WO2010011697A1 - Structural variants of antibodies for improved therapeutic characteristics - Google Patents

Structural variants of antibodies for improved therapeutic characteristics Download PDF

Info

Publication number
WO2010011697A1
WO2010011697A1 PCT/US2009/051321 US2009051321W WO2010011697A1 WO 2010011697 A1 WO2010011697 A1 WO 2010011697A1 US 2009051321 W US2009051321 W US 2009051321W WO 2010011697 A1 WO2010011697 A1 WO 2010011697A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
fragment
veltuzumab
humanized
substituted
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/051321
Other languages
English (en)
French (fr)
Inventor
David M. Goldenberg
Chien-Hsing Chang
Hans J. Hansen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Immunomedics Inc
Original Assignee
Immunomedics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BRPI0917204A priority Critical patent/BRPI0917204A2/pt
Priority to JP2011520147A priority patent/JP6049163B2/ja
Priority to AU2009274129A priority patent/AU2009274129B2/en
Priority to EP09800909.5A priority patent/EP2318048B1/en
Priority to CN200980136900.6A priority patent/CN102159243B/zh
Priority to EA201100228A priority patent/EA201100228A1/ru
Priority to CA2731255A priority patent/CA2731255C/en
Priority to MX2011000891A priority patent/MX2011000891A/es
Priority to UAA201101684A priority patent/UA108735C2/uk
Priority to HK11109726.9A priority patent/HK1155388B/xx
Application filed by Immunomedics Inc filed Critical Immunomedics Inc
Priority to NZ590330A priority patent/NZ590330A/xx
Publication of WO2010011697A1 publication Critical patent/WO2010011697A1/en
Priority to IL210307A priority patent/IL210307B/en
Priority to ZA2011/00013A priority patent/ZA201100013B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/734Complement-dependent cytotoxicity [CDC]

Definitions

  • the present invention relates to structural variants of anti-CD20 antibodies and/or antigen binding fragments thereof, preferably involving the amino acid sequences of complementarity-determining regions (CDRs), with improved therapeutic characteristics.
  • the structural variation may comprise changes to the third CDR sequence of the antibody heavy chain (CDRH3), for example substitution of an aspartate residue for an asparagine residue at Kabat position 101.
  • the structural variation may comprise an arginine residue at Kabat position 94, which may form a salt bridge with an aspartate at Kabat position 101.
  • the structural variation may comprise a valine residue at Kabat position 102.
  • Such structural variants may provide improved efficacy for diseases related to proliferation of B-cells, such as B-cell leukemias, lymphomas or autoimmune diseases, as well as other immune diseases implicating B-cells.
  • the improved efficacy may allow administration of low dosages of anti-CD20 antibody or antigen binding fragment thereof, such as 80 mg or less, more preferably 50 mg or less, most preferably 30 mg or less, which may be administered two or more times about one to three weeks apart, or even two or more times weekly.
  • the anti-CD20 antibody may be a humanized, chimeric or human anti-CD20 antibody, particularly a monoclonal antibody (MAb).
  • MAb monoclonal antibody
  • Other embodiments may concern therapeutic and/or diagnostic conjugates of humanized, chimeric or human anti-CD20 antibodies and methods of treating B-cell lymphomas and leukemias and various autoimmune diseases, for example using humanized, chimeric or human anti-CD20 antibodies.
  • Still other embodiments may relate to antibody fusion proteins or antigen binding fragments thereof comprising at least one anti-CD20 MAb or antigen binding fragment thereof, in some cases in combination with a second, different antibody, especially anti-CD20 antibody, preferably anti- CD20 MAb, or antigen binding fragment thereof.
  • the humanized, chimeric or human MAb s, antigen binding fragments thereof or antibody fusion proteins may be administered alone, as a therapeutic immunoconjugate or in combination with one or more therapeutic agents, with other naked antibodies or other immunoconjugates. Still other embodiments relate to DNA sequences encoding humanized, chimeric or human anti-CD20 antibodies and antibody fusion proteins, vectors and host cells containing the DNA sequences, and methods of making the humanized, chimeric or human anti-CD20 antibodies.
  • the immune system of vertebrates consists of a number of organs and cell types which have evolved to accurately recognize foreign antigens, specifically bind to, and eliminate/destroy such foreign antigens.
  • Lymphocytes amongst others, are critical to the immune system. Lymphocytes are divided into two major sub-populations, T cells and B cells. Although inter-dependent, T cells are largely responsible for cell-mediated immunity and B -cells are largely responsible for antibody production (humoral immunity).
  • each B -cell can produce an enormous number of antibody molecules. Such antibody production typically ceases (or substantially decreases) when a foreign antigen has been neutralized.
  • B-cell lymphomas such as the B-cell subtype of non-Hodgkin's lymphoma
  • B-cell lymphomas are significant contributors to cancer mortality.
  • the response of B-cell malignancies to various forms of treatment is mixed. For example, in cases in which adequate clinical staging of non- Hodgkin's lymphoma is possible, field radiation therapy can provide satisfactory treatment. Still, about one-half of the patients die from the disease. Devesa et ah, J. Nat. Cancer Inst. 79:701 (1987).
  • B-cell antigens on these B-cell malignancies makes them optimal targets for therapy with unconjugated B-cell antibodies, such as against CD 19, CD20, CD21, CD23, and CD22 markers on B-cells.
  • HLA-DR, CD30, CD37, CD40, CD45, CD70, CD79a, and other antigens may serve as targets for normal and malignant B-cells, although they are also expressed on other cell types.
  • MUCl, MUC2, MUC3, and MUC4 antigens are also expressed in different hematopoietic malignancies, including B-cell tumors expressing CD20 and other B- cell markers.
  • ILGF insulin-like growth factors
  • MIF macrophage migration-inhibitory factor
  • antigen targets such as those associated with the vascular endothelium of tumors, including tenascin, vascular endothelium growth factor receptor (VEGFR), and placental growth factor (PlGF), as well as other categories of antigens associated with B-cell malignancies, such as oncogene products (cMET, Kras, bcl-2, bcl-6), are also suitable targets for therapeutic antibodies.
  • B-cells comprise cell surface proteins which can be utilized as markers for differentiation and identification.
  • One such human B-cell marker is the human B lymphocyte-restricted differentiation antigen, Bp35, referred to as CD20.
  • CD20 is expressed during early pre-B-cell development and remains until plasma cell differentiation. CD20 is expressed on both normal B cells and malignant B cells whose abnormal growth can lead to B-cell lymphomas and leukemias. Antibodies against the CD20 antigen have been investigated for the therapy of B-cell lymphomas and leukemias.
  • a chimeric anti-CD20 antibody designated as "IDEC-c2B8" (rituximab)
  • IDEC-c2B8 a chimeric anti-CD20 antibody
  • rituximab has activity against B-cell lymphomas when provided as unconjugated antibodies at repeated injections of doses exceeding 500 mg per injection.
  • About 50 percent of non-Hodgkin's patients, having the low-grade indolent form, treated with this regimen showed responses.
  • Therapeutic responses have also been obtained using 131 I-labeled Bl (tositumomab) anti-CD20 murine monoclonal antibody when provided as repeated doses with pretreatment of unlabeled antibodies exceeding 600 mg per injection.
  • non-human monoclonal antibodies typically lack human effector functionality, i.e., they are unable to mediate complement- dependent lysis or lyse human target cells through antibody-dependent cellular toxicity or Fc- receptor mediated phagocytosis.
  • non-human monoclonal antibodies can be recognized by the human host as a foreign protein and, therefore, repeated injections of such foreign antibodies can lead to the induction of immune responses leading to harmful hypersensitivity reactions.
  • HAMA Human Anti-Mouse Antibody
  • Chimeric antibodies are antibodies which comprise portions from two or more different species.
  • Liu, A. Y. et al "Production of a Mouse-Human Chimeric Monoclonal Antibody to CD20 with Potent Fc-Dependent Biologic Activity" J. Immunol. 139/10:3521-3526 (1987), describe a mouse/human chimeric antibody directed against the CD20 antigen. See also, PCT Publication No. WO 88/04936.
  • An exemplary chimeric antibody would comprise mouse variable region sequences attached to human antibody constant region sequences.
  • humanized antibodies are even more preferred, in order to further reduce the possibility of inducing a HAMA reaction.
  • techniques for humanization of murine antibodies by replacing murine framework and constant region sequences with corresponding human antibody framework and constant region sequences are well known in the art and have been applied to numerous murine anti-cancer antibodies.
  • Antibody humanization may also involve the substitution of one or more human framework amino acid residues with the corresponding residues from the parent murine framework region sequences.
  • Another approach that has improved the ability of antibodies to be effective in the treatment of B-cell disorders has been to conjugate a therapeutic agent, such as a radioactive or chemotherapeutic agent to the antibody, such that the agent is localized at the tumor site.
  • a therapeutic agent such as a radioactive or chemotherapeutic agent
  • the above-referenced 1F5 antibody and other B-cell antibodies have been labeled with 131 I and were evaluated for biodistribution in two patients. See Eary, J. F. et al., "Imaging and Treatment of B-CeIl Lymphoma" /. Nuc. Med. 31/8:1257-1268 (1990); see also, Press, O. W.
  • NEJM 329/7:459 (1993) 131 I-labeled anti-CD20 antibody Bl
  • PCT published application WO 92/07466 antibodies conjugated to chemotherapeutic agents such as doxorubicin or mitomycin.
  • these approaches have not eliminated the obstacles associated with using murine antibodies, despite the fact that many patients with lymphoma who have received prior aggressive cytotoxic chemotherapy are immune suppressed, thus having lower HAMA rates than lymphoma patients who have not been heavily pretreated.
  • Autoimmune diseases are a class of diseases associated with B-cell disorders.
  • Examples comprise acute idiopathic thrombocytopenic purpura, chronic idiopathic thrombocytopenic purpura, dermatomyositis, Sydenham's chorea, myasthenia gravis, systemic lupus erythematosus, lupus nephritis, rheumatic fever, polyglandular syndromes, bullous pemphigoid, Type-I diabetes mellitus, Henoch-Sch ⁇ nlein purpura, post-streptococcal nephritis, erythema nodosum, Takayasu's arteritis, Addison's disease, rheumatoid arthritis, multiple sclerosis, sarcoidosis, ulcerative colitis, erythema multiforme, IgA nephropathy, polyarteritis nodosa, ankylosing spondylitis, Goodpasture's syndrome, thromboangitis
  • Still other diseases with immunological dysregulation are suitably treated by the novel compositions and methods described herein, such as hemolytic anemias, cryoglobulinemias, hepatitis (particularly hepatitis C), graft- versus-host disease (GVHD) (particularly after allogeneic stem cell transplantation), allosensitization (particularly with organ transplantation).
  • hemolytic anemias particularly cryoglobulinemias
  • cryoglobulinemias particularly hepatitis C
  • GVHD graft- versus-host disease
  • allosensitization particularly with organ transplantation.
  • the structural variation may comprise an aspartate residue at Kabat position 101, for example as a substitution for an asparagine residue, in V H of CDR3 (CDRH3).
  • the structural variation may comprise an arginine residue at Kabat position 94, which may form a salt bridge with an aspartate at Kabat position 101.
  • the structural variation may comprise a valine residue at Kabat position 102.
  • the improved therapeutic characteristics may take a variety of forms, such as a slower dissociation rate from the target antigen, an increase in complement-dependent cytotoxicity (CDC) and/or a reduction in EC 50 in complement-dependent cytotoxicity (CDC).
  • the characteristics may include efficacy at a lower dosage, preferably a dosage of 80 mg or less for a human subject, more preferably a dosage of 50 mg or less, most preferably a dosage of 30 mg or less.
  • the dosage may be administered two or more times. Preferably, where multiple administrations are provided, they are administered about 1 to 3 weeks apart. But in certain disease setting, a more frequent, fractionated dosing is preferred, such as, for example, twice weekly for 4 or more weeks in chronic lymphocytic leukemia.
  • the anti-CD20 antibodies or antigen binding fragments thereof may be humanized, chimeric or human antibodies that bind to a human B -cell marker, such as anti-CD20 antibodies, of use for the treatment and diagnosis of B-cell disorders, such as B-cell malignancies and autoimmune diseases, as well as other diseases involving B-cells, such as GVHD, hemolytic anemia, cryoglobulinemia, allosensitization, and in organ transplant rejection, as well as certain viral diseases, such as hepatitis C.
  • B-cell disorders such as B-cell malignancies and autoimmune diseases
  • other diseases involving B-cells such as GVHD, hemolytic anemia, cryoglobulinemia, allosensitization, and in organ transplant rejection, as well as certain viral diseases, such as hepatitis C.
  • the humanized, chimeric or human anti-CD20 antibodies may be used for methods of treatment of mammalian subjects, such as humans or domestic animals, as naked antibodies either alone or in combination with one or more therapeutic agents, as immunoconjugates labeled with one or more therapeutic and/or diagnostic agents, as an antibody fusion protein, in pre- targeting methods with targetable constructs that are conjugated to one or more therapeutic or diagnostic agents, or as a multimodal therapy with other antibodies, other therapeutic agents or immunomodulators.
  • the humanized, chimeric or human anti-CD20 antibodies can also be used as a diagnostic imaging agent alone, in combination with other diagnostic imaging agents, and/or in conjunction with therapeutic applications.
  • inventions may be directed to anti-CD20 MAbs or antigen binding fragments thereof that contain specific murine CDRs or a combination of murine CDRs from more than one murine or chimeric anti-CD20 MAb.
  • These MAbs can be humanized, chimeric or human anti-CD20 MAbs.
  • the CDR sequences may include, but are not limited to, light chain CDR sequences CDRLl (RASSSVSYIH, SEQ ID NO:1), CDRL2 (ATSNLAS, SEQ ID NO:2) and CDRL3 (QQWTSNPPT, SEQ ID NO:3) and heavy chain CDR sequences CDRHl (SYNMH, SEQ ID NO:4), CDRH2 (AIYPGNGDTSYNQKFKG, SEQ ID NO:5) and CDRH3 (STYYGGDWYFDV, SEQ ID NO:6).
  • CDRLl light chain CDR sequences CDRLl
  • CDRL2 ATSNLAS, SEQ ID NO:2
  • CDRL3 QQWTSNPPT, SEQ ID NO:3
  • heavy chain CDR sequences CDRHl SYNMH, SEQ ID NO:4
  • CDRH2 AIYPGNGDTSYNQKFKG, SEQ ID NO:5
  • CDRH3 STYYGGDWYFDV
  • Various embodiments may concern bispecific antibodies or antibody fusion proteins comprising at least two anti-CD20 MAbs or antigen binding fragments thereof or a first MAb comprising an anti-CD20 MAb or antigen binding fragment thereof and a second MAb.
