will increase when the nucleic acid amplified is denatured) adjacent to the fluorophore and without mismatched bases at its 3 'end. A primer with opposite polarity and an enzyme with DNA polymerase activity or a mixture of enzymes that may or may not include the 3'-5 'exonuclease-corrective error activity. The second strategy consists of a primer labeled with a 5 'emitting fluorophore with at least three guanines (the fluorescence of the marking will decrease when the amplified nucleic acid is denatured) or three cytosines (the fluorescence of the marking will increase when the amplified nucleic acid is denatured ) adjacent to the fluorophore and with bases mismatched at its 3 'end or adjacent bases with respect to the substrate DNA with which it hybridizes, and that these bases are cleaved and corrected by an enzyme with 3'-5' nuclease activity. With opposite polarity. And a DNA polymerase enzyme or a mixture of enzymes that include the 3'-5 'exonuclease-corrective error activity.

A third strategy similar to the previous ones consists of a 5'-labeled primer with an emitting fluorophore together with a sequence of guanines and / or cytosines and with mismatched bases and a mating that acts as a shield (quencher), of the fluorescence of the emitting fluorophore at the 3 'end. A primer with opposite polarity. And a DNA polymerase enzyme or a mixture of enzymes that include the 3 '-5' exonuclease-corrective error activity.

Finally, a fourth strategy that consists of a 5 'labeled primer with at least three guanines or cytosines adjacent to the fluorophore and with mismatched bases at its 3' end. A probe labeled at its 3 'end with a fluorescence shielding agent from the previous primer mating and in its sequence exhibits perfect complementarity with the 3' end of the labeled primer which prevents its degradation by the 3 '-5' exonuclease activity -corrector of errors of at least one DNA polymerase required in this system and at the same time Lia fluorescence of primer primer. And a primer with opposite polarity.

The primer labeled with a fluorophore at the 5 'end and / or the oligonucleotide labeled with a quencher at the 3' end and of perfect complementarity may have modifications in the binding of their bases by non-phosphodiester bonds and / or inclusion of bases analogs and / or spacers.

Also, the primer labeled with a emitting fluorophore at the 5 'end may have a tail of G or C bases at its 5' end that are not complementary to the substrate DNA sequence but that are incorporated into the DNA fragment amplified by the activity DNA polymerase.

In each of the strategies used, the sequence of guanines or cytosines adjacent to the fluorophore of the labeled primer may or may not be complementary to the substrate nucleic acid which facilitates its design.

The other aspect of the invention includes a step after the stage of amplification of denaturation curve analysis, "melting curves", of amplified nucleic acids, or of amplified nucleic acid, this analysis is carried out by measuring the change in the fluorescence signal from the emitting fluorophore incorporated in the different previously amplified DNA fragments, when they pass from double strands to single strands or vice versa.

If the substrate nucleic acids are multiple, an analysis can be performed simultaneously by selecting the corresponding primers where at least one of them for each target nucleic acid is labeled at the 5 'end with emitting fluorophores that emit at different wavelengths.

In another aspect of the invention one of the primers is common for at least two target nucleic acids and is labeled with a 5'-end emitting fluorophore.

In another aspect at least one of the primers for each target nucleic acid may be labeled at the 5 'end with the same fluorophore.

In a final aspect each of the primers labeled at the 5 'end with the same fluorophore has G or C sequences adjacent to the 5' end, the denaturation curves of the amplified DNA fragments where the G sequence has been incorporated will be negative and in the case of cytosines it will be positive

Another improvement of the invention is that the new design allows amplifying and identifying sequences within a conserved nucleic acid zone that has previously been amplified. In this application a second amplification will be carried out using as a substrate the amplicon obtained in the first amplification. This second amplification is carried out by one or more primers with simple marking at its 5 'end, or internally, with the fluorophores already mentioned and with primers of opposite polarity. Primers with double marking may also be used; A fluorophore end 5 'and end 3' has mismatched bases marked with the shield. The Tm of the primers marked and primers with opposite polarity of the second amplification must differ at least 10 ⁰ C above or below the Tm of the primers of the first amplification.

The applications of this last aspect of the invention are very wide, from genotyping of different species to the detection of SNPs (single nucleotide polymorphisms). This application of the invention allows a quantification of the first reaction called generic reaction. The second reaction is specific, it is possible to use primers labeled with the same fluorophore or with different fluorophores in this reaction. In the first case, genotypes or SNPs will be differentiated by differences in the Tm according to the length - G + C content or the guanine / cytosine sequence adjacent to the fluorophore, while in the second case, each genotype or SNP will correspond to a fluorophore, detecting Fluorescence changes with each particular fluorophore.

For the detection of SNPs it is necessary that the labeled primer of the second amplification hybridizes perfectly in the area where the nucleic acid base change appears. If an enzyme with error corrective activity 3 '-5' is used, the mutation should be located in the vicinity of the 5 'end of the labeled primer to prevent its error correction activity.

In all applications of this invention, fluorescence changes due to the passage of double strands to single strands or vice versa of the labeled DNA are more pronounced according to the number and position of guanine and cytosine residues near fluorophore. In the case of guanine residues, when the amplified nucleic acid is denatured, the intensity of the Adjacent fluorophore decreases, while if near the fluorophore there are cytosine residues when the amplified nucleic acid is denatured the fluorescence intensity increases. Factor that must be taken into account when designing.

The kits developed with the present invention may be used for the detection, quantification and identification of nucleic acids. Its design will include primers labeled according to the present invention and an appropriate DNA polymerase or enzyme mixture. There may also be kits in which the invention is applied indirectly, with the participation of other techniques such as Taqman probes, Molecular Beacon, interfering agents (Sybr Green, Bebo, Boxto ...) and LIONPROBES ™ probes. In these cases the kit will be used for the analysis and identification of nucleic acids.

The kits developed include labeled primers, primers of opposite polarity to the probe, an enzyme DNA polymerases or mixture of enzymes that include or not 3 '-5' exonuclease-corrective error activity and the reagents necessary to perform amplification (buffer , dNTPs, magnesium ions, PCR adjuvants).

The kits of the present invention have primers detect viral target nucleic acids, and preferably the viral target nucleic acid is a human oncogenic Papillomavirus.

DESCRIPTION OF THE DRAWINGS

FIGS.1A, 1B, 1C, 1D, 1E, 1F, 1G and IH show the hybridization of the oligonucleotides labeled with the substrate DNA. FIG. IA Plasmprobe probe, FIG. IB probe 531ML, FIG. Probe IC 531ML3, FIG. FaIMFl probe ID, FIG. IE FaIMRl probe, FIG. IF probe rpoMLF2, FIG. IG probe Mecalf and FIG. IH BHIVLF probe. The mismatches of the labeled oligo-nucleotides (upper part) are indicated in italics with respect to the substrate DNA (lower part).

FIGS.2A, 2B, 2C, 2D, 2E, 2F, 2G and 2H correspond to the Melting curves converted to temperature peaks (FAM channel) of FIGS.1.

FIGS.3A, 3B and 3C show the amplification results, the melting curve and the temperature peaks in fluorescence graphs (FAM channel) in the case of using Plasmodium falciparum as substrate DNA and a probe labeled at its 5 'end with 6FAM followed by a sequence of guanines. FIGS.3D, 3E and 3F show the amplification results, the melting curve and the temperature peaks in fluorescence graphs (FAM channel) in the case of using Plasmidium falciparum as substrate DNA and a probe marked at its end 5 'with 6FAM followed by a cytosine sequence.

FIGS.4A, 4B and 4C show the amplification results, the melting curve and the temperature peaks in fluorescence graphs (FAM channel) in the case of using different types of human papillomavirus and a probe as substrate DNA marked at its 5 'end with 6FAM and at its 3' end with TAMRA followed by a sequence of cytosines. FIGS.4D, 4E and 4F show the amplification results, melting curve and temperature peaks in fluorescence graphs (FAM channel) in the case of using total human DNA and a probe labeled at its 5 'end as substrate DNA with 6FAM and at its 3 'end with TAMRA followed by a guanine sequence. FIG.5A are the results of Real-time amplification of a conserved region of different substrate DNA in fluorescence graphs (FAM channel) versus a number of cycles in different cases. In dashed lines, the negative that has amplified an unspecified product is represented. On the right side of the figure, the analysis of the agaseous gel of the amplified products is shown. FIG. 5B corresponds to the Melting curve with the temperature peaks (FAM channel) of FIG. 5A.

FIG.6A shows the real-time amplification in fluorescence graphs (FAM channel) with respect to the number of cycles of two DNAs that belong to two Plasmodium species that are P. falciparum (represented by a continuous line) and P. malariae (represented by a broken line). FIG.6B is the graph of the Melting curve with the temperature peaks (FAM channel) of FIG.6A.

FIG. 7A is the fluorescence plot (JOE channel) versus number of amplification cycles of a conserved region of the Plasmodium genome with four types of species (P. falciparum, P. malariae, P. ovale and P. vivax) . FIG.7B corresponds to the Melting curves converted to temperature peaks (FAM channel) of the second amplification that the first amplification of FIG.7A had used as a substrate. The agarose gel analysis of the products obtained in the second amplification is shown on the right side of FIG. 7B.

FIG. 8A shows a fragment of the wild-type sequence of the rpoβ gene of Mycobacterium tuberculosis (MTB). FIG. 8B is the sequence of the rpoβ gene of MTB with the mutation in codon 516 (depicted at the top). FIG.8C are possible mutations in codon 526. FIG.8D are mutations in codon 531. Bold specific MTB primers are shown in bold.

FIG. 9A shows the results of real-time amplification of a fragment of the rpoβ gene specific to MTB in fluorescence plots (JOE channel) versus number of cycles. The substrate DNAs used were a plasmid with MTB DNA without mutations in the rpoβ gene

(prpo-WT), a plasmid with MTB DNA with the mutation in codon 516 (prpo-516), another plasmid with MTB DNA with the mutation in codon 526 (prpo-526T), another plasmid with DNA MTB with the mutation in codon 526 (prpo-526A) and a plasmid with MTB DNA with the mutation in codon 531 (prpo-531). FIG. 9B are the temperature peaks (FAM channel) of the products obtained in the second amplification that have used as a substrate the products obtained in the first amplification of FIG. 9A.

PREFERRED EMBODIMENT OF THE INVENTION

EXAMPLE 1.

Real-time amplification test followed by a melting curve using fluorescently labeled oligonucleotides as primers to check the effect of the nucleotide sequence and its position that give rise to a change in fluorescence when the amplified nucleic acid dissociates and passes from double strands to single strands. .

The labeled oligonucleotides (probes) shown in Figures 1 they were synthesized by Applied Biosystems (double tide) and DNA-Technology A / S (single tide). The probes are of varying sizes, different nucleotide sequence, single or double tides and different orientations. The reporter in all probes is located at its 5 'ends and the fluorescent molecule is 6FAM (6-carboxyfluorescein). In the case where the probe is doubly labeled with a 5 'end and a 3' end quencher, its sequence has mismatches of bases at the 3 'end or adjacent bases when hybridizing with the substrate nucleic acid ( Nucleotides shown in italics in Figures 1) and consequently the 3'-5 'nuclease activity of the Pfu polymerase, used in all experiments, releases the quencher from the probe.

Substrate DNAs vary according to the probe used. The probe of FIG. IA (Plasmprobe) uses a conserved region of the genome of Plasmodium falciparum (GenBank Access # M19172) as template DNA and relies on a primer (Plasmrev2) for the development of Real-Time amplification. The substrate DNA of the probes of FIG. IB (531ML), FIG. IC (531ML3) and FIG. IF (rpoMLF2) is a species of Mycobacterium tuberculosis with a mutation in its genome located on codon 531 that confers resistance to the antibiotic rifampicin (GenBank Access # EF628318). The primer with polarity opposite to the probes is in the case of 531ML and 531ML3, Trev and for the rpoMLF2 probe it is 531R. In FIG. ID and IE the template DNA is the same as in FIG. AI but the primer is different. The primer of FIG. ID (FaIMLFl probe) is Mrev3 and the primer of FIG. IE (FaIMLRl probe) is Mfor. The Mecalf probe of FIG. IG uses a conserved region of the genome of the Staphylococcus aureus bacterium (GenBank Access # AB236888) as substrate DNA It confers resistance to antibiotics derived from methicillin and its corresponding primer is Mecar2. Finally, the substrate DNA of the probe of FIG. IH

(BHIVLF) is a control plasmid (pHIV-Control) that has cloned a cDNA fragment preserved in the genome of HIV type I virus (Acrometrix Panel HIV-I) and its primer is RTR-BIV.

The sequences of the probes, together with their specific primers, described below, have a very similar melting temperature (Tm) for correct real-time amplification.

Plasmprobe 5 '6FAM AGGCAGCAGGCGCGTAAATTACCCAATGA 3' TR (SEQ ID NO: 1) Plasmrev2 5 'TGGGAAGGTTTTAAATTCCCA 3' (SEQ ID NO: 2)

531ML 5 '6FAM TGGCGCTGGGGCC 3' (SEQ ID NO: 3)

531ML3 5 '6FAM TGTTGGCGCTGGGG 3' (SEQ ID NO: 4)

Trev 5 'TGCACGTCGCGGAC 3' (SEQ ID NO: 5)

FaIMLFl 5 '6FAM AGGCAGCAGGCGC 3' (SEQ ID NO: 6) Mrev3 5 'TCCCACCAT TCCAAT TACA 3' (SEQ ID NO: 7)

FaIMLRl 5 '6FAM TCCCACCATTCCAATTACA 3' (SEQ ID NO: 8)

Mf or 5 'CCCAATTCTAAAGAAGAGAGG 3' (SEQ ID NO: 9) rpoMLF2 5 '6FAM AGCCAGCTGAGCCAAT 3' (SEQ ID NO: 10)

53 IR 5 'CCAGCGCCAACAGTC 3' (SEQ ID NO: 11) Mecalf 5 '6FAM ACGATCCTGAATGTTTATATCTTTAACGCCCA 3' TR (SEQ ID NO: 12)

Mecar2 5 'CGATAATGGTGAAGTAGAAATGACTGAAC 3' (SEQ ID NO: 13)

BHIVLF 5 '6FAM AAAGAAAAGGGGGGATTGGGGGGTCA 3' (SEQ ID NO: 14)

RTR-BIV 5 'GTCTATTATTCTTTCCCCTGCACTGT 3' (SEQ ID NO: 15)

The amplification mixtures in each case were carried out with the Biotools Pfu DNA polymerase kit (Bio-tools B&M Labs, Madrid, Spain), including in the O 'lU / μl mixture of Pfu DNA polymerase, reaction buffers, 200 _μM dNTPs, 4mM MgCl ₂ , probe (0.2 _µM ) and primer (0'3μM) being the final reaction volume of 20μl. The amplification of the corresponding substrate DNA with an amount of approximately 50,000 copies was tested with each amplification mixture and the specific probe and primer pair, as well as a control without

Substrate DNA.

The Real-Time amplification equipment that was used was the Gene 3000 Rotor. The amplification cycles and subsequent melting curve programmed in the equipment were the same in all amplification mixtures except in the step where the probe and the primer hybridize with the DNA substrate (in English called step of "annealing"), which was different according to the Tm of the probe and the primer used in the amplification. The amplification cycles and the melting curve cycles are as follows:

Denaturation: 4 min at 95 ° C. 1 cycle Amplification: 5 sec at 97 ° C, 5 sec at annealing Tra corresponding to the probe-primer pair (Table 1), 30 sec at 62 ° C (fluorescence capture). 35 cycles Melting: 30 sec at 65 ° C and Tra ramp

0.4 ° C / sec from 65 ° C to 95 ° C capturing fluorescence at each increase in Tra.