  • the second MAb may bind to a tumor-associated antigen, such as those listed above, or a hapten, for example on a targetable conjugate.
  • Other embodiments may concern therapeutic or diagnostic conjugates of anti-CD20 MAbs or antigen binding fragments thereof or antibody fusion proteins, bound to at least one therapeutic agent or at least one diagnostic agent. Antibodies and fusion proteins with multiple therapeutic agents of the same or different type are also encompassed.
  • the anti-CD20 antibodies, antigen binding fragments or fusion proteins may be used in therapeutic or diagnostic pre-targeting methods, for example using bispecific antibodies with one arm that binds specifically to a cell, disease, tissue or pathogen (e.g., hepatitis-C-associated target antigen) and a second arm that binds to a targetable conjugate attached to one or more diagnostic or therapeutic agents.
  • bispecific antibodies with one arm that binds specifically to a cell, disease, tissue or pathogen (e.g., hepatitis-C-associated target antigen) and a second arm that binds to a targetable conjugate attached to one or more diagnostic or therapeutic agents.
  • Methods of pre-targeting with bispecific antibodies are well known in the art (see, e.g., U.S. Patent Nos. 7,300,644; 7,138,103; 7,074,405; 7,052,872; 6,962,702; 6,458,933, the Examples section of each of which is incorporated herein by reference).
  • Alternative embodiments may concern methods of using the anti-CD20 MAbs or antigen binding fragments thereof or antibody fusion proteins for therapy, either alone, in combination with one or more other therapeutic agents, for example as the antibody component of a therapeutic immunoconjugate with one or more therapeutic agents or as a naked antibody, antigen binding fragment or fusion protein administered alone or in combination with one or more therapeutic agents.
  • Use for diagnostic methods in combination with one or more diagnostic agents is also contemplated.
  • the disease to be diagnosed or treated is a B-cell mediated immune disease, autoimmune disease, B-cell lymphoma or leukemia.
  • B-cell mediated immune disease refers to a sub-class of autoimmune disease, as well as the other immune diseases discussed above (e.g., GVHD, cryoglobulinemia, hemolytic anemia, allosensitization, transplant organ rejection) in which the disease state is primarily mediated by production of autoantibodies, rather than by autoreactive T lymphocytes, or by a combination of B- and T-cell immunity.
  • FIG. 1 Variable light chain (cA20Vk) and variable heavy chain (cA20VH) sequences of cA20, a chimeric anti-CD20 antibody.
  • the CDR region sequences are shown in bold and underlined.
  • the amino acid residues and the nucleotides are numbered sequentially and same numbering system is used for humanized V sequences shown in FIG. 2.
  • the light chain variable region is shown in FIG. IA (SEQ ID NOS 7 & 8) and the heavy chain variable region is shown in FIG. IB (SEQ ID NOS 9 & 10).
  • the Kabat numbering scheme was used for amino acid residues.
  • FIG. 2 Nucleotide and amino acid sequences of the hA20 light chain hA20Vk (FIG. 2A) (SEQ ID NOS 11 & 12), and heavy chain hA20VHl (FIG. 2B) (SEQ ID NOS 13 & 14), as well as the adjacent flanking sequences of the VKpBR2 (FIG. 2A) and VHpBS2 (FIG. 2B) staging vectors, respectively.
  • the non-translated nucleotide sequences are shown in lowercase.
  • the restriction sites used for subcloning are underlined and indicated.
  • FIG. 3 Comparison of the variable region sequences of cA20 (SEQ ID NOS 8 & 10), rituximab (from murine C2B8, SEQ ID NOS 15 & 16) and hA20 (SEQ ID NOS 12 & 14). Dots indicate homology to cA20. CDR sequences are in boxes. The heavy chain (FIG. 3A) and light chain (FIG. 3B) variable region sequences are shown.
  • FIG. 4 Scatchard analysis - the binding characteristics of veltuzumab and rituximab were determined by binding the 125 I-labeled MAbs to Raji cells.
  • Direct cell surface saturation binding and Scatchard plot analysis (inset) - closed triangles veltuzumab; circles rituximab.
  • B max and K d were determined by non-linear regression analysis using a one-site binding model with Prism software. These results are representative of one of three repeated experiments.
  • FIG. 5 Comparison of dissociation rates of veltuzumab and rituximab from live cells. Daudi (A), Ramos (B), and Raji (C- E) cells were stained with PE-labeled rituximab (closed triangle), veltuzumab (closed square), cA20 (upside down closed triangle), DlOlN (closed circle), 1F5 (open circle) or Bl (tositumomab) (open square). The labeled MAbs were incubated at 37°C with (A-D) or without (E) excess veltuzumab Fab' -NEM and the cells analyzed by flow cytometry over time. The off -rate was determined by non-linear regression (one phase exponential decay) and P-values were generated by F-test using GraphPad Prism software.
  • FIG. 6 Effects of veltuzumab and rituximab on proliferation of non-Hodgkin's lymphoma cell lines. Anti-proliferative effects were assessed by MTT cytotoxicity assays. Cells were cultured with the MAbs with or without a second antibody for crosslinking. White bars, no second antibody; gray bars with GAH second antibody; error bars, SD.
  • FIG. 7 In vitro depletion of B-cells from healthy blood donors. The effect of veltuzumab on peripheral blood lymphocytes from healthy volunteers was evaluated in vitro using flow cytometry. Decrease in the percent of CD 19+ cells present in the lymphocyte gate after a two-day incubation of heparinized whole blood of healthy volunteers with veltuzumab is shown. Each line represents a different blood donor. Error bars, SD.
  • FIG. 8 Survival curves for veltuzumab in a disseminated Burkitt's lymphoma xenograft model comparing intraperitoneal versus subcutaneous administration. CB. 17
  • SCID mice were administered 1.5xlO 7 Daudi cells i.v. on day 0.
  • Therapy with veltuzumab began on day 1 with mice receiving either a single i.p. or single s.c. injection of veltuzumab.
  • Doses administered were 60, 20, or 5 ⁇ g veltuzumab.
  • Control mice received an i.p. injection of either saline or 60 ⁇ g hMN-14 IgG (labetuzumab, anti-CEACAM5 isotype matched antibody).
  • FIG. 9 The minimal effective dose of veltuzumab was determined in a disseminated
  • Burkitt lymphoma xenograft model CB. 17 SCID mice were administered 1.5xlO 7 Daudi cells i.v. on day 0. Therapy with veltuzumab began on day 1 with mice receiving a single i.p. injection of veltuzumab. Doses administered were 0.5, 0.25, 0.1, or 0.05 ⁇ g veltuzumab.
  • Control mice received a 200 ⁇ L i.p. of saline.
  • FIG. 10 Representative survival curves of mice bearing disseminated follicular cell lymphoma and treated with decreasing doses of veltuzumab.
  • CB. 17 SCID mice were administered 2.5xlO 6 WSU-FSCCL cells i.v. on day 0.
  • mice received a single i.p. injection of veltuzumab at a dose of 35, 3.5, 0.35, or 0.035 ⁇ g.
  • Control mice received only saline.
  • FIG. 11 The effect of depleting NK cells and neutrophils on anti-lymphoma activity was assessed in SCID mice.
  • Control mice received 100 ⁇ L saline.
  • FIG. 12 Serum pharmacokinetics - veltuzumab (150 ⁇ g) was administered to naive
  • FIG. 13 Veltuzumab is more effective than rituximab in controlling the growth of lymphoma in vivo in SCID mice.
  • SCID mice were inoculated with Raji cells by tail vein injection. On days +5, +10, +15 and +20, the mice received either rituximab or veltuzumab
  • FIG. 14 Kaplan-Meier estimates of duration of response (DR) and time to progression (TTP) for 24 follicular lymphoma responders in human studies of veltuzamab effects in non-Hodgkin's lymphoma.
  • FIG. 15 B-cell levels for NHL patients treated with veltuzumab in different dose groups measured at baseline, prior to infusions 2, 3 and 4, at 4 and 12 weeks later, then at 3- month intervals for up to 12 months after last infusion.
  • an antibody refers to a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (e.g., an IgG antibody) or an immunologically active, antigen-binding portion of an immunoglobulin molecule, like an antibody fragment.
  • immunoglobulin molecule e.g., an IgG antibody
  • immunologically active, antigen-binding portion of an immunoglobulin molecule like an antibody fragment.
  • An antibody fragment is a portion of an antibody such as F(ab') 2 , F(ab) 2 , Fab', Fab, Fv, scFv and the like. Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the intact antibody. For example, an anti-CD20 monoclonal antibody fragment binds to CD20.
  • antibody fragment also includes isolated fragments consisting of the variable regions, such as the "Fv” fragments consisting of the variable regions of the heavy and light chains, recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker ("scFv proteins"), and minimal recognition units consisting of the amino acid residues that mimic the hypervariable region.
  • scFv proteins peptide linker
  • antibody fragment does not include portions of antibodies without antigen binding activity, such as Fc fragments.
  • a naked antibody refers to an antibody or antigen binding fragment thereof which is not conjugated to a therapeutic agent.
  • the Fc portion of the antibody molecule may provide effector functions, such as complement fixation and ADCC (antibody dependent cell cytotoxicity), which set mechanisms into action that may result in cell lysis. However, it is possible that the Fc portion is not required for therapeutic function, with other mechanisms, such as apoptosis, coming into play. Naked antibodies may include polyclonal and monoclonal antibodies, as well as recombinant antibodies, such as chimeric, humanized or human antibodies.
  • a therapeutic agent is a molecule or atom which is administered separately, concurrently or sequentially with an antibody moiety or conjugated to an antibody moiety, i.e., antibody or antibody fragment, or a subfragment, and is useful in the treatment of a disease.
  • Non-limiting examples of therapeutic agents include antibodies, antibody fragments, drugs, toxins, nucleases, hormones, immunomodulators, chelators, boron compounds, photoactive agents, oligonucleotides (e.g. anti-sense oligonucleotides or RNAi) and radioisotopes.
  • therapeutic agents include antibodies, antibody fragments, drugs, toxins, nucleases, hormones, immunomodulators, chelators, boron compounds, photoactive agents, oligonucleotides (e.g. anti-sense oligonucleotides or RNAi) and radioisotopes.
  • a diagnostic agent is a detectable molecule or atom that may be conjugated to an antibody, antibody fragment, targetable construct or other moiety for delivery to a cell, tissue, pathogen or other target associated with a disease or medical condition.
  • useful diagnostic agents include, but are not limited to, radioisotopes, ultrasound, dyes (such as with the biotin- streptavidin complex), contrast agents, fluorescent compounds or molecules and enhancing agents (e.g. paramagnetic ions for magnetic resonance imaging).
  • An immunoconjugate is a conjugate of an antibody component with at least one therapeutic or diagnostic agent. An antibody component may be conjugated with multiple therapeutic and/or diagnostic agents to form an immunoconjugate.
  • antibody fusion protein may refer to a recombinantly produced antigen- binding molecule in which one or more of the same or different single-chain antibody or antibody fragment segments with the same or different specificities are linked. Valency of the fusion protein indicates how many binding arms or sites the fusion protein has to a single antigen or epitope; i.e., monovalent, bivalent, trivalent or multivalent. The multivalency of the antibody fusion protein means that it can take advantage of multiple interactions in binding to an antigen, thus increasing the avidity of binding to the antigen. Specificity indicates how many antigens or different epitopes an antibody fusion protein is able to bind; i.e., monospecific, bispecific, trispecific, multispecific.
  • a natural antibody e.g., an IgG
  • Monospecific, multivalent fusion proteins have more than one binding site for an epitope but only bind with one epitope.
  • the fusion protein may comprise a single antibody component, a multivalent or multispecific combination of different antibody components or multiple copies of the same antibody component.
  • the fusion protein may additionally comprise an antibody or an antibody fragment and a therapeutic agent. Examples of therapeutic agents suitable for such fusion proteins include immunomodulators ("antibody-immunomodulator fusion protein") and toxins ("antibody- toxin fusion protein").
  • One preferred toxin comprises a ribonuclease (RNase), preferably a recombinant RNase.
  • RNase ribonuclease
  • Another preferred immunomodulator fusion protein is an immunocytokine, such as fusing an interferon to a specific antibody or multivalent antibody or multispecific antibody as described herein.
  • a multispecific antibody is an antibody that can bind simultaneously to at least two targets that are of different structure, e.g., two different antigens, two different epitopes on the same antigen, or a hapten and/or an antigen or epitope.
  • One specificity may be for a B- cell, T-cell, myeloid-, plasma- or mast-cell antigen or epitope.
  • Another specificity may be to a different antigen on the same cell type, such as CD20, CD19, CD21, CD23, CD37, CD45, CD70, CD79a, CD80, HLA-DR, CD74, MUCl or CD22 on B-cells.
  • Multispecific, multivalent antibodies are constructs that have more than one binding site, and the binding sites are of different specificity.
  • a bispecific antibody is an antibody that can bind simultaneously to two targets which are of different structure.
  • bispecific antibodies (bsAb) and bispecific antibody fragments (bsFab) have at least one arm that specifically binds to, for example, a B-cell, T-cell, myeloid-, plasma- or mast-cell antigen or epitope and at least one other arm that specifically binds to a targetable conjugate that bears a therapeutic or diagnostic agent.
  • Rituximab is well known in the art and is commercially available from Biogen/IDEC and Genentech (see, e.g., U.S. Patent Nos. 5,736,137; 5,776,456; 6,399,061; 6,455,043; 6,846,476). Based on this success, efforts are underway to introduce improved anti-CD20 antibodies (Stein et al, Clin Cancer Res. 2004, 10:2868-78; Teeling et al, Blood. 2004, 104:1793-1800; Vugmeyster et al, J Immunother. 2005, 28:212- 219, Umana et al, Ann Oncol.
  • Veltuzumab has a shorter infusion time than rituximab while indicating a higher complete response (CR) rate than has been reported for rituximab (Morschhauser et al, Proc Am Soc Clin Oncol, J Clin Oncol. 2007, 25(18S):449s; Goldenberg et al, Proc Amer Soc Clin Oncol, J. Clin. Oncol. 2008, 26(15S): 142s).
  • veltuzumab was recombinantly engineered using the backbone framework regions of the humanized anti-CD22 MAb, epratuzumab or hLL2 (see, e.g., Leung et al, MoI Immunol. 1995, 32:1413-1427; U.S. Patent Nos. 6,306,393; 6,183,774 and 7,074,403, the Examples section of each incorporated herein by reference), while having identical light chain CDRs, identical heavy chain CDRl and CDR2, but a different CDR3-V H (CDRH3) construct, compared to rituximab, as shown in Table 1 below.