TABLE 1

Couple Probe - Tra primer by Annealing

Plasmprobe Plasmrev2 58 ° C 531ML Trev 52 ° C Continuation-TABLE 1

Couple Probe - Tra primer by Annealing

531ML3 Trev 54 ° C

FaIMLFl Mrev3 52 ° C

FaIMLRl Mfor 52 ° C rpoMLF2 531R 52 ° C

Mecalf Mecar2 61 ° C

BHIVLF RTR-BIV 61 ° C

The graphs of the melting curves carried out by each probe-primer pair in Table 1 are shown in Figures 2A-2H. With some probes, temperature peaks are observed (Figures 2A-2F) and with others not (Figures 2G and 2H). Also the intensity of the fluorescence signal of the temperature peaks varies from one probe to another. The positioning and number of nucleotides with guanine (G) and cytosine (C) residues is very important in the design of the probe. The six nucleotides that follow the base that the fluorophore is attached must be at least 3G or 3C and preferably should be located just after the base that holds the reporter together. G residues absorb the emission fluorescence of the reporter more than C residues. In this way you can see a change in fluorescence in the Melting curve when you pass the product from double strand to single strand. (Table 2). TABLE 2

Change of

Fluorescence when moving from dsDNA to £ 3sDNA

Probe Design Position Number (+++ high, ++ medium

(5 '6FAM ...) G / C G / C ++ low, - no change)

Plasmprobe (FIG. 2A) AGGCAGC 5 1,2,3,5,6 +++

531ML (FIG.2B) TGGCGCT 5 1,2,3,4,5 ++

531ML3 (FIG.2C) TGTTGGC 4 1,4,5,6 ++

FALMLFl (FIG.2D) AGGCAGC 5 1,2,3,5,6 ++

FALMLRl (FIG.2E) TCCCACC 5 1,2,3,5,6 + rpoMLF2 (FIG.2F) AGCCAGC 5 1,2,3,5,6 +

Mecalf (FIG.2G) ACGATCC 4 1,2,5,6 -

BHIVLF (FIG.2H) AAAGAAA 1 3 -

Double stranded DNA (dsDNA), single stranded DNA (ssDNA)

The temperature peak of the Melting curve, represented in Figures 2A-2H, of each PCR product amplified with the probe-primer pair corresponds approximately (the composition of the buffer and the use of possible PCR additives in the mixture of amplification vary the Tm of the product) with the Tm of the amplified product predicted with specialized programs such as Aliele ID 2.0 and Primer Express 1.0. (Table 3).

TABLE 3

Product size Tm predicted Tm peak

Probe Pair - Tra AlIeIeID 2.0 amplified primer

Plasmprobe Plasmrev2 llβpb 82'1 ° C 79 ° C

531ML Trev 62pb 92'9 ° C 87 ° C

531ML3 Trev 64pb 92'4 ° C 86 ° C

FaIMLFl Mrev3 lOlpb 81'9 ° C 78 ° C Continuation-TABLE 3

Product size Tm predicted Tm peak

Probe Pair - Tra AlIeIeID 2.0 amplified primer

FaIMLRl Mfor 80pb 78 ° C 75 ° C rpoMLF2 531R 76pb 88'8 ° C 86 ° C

Mecalf Mecar2 85pb IA ¹ I ⁰ C - ° c

BHIVLF RTR-BIV 49pb 76'1 ° C - ° c

Base pairs (bp)

EXAMPLE 2

Real-time amplification test followed by a melting curve with two probes with simple marking (a fluorophore at the 5 'end) and two primers, to identify the same substrate DNA by analysis of opposite fluorescence signals according to which probe is used.

The substrate DNA was a conserved region of the Plasmodium species: P. falciparum (GenBank Access # M 19172).

The first probe carries a simple fluorescent marking (5'6FAM), acts as a primer in the amplification reaction and has a 100% homology with the conserved region of Plasmodium falciparum. Within the six nucleotides that follow the nucleotide that carries the reporter together, there are three guanines in positions 2,3 and 6. In this way as the nucleic acid is generated in the amplification, through the probe, a increase in fluorescence signal. In addition, the generated nucleic acid can undergo a negative change in fluorescence signal by double Strand to single strand. The probe designed as described below was FaIMLFl (SEQ ID NO: 6).

The reverse primer (in the opposite direction to the FaIMLFl probe) that hybridizes perfectly (100% homogenous) with the conserved region of Plasmodium falciparum was Mrev3 (SEQ ID NO: 7).

The second probe carries a simple fluorescent marking (5'6FAM), acts as a primer in the amplification reaction and has a 100% homology with the conserved region of Plasmodium falciparum. Within the six nucleotides that follow the nucleotide that carries the reporter together, there are 4 cytosines in positions 2,3,4 and 6. In this way as the nucleic acid is generated in the amplification, by means of the probe, gets a decrease in the fluorescence signal. In addition to the generated nucleic acid, you can experience a positive change in fluorescence signal from double strand to single strand. The probe designed as described below was FaIMLRl (SEQ ID NO: 8).

The forward primer (in the direction set to the FaIMLRl probe) that hybridizes perfectly (100% homology) with the conserved region of Plasmodium falciparum was Mfor (SEQ ID NO: 9).

The amplification mixtures, both for the FaIMLFl probe (0.3 _μM ) - Mfor primer (0.3 _μM ) and for the FaIMLRl probe (0.3 _μM ) - Mrev3 primer (0.3 _μM ), were performed with the Biotools Pfu DNA Polymerase II kit

(Biotools), including in the mixture 0.1 U / _μ l Pfu polymerase DNA, reaction buffers, 200 _μ M dNTP, 4 mM MgCl2 and 1.25 M Betaine (adjuvant to increase specificity) being the volume end of the reaction of 20 _μ l.

The Real Time amplification equipment used was the Gene 3000 Rotor. The amplification cycles and subsequent melting curve were as follows:

Denaturation: 4 min at 95 ° C. 1 cycle Amplification: 5 sec at 97 ° C, 5 sec at 52 ° C,

30 sec at 62 ° C (Fluorescence capture in the FAM channel).

40 cycles

Melting: 30 sec at 65 ° C and temperature ramp of 0.4 ° C / sec from 65 ° C to 90 ⁰ C capturing fluorescence in the FAM channel at each temperature increase.

The amplification graphs where the fluorescence signal in the FAM channel is plotted against the number of cycles and the graphs of the post-amplification melting curve are shown in Figures 3A, 3B, 3C, 3D, 3E and 3F.

As seen in Figure 3A, samples with different concentrations of Plasmodium falciparum substrate DNA (A, B, C), and using the FaIMLFl probe and the Mrev3 primer, amplify at a rate proportional to the initial amount of substrate DNA while that samples without substrate DNA (D) do not amplify. The fluorescence curves of the amplification are positive for having a Guanine sequence attached to the probe fluorophore in positions 2,3 and 6. (Table 4).

Figure 3B shows the melting curve and Figure 3C shows the temperature peaks of The four samples tested only in the samples with substrate DNA show a temperature peak that corresponds to the Tm of the amplified product (Table 4). The melting curve, as seen in Figure 3B, shows a decrease in fluorescence when the nucleic acid is denatured because the reporter fluorophore is bound to a sequence of 6 guanines at positions 2,3 and 6.

TABLE 4

Sample Ct Peak Tm Concentration

Calculated (copies) of Tra r i _ -, η (-0,207Ct + 10,389)

P. falciparum 27, 26 57005.87 copies 78, 20 ⁰ CA

(5xlO ⁴ copies)

P. falciparum 32, 68 3846.54 copies 78, 05 ⁰ CB

(5x10 copies)

P. falciparum 27, 26 570, 06 copies 77, 90 ⁰ CC

(5xlO ² copies)

Control without DNA - - - - D

In Figure 3D the samples are observed at different concentrations of the P. falciparum substrate DNA (E, F, G) and using the FaIMLRl probe and the Mfor primer, they amplify in a cadence proportional to the initial amount of substrate DNA while that samples (H) without substrate DNA do not amplify. The fluorescence curves of the amplification are negative because a cytosine sequence is attached to the probe fluorophore in positions 2,3,4 and 6. (Table 5).

Figure 3E shows the melting curve and Figure 3F shows the temperature peaks of The four samples tested. Mues ^¬ only in DNA substrate after a peak temperature corresponding to the Tm of the amplified product appears. (Table 5). The melting curve, as seen in Figure 3E, shows an increase in fluorescence when the nucleic acid is denatured because the reporter fluorophore is bound to a sequence of cytosines at positions 2, 3, 4 and 6.

TABLE 5

Sample Ct Peak Tm Concentration

Calculated (copies) of Tra

P. falciparum 23, 57005, 87 copies 74.47 ° C

(5xlO ⁴ copies) P. falciparum 29, 12 3846, 54 copies 74.32 ° C

(5x10 copies) P. falciparum 32.83 570, 06 copies 73.81 ° C

(5xlO ² copies) Control without DNA

The results of the amplification fluorescence curves and melting curves match the expected behavior of the reporter fluorophore (in this case 6FAM). When the fluorophore followed by a Guanine sequence is in single strand mode, the fluorescence intensity is blocked, unlike if the fluorophore is followed by a cytosine sequence. Similarly, in double strand mode the fluorescence intensity increases in the case of the fluorophore followed by a Guanine sequence while with a cytosine sequence the fluorescence intensity decreases.

The results obtained indicate that with this With a new probe design, it is possible to quantify nucleic acids and identify different substrate DNAs by means of a melting curve with the same or a different fluorophore without the need to label the probe with a fluorescence shielding molecule (quencher).

EXAMPLE 3

Real-time amplification test followed by a melting curve with two double-headed probes

(a fluorophore or reporter at the 5 'end and a quencher or quencher at the 3' end) and two primers to identify two different substrate DNAs.

The substrate DNAs were different types of

Human papillomavirus: type 6 (GenBank Access # AF092932.1), type 52 (GenBank Access # X74481.1), type 11 (GenBank Access # M14119.1), type 44 (GenBank Access # U31788.1), type 45 ( GenBank Access # X74479.1), type 31 (GenBank Access # J04353.1), type 39 (GenBank Access # M62849.1), type 56 (GenBank Access # X74483.1), type 16 (GenBank Access # K02718.1 ), type 59 (GenBank Access # X77858.1), type 33 (GenBank Access # M12732.1), type 70 (GenBank Access # U21941.1), type 18 (GenBank Access # AY262282.1), type 35 (Access GenBank # M74117.1), type 58 (GenBank Access # D90400.1) and human DNA (GenBank Access # AC104389.8).

The human Papillomavirus detection probe was designed with a double fluorescent marking (5'6FAM - 3'TAMRA), acts as a primer in the amplification reaction and has a tail of 5 nucleotide bases at its 5 'end with 4 cytosines in positions 1,2,3 and 5 that are not complementary to the substrate DNA sequence but are incorporated into the DNA fragment amplified by the DNA polymerase enzyme activity. The probe also shows mismatches in the last two nucleotides of its 3 'end. In this way, the nucleic acid generated in the amplification, through the probe, can undergo a change in fluorescence signal from double strand to single strand, which allows a melting curve to be obtained and an increase in fluorescence when denatured. the specific product amplified. The probe designed as described above was ONlLA (SEQ ID NO: 16, 5 '6FAM-CCCGCTGTCAAAAACCGTTGTGTCCCT-3' TAMRA).

The reverse primer (in the opposite direction to the ONlLA probe) that hybridizes with a conserved region of the most widespread human Papillomavirus types in the world population, was 0N2RA (SEQ ID

NO: 17, 5 '-CCCGCGAGCTGTCGCTTAATTGCTC-3').

The detection probe of a region of the human β-globin gene carries a double fluorescent tide

(5'6FAM-3'TAMRA), acts as a primer in the amplification reaction and shows mismatches in the last two nucleotides of its 3 'end. Within the six nucleotides that follow the nucleotide that carries the reporter fluorophore and that hybridize perfectly with the substrate DNA, there are four guanines in positions 1,2,3 and 6. In this way the nucleic acid generated in the amplification, by means of the probe, you can experience a change in fluorescence signal from double strand to single strand, which allows you to perform a melting curve and obtain a decrease in the fluorescence signal when the specific PCR product is denatured. The probe designed as described above was SGlob (SEQ ID NO: 18, 5'6FAM-GGGCAGTCATTAAGTCAG GCA-3 'TAMRA). The reverse primer (in the opposite direction to the SGlob probe) that hybridizes perfectly (100% homology) with the conserved region of the human β-globin gene was GlobRev (SEQ ID NO: 19, 5 'CATATTCCAAGTTTACTAAG AGC 3') •

The mixture detection- amplification for quantification and identification of Human Papillomavirus oncogenic was performed with the kit Biotools Pfu DNA polymerase III (Biotools), including in O'lU / .mu.l Pfu DNA polymerase mixture of, 0'025U / _μ l Tth DNA polymerase, reaction buffers, 200μM dNTPs, 4mM MgCl2, 0.5M Betaine (adjuvant to increase specificity), 1% Tween, ONlLA probe (0.2 _μM ) and ON2RA primer (0 ' 2um) with a final volume of 20 _μ l reaction.

The amplification mixture for the detection-quantification and identification of β-globin was performed with the Biotools Pfu DNA polymerase IV kit (Biotools), including in the O'lU / μl mixture of Pfu DNA polymerase, 0.025U / μl of Tth DNA polymerase, reaction buffers, 200 _μM dNTPs, 4mM MgCl _2.5 0.5M, 1% Tween, SGlob probe (0.3 _μM ) and GlobRev primer (0.4 _μM ) being the final volume of the reaction of 20μl.

The Real-Time amplification equipment used was the Gene 3000 Rotor, the Gene 6000 Rotor and the 7500 Real Time. The amplification cycles for the two mixtures and subsequent cycles of the curve of

Melting were the following:

Denaturation: 4 min at 95 ° C. 1 cycle Amplification: 5 sec at 97 ° C, 1 sec at 52 ° C, 35 sec at 66 ° C (fluorescence capture channel FAM / Green). 45 cycles

Melting: 20 sec at 70 ⁰ C and Tra ramp at 0.3 ° C / sec from 70 ⁰ C to 88 ⁰ C capturing fluorescence in the FAM channel at each Tra increase.

The amplification graphs where the fluorescence signal in the FAM / Green channel is plotted against the number of cycles, and the graphs of the post-amplification melting curve are shown in Figures 4A, 4B, 4C, 4D, 4E And 4F.

The homology of the ONlLA probe and the reverse ON2RA primer with the types of human Papillomavirus necessary for specific amplification by PCR (> 75% homology), is only fulfilled by the following oncogenic types (indicated from highest to lowest homology): 33 (I), 31 (J), 58 (K), 16 (L), 35 (M), 18 (N) and 52 (0). (Table 6).