  • CDRH3-V H CDRH3-V H
  • veltuzumab has unique characteristics in terms of significantly improved complement- dependent cytotoxicity (CDC) in the Daudi cell line, slower off -rates in all three lymphoma cell lines tested, compared to rituximab, and potent anti-B-cell activity in cynomolgus monkeys and therapeutic effects in human lymphoma-murine models, as well as significantly better control of Raji lymphoma xenografts in mice as compared to rituximab, thus corroborating the activity observed in patients at very low doses.
  • CDC complement- dependent cytotoxicity
  • the present invention provides humanized, chimeric or human anti-CD20 antibodies, and antibody fusion proteins thereof, useful for treatment of mammalian subjects, humans and domestic animals, alone, as a conjugate or administered in combination with other therapeutic agents, including other naked antibodies and antibody therapeutic conjugates.
  • the instant anti-CD20 MAbs or antigen binding fragments thereof comprise an aspartate residue at Kabat position 101, an arginine residue at Kabat position 94, and a valine residue at Kabat position 102 of CDR3's V H • More preferably, the anti-CD20 antibodies and antigen binding fragments thereof comprise the CDR sequences of veltuzumab, comprising light chain CDR sequences CDRLl (RASSSVSYIH, SEQ ID NO:1), CDRL2 (ATSNLAS, SEQ ID NO:2) and CDRL3 (QQWTSNPPT, SEQ ID NO:3) and heavy chain CDR sequences CDRHl (SYNMH, SEQ ID NO:4), CDRH2 (AIYPGNGDTSYNQKFKG, SEQ ID NO:5) and CDRH3 (STYYGGD WYFDV, SEQ ID NO:6).
  • CDRLl light chain CDR sequences CDRLl
  • CDRL2 ATSNLAS, SEQ ID NO:2
  • the anti-CD20 antibody is veltuzumab.
  • the humanized anti-CD20 MAb or antigen binding fragment thereof may comprise the CDRs of a murine anti-CD20 MAb (or sequences derived from the CDRs of a murine anti- CD20 antibody) and the framework (FR) and constant regions of the light and heavy chain variable regions of one or more human antibodies, while retaining the B-cell, B-cell lymphoma and B-cell leukemia targeting characteristics of the parent murine anti-CD20 MAb.
  • the humanized anti-CD20 MAb or antigen binding fragment thereof may further comprise at least one amino acid from the corresponding FRs of the parent murine MAb.
  • the humanized anti-CD20 MAb or antigen binding fragment thereof may contain at least one amino acid residue corresponding to amino acids 1, 5, 27, 30, 38, 48, 67, 68, 70, 95, 115 or 116 of the heavy chain variable region shown in FIG. 2B (hA20VHl, SEQ ID NO: 14) and/or at least one amino acid residue corresponding to amino acid residues 4, 21, 35, 38, 45, 46, 59, 99, 104 or 106 of the light chain variable region shown in HG. 2A (hA20Vk, SEQ ID NO: 12).
  • the murine framework amino acid residues can be substituted in the human FR regions of the light and heavy variable chains if necessary to maintain proper binding or to enhance binding to the CD20 antigen.
  • the humanized anti-CD20 MAb or antigen binding fragment thereof comprises the amino acid sequences of hA20Vk (SEQ ID NO: 12) and hA2VHl (SEQ ID NO: 14).
  • Chimeric anti-CD20 MAbs or antigen binding fragments thereof may comprise the variable region sequences of a murine anti-CD20 antibody (or derived from a murine anti-CD20 antibody), attached to human antibody constant region sequences.
  • the light and heavy chain variable regions of a chimeric anti-CD20 MAb comprise the CDR sequences of cA20Vk (SEQ ID NO:8) and cA20VH (SEQ ID NO: 10), shown in HGS. IA and IB.
  • the chimeric anti-CD20 MAb or antigen binding fragment thereof comprises the light and heavy chain variable region sequences of cA20Vk (SEQ ID NO:8) and cA20VH (SEQ ID NO: 10).
  • Certain embodiments may concern a human anti-CD20 MAb or antigen binding fragment thereof, having substantially the B-cell, and B-cell lymphoma and leukemia cell targeting and cell binding characteristics of a murine anti-CD20 MAb, wherein the CDRs are as set forth above for the chimeric and humanized anti-CD20 MAbs as shown in FIGS. 1 and 2.
  • Other embodiments may encompass antibody fusion proteins or antigen binding fragments thereof comprising at least one anti-CD20 MAb or antigen binding fragments thereof, as described above.
  • the antibody fusion protein or antigen binding fragment thereof is also intended to encompass an antibody fusion protein or antigen binding fragment thereof comprising at least one first anti-CD20 MAb or antigen binding fragment thereof as described above and at least one second MAb or antigen binding fragment thereof, other than the anti- CD20 MAb or antigen binding fragment thereof described above.
  • this second MAb is a MAb reactive with B7, CD4, CD5, CD8 CD14, CD15, CD16, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD45, CD46, CD52, CD54, CD55, CD59, CD70, CD74, CD80, CD95, CD126, CD133, CD138, CD154, CEACAM6, ED-B fibronectin, Factor H, FHL-I, FIt-I, Flt-3, folate receptor, GROB, HMGB-I, hypoxia inducible factor (HIF), HM1.24, insulin-like growth factor-1 (ILGF-I), insulin-like growth factor-1 receptor (ILGF-IR), IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IL-2, IL-4R, IL-6R, IL-13R, IL-15R, IL-17R, IL-18R, IL-6, IL
  • the humanized, chimeric or human anti-CD20 antibody may possess enhanced affinity binding with the epitope, as well as antitumor and anti-B-cell activity, as a result of CDR mutation and manipulation of the CDR and other sequences in the variable region to obtain a superior therapeutic agent for the treatment of B -cell disorders, including B -cell lymphomas and leukemias and autoimmune diseases and also other immune diseases involving B-cells (GVHD, hemolytic anemia, organ transplant rejection).
  • B -cell lymphomas and leukemias and autoimmune diseases and also other immune diseases involving B-cells (GVHD, hemolytic anemia, organ transplant rejection).
  • ADCC antibody-dependent cell-dependent cytotoxicity
  • CDC complement-dependent cytotoxicity
  • One or more amino acid substitutions or the introduction of cysteine in the Fc region may be made, thereby improving internalization capability and/or increased complement-dependent cell killing and ADCC. See Caron et al., J. Exp. Med. 176:1191-1195 (1991) and Shopes, Br. J. Immunol. 148:2918-2022 (1992), incorporated herein by reference.
  • An antibody fusion protein may be prepared that has dual Fc regions with both enhanced complement lysis and ADCC capabilities.
  • the disclosed methods and compositions may involve production and use of antibodies or antigen-binding fragments thereof with one or more substituted amino acid residues.
  • methods for making monoclonal antibodies against virtually any target antigen are well known in the art. Typically, these result in production of murine antibodies against a target antigen.
  • the antigen-binding specificity of murine monoclonal antibodies is determined largely by the hypervariable complementarity determining region (CDR) sequences.
  • Murine antibodies generally comprise 6 CDR sequences, 3 on the antibody light chain and 3 on the heavy chain.
  • chimeric, humanized or human versions of murine antibodies may be constructed by techniques such as CDR grafting, where the murine CDR sequences are inserted into, for example, human antibody framework and constant region sequences, or by attaching the entire murine variable region sequences to human antibody constant region sequences.
  • the variable region sequences of an antibody may be constructed, for example, by chemical synthesis and assembly of oligonucleotides encoding the entire light and heavy chain variable regions of an antibody.
  • the structural, physical and/or therapeutic characteristics of chimeric, humanized or human antibodies may be optimized by replacing one or more amino acid residues.
  • amino acid substitutions typically involve the replacement of an amino acid with another amino acid of relatively similar properties (i.e., conservative amino acid substitutions).
  • conservative amino acid substitutions The properties of the various amino acids and effect of amino acid substitution on protein structure and function have been the subject of extensive study and knowledge in the art.
  • the hydropathic index of amino acids may be considered (Kyte & Doolittle, 1982, J. MoI. Biol, 157:105-132).
  • the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules.
  • Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte & Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (- 0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • amino acids whose hydropathic indices are within + 2 is preferred, within + 1 are more preferred, and within + 0.5 are even more preferred.
  • Amino acid substitution may also take into account the hydrophilicity of the amino acid residue (e.g., U.S. Pat. No. 4,554,101).
  • Hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0); glutamate (+3.0); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 .+-.1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). Replacement of amino acids with others of similar hydrophilicity is preferred, but not required.
  • amino acid side chain For example, it would generally not be preferred to replace an amino acid with a compact side chain, such as glycine or serine, with an amino acid with a bulky side chain, e.g., tryptophan, tyrosine.
  • a compact side chain such as glycine or serine
  • an amino acid with a bulky side chain e.g., tryptophan, tyrosine.
  • the effect of various amino acid residues on protein secondary structure is also a consideration. Through empirical study, the effect of different amino acid residues on the tendency of protein domains to adopt an alpha-helical, beta-sheet or reverse turn secondary structure has been determined and is known in the art (see, e.g., Chou & Fasman, 1974, Biochemistry, 13:222-245; 1978, Ann. Rev. Biochem., 47: 251-276; 1979, Biophys. J., 26:367-384).
  • amino acid substitutions include whether or not the residue is located in the interior of a protein or is solvent exposed. For CDR residues, the residue in the free antibody would normally be assumed to be solvent exposed. For interior residues, conservative substitutions would include: Asp and Asn; Ser and Thr; Ser and Ala; Thr and Ala; Ala and GIy; He and Val; Val and Leu; Leu and Ile; Leu and Met; Phe and Tyr; Tyr and Trp.
  • conservative substitutions would include: Asp and Asn; Asp and Glu; Glu and GIn; Glu and Ala; GIy and Asn; Ala and Pro; Ala and GIy; Ala and Ser; Ala and Lys; Ser and Thr; Lys and Arg; VaI and Leu; Leu and He; He and VaI; Phe and Tyr.
  • monoclonal antibodies can be obtained by injecting mice with a composition comprising an antigen, removing the spleen to obtain B- lymphocytes, fusing the B -lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones which produce antibodies to the antigen, culturing the clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
  • MAbs can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography. See, for example, Coligan at pages 2.7.1-2.7.12 and pages 2.9.1-2.9.3. Also, see Baines et al, "Purification of Immunoglobulin G (IgG)," in METHODS IN MOLECULAR BIOLOGY, VOL. 10, pages 79-104 (The Humana Press, Inc. 1992). [0070] After the initial raising of antibodies to the immunogen, the antibodies can be sequenced and subsequently prepared by recombinant techniques.
  • humanization or chimerization of murine antibodies and antibody fragments are well known to those skilled in the art.
  • humanized monoclonal antibodies are produced by transferring mouse complementary determining regions from heavy and light variable chains of the mouse immunoglobulin into a human variable domain, and then, substituting human residues in the framework regions of the murine counterparts.
  • the use of antibody components derived from humanized monoclonal antibodies obviates potential problems associated with the immunogenicity of murine constant regions.
  • a chimeric antibody is a recombinant protein in which the variable regions of a human antibody have been replaced by the variable regions of, for example, a mouse antibody, including the complementarity-determining regions (CDRs) of the mouse antibody.
  • Chimeric antibodies exhibit decreased immunogenicity and increased stability when administered to a subject.
  • CDRs complementarity-determining regions
  • a chimeric or murine monoclonal antibody may be humanized by transferring the mouse CDRs from the heavy and light variable chains of the mouse immunoglobulin into the corresponding variable domains of a human antibody.
  • the mouse framework regions (FR) in the chimeric monoclonal antibody are also replaced with human FR sequences.
  • additional modification might be required in order to restore the original affinity of the murine antibody. This can be accomplished by the replacement of one or more some human residues in the FR regions with their murine counterparts to obtain an antibody that possesses good binding affinity to its epitope.
  • the phage display technique may be used to generate human antibodies ⁇ e.g., Dantas-Barbosa et al., 2005, Genet. MoI. Res. 4:126-40).
  • Human antibodies may be generated from normal humans or from humans that exhibit a particular disease state, such as cancer (Dantas-Barbosa et al., 2005).
  • the advantage to constructing human antibodies from a diseased individual is that the circulating antibody repertoire may be biased towards antibodies against disease-associated antigens.
  • RNAs were converted to cDNAs and used to make Fab cDNA libraries using specific primers against the heavy and light chain immunoglobulin sequences (Marks et al., 1991, J. MoI. Biol. 222:581-97).
  • Human antibodies may also be generated by in vitro activated B-cells. See U.S. Patent Nos. 5,567,610 and 5,229,275, the Examples section of each of which is incorporated herein by reference. The skilled artisan will realize that these techniques are exemplary and any known method for making and screening human antibodies or antibody fragments may be utilized.
  • transgenic animals that have been genetically engineered to produce human antibodies may be used to generate antibodies against essentially any immunogenic target, using standard immunization protocols. Methods for obtaining human antibodies from transgenic mice are disclosed by Green et al., Nature Genet. 7:13 (1994), Lonberg et al, Nature 368:856 (1994), and Taylor et al, Int. Immun.
  • the XenoMouse® was transformed with germline-configured YACs (yeast artificial chromosomes) that contained portions of the human IgH and Igkappa loci, including the majority of the variable region sequences, along with accessory genes and regulatory sequences.
  • the human variable region repertoire may be used to generate antibody producing B-cells, which may be processed into hybridomas by known techniques.
  • a XenoMouse® immunized with a target antigen will produce human antibodies by the normal immune response, which may be harvested and/or produced by standard techniques discussed above.
  • a variety of strains of XenoMouse® are available, each of which is capable of producing a different class of antibody.
  • Transgenically produced human antibodies have been shown to have therapeutic potential, while retaining the pharmacokinetic properties of normal human antibodies (Green et al., 1999).
  • the skilled artisan will realize that the claimed compositions and methods are not limited to use of the XenoMouse® system but may utilize any transgenic animal that has been genetically engineered to produce human antibodies.
  • Antibody fragments which recognize specific epitopes can be generated by known techniques.
  • the antibody fragments are antigen binding portions of an antibody, such as F(ab')2, Fab', F(ab) 2 , Fab, Fv, scFv and the like.
  • F(ab') 2 fragments can be produced by pepsin digestion of the antibody molecule and Fab' fragments can be generated by reducing disulfide bridges of the F(ab') 2 fragments.
  • Fab' expression libraries can be constructed (Huse et al., 1989, Science, 246:1274-1281) to allow rapid and easy identification of monoclonal Fab' fragments with the desired specificity.
  • a single chain Fv molecule comprises a VL domain and a VH domain.
  • the VL and VH domains associate to form a target binding site.
  • These two domains are further covalently linked by a peptide linker (L).