TABLE 6

% homology% homology% homology

Sample probe ONlLA primer ON2RA ON1LA / ON2RA

HPV16 Oncogenic 70'5% 87'7% 79'1% L

HPV18 Oncogenic 67'5% 85'6% 76'5% N

HPV31 Oncogenic 78'9% 86'6% 82'7% J

HPV33 Oncogenic 74'3% 91'8% 83'1% I

HPV35 Oncogenic 77'5% 82'1% 79'8% M

HPV39 Oncogenic 73% 72'3% 72'6%

HPV45 Oncogenic 56'8% 82'7% 69'7%

HPV51 Oncogenic 53'4% 77'4% 65'4%

HPV52 Oncogenic 65'3% 86'9% 76'1% O

HPV56 Oncogenic 59'7% 58'9% 59'3%

HPV58 Oncogenic 74'3% 86'9% 80'6% K Continuation-TABLE 6

% homology% homology% homology

Sample probe ONlLA primer 0N2RA 0N1LA / 0N2RA

HPV59 Oncogenic 63'9% 50'6% 57'2%

HPV68 Oncogenic 71'2% 46'5% 58'8%

HPV69 Oncogenic 61'4% 61'3% 61'3%

HPV73 Oncogenic 70'4% 48'3% 59'3%

HPV82 Oncogenic 54'6% 59'8% 57'2%

HPV 6 Non-Oncogenic 60'2% 82'2% 71'2%

Non-Oncogenic HPVl 63'6% 82'2% 72'9%

HPV42 Non-Oncogenic 55% 58'1% 56'5%

HPV43 Non-Oncogenic 51'7% 58'7% 55'2%

HPV44 Non-Oncogenic 66'9% 82'2% 74'5%

HPV54 Non-Oncogenic 59'9% 42'2% 51'1%

HPV61 Non-Oncogenic 48'2% 77'6% 62'9%

HPV70 Non-Oncogenic 71'2% 67% 69'1%

HPV72 Non-Oncogenic 55'5% 76'3% 65'9%

HPV81 Non-Oncogenic 52.3% 77'4% 64'8%

HPV (Human Papilloma Virus)

As seen in Figure 4A, only samples with the substrate DNA of human Papillomavirus (HPV ONC) types 33 (1), 31 (J), 58 (K), 16 (L), 35 ( M), 18 (N) and 52 (0) amplified, while samples with DNA substrate other non - oncogenic human Papillomavirus (HPV NONC) or without DNA after Mues ^¬ substrate (NTC) fail to be amplified. (Table 7).

TABLE 7

Sample Ct Concentration

Calculated (copies)

N = 10 ^(" ° ' ^{247ct + H} - ⁶⁰³⁾

Positive Control 5xl0e5 copies 23.52 638378.52 Positive Control 5xl0e4 copies 28.6 35588.72 Continuation-TABLE 7

Sample Ct Concentration

Calculated (copies)

Positive Control 5xl0e3 copies 32 5160.71

Positive Control 5xl0e2 copies 36.15 489.81

Positive Control 5xl0 copies 40.02 54.42

Control without DNA

Control without DNA2

HPV 6 No Oncogemco

HPV52 Oncogemco 44.76 3.69 O

HPVIl No Oncogemco

HPV44 No Oncogemco

HPV45 Oncogemco

HPV31 Oncogemco 37.23 264.76 J

HPV39 Oncogemco

HPV56 Oncogemco

HPV16 Oncogemco 42.34 14.56 L

HPV59 Oncogemco

HPV33 Oncogemco 31.51 6816.33 I

HPV70 Oncogemco

HPV18 Oncogemco 43, 62 7.04 N

HPV35 Oncogemco 43, 23 8.79 M

HPV58 Oncogemco 37 '84 187.45 K

The melting curve is shown in Figure 4B and the temperature peaks of the twenty-two samples tested are shown in Figure 4C. In the positive control and in the HPC ONC samples that amplify a temperature peak appears that corresponds to the Tm of the specific amplified product. (Table 8). The melting curve, as seen in Figure 4C, shows an increase in fluorescence when the nucleic acid is denatured because the reporter fluorophore is bound to a cytosine tail at positions 1,2,3 and 5.

TABLE

Sample Tm peak of Tra Positive Control 5xl0e5 copies 81 '18 ° C

Positive Control 5xl0e4 copies 81 '12 ° C Positive Control 5xl0e3 copies 81' 18 ° C Positive Control 5xl0e2 copies 81 '18 ° C Positive Control 5xl0the copies 81'24 ° C HPV52 Oncogenic 81' 09 ⁰ CO

HPV31 Oncogenic 81'33 ° C J HPV16 Oncogenic 81 '6 ° C L HPV33 Oncogenic 81'39 ° C I HPV18 Oncogenic 81'39 ° C N HPV35 Oncogenic 81'47 ° C M

HPV58 Oncogenic 81'57 ° C K

Figure 4D shows the amplification of a region of the β-globin gene of the same substrate DNA that includes the different types of human Papillomavirus that in turn contain cellular genomic DNA from the extraction-purification of each sample and where its amplifications are similar to the amplification of the Positive Control 5 x 10e4 copies (βG2). (Table 9). TABLE 9

Sample Ct Concentration

Calculated (copies) r 1 _ 20 <- ° - ^247ct + H.603 ⁾ Positive Control 5xl0e5 copies 28, 77 595950.93 βGl

Positive Control 5xl0e4 copies 35, 3 33671.71 βG2

Positive Control 5xl0e3 copies 39, 03 6511.16 βG3

Positive Control 5xl0e2 copies 44, 95 478.35 βG4 Control without DNA - - βG5 Continuation-TABLE 9

Sample Ct Concentration

Calculated (copies) r i _ -, η (-0.247Ct + 11, 603) Control without DNA2 βG6

The melting curve is observed in Figure 4E and the temperature peaks after amplification of the β-globin gene region of the human Papillomavirus substrate DNAs are shown in Figure 4F. In all the samples a temperature peak appears like that of the Positive Control. The melting curve, as seen in Figure 4E, shows a decrease in fluorescence when the nucleic acid is denatured because the reporter fluorophore is attached to a guanine sequence at positions 1,2,3 and 6. (Table 10 ). TABLE 10

Sample Tm peak of Tra Positive Control 5xl0e5 copies 79 '06 ⁰ C βGl

Positive Control 5xl0e4 copies 79 '06 ⁰ C βG2

Positive Control 5xl0e3 copies 79 '06 ⁰ C βG3

Positive Control 5xl0e2 copies 79 ° C βG4

Control without βG5 DNA Control without DNA2 βG6

The results of the amplification of human Papillomavirus types: 33, 31, 58, 16, 35, 18 and 52 are consistent with the highest homology percentages of the ONlLA probe and the ON2RA primer. In turn, the results of the amplification of a conserved region of the β-globin gene in each substrate DNA indicates that the extraction from the same volume of blood was very homogeneous because they had similar quantifications all the samples.

The results of the melting curve in both amplifications agree perfectly with the specific products obtained. It is also observed the different behavior of the fluorescence signal of the melting curves according to whether the reporter fluorophore (in this case 6FAM), which is incorporated into the amplified product, is followed by a guanine sequence (β-globin - negative curve) or a cytosine sequence (HPV - positive curve).

The results obtained indicate that with the new probe design it is possible to quantify nucleic acids and specifically discriminate similar DNA substrate by the homology of the hybridization sequence. In turn, the analysis is improved to rule out false positives due to amplification of non-specific products or possible contamination.

EXAMPLE 4

Real-time amplification test with probes

LIONPROBRES ™ designed as described in the present invention in order to identify possible nonspecific products generated in the amplification, by means of a melting curve.

The Lion probe tested carries a double fluorescent tide (5 '6FAM-3' TAMRA), acts as a primer in the amplification reaction and has mismatches in the last two nucleotides of its 3 'end. Within the six nucleotides that follow the nuleotide that has the reporter attached, there are three Gs in positions 1,2,5 and two Cs in positions 3,6. In this way the nucleic acid generated in the amplification, by means of the Lion probe I tested, you can experience a change in fluorescence signal from double strand to single strand.

The substrate DNA was the same conserved region of three Plasmodium species: P. falciparum (Access GenBank # M19172), P.malariae (Access GenBank # M54897) and P. ovale (Access GenBank # L48987)

The reverse primer (in the opposite direction) that hybridizes perfectly (100% homology) with the conserved region of the three Plasmodium species was Plasm-rev2 (SEQ ID NO: 2).

The LIONPROBRES ™ probe designed as described above was Plasmprobe (SEQ ID NO: 1).

The amplification mixture was performed with the Biotools Pfu DNA polymerase kit (Biotools), including in the O'lU / μl mixture of Pfu DNA polymerase, reaction buffers, 200μM dNTPs, 4mM MgCl2, Plasmprobe probe (0.2μM) and Plasmrev2 primer (0.3 µM) being the final reaction volume of 20μl.