  • L peptide linker
  • An antibody fragment can be prepared by proteolytic hydrolysis of the full length antibody or by expression in E. coli or another host of the DNA coding for the fragment.
  • An antibody fragment can be obtained by pepsin or papain digestion of full length antibodies by conventional methods. For example, an enzymatic cleavage using papain produces two monovalent Fab fragments and an Fc fragment. These methods are described, for example, by Goldenberg, U.S. Patent Nos. 4,036,945 and 4,331,647 and references contained therein, which patents are incorporated herein by reference. Also, see Nisonoff et al., Arch Biochem. Biophys. 89: 230 (1960); Porter, Biochem. J. 73: 119 (1959), Edelman et al, in METHODS IN ENZYMOLOGY VOL. 1, page 422 (Academic Press 1967), and Coligan at pages 2.8.1- 2.8.10 and 2.10.-2.10.4.
  • Bispecific antibodies are useful in a number of biomedical applications. For instance, a bispecific antibody with binding sites for a tumor cell surface antigen and for a T-cell surface receptor can direct the lysis of specific tumor cells by T cells. Bispecific antibodies recognizing gliomas and the CD3 epitope on T cells have been successfully used in treating brain tumors in human patients (Nitta, et al., Lancet 1990; 355:368-371). Pre-targeting methods with bispecific antibodies comprising at least one binding site for a tumor-associated antigen (TAA) or other disease target, as well as at one binding site for a targetable construct conjugated to therapeutic or diagnostic agents, are also well known in the art (see, e.g., U.S. Patent Nos. 7,300,644; 7,138,103; 7,074,405; 7,052,872; 6,962,702; 6,458,933, the Examples section of each of which is incorporated herein by reference).
  • TAA tumor-associated antigen
  • Bispecific antibodies comprising the antigen-binding variable region sequences of any known anti-TAA antibody may be utilized, including but not limited to hPAM4 (U.S. Patent No. 7,282,567), hA20 (U.S. Patent No. 7,251,164), hA19 (U.S. Patent No. 7,109,304), MMMU31 (U.S. Patent No. 7,300,655), hLLl (U.S. Patent No. 7,312,318,), hLL2 (U.S. Patent No. 7,074,403), hMu-9 (U.S. Patent No. 7,387,773), hL243 (U.S. Patent Application No.
  • antibodies of use may be commercially obtained from a wide variety of known sources.
  • a variety of antibody secreting hybridoma lines are available from the American Type Culture Collection (ATCC, Manassas, VA).
  • ATCC American Type Culture Collection
  • VA Manassas
  • a large number of antibodies against various disease targets, including but not limited to tumor-associated antigens, have been deposited at the ATCC and/or have published variable region sequences and are available for use in the claimed methods and compositions. See, e.g., U.S. Patent Nos.
  • antibody sequences or antibody- secreting hybridomas against almost any disease-associated antigen may be obtained by a simple search of the ATCC, NCBI and/or USPTO databases for antibodies against a selected disease-associated target of interest.
  • the antigen binding domains of the cloned antibodies may be amplified, excised, ligated into an expression vector, transfected into an adapted host cell and used for protein production, using standard techniques well known in the art.
  • Bispecific antibodies can be produced by the quadroma method, which involves the fusion of two different hybridomas, each producing a monoclonal antibody recognizing a different antigenic site (Milstein and Cuello, Nature, 1983; 305:537-540).
  • bispecific antibodies Another method for producing bispecific antibodies uses heterobifunctional cross- linkers to chemically tether two different monoclonal antibodies (Staerz, et al., Nature 1985; 314:628-631; Perez, et al, Nature 1985; 316:354-356). Bispecific antibodies can also be produced by reduction of each of two parental monoclonal antibodies to the respective half molecules, which are then mixed and allowed to reoxidize to obtain the hybrid structure (Staerz and Bevan, Proc Natl Acad Sci USA 1986; 83:1453-1457). Another alternative involves chemically cross-linking two or three separately purified Fab' fragments using appropriate linkers. (See, e.g., European Patent Application 0453082).
  • trimers with linkers between 0 and 2 amino acid residues, trimers (termed triabody) and tetramers (termed tetrabody) are favored, but the exact patterns of oligomerization appear to depend on the composition as well as the orientation of V-domains (VH-linker-VL or V L - linker-V ⁇ ), in addition to the linker length.
  • Patent 7,527,787) 20070264265 and 20090060862 and USSN 12/418,877, filed April 8, 2009, the Examples section of each of which is incorporated herein by reference).
  • the technique utilizes complementary protein binding domains, referred to as anchoring domains and dimerization and docking domains, which bind to each other and allow the assembly of complex structures, ranging from dimers, trimers, tetramers, quintamers and hexamers. These form stable complexes in high yield without requirement for extensive purification.
  • the DNL technique allows the assembly of monospecific, bispecific or multispecific antibodies, either as naked antibody moieties or in combination with a wide range of other effector molecules such as immunomodulators, enzymes, chemotherapeutic agents, chemokines, cytokines, diagnostic agents, therapeutic agents, radionuclides, imaging agents, anti-angiogenic agents, growth factors, oligonucleotides, hormones, peptides, toxins, pro- apoptotic agents, or a combination thereof. Any of the techniques known in the art for making bispecific or multispecific antibodies may be utilized in the practice of the presently claimed methods.
  • Bispecific or multispecific antibodies may be utilized in pre-targeting techniques.
  • Pre-targeting is a multistep process originally developed to resolve the slow blood clearance of directly targeting antibodies, which contributes to undesirable toxicity to normal tissues such as bone marrow.
  • a radionuclide or other therapeutic agent is attached to a small delivery molecule (targetable construct or targetable conjugate) that is cleared within minutes from the blood.
  • a pre-targeting bispecific or multispecific antibody, which has binding sites for the targetable construct as well as a target antigen, is administered first, free antibody is allowed to clear from circulation and then the targetable construct is administered.
  • Pre-targeting methods are well known in the art, for example, as disclosed in Goodwin et al, U.S. Pat. No. 4,863,713; Goodwin et al, J. Nucl. Med. 29:226, 1988; Hnatowich et al, J. Nucl. Med. 28:1294, 1987; Oehr et al, J. Nucl. Med. 29:728, 1988; Klibanov et al, J. Nucl. Med. 29:1951, 1988; Sinitsyn et al, J. Nucl. Med. 30:66, 1989; Kalofonos et al, J. Nucl. Med. 31:1791, 1990; Schechter et al, Int. J.
  • a pre-targeting method of treating or diagnosing a disease or disorder in a subject may be provided by: (1) administering to the subject a bispecific antibody or antigen binding antibody fragment; (2) optionally administering to the subject a clearing composition, and allowing the composition to clear the antibody from circulation; and (3) administering to the subject the targetable construct, containing one or more chelated or chemically bound therapeutic or diagnostic agents.
  • the technique may also be utilized for antibody dependent enzyme prodrug therapy (ADEPT) by administering an enzyme conjugated to a targetable construct, followed by a prodrug that is converted into active form by the enzyme.
  • ADPT antibody dependent enzyme prodrug therapy
  • the antibodies, antigen binding antibody fragments or fusion proteins described herein may be administered alone, as a "naked" antibody, antigen binding fragment thereof or fusion protein.
  • the antibody, antigen binding fragment thereof or fusion protein may be administered before, concurrently with, or after at least one other therapeutic agent.
  • an antibody, antigen binding fragment thereof or fusion protein may be covalently or non-covalently attached to at least one therapeutic and/or diagnostic agent to form an immunoconjugate.
  • Diagnostic agents are preferably selected from the group consisting of a radionuclide, a radiological contrast agent, a paramagnetic ion, a metal, a fluorescent label, a chemiluminescent label, an ultrasound contrast agent and a photoactive agent. Such diagnostic agents are well known and any such known diagnostic agent may be used.
  • Non- limiting examples of diagnostic agents may include a radionuclide such as 110 In, 111 In, 177 Lu, 18 F, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 90 Y, 89 Zr, 94m Tc, 94 Tc, 99m Tc, 120 I, 123 I, 124 I, 125 I, 131 I, 154"158 Gd, 32 P, 11 C, 13 N, 15 O, 186 Re, 188 Re, 51 Mn, 52m Mn, 55 Co, 72 As, 75 Br, 76 Br, 82m Rb, 83 Sr, or other gamma-, beta-, or positron-emitters.
  • a radionuclide such as 110 In, 111 In, 177 Lu, 18 F, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 90 Y, 89 Zr, 94m Tc, 94 Tc
  • Paramagnetic ions of use may include chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) or erbium (III).
  • Metal contrast agents may include lanthanum (III), gold (III), lead (II) or bismuth (III).
  • Ultrasound contrast agents may comprise liposomes, such as gas filled liposomes. Radiopaque diagnostic agents may be selected from barium compounds, gallium compounds and thallium compounds.
  • fluorescent labels are known in the art, including but not limited to fluorescein isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
  • Chemiluminescent labels of use may include luminol, isoluminol, an aromatic acridinium ester, an imidazole, an acridinium salt or an oxalate ester.
  • Therapeutic agents are preferably selected from the group consisting of a radionuclide, an immunomodulator, an anti-angiogenic agent, a cytokine, a chemokine, a growth factor, a hormone, a drug, a prodrug, an enzyme, an oligonucleotide, an interference RNA, a pro- apoptotic agent, a photoactive therapeutic agent, a cytotoxic agent, which may be a chemotherapeutic agent or a toxin, a second antibody or fragment thereof and a combination thereof.
  • the drugs of use may possess a pharmaceutical property selected from the group consisting of antimitotic, antikinase, alkylating, antimetabolite, antibiotic, alkaloid, anti- angiogenic, pro-apoptotic agents and combinations thereof.
  • Exemplary drugs of use include, but are not limited to, 5-fluorouracil, aplidin, azaribine, anastrozole, anthracyclines, bendamustine, bleomycin, bortezomib, bryostatin-1, busulfan, calicheamycin, camptothecin, carboplatin, 10-hydroxycamptothecin, carmustine, celebrex, chlorambucil, cisplatin (CDDP), Cox-2 inhibitors, irinotecan (CPT-I l), SN-38, carboplatin, cladribine, camptothecans, cyclophosphamide, cytarabine, dacarbazine, docetaxel, dactinomycin, daunorubicin, doxorubicin, 2-pyrrolinodoxorubicine (2P-DOX), cyano-morpholino doxorubicin, doxorubicin glucuronide, epi
  • Toxins of use may include ricin, abrin, alpha toxin, saporin, ribonuclease (RNase), e.g., onconase, DNase I, Staphylococcal enterotoxin-A, pokeweed antiviral protein, gelonin, diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
  • RNase ribonuclease
  • Immunomodulators of use may be selected from a cytokine, a stem cell growth factor, a lymphotoxin, a hematopoietic factor, a colony stimulating factor (CSF), an interferon (IFN), erythropoietin, thrombopoietin and a combination thereof.
  • CSF colony stimulating factor
  • IFN interferon
  • lymphotoxins such as tumor necrosis factor (TNF), hematopoietic factors, such as interleukin (IL), colony stimulating factor, such as granulocyte-colony stimulating factor (G-CSF) or granulocyte macrophage-colony stimulating factor (GM-CSF), interferon, such as interferons- ⁇ , - ⁇ or - ⁇ , and stem cell growth factor, such as that designated "Sl factor”.
  • TNF tumor necrosis factor
  • IL interleukin
  • colony stimulating factor such as granulocyte-colony stimulating factor (G-CSF) or granulocyte macrophage-colony stimulating factor (GM-CSF)
  • interferon such as interferons- ⁇ , - ⁇ or - ⁇
  • stem cell growth factor such as that designated "Sl factor”.
  • cytokines include growth hormones such as human growth hormone, N- methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; prostaglandin, fibroblast growth factor; prolactin; placental lactogen, OB protein; tumor necrosis factor- ⁇ and - ⁇ ; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF- ⁇ ; platelet- growth factor; transforming growth factors (TGFs) such as TGF- ⁇ and TGF- ⁇ ; insulin-like growth factor-I and -II; erythropoie
  • Chemokines of use include RANTES, MCAF, MlPl-alpha, MIPl-Beta and IP-IO.
  • Radioactive isotopes useful for treating diseased tissue include, but are not limited to- 111 In, 177 Lu, 212 Bi, 213 Bi, 211 At, 62 Cu, 67 Cu, 90 Y, 125 I, 131 1, 32 P, 33 P, 47 Sc, 111 Ag, 67 Ga, 142 Pr, 153 Sm, 161 Tb, 166 Dy, 166 Ho, 186 Re, 188 Re, 189 Re, 212 Pb, 223 Ra, 225 Ac, 59 Fe, 75 Se, 77 As, 89 Sr, 99 Mo, 105 Rh, 109 Pd, 143 Pr, 149 Pm, 169 Er, 194 Ir, 198 Au, 199 Au, and 211 Pb.
  • the therapeutic radionuclide preferably has a decay energy in the range of 20 to 6,000 keV, preferably in the ranges 60 to 200 keV for an Auger emitter, 100-2,500 keV for a beta emitter, and 4,000-6,000 keV for an alpha emitter.
  • Maximum decay energies of useful beta- particle-emitting nuclides are preferably 20-5,000 keV, more preferably 100-4,000 keV, and most preferably 500-2,500 keV. Also preferred are radionuclides that substantially decay with Auger-emitting particles.
  • beta- particle-emitting nuclides are preferably ⁇ 1,000 keV, more preferably ⁇ 100 keV, and most preferably ⁇ 70 keV. Also preferred are radionuclides that substantially decay with generation of alpha-particles.
  • Such radionuclides include, but are not limited to: Dy- 152, At- 211, Bi-212, Ra-223, Rn-219, Po-215, Bi-211, Ac-225, Fr-221, At-217, Bi-213 and Fm-255. Decay energies of useful alpha-particle-emitting radionuclides are preferably 2,000-10,000 keV, more preferably 3,000-8,000 keV, and most preferably 4,000-7,000 keV.
  • radioisotopes of use include 11 C, 13 N, 15 O, 75 Br, 198 Au, 224 Ac, 126 I, 133 I, 77 Br, 113m In, 95 Ru, 97 Ru, 103 Ru, 105 Ru, 107 Hg, 203 Hg, 121m Te, 122m Te, 125m Te, 165 Tm, 167 Tm, 168 Tm, 197 Pt, 109 Pd, 105 Rh, 142 Pr, 143 Pr, 161 Tb, 166 Ho, 199 Au, 57 Co, 58 Co, 51 Cr, 59 Fe, 75 Se, 201 Tl, 225 Ac, 76 Br, 169 Yb, and the like.
  • Some useful diagnostic nuclides may include 124 I, 123 I, 131 I, 18 F, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 89 Zr, 94 Tc, 94m Tc, 99m Tc, or 111 In.
  • Therapeutic agents may include a photoactive agent or dye.
  • Fluorescent compositions such as fluorochrome, and other chromogens, or dyes, such as porphyrins sensitive to visible light, have been used to detect and to treat lesions by directing the suitable light to the lesion. In therapy, this has been termed photoradiation, phototherapy, or photodynamic therapy. See Jori et al. (eds.), PHOTOD YNAMIC THERAPY OF TUMORS AND OTHER DISEASES (Libreria Progetto 1985); van den Bergh, Chem. Britain (1986), 22:430. Moreover, monoclonal antibodies have been coupled with photoactivated dyes for achieving phototherapy. See Mew et al., J.
  • Corticosteroid hormones can increase the effectiveness of other chemotherapy agents, and consequently, they are frequently used in combination treatments.
  • Prednisone and dexamethasone are examples of corticosteroid hormones. .
  • anti-angiogenic agents such as angiostatin, baculostatin, canstatin, maspin, anti-VEGF antibodies, anti-PIGF peptides and antibodies, anti-vascular growth factor antibodies, anti-Flk-1 antibodies, anti-Fit- 1 antibodies and peptides, anti-Kras antibodies, anti-cMET antibodies, anti-MIF (macrophage migration-inhibitory factor) antibodies, laminin peptides, fibronectin peptides, plasminogen activator inhibitors, tissue metalloproteinase inhibitors, interferons, interleukin-12, IP-IO, Gro- ⁇ , thrombospondin, 2- methoxyoestradiol, proliferin-related protein, carboxiamidotriazole, CMlOl, Marimastat, pentosan polysulphate, angiopoietin-2, interferon- alpha, herbimycin A, PNU145156E, 16
  • oligonucleotides especially antisense oligonucleotides that preferably are directed against oncogenes and oncogene products of B- cell malignancies, such as bcl-2.
  • Preferred antisense oligonucleotides include those known as siRNA or RNAi.
  • any of the antibodies, antigen binding antibody fragments or antibody fusion proteins described herein may be conjugated to one or more therapeutic or diagnostic agents.
  • the therapeutic agents do not need to be the same but can be different, e.g., a drug and a radioisotope.
  • 131 I can be incorporated into a tyrosine of an antibody or fusion protein and a drug attached to an epsilon amino group of a lysine residue.
  • Therapeutic and diagnostic agents also can be attached, for example to reduced SH groups and/or to carbohydrate side chains. Many methods for making covalent or non-covalent conjugates of therapeutic or diagnostic agents with antibodies or fusion proteins are known in the art and any such known method may be utilized.
  • a therapeutic or diagnostic agent can be attached at the hinge region of a reduced antibody component via disulfide bond formation.
  • such agents can be attached using a heterobifunctional cross-linker, such as iV-succinyl 3-(2-pyridyldithio)propionate (SPDP). Yu et ⁇ l, Int. J. Cancer 56: 244 (1994). General techniques for such conjugation are well-known in the art.
  • the therapeutic or diagnostic agent can be conjugated via a carbohydrate moiety in the Fc region of the antibody.
  • the carbohydrate group can be used to increase the loading of the same agent that is bound to a thiol group, or the carbohydrate moiety can be used to bind a different therapeutic or diagnostic agent.
  • the Fc region may be absent if the antibody used as the antibody component of the immunoconjugate is an antigen binding antibody fragment.
  • a carbohydrate moiety into the light chain variable region of a full length antibody or antigen binding antibody fragment. See, for example, Leung et al., J. Immunol. 154: 5919 (1995); Hansen et al, U.S. Patent No. 5,443,953 (1995), Leung et al, U.S. Patent No. 6,254,868, each incorporated herein by reference.
  • the engineered carbohydrate moiety is used to attach the therapeutic or diagnostic agent.
  • a chelating agent may be attached to an antibody, antigen binding antibody fragment or fusion protein or to a targetable construct and used to chelate a therapeutic or diagnostic agent, such as a radionuclide.
  • exemplary chelators include but are not limited to DTPA (such as Mx-DTPA), DOTA, TETA, NETA or NOTA.
  • Methods of conjugation and use of chelating agents to attach metals or other ligands to proteins are well known in the art (see, e.g., U.S. Patent Application Serial No. 12/112,289, the Examples section of which is incorporated herein by reference).
  • radioactive metals or paramagnetic ions may be attached to proteins or peptides by reaction with a reagent having a long tail, to which may be attached a multiplicity of chelating groups for binding ions.
  • a tail can be a polymer such as a polylysine, polysaccharide, or other derivatized or derivatizable chains having pendant groups to which can be bound chelating groups such as, e.g., ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), porphyrins, polyamines, crown ethers, bis-thiosemicarbazones, polyoximes, and like groups known to be useful for this purpose.
  • EDTA ethylenediaminetetraacetic acid
  • DTPA diethylenetriaminepentaacetic acid
  • porphyrins polyamines, crown ethers, bis-thiosemicarbazones, polyoximes, and like groups known to be useful for
  • Chelates may be directly linked to antibodies or peptides, for example as disclosed in U.S. Patent 4,824,659, incorporated herein by reference.
  • Particularly useful metal-chelate combinations include 2-benzyl-DTPA and its monomethyl and cyclohexyl analogs, used with diagnostic isotopes in the general energy range of 60 to 4,000 keV, such as 125 I, 131 I, 123 I, 124 I, 62 Cu, 64 Cu, 18 F, 111 In, 67 Ga, 68 Ga, 99m Tc, 94m Tc, 11 C, 13 N, 15 O, 76 Br , for radio-imaging.
  • chelates when complexed with non-radioactive metals, such as manganese, iron and gadolinium are useful for MRI.
  • Macrocyclic chelates such as NOTA, DOTA, and TETA are of use with a variety of metals and radiometals, most particularly with radionuclides of gallium, yttrium and copper, respectively.
  • metal-chelate complexes can be made very stable by tailoring the ring size to the metal of interest.
  • Other ring-type chelates such as macrocyclic polyethers, which are of interest for stably binding nuclides, such as 223 Ra for RAIT are encompassed.
  • Various embodiments concern methods of treating a B-cell lymphoma or leukemia cell disease or an autoimmune disease in a subject, such as a mammal, including humans, domestic or companion pets, such as dogs and cats, comprising administering to the subject a therapeutically effective amount of an antibody, antigen binding fragment thereof or fusion protein.
  • the antibody or antigen binding fragment thereof is an anti- CD20 MAb.
  • the therapy may utilize a "naked antibody" that does not have a therapeutic agent bound to it.
  • the administration of a "naked” anti-CD20 antibody can be supplemented by administering concurrently or sequentially a therapeutically effective amount of another "naked antibody” that binds to or is reactive with another antigen on the surface of the target cell.
  • Preferred additional MAbs comprise at least one humanized, chimeric or human MAb selected from the group consisting of a MAb reactive with CD4, CD5, CD8, CD14, CD15, CD16, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD45, CD46, CD52, CD54, CD70, CD74, CD79a, CD80, CD95, CD126, CD133, CD138, CD154, CEACAM6, B7, MUCl, MUC2, MUC3, MUC4, Ia, HM1.24, HLA-DR, tenascin, FIt-I, Flt-3, VEGFR, PlGF, ILGF, ILGF-IR, IL-6, IL-25, tenascin, MIF, complement factor C5, an oncogene, oncogene product, bcl-2, bcl-6, Kras, cMET, or a combination thereof.
  • Multimodal therapies may include therapy with naked anti-CD20 antibodies supplemented with administration of anti-CD22, anti-CD 19, anti-CD21, anti-CD74, anti-CD80, anti-CD23, anti-CD45, or HLA-DR (including the invariant chain) antibodies in the form of naked antibodies, fusion proteins, or as immunoconjugates.
  • Immunoconjugates may comprise an antibody or antigen binding fragment thereof conjugated to one or more of any therapeutic and/or diagnostic agent as discussed above.
  • the naked anti-CD20 antibodies or antigen binding fragments thereof may also be supplemented with naked antibodies against a MUCl antigen that is expressed on certain B-cells.
  • Various antibodies of use such as anti-CD19 and anti-CD22 antibodies, are known to those of skill in the art. See, for example, Ghetie et al., Cancer Res. 48:2610 (1988); Hekman et al., Cancer Immunol. Immunother. 32:364 (1991); Longo, Curr. Opin. Oncol. 8:353 (1996), U.S. Patent Nos.
  • CVB (1.5 g/m 2 cyclophosphamide, 200-400 mg/m 2 etoposide, and 150-200 mg/m 2 carmustine) is a regimen used to treat non-Hodgkin's lymphoma. Patti et al., Eur. J. Haematol. 51: 18 (1993). Other suitable combination chemotherapeutic regimens are well- known to those of skill in the art. See, for example, Freedman et al., "Non-Hodgkin's Lymphomas," in CANCER MEDICINE, VOLUME 2, 3rd Edition, Holland et al. (eds.), pages 2028-2068 (Lea & Febiger 1993).
  • first generation chemotherapeutic regimens for treatment of intermediate- grade non-Hodgkin's lymphoma include C- MOPP (cyclophosphamide, vincristine, procarbazine and prednisone) and CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone).
  • a useful second generation chemotherapeutic regimen is m-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone and leucovorin), while a suitable third generation regimen is MACOP-B (methotrexate, doxorubicin, cyclophosphamide, vincristine, prednisone, bleomycin and leucovorin).
  • Additional useful drugs include phenyl butyrate, bendamustine, and bryostatin-1.
  • both chemotherapeutic drugs and cytokines are co-administered with an antibody, immunoconjugate or fusion protein, preferably comprising an anti-CD20 antibody or antigen binding fragment thereof.
  • co-administration would refer to the simultaneous administration of two or more agents, such as an antibody and a therapeutic agent.
  • the cytokines, chemotherapeutic drugs and antibody or immunoconjugate can be administered in any order, or together.
  • Immunoconjugates or naked antibodies can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the immunoconjugate or naked antibody is combined in a mixture with a pharmaceutically suitable excipient.
  • Sterile phosphate-buffered saline is one example of a pharmaceutically suitable excipient.
  • suitable excipients are well-known to those in the art. See, for example, Ansel et al., PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger 1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing Company 1990), and revised editions thereof.
  • the immunoconjugate or naked antibody can be formulated for intravenous administration via, for example, bolus injection or continuous infusion.
  • the antibody is infused over a period of less than about 4 hours, and more preferably, over a period of less than about 3 hours.
  • the first 25-50 mg could be infused within 30 minutes, preferably even 15 min, and the remainder infused over the next 2-3 hrs.
  • Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi- dose containers, with an added preservative.
  • the compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • Control release preparations can be prepared through the use of polymers to complex or adsorb the immunoconjugate or naked antibody.
  • biocompatible polymers include matrices of poly(ethylene-co- vinyl acetate) and matrices of a polyanhydride copolymer of a stearic acid dimer and sebacic acid. Sherwood et al., Bio/Technology 10: 1446 (1992). The rate of release of an immunoconjugate or antibody from such a matrix depends upon the molecular weight of the immunoconjugate or antibody, the amount of immunoconjugate, antibody within the matrix, and the size of dispersed particles.
  • the immunoconjugate, antibody fusion proteins, or naked antibody may also be administered to a mammal subcutaneously or even by other parenteral routes. Moreover, the administration may be by continuous infusion or by single or multiple boluses. Preferably, the antibody is infused over a period of less than about 4 hours, and more preferably, over a period of less than about 3 hours. This is preferably performed by infusing slowly at first. For example, a dose of 25 to 50 mg is infused within 15-30 minutes and the remainder of the dose is infused over a period of up to 2-3 hrs.
  • the dosage of an administered immunoconjugate, fusion protein or naked antibody for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. With therapeutic antibodies of lower efficacy than veltuzumab, it may be desirable to provide the recipient with a dosage of immunoconjugate, antibody fusion protein or naked antibody that is in the range of from about 1 mg/kg to 20 mg/kg as a single intravenous infusion, although a lower or higher dosage also may be administered as circumstances dictate. Dosages may range from 1 to 20, 5 to 10, 2 to 10, 10 to 20, 5 to 15, 1 to 10, 1 to 5, 2 to 5 mg/kg or any range in between 1 and 20 mg/kg.
  • the dosage may be repeated as needed, for example, once per week for 4-10 weeks, once per week for 8 weeks, once per week for 4 weeks, or twice or 3- times per week for 2-8 weeks. It may also be given less frequently, such as every other week for several months, or monthly or quarterly for many months, as needed in a maintenance therapy.
  • an antibody such as a naked anti-CD20 MAb, may be administered as one dosage every 2 or 3 weeks, repeated for a total of at least 3 dosages. Or, the antibodies may be administered once per week for 4-8 weeks. If the dosage is lowered to approximately 200-300 mg/m 2 (340 mg per dosage for a 1.7-m 2 patient, or 4.9 mg/kg for a 70 kg patient) or less, it may be administered once weekly for 4 to 8 weeks. Alternatively, the dosage schedule may be decreased, namely every 2 or 3 weeks for 2-3 months. The dosing schedule can optionally be repeated at other intervals and dosage may be given through various parenteral routes, with appropriate adjustment of the dose and schedule.
  • NHL or an autoimmune disease may be treated with 4 weekly infusions of a humanized anti-CD20 antibody at a dose of 100-400 mg/m weekly for 4 consecutive weeks (i.v. (intravenously) over 2-6 hours), repeated as needed over the next months/yrs.
  • the humanized anti-CD20 antibody may be administered at a dose of 100-300 mg/m 2 once every other week or every third week, for 4 to 8 injections.
  • NHL may be treated with 4 weekly infusions as above, or injections less frequently as above, but combined with epratuzumab (anti-CD22 humanized antibody) on the same days, at a dose of 360 mg/m 2 , given as i.v.
  • the antibodies used in combination therapy may also be infused in alternative sequences, such that they are alternated on different weeks, resulting in each being given every other week for a total injection sequence for each of 4 to 8 or more doses. These dosage schedules may then be repeated at different intervals, such as every 3-6 months, depending on the patient's clinical status and response to each therapy regimen.
  • NHL may be treated with 4 weekly infusions, or less frequent infusions, of an anti-CD20 antibody, combined with one or more injections of CD22 MAb radiolabeled with a therapeutic isotope such as yttrium- 90 (at a total dose of Y-90 between 5 and 35 mCi/meter-square as one or more injections over a period of weeks or months).
  • a therapeutic isotope such as yttrium- 90 (at a total dose of Y-90 between 5 and 35 mCi/meter-square as one or more injections over a period of weeks or months).