The amplification of the three Plasmodium species with an amount of approximately 500,000 copies was tested with the same mixture, as well as three controls without substrate DNA.

The Real-Time amplification equipment used was the Gene 3000 Rotor. The amplification cycles and subsequent melting curve cycles were as follows:

Denaturation: 4 min at 95 ° C. 1 cycle Amplification: 5 sec at 97 ° C, 30 sec at 58 ° C (fluorescence capture FAM channel), 50 sec at 72 ° C. 55 cycles, (the number of cycles is high to cause the amplification of nonspecific products or commodities)

Melting: 30 sec at 65 ° C and Tra ramp of 0.4 ° C / sec from 65 ° C to 99 ° C capturing fluorescence in the FAM channel at each Tra increase.

The amplification graphs where the fluorescence signal in the FAM channel is plotted against the number of cycles, the graph of the melting curve after amplification and the results of the amplified products analyzed in a stained 2% agarose gel with Ethidium Bromide are shown in Figures 5A and 5B.

As seen in Figure 5A, samples with the substrate DNA of each Plasmodium species begin to amplify between cycles 15 and 25 (Ct), while samples without substrate DNA amplify unspecific products or contamination from cycle 40. (Table 11).

TABLE 11

Sample Ct

Plasmodium falciparum 22 '88 P Plasmodium malaπae 17' 7 Q

Plasmodium ovale 15 '56 R

Control without DNA 45 '72 S

Control without DNA2 45 '23 T

Control without DNA3 42 '66 U The melting curve converted to temperature peaks of the six samples tested is shown in Figure 5B. In samples without DNA a peak of lower temperature appears than in samples with substrate DNA corresponding to the amplified nonspecific nucleic acid. The Control without DNA3 (represented by dashed line in FIG. 5B) has the two temperature peaks which means that it has suffered contamination by the substrate DNA. The Tm of the specific nucleic acid amplified from the substrate DNA is approximately 3 ° C greater than the Tm of the non-specific product. (Table 12).

TABLE 12

Product size Tm predicted Tm peak

Tra AlIeIeID 2.0 amplified sample

Plasmodium falciparum llδpb 82 '1 ⁰ C 79' 12 ⁰ C

Plasmodium malaπae llδpb 82 '1 ⁰ C 79' 68 ⁰ C

Plasmodium ovale llδpb 82 '1 ⁰ C 79' 4 ⁰ C

Control without cDNA - - 76 '08 ⁰ C

Control without DNA2 - - 76 '08 ⁰ C

Control without DNA3 - - 76O8 / 79 '68 ⁰ C

Base pairs (bp)

The results of the melting curve are consistent with the analysis of the 2% agarose gel stained with Ethidium Bromide as seen in FIG. 5A. The presence in the gel of the amplification bands of llβpb in the first three samples with substrate DNA (P, Q, R) is consistent with the size expected in the amplification. The amplification bands of approximately 80 bp in the gel belong to the nonspecific products of the Control samples without DNA (S, T). The last lane of the gel corresponds to the Control without DNA3 (U) and two amplification bands can be observed, one corresponding to the nonspecific product and the other band to contamination with the substrate DNA. This confirms the results shown in the melting curve.

The results obtained indicate that the new design of the LIONPROBES ™ probes improves the analysis to rule out false positives due to amplification of non-specific products or possible contamination.

EXAMPLE 5

Real-time amplification assay followed by a melting curve with a LIONPROBES ™ probe and a primer to identify two substrate DNAs whose internal amplified sequences are different

The substrate DNAs were two species of Plasmodium: P. falciparum (Access GenBank # M19172) and P.malariae (Access GenBank # M54897).

The LIONPROBES ™ probe was the same as in the

Example 2 (Plasmprobe) with all its properties described above.

The primer was Malrev2 (SEQ ID NO: 20, 5'-TGCTGGC ACCAGACTTGCCCTCCA-3 '). The primer (with polarity opposite the probe) hybridizes perfectly (100% homology) with the two Plasmodium species.

The amplification mixture was performed with the Biotools Pfu DNA polymerase kit (Biotools), including in the O'lU / μl mixture of Pfu DNA polymerase, reaction buffers, 200μM dNTPs, 4mM MgCl2, Plasmprobe probe (0.2μM) and Malrev2 primer (0.3μM), the final reaction volume being 20μl.

The amplification of the two Plasmodium species with an amount of approximately 500,000 copies was tested with the same mixture, as well as a control without substrate DNA.

Denaturation: 4 min at 95 ° C. 1 cycle Amplification: 5 sec at 97 ° C, 80 sec at 67 ° C (fluorescence capture FAM channel). 30 cycles Melting: 30 sec at 75 ° C and Tra ramp

0.4 ° C / sec from 75 ° C to 90 ⁰ C capturing fluorescence in the FAM channel in each increment of Tra.

The amplification graphs where the fluorescence signal in the FAM channel is plotted against the number of cycles and the graph of the post-amplification melting curve are shown in Figures 6A and 6B respectively.

As seen in Figure 6A, samples with the substrate DNA of each Plasmodium species begin to amplify between cycles 10 and 20: P.falciparum (Ct: 16 '45) (W) and P.malariae (Ct: 13 '22) (V). The Control without DNA (X) sample does not show an increase in amplification fluorescence

Figure 6B shows the melting curve converted to temperature peaks of the three samples tested. The peak temperature of the sample with P substrate DNA. falciparum is approximately 1 ° C less than the sample with DNA substrate of P.malariae. These results are due to the different content of G + C and the size amplified with each Plasmodium species. The Control without DNZ sample has no temperature peak that matches the amplification results. (Table 13).

TABLE 13

Product size Content Tm predicted Tm peak

Amplified sample G + C AlIeIeID 2.0 from Tra

P. falciparum 151pb 42'76% 85'2 ° C 81 '15 ⁰ CWP .malariae 150pb 43'33% 85'8 ° C 82'14 ⁰ CV Control without DNA X

Base pairs (bp)

The results obtained indicate that with the new design of the LIONPROBRES ™ probes it is possible to identify substrate DNAs that differ in size and / or in G + C content in a direct way (a single amplification with a LIONPROBES ™ probe and a primer).

EXAMPLE 6

Real-time amplification assay of a conserved region of several substrate DNAs followed by a second amplification and a melting curve for the identification of a specific substrate DNA. The substrate DNAs were three species of Plasmodium: P. falciparum (Access GenBank # 1419172), P.malariae (Access GenBank # M54897) and P. ovale (Access GenBank # L48987).

The Lion probe used in the first amplification for the quantification and detection of the conserved area of Plasmodium was Pprobe2 (SEQ ID NO: 21, 5'VIC-GGGTATTGGCCTAACATGGCTATGACGGGCT-S 'TAMRA).

The last two bases of the 3 'end of the probe are not homologous to the substrate DNA so the enzyme with 3' -5 'error-correcting exonuclease activity releases the mismatched bases and the quencher (TAMRA) so that the reporter (VIC) can emit fluorescence in each amplification cycle at the same time that the nucleic acid is generated in the PCR.

The primer with polarity opposite to the Lion probe tested Pprobe2 used in the first amplification for the quantification and detection of the conserved zone of

Plasmodium, was Malrev2. This primer has 100% homology with the substrate DNA.

In the second amplification the substrate DNAs were those produced in the first amplification. A labeled oligonucleotide and a primer with opposite polarity were used for amplification. The labeled oligonucleotide was FaIMLFl (SEQ ID NO: 6) which has the 6FAM molecule labeled at its 5 'end and has a 100% homology with the substrate DNAs produced in the first amplification that come from the three Plasmodium species. The primer was Mrev3 (SEQ ID NO: 7) which is only 100% homologous with the P substrate DNA. falciparum The mutations of the primer with the others Substrate DNAs are located in the middle or near the 5 'end of the primer sequence so that the enzyme with 3'-5' error-correcting exonuclease activity cannot release the mismatched bases and there is no amplification in this way to unless there is substrate DNA of P. falciparum

The Tm of the probes and primers are different so that the two amplifications can develop consecutively with different temperature cycles. Also the sizes of the nucleic acids obtained in each amplification are different, the product of the second amplification being smaller than that of the first amplification, which allows the incubation times at the temperatures of the steps of the second amplification to be minors (Table 14)

TABLE 14

Tm Primer Probe - Tm Primer Expected Size

Pprobe2 Malrev2 67'1 ° C 68'1 ° C 243pb FaIMLFl Mrev3 49'8 ° C 50'1 ⁰ C lOlpb

Base pairs (bp)

The amplification mixture was performed with the Biotools Pfu DNA polymerase II kit (Biotools), including in the O'lU / μl mixture of Pfu DNA polymerase, reaction buffers, 200 _μM dNTPs, 4mM MgCl ₂ , 1 '25M Betaine (adjuvant to increase specificity), Pprobe2 probe (0.2 _μM ), Malrev2 primer (0.3 _μM ), FaIMLFl probe (0.3 _μM ) and Mrev3 primer (0.3 μM) being the final volume of the reaction of 20μl.

With the same mixture, the amplification of the three Plasmodium species was tested with a quantity of Approximately 500,000 copies, as well as a control without substrate DNA.

Denaturation: 5 min at 95 ° C. 1 cycle Amplification I: 5 sec at 97 ° C, 60 sec at 68 ° C

(fluorescence capture JOE channel). 30 cycles Amplification II: 5 sec at 90 ⁰ C, 5 sec at 53 ° C,

20 sec at 62 ° C. 10 cycles Melting: 30 sec at 70 ⁰ C and Tra ramp

0.4 ° C / sec from 70 ⁰ C to 99 ° C capturing fluorescence in the FAM channel in each increment of Tra.

The graph of the first amplification where the fluorescence signal in the JOE channel is plotted against the number of cycles and the graph of the melting curve in the FAM channel after the second amplification are shown in Figures 7A and 7B regarding - tively.

As seen in Figure 7A, samples with the three substrate DNAs of each Plasmodium species begin to amplify between cycles 10 and 20 of the first amplification: P. falciparum (Ct: 18 '81) (α), P.malariae (Ct: 13'42) (Z) and P. ovale (Ct: 11' 32) (Y). The Control sample without DNA (β) does not show an increase in fluorescence in the amplification.

The Melting curve is shown in Figure 7B converted to temperature peaks after the second amplification of the four samples tested. Only in the sample with DNA substrate of P. falciparum (α) a temperature peak appears confirming the specificity of the Mrev3 primer with P. falciparum and not with the other Plasmodium species. The expected Tm of the lOlpb product generated in the second amplification from P DNA. falciparum is 81.9 ° C and the Tm obtained from the melting curve is 77.6 ° C.

The results of the Real-time amplification and the melting curve agree with the analysis of the 2% agarose gel stained with Ethidium Bromide as seen on the right of Figure 7B. The presence in the gel of the 243 bp band with the three Plasmodium substrate DNAs is consistent with the expected size at the first amplification of a conserved Plasmodium region. The lOlpb band that only appears in the sample with P substrate DNA. falciparum (first lane of the gel after the lOOpb marker) matches the expected size in the second amplification of a specific region of P. falciparum and with the results of the melting curve. The last lane corresponds to the Control without DNA where amplification has not occurred so no bands are observed in the gel.

The results obtained indicate that it is possible to detect and quantify different substrate DNAs that have common conserved regions in their genome by means of a LIONPROBES ™ probe and a primer. In addition, also with the use of labeled oligonucleotides, designed as described in the present invention and an additional primer, it is possible to identify a substrate DNA specifically from the amplification of a common conserved region of different substrate DNAs by A second amplification and a melting curve.

EXAMPLE 7

Real-time amplification assay of a common gene of several substrate DNAs with specific internal mutations in the sequence of each, followed by a second amplification and a melting curve for the identification of each specific mutation and its position.

The substrate DNAs were five species of Mycobacterium tuberculosis: plasmid with unmodified rpoβ gene (prpo-WT), plasmid with Asp516Val mutation within the rpoβ gene (prpo-516), plasmid with His526Asp mutation within the rpoβ gene (prpo-526A), His526Tyr mutation plasmid within the rpoβ gene (prpo-526T) and Ser531Leu mutation plasmid (prpo-531) within the rpoβ gene. Fragments of the rpoβ gene inserted in the PCR 2.1 TOPO vector (Invitrogen) in each case are shown in Figures 8. FIG. 8A represents the sequence of the prpo-WT insert (SEQ ID NO. 31). FIG. 8B shows the mutation of an adenine (A) by a thymine (T) in the prpo-516 insert (SEQ ID NO. 32). In the sequence of FIG. 8C (SEQ ID NO. 33) there are two mutations, a change of a T for a cytosine (C) corresponding to the insert of prpo-526T and a change of a guanine (G) for a C which is the insert of prpo-526A. Finally, the sequence of FIG. 8D (SEQ ID NO. 34) contains a mutation of a T by a C belonging to the insert of prpo-531. These mutations within the genome of the Mycobacterium tuberculosis bacterium confer resistance against an antibiotic called rifampin. The LIONPROBES ™ probe used in the first amplification for the quantification and detection of the rpoβ gene fragment of all the plasmids described above was TBS (SEQ ID NO: 22.5 'VIC-AGGAGTTCTTCGG CACCAGCCCA-3' TAMRA). The penultimate base of the 3 'end of the probe is not homologous to the substrate DNAs, so the enzyme with 3' -5 'error-correcting exonuclease activity releases the mismatched bases and the quencher (TAMRA) with which the reporter (VIC) it can emit fluorescence in each amplification cycle at the same time that the nucleic acid is generated in the PCR.

The primer with polarity opposite to the LIONPROBES ™ TBS probe used in the first amplification for quantification and detection of the rpoβ gene fragment was TBR (SEQ ID NO: 23.5 '-TGCACGTCGCGGACCTCCA-3'). This primer has 100% homology with the substrate DNAs.

In the second amplification the substrate DNAs were those produced in the first amplification. A labeled oligonucleotide and primers with opposite polarity were used for amplification. The labeled oligonucleotide was rpoMLF2 (SEQ ID NO: 10) which has the 6FAM molecule labeled at its 5 'end and has a 100% homology with the substrate DNAs produced in the first amplification that come from the five plasmids. The primers were: 516R (SEQ ID NO: 24, 5'- GGTTGTTCTGGACCATG-3 ') which is only 100% homologous with the prpo-516 plasmid, 526Rl (SEQ ID NO: 25, 5'- CGCTTGTAGGTCAACC-3' ) that it is only 100% homologous with plasmid prpo-526T, 526R2 (SEQ ID NO: 26, 5'-CGCTTGTCGGTC AACC-3 ') that is only 100% homologous with plasmid prpo-526A and 531R (SEQ ID NO: 11) which is only 100% homologous with the prpo-531 plasmid. Mutations with other substrate DNAs are located in the middle or near the 5 'end of the primer sequence, in this way the enzyme with 3'-5' error-correcting exonuclease activity cannot release the unpaired base and there is no amplification unless there is DNA substrate with sequence complementary to the primer with 100% homology.

The Tm of the probes and primers are different so that the two amplifications can develop consecutively with different temperature cycles. Also the sizes of the nucleic acids obtained in each amplification are different, the products of the second amplification being smaller than that of the first amplification which allows the incubation times at the temperatures of the second amplification steps to be smaller. . (Table 15).