  • a naked or conjugated anti-CD20 antibody that has been engineered to be particularly efficacious may be administered at very low dosages for treatment of diseases such as B-cell diseases, such as B-cell lymphomas or leukemias, systemic lupus erythematosus, follicular lymphoma, non-Hodgkin's lymphoma or immune thrombocytopenic purpura, or pemphigus vulgaris, as well as such immune diseases as GVHD, hemolytic anemia, cryoglobulinemia, allosensitization, and organ transplant rejection.
  • diseases such as B-cell diseases, such as B-cell lymphomas or leukemias, systemic lupus erythematosus, follicular lymphoma, non-Hodgkin's lymphoma or immune thrombocytopenic purpura, or pemphigus vulgaris, as well as such immune diseases as GVHD, hemolytic anemia, cryoglobulinemia, allosensitization,
  • doses as low as 80 mg or less of veltuzumab, more preferably 50 mg or less, most preferably 30 mg or less, may be efficacious when administered to a human subject.
  • Such dosages may preferably be administered two or more times to the subject at an interval of about one to three weeks, and may even be given more than once weekly, e.g., twice or thrice weekly, such as in a fractionated dosing which may continue over several weeks (which may be preferred in certain diseases, such as, for example, chronic lymphocytic leukemia).
  • anti-CD20 antibodies such as veltuzumab have been found to be effective to deplete circulating B-cells and/or to inhibit the growth of B-cell related tumors.
  • Administration of low dosage anti-CD20 antibodies is preferably by intravenous or subcutaneous delivery.
  • veltuzumab As described in the Examples below, preferred protocols for low-dosage administration of veltuzumab have been found to work well in the practice of the claimed methods and may be utilized.
  • a single i.p. (intraperitoneal) or s.c. (subcutaneously) injection of as low as 5 ⁇ g veltuzumab per 20 gm mouse produced a significant decrease in mortality compared to controls (Example 13). Extrapolating to a 70 kg human the 5 ⁇ g dosage would be equivalent to a single 17.5 mg injection of veltuzumab.
  • Non-limiting examples include administration of 80 mg i.v.
  • veltuzumab in 2 doses at an interval of two weeks (Example 15), 4 once-weekly doses of 138 mg (80 mg/m 2 ) i.v. veltuzumab (Example 15), 4 doses of 80 mg veltuzumab administered s.c. at two week intervals (Example 15), 4 weekly doses of 80 mg/m 2 i.v. veltuzumab (Example 15), 2 doses of 10 mg veltuzumab s.c. at two week interval (Example 17), doses of 40 mg veltuzumab s.c. twice weekly for 6 weeks (Example 18), 2 doses of 40 mg veltuzumab s.c.
  • Example 19 3 doses of 120 mg veltuzumab s.c. weekly(Example 20), an initial i.v. injection of 15 mg veltuzumab followed by 40 mg s.c. weekly for 3 weeks (Example 21), 4 s.c. injections of 40 mg veltuzumab at zero, 8, 12 and 21 days (Example 22) and 4 s.c. injections of 80 mg veltuzumab two weeks apart (Example 16). It is noteworthy that in the latter case (Example 16), a single s.c. injection of 80 mg veltuzumab produced a significant regression of a tumor neck mass and rapid depletion of circulating B-cells.
  • Example 24 shows that 4 once- weekly doses of veltuzumab as low as 80 mg/m 2 resulted in complete responses in at least some human patients with NHL.
  • veltuzumab are exemplary only and that other non-limiting dosages may be utilized in the practice of the claimed methods, such as 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 mg veltuzumab (total dose) or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 mg/m veltuzumab, administered i.v. or more preferably s.c.
  • veltuzumab may be provided in the form of prefilled syringes or autoinjection pens, formulated for s.c, i.v. or other parenteral injection, at a dosage of 10 to 180, 10 to 100 mg, 20 to 80 mg, 30 to 60 mg, 40 to 50 mg or any other range of dosages.
  • Exemplary ranges of low-dosage veltuzumab for s.c, i.v. or i.p. administration may be less than 1 mg, 1 to 2 mg, 1 to 5 mg, 1 to 10 mg, 1 to 20 mg, 1 to 50 mg, 1 to 75 mg, 1 to 100 mg, 2 to 5 mg, 2 to 10 mg, 2 to 20 mg, 2 to 50 mg, 2 to 75 mg, 2 to 100 mg, 5 to 10 mg, 5 to 20 mg, 5 to 30 mg, 5 to 40 mg, 5 to 50 mg, 5 to 60 mg, 5 to 75 mg, 5 to 100 mg, 10 to 20 mg, 10 to 30 mg, 10 to 40 mg, 10 to 50 mg, 10 to 60 mg, 10 to 75 mg, 10 to 100 mg, 20 to 30 mg, 20 to 40 mg, 20 to 50 mg, 20 to 60 mg, 10 to 75 mg, 10 to 100 mg, 20 to 30 mg, 20 to 40 mg, 20 to 50 mg, 20 to 60 mg, 20 to 75 mg, 20 to 100 mg, 25 to 40 mg, 25 to 50 mg, 25
  • the same ranges in mg/m 2 may be administered to a human subject.
  • such low dosages of veltuzumab have been shown to be effective at least in animal model systems and some exemplary human subjects with B-cell related leukemias or lymphomas or autoimmune diseases, or other immune diseases.
  • the compositions described herein are particularly useful for treatment of various autoimmune diseases as well as indolent forms of B-cell lymphomas, aggressive forms of B- cell lymphomas, chronic lymphatic leukemias, acute lymphatic leukemias, and Waldenstrom's macro globulinemia, as well as GVHD, cryoglobulinemia, hemolytic anemia, allosensitization, and organ transplant rejection.
  • the humanized anti-CD20 antibody components and immunoconjugates can be used to treat both indolent and aggressive forms of non-Hodgkin's lymphoma, various autoimmune diseases (e.g., rheumatoid arthritis, SLE, Sjogren's syndrome, pemphigus vulgaris, immune thrombocytopenic purpura), and various other immune diseases (organ transplant rejection, such as kidney and heart rejection, GVHD after allogeneic stem cell transplantion, and immune hemolytic anemia).
  • autoimmune diseases e.g., rheumatoid arthritis, SLE, Sjogren's syndrome, pemphigus vulgaris, immune thrombocytopenic purpura
  • organ transplant rejection such as kidney and heart rejection, GVHD after allogeneic stem cell transplantion, and immune hemolytic anemia.
  • the antibodies can be used for treating B-cell lymphoma and leukemia, and other B-cell diseases or disorders.
  • Exemplary types of cancers that may be targeted include acute lymphoblastic leukemia, chronic lymphocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma and multiple myeloma.
  • Anti-CD20 antibodies can be used to treat B-cell related autoimmune diseases, including Class III autoimmune diseases such as immune-mediated thrombocytopenias (acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpuraO, dermatomyositis, Sjogren's syndrome, multiple sclerosis, Sydenham's chorea, myasthenia gravis, systemic lupus erythematosus, lupus nephritis, rheumatic fever, rheumatoid arthritis, polyglandular syndromes, bullous pemphigoid, diabetes mellitus, Henoch-Sch ⁇ nlein purpura, post-streptococcal nephritis, erythema nodosum, Takayasu's arteritis, Addison's disease, sarcoidosis, ulcerative colitis, erythema multiforme
  • Anti-CD20 antibodies may also induce apoptosis in cells expressing the CD20 antigen. For example, it was demonstrated that apoptosis could be induced using lymphoid cells that have Fc-receptors reactive with the IgGl-Fc of CD20 MAbs that are crosslinked. See Shan et al, Cancer Immunol. Immunother. 48(12):673-683 (2000). Further, it was reported that aggregates of a chimeric CD20 MAb, i.e., homopolymers, induced apoptosis. See Ghetie et al, Blood 97(5): 1392-1398 (2000) and Ghetie et al, Proc. Natl. Acad. Sci USA 94(14): 7509-7514 (1997).
  • kits containing components suitable for treating or diagnosing diseased tissue in a patient.
  • Exemplary kits may contain at least one antibody, antigen binding fragment or fusion protein as described herein. If the composition containing components for administration is not formulated for delivery via the alimentary canal, such as by oral delivery, a device capable of delivering the kit components through some other route may be included.
  • an anti-CD20 antibody or antigen binding fragment thereof such as veltuzumab
  • a prefilled syringe or autoinjection pen containing a sterile, liquid formulation or lyophilized preparation of antibody (e.g., Kivitz et al, Clin. Ther. 2006, 28:1619-29).
  • the kit components may be packaged together or separated into two or more containers.
  • the containers may be vials that contain sterile, lyophilized formulations of a composition that are suitable for reconstitution.
  • a kit may also contain one or more buffers suitable for reconstitution and/or dilution of other reagents.
  • Other containers that may be used include, but are not limited to, a pouch, tray, box, tube, or the like.
  • Kit components may be packaged and maintained sterilely within the containers. Another component that can be included is instructions to a person using a kit for its use.
  • Still other embodiments may concern DNA sequences comprising a nucleic acid encoding an antibody, antigen binding fragment thereof, fusion protein or bispecific antibody.
  • Exemplary sequences that may be encoded and expressed include an anti-CD20 MAb or antigen binding fragment thereof, a fusion protein comprising at least one anti-CD20 antibody or antigen binding fragments thereof, a fusion protein comprising at least one first antibody or antigen binding fragment thereof and at least one second antibody or antigen binding fragment thereof.
  • the first and second antibodies may comprise an anti-CD20 antibody, an antibody against a tumor or B-cell associated antigen such as B7, CD4, CD5, CD8 CD14, CD15, CD16, CD19, CD20, CD21, CD22, CD23, CD25, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD45, CD46, CD52, CD54, CD55, CD59, CD70, CD74, CD79a, CD80, CD95, CD 126, CD133, CD138, CD154, CEACAM6, ED-B fibronectin, IL-2, IL-6, IL-25, MUCl, MUC2, MUC3, MUC4, MIF, NCA-66, Ia, HM1.24, HLA-DR, tenascin, TlOl, TAC, TRAIL-Rl, TRAIL-R2, VEGFR, EGFR, PlGF, ILGF, ILGF-IR, FIt-I, Flt-3, ten
  • Various embodiments relate to expression vectors comprising the coding DNA sequences.
  • the vectors may contain sequences encoding the light and heavy chain constant regions and the hinge region of a human immunoglobulin to which may be attached chimeric, humanized or human variable region sequences.
  • the vectors may additionally contain promoters that express MAbs in a selected host cell, immunoglobulin enhancers and signal or leader sequences.
  • Vectors that are particularly useful are pdHL2 or GS.
  • the light and heavy chain constant regions and hinge region may be from a human EU myeloma immunoglobulin, where optionally at least one of the amino acid in the allotype positions is changed to that found in a different IgGl allotype, and wherein optionally amino acid 253 of the heavy chain of EU based on the EU number system may be replaced with alanine. See Edelman et al, Proc. Natl. Acad. Sci USA 63: 78-85 (1969).
  • the skilled artisan will realize that methods of genetically engineering expression constructs and insertion into host cells to express engineered proteins are well known in the art and a matter of routine experimentation. Host cells and methods of expression of cloned antibodies or antigen binding fragments have been described, for example, in U.S. Patent Application Serial Nos. 11/187,863, filed 7/25/05; 11/253,666, filed 10/20/05 and 11/487,215, filed 7/14/06, the Examples section of each of which is incorporated herein by reference.
  • VK (variable light chain) and V H (variable heavy chain) sequences for anti-CD20 antibodies may be obtained by a variety of molecular cloning procedures, such as RT-PCR, 5'- RACE, and cDNA library screening.
  • V genes of an anti-CD20 MAb from a cell that expresses a murine anti-CD20 MAb can be cloned by PCR amplification and sequenced.
  • the cloned V L and V H genes can be expressed in cell culture as a chimeric Ab as described by Orlandi etal, (Proc. Natl. Acad. ScL, USA, 86: 3833 (1989)).
  • a humanized anti-CD20 MAb can then be designed and constructed as described by Leung et al. (MoI. Immunol., 32: 1413 (1995)).
  • cDNA can be prepared from any known hybridoma line or transfected cell line producing a murine anti-CD20 MAb by general molecular cloning techniques (Sambrook et al., Molecular Cloning, A laboratory manual, 2 nd Ed (1989)).
  • the VK sequence for the MAb may be amplified using the primers VKlBACK and VKlFOR (Orlandi et al., 1989) or the extended primer set described by Leung et al.
  • V H sequences can be amplified using the primer pair VH1BACK/VH1FOR (Orlandi et al, 1989) or the primers annealing to the constant region of murine IgG described by Leung et al. (Hybridoma, 13:469 (1994)).
  • Amplified VK and VH fragments can be purified on 2% agarose (BioRad, Richmond, CA).
  • the humanized V genes can be constructed by a combination of long oligonucleotide template syntheses and PCR amplification as described by Leung et al. (MoI. Immunol, 32: 1413 (1995)).
  • PCR products for VK can be subcloned into a staging vector, such as a pBR327 -based staging vector, VKpBR, that contains an Ig promoter, a signal peptide sequence and convenient restriction sites to facilitate in-frame ligation of the VK PCR products.
  • PCR products for V H can be subcloned into a similar staging vector, such as the pBluescript-based VHpBS. Individual clones containing the respective PCR products may be sequenced by, for example, the method of Sanger et al (Proc. Natl. Acad. ScL, USA, 74: 5463 (1977)).
  • VK and V H sequences can be excised from VKpBR and VHpBS, respectively, by double restriction digestion as Hindlll-BamHI fragments.
  • the VK and V H expression cassettes can be ligated into appropriate expression vectors, such as pKh and pGlg, respectively (Leung et al, Hybridoma, 13:469 (1994)).
  • the expression vectors can be co-transfected into an appropriate cell, e.g., myeloma Sp2/0-Agl4 (ATCC, VA), colonies selected for hygromycin resistance, and supernatant fluids monitored for production of a chimeric, humanized or human anti-CD20 MAb by, for example, an ELISA assay.
  • the VK and VH expression cassettes can be assembled in the modified staging vectors, VKpBR2 and VHpBS2, excised as Xbal/BamHI and XhoI/BamHI fragments, respectively, and subcloned into a single expression vector, such as pdHL2, as described by Gilles et al (J. Immunol.
  • Co-transfection and assay for antibody secreting clones by ELISA can be carried out as follows. About 10 ⁇ g of VKpKh (light chain expression vector) and 20 ⁇ g of VHpGIg (heavy chain expression vector) can be used for the transfection of 5 X 10 6 SP2/0 myeloma cells by electroporation (BioRad, Richmond, CA) according to Co et al, J. Immunol, 148: 1149 (1992). Following transfection, cells may be grown in 96-well microtiter plates in complete HSFM medium (Life Technologies, Inc., Grand Island, NY) at 37 0 C, 5% CO 2 .