TABLE 15

Tm Primer Probe - Tm Primer Expected Size

TBS TBR 63 '5 ° C 63'3 ° C 145pb rpoMLF2 516R 50' 8 ° C 48'2 ° C 34pb rpoMLF2 526Rl 50 '8 ° C 47'3 ° C 59pb rpoMLF2 526R2 50' 8 ° C 48'5 ° C 59pb rpoMLF2 531 50 '8 ° C 50 ⁰ C 76pb

Base pairs (bp)

The amplification mixture was performed with the Biotools Pfu DNA polymerase II kit (Biotools), including in the 0'lU / μl mixture of Pfu DNA polymerase, reaction buffers, 200 _μM dNTPs, 4mM MgCl ₂ , 1 '25M Betaine, TBS probe (0.2 _μM ), TBR primer (0.3 _μM ), rpoMLF2 probe (0.3 _μM ), 516R primer (0.3 _μM ), 526Rl primer (0' 3 _μ M), primer 526R2 (0.3 _μ M) and primer 531R (0.3 _μ M) with a final volume of 20 _μ l reaction. With the same mixture the amplifications of the five plasmids (prpo) with an amount of approximately 50,000 copies were tested, as well as a control without substrate DNA.

Denaturation: 4 min at 95 ° C. 1 cycle Amplification I: 5 sec at 97 ° C, 20 sec at 62 ° C, 40 sec at 70 ⁰ C (fluorescence capture in JOE channel). 35 cycles

Amplification II: 5 sec at 97 ° C, 5 sec at 52 ° C,

25 sec at 62 ° C. 10 cycles

The graph of the first amplification where the fluorescence signal in the JOE channel is plotted against the number of cycles and the graph of the melting curve in the FAM channel after the second amplification are shown in Figures 9A and 9B respectively .

As seen in Figure 9A, samples with the five substrate DNAs of each corresponding plasmid begin to amplify between cycles 10 and 27. The Control sample without DNA does not show increased fluorescence in amplification. (Table 16). TABLE 16

Sample Ct prpo-516 22 '6 (ζ) prpo-526T 15' 39 (ε) prpo-526A 26 '37 (η) prpo-531 10' 15 (Y) prpo-WT 10 '64 (δ)

Control without DNA --- (θ)

The melting curve converted to temperature peaks after the second amplification of the six samples tested is shown in Figure 9B. Three different temperature peaks appear as a result of the amplification of nucleic acids of different sizes and variable G + C content according to the substrate DNA (plasmid) used. (Table 17).

TABLE 17

Product size Content Tm predicted Tm peak

Amplified sample G + C AlIeID 2.0 of Tra prpo-516 34pb 52'94% 80'2 ⁰ C 78 '82 ⁰ C ζ prpo-526T 59pb 57'63% 86'1 ° C 83 '02 ⁰ C ε prpo-526A 59pb 59'32% 86'6 ° C 83'08 ⁰ C η prpo-531 76pb 61'84% 88'8 ° C 85 '48 ⁰ C and prpo-WT - - δ

Base pairs (bp)

The results of the melting curve agree with the specific identification of the samples tested. The primers only amplify the specific plasmid whose sequence is completely complementary to the primer sequence. In this way each primer amplifies only in the presence of the specific plasmid generating different PCR products according to the plasmid used as substrate DNA. These PCR products and consequently the plasmids tested can be identified by their Tm.

The results obtained indicate that by amplifying a specific region of several substrate DNAs that contain common external sequences, it is possible to identify internal mutations, point changes or SNPs (single nucleotide polymorphisms) in the sequence, specific to each substrate DNA , through a second amplification and a melting curve using labeled oligonucleotides designed as described in the present invention, and primers homologous in sequence to each mutation to be identified. Each amplified substrate DNA that has a mutation recognized by one of the primers can be differentiated according to the temperature peak obtained in the melting curve.

Claims

I ^a .- Method for the detection and / or quantification of at least one substrate nucleic acid, target, in a sample, characterized in that: or the substrate nucleic acid (s) is contacted on a support / s with at least:

_• a primer, forward or reverse, marked with a emitting fluorophore at the 5 'end, and having at least three G bases or three C bases at the six nucleotides that follow the base marked with the emitting fluorophore,

_• a primer with opposite polarity • an enzyme with DNA polymerase activity

or the previous mixture is amplified

or the change in the fluorescence signal is detected and / or measured due to the accumulation of amplified nucleic acid fragments in a double-chain state where the emitting fluorophore and the sequence of G or C have been incorporated, the difference in fluorescence will be positive , increase, when the double stranded amplified nucleic acid fragments include the guanine sequence; and the fluorescence difference will be negative, a decrease, when the double stranded amplified nucleic acid fragments include the cytosine sequence

2 .- A method according ^to claim I wherein the nucleic acid substrate target in a sample comes from a previous amplification occurs consecutively or sequentially in the same carrier detection and / or quantification and wherein the primers used in prior amplification will be of longer length of nucleotide bases and / or greater content in G / C bases

3 .- A method according ^to claim I charac- terized to 2 because the labeled primer an emitter fluorophore on the 5 'end has one or more bases unpaired at the 3' end of the chain, or adjacent bases relative to DNA substrate with which it hybridizes, and that these bases are cleaved and corrected by an enzyme with 3'-5 'nuclease activity

4 .- A method according ^to claim 3 wherein the labeled primer an emitter fluorophore on the 5 'end is labeled at the 3' end with a quencher fluorescence quencher

5 .- A method according ^to claim 3 wherein the step of contacting includes additionally an oligonucleotide labeled with a quencher at the 3 'end and having perfect complementarity to the 3' end of primer labeled with the fluorophore emitter the 5 'end which prevents degradation of the latter by the 3' -5 'nuclease activity and shields the fluorescence of the emitting fluorophore

6 .- method according ^to claim 5 wherein the primer labeled with a fluorophore at the 5 'and / or a quencher labeled oligonucleotide at the 3' and perfect complementarity modifications at the junction of its bases by links non-phosphodiester and / or inclusion of analog bases and / or spacers

7 ^a .- Method according to claim I ^a to 6 ^a , characterized in that the fluorophore labeled primer The emitter at the 5 'end has a tail of G or C bases at its 5' end that are not complementary to the substrate DNA sequence but are incorporated into the DNA fragment amplified by the DNA polymerase activity.

8 .- method according ^to claim I to 7 wherein the difference of fluorescence detected and / or measured is directly proportional to the amount of amplified DNA substrate

9 .- method according claim 8 characterized in that it includes a step after the amplification step of analysis of denaturation curves, "melting curves" of the amplified nucleic acids or amplified nucleic acid, this analysis is performed measuring the change of the fluorescence signal from the emitting fluorophore incorporated in the different previously amplified DNA fragments, when they pass from double stranded to single stranded or vice versa

10 .- Method according ^to claim 9 wherein a plural number of nucleic acid substrate target are detected, quantified and identified by analysis of denaturation curves simultaneously by selection of corresponding primers wherein at least one of them for each target nucleic acid is labeled at the 5 'end with emitting fluorophores that emit at different wavelengths

11 .- Method according ^to claim 9 wherein a plural number of nucleic acid substrate (target) are detected and identified by analysis of the denaturation curves simultaneously by selecting the corresponding primers where at least one of them for each target nucleic acid is labeled at the 5 'end with the same fluorophore

12 .- Method according to claim 11 wherein each of the primers labeled at the 5'end with the same fluorophore have sequences G or C adjacent the 5 'end, the denaturation curves of amplified DNA fragments where there Once the G sequence is incorporated, it will be negative and in the case of cytosines it will be positive

13 .- Method according to claim 9 wherein a plural number of nucleic acid substrate target are detected and identified by analysis of the denaturation curves simultaneously by selection of corresponding primers where one of them is common for the minus two target nucleic acids and is labeled with a emitting fluorophore at its 5 'end

14 .- Method according ^to claim I to 13 wherein the / the substrate nucleic acid is / origin in biological samples animal or vegetable cell cultures, food, water samples, soil or air

15 .- A kit for the detection, quantitation and identification of one or more nucleic acids in a sample comprising the primers used in the two method- of claims I ^to 14 and a DNA polymerase ^to activity or enzyme mixture having such activity plus 3 '-5' nuclease activity

16 .- A kit according ^to claim 15 wherein the primers detect target viral nucleic acids 17 .- The kit according ^to claim 16 wherein the viral target nucleic acid is a human oncogenic Papillomavi- rus.