  • complete HSFM medium Life Technologies, Inc., Grand Island, NY
  • the selection process can be initiated after two days by the addition of hygromycin selection medium (Calbiochem, San Diego, CA) at a final concentration of 500 units/ml of hygromycin. Colonies typically emerge 2-3 weeks post-electroporation. The cultures can then be expanded for further analysis. Transfectoma clones that are positive for the secretion of chimeric, humanized or human heavy chain can be identified by ELISA assay.
  • Antibodies can be isolated from cell culture media as follows. Transfectoma cultures are adapted to serum-free medium. For production of chimeric antibody, cells are grown as a 500 ml culture in roller bottles using HSFM. Cultures are centrifuged and the supernatant filtered through a 0.2 ⁇ membrane. The filtered medium is passed through a protein A column (1 x 3 cm) at a flow rate of 1 ml/min. The resin is then washed with about 10 column volumes of PBS and protein A-bound antibody is eluted from the column with 0.1 M glycine buffer (pH 3.5) containing 10 mM EDTA.
  • 0.1 M glycine buffer pH 3.5
  • Fractions of 1.0 ml are collected in tubes containing 10 ⁇ l of 3 M Tris (pH 8.6), and protein concentrations determined from the absorbance at 280/260 nm. Peak fractions are pooled, dialyzed against PBS, and the antibody concentrated, for example, with the Centricon 30 (Amicon, Beverly, MA). The antibody concentration is determined by ELISA and its concentration adjusted to about 1 mg/ml using PBS. Sodium azide, 0.01% (w/v), is conveniently added to the sample as preservative.
  • Example 1 Construction of chimeric and humanized anti-CD20 antibodies
  • the construction of chimeric (cA20) and humanized (hA20, veltuzumab) anti-CD20 antibodies was performed as described in U.S. Patent No. 7,151,164, the Examples section of which is incorporated herein by reference. (See also, Stein et al, Clin Cancer Res 2004; 10: 2868-2878.)
  • the variable region DNA and amino acid sequences of cA20 and hA20 are disclosed, respectively, in FIG. 1 and FIG. 2.
  • CDR sequences of cA20 and hA20 are identical to those of rituximab (parental murine MAb C2B8), with the exception of the third CDR of the heavy chain (CDRH3).
  • CDRH3 the heavy chain CDR sequences are referred to as CDRH 1-H3 and the light chain CDRs as CDRL1-L3.
  • CDRH3 sequences for anti-CD20 antibodies only C2B8 and the corresponding rituximab have an asparagine residue at Kabat position 101.
  • veltuzumab (hA20) were constructed using the same human IgG donor framework regions (FRs) as the humanized anti-CD22 antibody epratuzumab (Leung et al, MoI Immunol 1995; 32: 1413-1427). Specifically, FRl, FR2, and FR3 of the human EU antibody and FR4 of the human NEWM antibody were selected for the heavy chain and the FRs of the human REI antibody were selected for the light chain of the humanized hA20 antibody. As disclosed in U.S. Patent No.
  • hA20VHl contains nine changes from the human EU frameworks
  • hA20V ⁇ contains seven amino acid changes from the REI framework (U.S. Patent No. 7,151,164).
  • FIG. 3 A comparison of the variable region sequences of cA20, hA20 and rituximab (from c2B8) is shown in FIG. 3.
  • cA20 differs from veltuzumab (hA20) in the variable framework regions but has identical CDRs as veltuzumab.
  • the framework region sequences of cA20 are identical to those of rituximab (c2B8), with the exception of three amino acid residues at the N-terminal end of the light chain, while the framework region sequences of ritixumab and veltuzumab differ at 18 residues in the light chain and 14 residues in the heavy chain.
  • veltuzumab and rituximab differ significantly with respect to the rate of dissociation from CD20 positive lymphoma cells and in certain therapeutic characteristics in vivo and in vitro.
  • DlOlN a mutant of veltuzumab, designated DlOlN, was engineered with a non-conservative single amino acid change of aspartic acid to asparagine at position 101 in CDRH3.
  • DlOlN has the same CDRs as rituximab but identical FRs to veltuzumab. Further details of the construction of DlOlN are provided below.
  • Table 1 compares the CDRH3 sequences of veltuzumab, cA20, DlOlN, rituximab, and 1F5, all of which have identical CDRHl and CDRH2 sequences. Table 1. Comparison of CDRH3 1
  • Residues marked as • are identical to those of veltuzumab in the same position.
  • a third PCR reaction using a mixture of the 210 bp and 510 bp products as template and the 5' Xhol and 3' Hind3 primers produced a 680 bp amplimer, which was gel isolated and cloned into the pGemT PCR cloning vector (Promega, Madison, WI). The sequence of the amplimer was confirmed by automated DNA sequencing. The 680 bp fragment was excised from the pGemT vector with Xhol and Hind III restriction enzymes and ligated into the hA20-pdHL2 vector, which was prepared by digestion with the same enzymes. The sequence of the final vector, D101N-hA20-pdHL2, was confirmed by automated DNA sequencing.
  • the murine hybridoma 1F5 and the human Burkitt lymphoma lines, Daudi, Raji and Ramos, were purchased from the American Type Culture Collection (Manassas, VA).
  • the non-Burkitt lymphoma cell lines used were: SU-DHL-6 from Dr. Alan Epstein (University of Southern California, Los Angeles, CA), and WSU- FSCCL from Dr. Mitchell Smith (Fox Chase Cancer Center, Philadelphia, PA).
  • the cells were grown as suspension cultures in DMEM (Life Technologies, Inc. Gaithersburg, MD), supplemented with 10% fetal bovine serum, penicillin (100 units/ml), streptomycin (100 ⁇ g/ml), and L-glutamine (2 mM).
  • the maximum number of binding sites per Raji cell and the apparent dissociation constants of veltuzumab and rituximab were determined by nonlinear regression analysis of the saturation binding data obtained with the radioiodinated samples and Raji cells, using Prism software (GraphPad Software Inc., San Diego, CA).
  • Raji cells (5xlO 5 ) were incubated with radioiodinated MAbs in an assay volume of 225 ⁇ l, using tissue culture media as diluent, for 1 h at 37°C or room temperature. Cells then were washed twice with PBS containing 1% horse serum, and cell pellets were counted in a gamma counter.
  • the MAbs were titrated at a 2:3 serial dilution starting with approximately 2xlO 6 cpm/2 ⁇ g MAb/tube, run in triplicate. Non-specific binding was measured by including replicate unlabeled MAb. Immunoreactivity of the radiolabeled MAbs, measured by binding to anti-idiotype antibodies, was 90% or greater.
  • the results shown in FIG. 4 demonstrate that both the number of binding sites per cell and the equilibrium dissociation constants (functional K d ) were similar for veltuzumab and rituximab.
  • the number of binding sites per Raji cell was calculated to range from 2.0x10 - 4.2xlO 5 for veltuzumab versus 1.8xlO 5 - 3.6 x 10 5 for rituximab.
  • the apparent dissociation constant values ranged from 6.23 - 12.02 nM for veltuzumab versus 6.70 - 8.63 nM for rituximab.
  • Ag (Antigen)-binding specificity and affinity studies of the anti-CD20 Abs cA20, hA20, and clF5, purified by affinity chromatography on a Protein A column were evaluated by a cell surface competitive binding assay with murine 2B8 and rituximab (IDEC Pharmaceuticals Corp., San Diego, CA).
  • a constant amount (100,000 cpm, -10 ⁇ Ci/ ⁇ g) of 125 I-labeled m2B8 or rituximab was incubated with Raji cells in the presence of varying concentrations (0.2-700 nM) of competing Abs (cA20, hA20, m2B8, clF5, or rituximab) at 4°C for 1-2 h. Unbound Abs were removed by washing the cells with PBS. Radioactivity associated with the cells was determined after washing. The results (not shown) demonstrated that cA20, hA20 and cIF5 all competed for binding to CD20 with rituximab (c2B8) and murine 2B8.
  • veltuzumab, rituximab, cA20, DlOlN, 15F and tositumomab were compared by flow cytometry using Daudi, Raji and Ramos cells (FIG. 5).
  • Each MAb was labeled with phycoerythrin (PE) using a Zenon R- Phycoerythrin Human IgG labeling kit following the manufacturer's suggested protocol (Invitrogen, Molecular Probes, Z-25455).
  • CM phenol red-free RPMI 1640 media supplemented with 10% FBS
  • CM phenol red-free RPMI 1640 media supplemented with 10% FBS
  • the in-vitro cytotoxicity assay was based on the method of Mosmann ( J Immunol Methods, 65: 55-63, 1983). Briefly, cell lines were plated at 1-2 x 10 4 cells/well (100 ⁇ l) in 96-well plates, to which antibodies were added (100 ⁇ l). After incubation for 4 days at 37°C in a humidified CO 2 (5%) incubator, 25 ⁇ l of 5.0 mg/ml MTT [3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyltetrazolium bromide] was added, and the cells were incubated for an additional 4 h at 37 0 C. Plates were then centrifuged and supernatants removed.
  • Pellets were dissolved using 100 ⁇ l DMSO/well and optical density was measured at 570 nm on a microplate reader (Molecular Devices, Sunnyvale, CA). Because unlabeled rituximab and veltuzumab were reported previously to require crosslinking for cytotoxic activity (Stein et al., Blood, 104: 3705-3711, 2004), goat-anti-human IgG (GAH) was added to some of the wells. Veltuzumab and rituximab were used at a final concentration of 5 ⁇ g/ml and GAH was used at 20 ⁇ g/ml. All tests were performed in 4 replicates.
  • veltuzumab and rituximab were examined using MTT cytotoxicity assays on four lymphoma cell lines, SU-DHL-6, Daudi, Raji, and WSU- FSCCL, which differ in their expression levels of CD20 ( Stein et al., Clin Cancer Res, 10: 2868-2878, 2004). While the sensitivity to both MAbs correlated with CD20 expression (SU-DHL-6 > Raji > Daudi > WSU-FSCCL), no significant differences in potency were observed between veltuzumab and rituximab within a cell line (FIG. 6).
  • Crosslinking with second antibody increased the efficacy of veltuzumab and rituximab on Raji and Daudi cells, two cell lines with intermediate levels of CD20 expression and sensitivity to killing by anti-CD20 MAbs (FIG. 6).
  • Inhibition of proliferation of cell lines on either extreme of anti-CD20 sensitivity e.g., SU-DHL-6, which is very sensitive, and WSU-FSCCL, which is very insensitive
  • did not benefit by the addition of second antibody did not benefit by the addition of second antibody (FIG. 6).
  • veltuzumab The effects of veltuzumab on human peripheral blood lymphocytes of healthy volunteers were assessed in vitro using flow cytometry. Aliquots of whole blood were incubated with veltuzumab for two days followed by analysis of B-cells (CD 19+) and T-cells (CD3+) by FACS. Controls included no antibody and a negative control humanized MAb (anti-CEACAM5 monoclonal antibody, hMN-14). Incubation of whole blood with veltuzumab led to significant decreases in the number of B-cells, but not T-cells (FIG. 7).
  • B-cells Decreases of B-cells ranged from 26 - 80% using 5 ⁇ g/ml, and 11 - 61 % using 1 ⁇ g/ml (P values vs. untreated cells ⁇ 0.05 with 1 ⁇ g/ml [6.7 nM] for 3/3 blood donors and 5 ⁇ g/ml [33.3 nM] for 5/5 blood donors). Because whole blood was used in the incubation mixtures, the decreases observed in the cell counts could be due to CDC or ADCC, as well as direct signaling.
  • a fluorometric method was used to evaluate and compare CDC activity of veltuzumab vs. rituximab. Daudi, Raji or Ramos cells (I x 10 6 /mL) were seeded (50 ⁇ L per well) in black 96- well plates (Nunc) and incubated for 3 h at 37 °C and 5% CO 2 with each test MAb (0.001 to 10 ⁇ g/mL) in the presence of human complement (Quidel Corp., San Diego, CA) at 1/20 final dilution. The indicator dye, AlamarBlue (BioSource, Camarillo, CA), was added and the incubation continued overnight.
  • AlamarBlue BioSource, Camarillo, CA
  • Viable cells were then quantified by measuring the fluorescence intensity with excitation at 530 nM and emission at 590 nM using a BioTek SynergyTM HT Multi-Detection Microplate Reader and KC4 Signature Software (BioTek Instruments, Inc., Winooski, VT).
  • the dose-response curves generated from the mean of 6 replicate determinations were analyzed using Prism software to obtain EC 50 values.
  • the experiments used a multi-factorial design, where the assay for each antibody was performed in triplicate each day, and repeated on three different days for a total of 9 assays per antibody.
  • the samples included 3 different lots of veltuzumab and one of rituximab.
  • Statistical analysis of the EC 50 data was based on a 2- way analysis of variance (ANOVA) model with day and antibody type as factors. Dunnett's multiple comparison procedure was utilized to perform the 3 comparisons of all 4 constructs at an overall experimental error rate of 0.05.
  • Example 9 Antibody-dependent cellular cytotoxicity (ADCC) assays.
  • PBMCs peripheral blood mononuclear cells
  • Daudi cells were incubated with each test antibody in triplicate at 5 ⁇ g/mL for 30 min at 37 0 C and 5% CO 2 .
  • Freshly isolated peripheral blood mononuclear cells (PBMCs) obtained from healthy volunteers were then added at a predetermined optimal effector-to-target ratio of 50: 1. Following a four hour incubation, cell lysis was assessed by CytoTox-One (Promega, Madison, WI). ADCC was determined for MAb + effector cells, MAb + target cells, and MAb + target cells + effector cells. Control wells containing MAb alone and target cells alone also were processed.
  • MET represents wells containing MAb, effector and target cells
  • ET is wells containing effector and target cells
  • T wells containing target cells only
  • Max is wells containing target cells and lysis buffer:
  • Example 10 Effects of natural killer (NK) cell and neutrophil depletion on therapy.
  • NK cells and neutrophils were performed as described previously (Hernandez-Ilizaliturri et. al., Clin Cancer Res 9:5810-12, 2003). Briefly, each mouse received 100 ⁇ L of anti-mouse Gr-I ascites i.p. (provided by Dr. FJ. Hernandez-Ilizaliturri, Roswell Park Cancer Institute, Buffalo, NY) and 100 ⁇ g anti-mouse IL-2 receptor antibody (TM ⁇ -1, BD PharMingen, Inc., San Jose, CA) one day before inoculating Ix 10 6 Raji cells, followed by two more i.p. injections of anti-mouse Gr-I ascites on Days 6 and 13. Depletion was confirmed by FACS analysis of blood samples taken from 1 depleted and 1 non-depleted mouse on Days 3 and 13. Veltuzumab (200 ⁇ g) or saline was administered i.v. on Days 3, 5, 7, and 11.
  • Example 11 Analysis of serum pharmacokinetics in mice after i.p. or s.c. administration.
  • a 96-well assay plate (Nunc Maxisorp Certified Flat-Bottom Immuno Modular w/frame; NalgeNunc International Corp., Rochester, NY) was coated with a rat anti- veltuzumab idiotype monoclonal antibody, WR2 (Immunomedics, Inc., Morris Plains, NJ).
  • a standard curve was constructed by making 8 serial dilutions of veltuzumab (100 to 1.56 ng/mL). The murine serum samples were appropriately diluted and, together with the standards, pipetted into triplicate wells.
  • Bound veltuzumab was detected with a peroxidase- conjugated goat anti-human polyclonal antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), and the plates developed using an OPD solution (o-phenylenediamine dihydrochloride, Sigma- Aldrich, St. Louis, MO). The plates were incubated in the dark until the color developed in the standard curve wells (-20 min). At this time, 4N sulfuric acid was added to the wells to stop the reaction, and the plates read on a plate reader at OD 49 onm. [0169] Using Prism software (GraphPad Software, Inc.), the concentration of veltuzumab was calculated in the mouse serum samples based on the standard curve.
  • Plasma concentrations that were determined from the above assay were converted to nmol/mL and analyzed using the WinNonLin PK software package (v5.1, Pharsight Corp., Mountain View, CA). Non-compartmental analysis was performed on both the i.p. and s.c. data (representing the best-fit model).
  • mice used in our PK study weighed an average of 30 g.
  • Whole blood volume in mice is estimated based on their weight and uses a range of 5.5 to 7% of body weight as mL of whole blood. If we use an average of 6.25%, our mice had approximately 1.9 mL whole blood of which approximately 50% is serum or 0.95 mL.
  • the monkeys were examined regularly, with blood sampling taken for MAb titers and PK, blood chemistry, coagulation, and hematology testing, as well as urinalysis, and then postmortem evaluation of lymphoid tissue status in spleen, mandibular, and mesenteric lymph nodes.
  • Veltuzumab administered i.v. or s.c. as single or multiple doses was well tolerated, with no clinical or persistent laboratory test abnormalities noted other than B-cell depletion in the circulation and lymphatic organs.
  • Post-mortem changes in the animals receiving all doses included follicular lymphoid depletion of the spleen, mandibular, and mesenteric lymph nodes at all doses (data not shown).
  • Transient decreases in white blood cells, neutrophils, lymphocytes, and basophils were noted, but only a rapid and persistent reduction in the number of peripheral blood B-cells was observed (not shown). These effects occurred within 2 days of dosing by either route and were present at doses of 6.7 mg/kg or higher.
  • Pharmacokinetic analyses indicated that the half-life was estimated at 5 to 8 days after i.v. injection or 6-13 days following s.c. administration, and the T max for both routes ranged from 2 to 5 days.
  • C max following i.v. injection was linear and showed no accumulation, and the AUCo- 27 days was greater for i.v. administration than for the s.c. route (not shown). This is likely related to the longer period required for the MAb to enter the blood stream via the s.c. route with a similar rate of clearance.
  • the dose-normalized AUC values showed accumulation of veltuzumab after i.v. -infusion or s.c.
  • Example 13 In-vivo efficacy of veltuzumab in mouse models.
  • mice were inoculated i.v. on Day 0 with 1.5xlO 7 cells, weighed, and randomly assigned to six treatment and two control groups (8 per group). On Day 1, mice in a treatment group received a single dose of veltuzumab (5, 20, or 60 ⁇ g) s.c.
  • each mouse in groups of 15 was inoculated with 2.5 x 10 6 cells i.v. and 5 days later received a single dose of veltuzumab (0.035, 0.35, 3.5, or 35 ⁇ g) i.p.
  • Animals were monitored daily and sacrificed humanely when hind-limb paralysis developed, when they became moribund, or if they lost more than 20% of initial body weight. Survival curves were analyzed using Kaplan-Meier plots (log-rank analysis), using the Prism (v4.03) software package (GraphPad Software, Inc.).
  • mice succumbed to disease (hind-limb paralysis) on day 28 the mean survival times (MSTs) of the two 60- ⁇ g groups were 101.9 ⁇ 26.8 and 114.6 ⁇ 21.8 days for i.p. and s.c, respectively, with 4/8 and 6/8 mice still alive when the study ended on Day- 126. Similar results were obtained for the animals given 20 ⁇ g, with the MSTs of 116.4 + 14.0 (i.p.) and 108.4 + 26.2 (s.c.) days, and 5/8 mice alive at the end of the study in both groups.
  • mice Only at the lowest dose (5 ⁇ g) was a >50% mortality rate observed (3/8 and 1/8 mice were still alive at the end of the study in each i.p./s.cgroup), but these mice still had a >3.2-fold increase in the MSTs (91.1 ⁇ 30.9 and 91.6 ⁇ 22.5 days for i.p. and s.c, respectively) compared to controls.
  • veltuzumab in Daudi Burkitt lymphoma xenografts.
  • a single 5 ⁇ g dose of veltuzumab proved to be potent in the Daudi disseminated Burkitt lymphoma model, even lower doses (0.5, 0.25, 0.1, and 0.05 ⁇ g) were then examined in this same disease model.
  • all four doses improved survival significantly (P ⁇ 0.0001) when compared to saline control mice (FIG. 9).
  • mice receiving a single dose of 0.5 ⁇ g had a 3-fold improvement in the MST compared to controls (69.5 ⁇ 23.9 vs. 21.4 ⁇ 1.1 days).
  • Even the lowest tested dose of 0.05 ⁇ g (50 ng) increased the MST (50 ⁇ 8 days) by more than 2-fold over the controls.
  • veltuzumab in follicular cell lymphoma xenografts.
  • a disseminated follicular cell lymphoma model WSU-FSCCL xenografts
  • groups of mice were administered single i.p. injections of veltuzumab (FIG. 10). Each group received a 10-fold dilution ranging from a high of 35 ⁇ g to a low of 0.035 ⁇ g (35, 3.5, 0.35, and 0.035 ⁇ g). Therapy did not start until 5 days after the administration of the WSU- FSCCL cells. All four doses significantly increased survival of the mice when compared to the saline control (FIG.
  • mice administered the 35- ⁇ g dose (44.3 ⁇ 4.9 days) was not significantly different from that of the 3.5- ⁇ g group (39.5 ⁇ 4.6 days), but was significantly (P ⁇ 0.021) longer than that of the 0.35- and 0.035- ⁇ g (35 ng) groups (40.5 ⁇ 1.6 days and 33.3 ⁇ 2.1 days, respectively). However, all mice, except for one in the 3.5- ⁇ g group, succumbed to disease progression by Day-61.
  • Veltuzumab shows improved in vivo efficacy compared to rituximab in a mouse model system.
  • SCID mice were inoculated with human Burkitt lymphoma (Raji) cells by tail vein injection. At 5, 10, 15 and 20 days after inoculation, the mice received either rituximab or veltuzumab (hA20) at 10 mg/kg/dose. The results of cumulative survival are shown in FIG. 13.
  • FIG. 13 shows that at over 90 days after inoculation, SCID mice with Raji lymphoma that had been treated with veltuzumab exhibited about an 80% survival rate, while equivalent mice treated with rituximab exhibited a survival rate close to zero.
  • the lower part of FIG. 13 shows that the estimated median cumulative survival was 22.1 days for control mice, 47.9 days for mice treated with rituximab and not yet reached for mice treated with veltuzumab.
  • a 79-year-old female with marginal zone lymphoma was initially diagnosed 12 years earlier and previously treated with CHOP and then CVP, but no rituximab. She presented with stage-IV disease including 2 enlarged iliac lymph nodes and bone marrow involvement. She received 4 once-weekly doses of 138 mg (80 mg/m 2 ) veltuzumab administered intravenously. B-cell levels were depleted following the first dose, and serum antibody levels increased with successive doses, reaching 120 ⁇ g/ml after the last dose and then clearing slowly with values still measurable (5 ⁇ g/ml) at last evaluation, 12 weeks later. Most importantly, the patient had an excellent response to treatment, with regression of the iliac lymph nodes to normal size on a CT scan and a negative bone marrow biopsy. The complete response is currently continuing at the last evaluation, 15 months after treatment.
  • a 42-year-old female with a 15-year history of follicular lymphoma had received multiple prior treatment regimens, including intravenous veltuzumab to which she had achieved a 9-month response. She received 80 mg veltuzumab injected subcutaneously every two weeks for a total of 4 doses. In spite of the low dose administered by this route, B-cell levels were depleted following the first dose. Serum antibody levels measured over several days following the initial dose showed levels increasing slowly to 10 ⁇ g/ml, which is comparable to levels obtained with intravenous administration.
  • a 41-year-old male with stage-IV, grade-3, follicular lymphoma was initially diagnosed 8 years earlier and had previously been treated with CHOP chemotherapy but no rituximab. He received 4 once-weekly doses of 80 mg/m 2 veltuzumab administered intravenously. B-cell levels were depleted following the first dose, and serum antibody levels increased with successive doses, reaching 86 ⁇ g/mL after the last dose and then clearing slowly with values still measurable (4 ⁇ g/mg) at last evaluation, 12 weeks later. Most importantly, there was complete disappearance of all disease including a 3.6 cm scalp lesion that had been present at study entry.
  • AF is a 63-year-old white male with Grade-3 follicular large-cell non-Hodgkiin's lymphoma, proven to be CD20+ by lymph node biopsy in January of 2004. His stage at diagnosis was stage 3, but presents now in stage 2. His prior therapy in 1992 included doxorubicin, vincristine, high-dose cyclophosphamide, which resulted in a remission of 24 months. In 1996, he received a regimen of ICE (ifosfamide, carboplatin and etoposide), and also stem-cell therapy, followed by consolidation radiation to a retroperitoneal mass. He responded for 88 months.
  • ICE ifosfamide, carboplatin and etoposide
  • MT is a 3-year old Asian female followed since age 11 months for multiple hematological autoantibodies and pancytopenia. At age 11 months she presented with diarrhea, red spots on her legs, blood in stools, diffuse petechiae and purpura on head, neck, trunk, and extremities, cervical adeonopathy, including several 1-cm axillary nodes, slightly enlarged spleen, increased fatigue, decreased appetite, bruising, and blasts on peripheral blood smear, increased sed rate (116 mm/h), D-dimer elevated, and bone marrow aspirate showing a hypercellular marrow (>90% cellularity), erythroid, myeloid and megakaryocyte precursors being abundant (maturation arrest myelocyte/metamyelocyte level but mature neutrophils seen).
  • Red cell precursors also showed some maturation arrest, but no cytogenetic abnormalities.
  • Lab studies also indicated elevations in immunoglobulins IgA, IgG, and IgM, and an increase in circulating CD19+ B-cells (48%).
  • the patient was first given steroids, but had a poor or no initial response. Therefore, she was given two courses of rituximab. In the first course, she received 4 weekly doses and the platelet count stabilized, but she continued to be anemic and neutropenic.
  • Her CD20 and CD 19 lymphocytes decreased, but after only 5-6 weeks, these increased dramatically.
  • a second course of rituximab involved 3 weekly doses, and over several weeks, her platelet count, hemoblobin and absolute neutrophil normalized, and after 2-3 months, red cell and platelet antibodies resolved. This remission to rituximab lasted for 9 months, but then thrombocytopenia was noted on a routine CBC, and again red cell, neutrophil and platelet antibody was detected. The patient was then given prednisone and intravenous immunoglobulin, and showed a partial response.
  • veltuzumab consisting of 10 mg subcutaneously, repeated at a dose of 10 mg veltuzumab given subcutaneously 2 weeks later.
  • depletion of circulating CD19-positive B-cells is found, and improvement in her red blood cell and platelet counts is observed.
  • the patient' s general condition shows improvement, her red blood cell, neutrophil, and platelet antibodies are barely measureable, and all hematological abnormalities show significant improvement, with platelet, neutrophil, and RBC counts being at the lower end of the normal ranges.
  • RT is a 47-year-old female with a 3-year history of chronic lymphocytic leukemia, now relapsed after a course of alemtuzumab (CAMPATH®), but prior history shows that she had responses of various durations to chlorambucil and other cytotoxic drugs. She presents now with evidence of CLL in her bone marrow and also an elevated peripheral lymphocyte count with prominent blasts of 58,000/cmm. She is given subcutaneous injections of 40 mg veltuzumab twice weekly for 6 weeks, and after the second injection, the peripheral lymphocyte count drops by 55%. Two weeks after the fourth s.c. injection, her peripheral blood counts are slightly above the normal range, but more importantly, bone marrow aspiration shows a definite good partial response, and the clinical picture of fatigue, petechiae, and diffuse enlarged cervical and other lymph nodes improve dramatically.
  • CAMPATH® alemtuzumab
  • RH is a 66-year-old male with a history of ITP for 1.5 years, 4 prior therapies, no splenectomy, and presenting with 26,000 platelets/cmm at baseline. He is given 2 doses of 40 mg veltuzumab subcutaneously, 2 weeks apart. Prior to the second injection, measurement of his blood CD 19+ lymphocytes shows >90% reduction. Two weeks after the second injection of veltuzumab, his platelet count shows a doubling, which increases to 70,000 by the 5 th week post therapy, which is maintained until week 11, when the platelet count again falls to counts of ⁇ 5,000/cmm. The patient is then retreated twice with 30 mg veltuzumab s.c, again 2 weeks apart.
  • the platelet count rises to 28,000/cmm, and then to 42,000/cmm by week 3 post therapy.
  • the platelet count is significantly improved to 67,000/cmm, and the patient is considered to have a good partial response, with no evidence of bleeding or petechiae during veltuzumab therapy, and returns to full-time activity and work.
  • FH is a 37-year-old female who gradually develops painful joints, particularly her wrists, over 3 months, with pain and early morning stiffness of about 40 min. On examination, both her wrists and the metacarpophalangeal joints of both her hands are swollen and tender, but are not deformed; there are no nodules or vasulitic lesions. She has an elevated C-reactive protein (CRP) level of 30 mg/1 but otherwise normal laboratory findings, but with a positive rheumatoid factor and antinuclear antibodies. She clearly is at the beginning of RA and is first treated with ibuprofen.
  • CRP C-reactive protein
  • K.S. is a 41-year-old woman who is referred to an oral surgeon for evaluation of a dry mouth. Except for an elevated sedimentation rate (ESR, 60 mm/h), she has no remarkable laboratory abnormalities. She develops a mild conjunctivitis and sore eyes 2 months later. Her rheumatoid factor becomes positive, her total serum proteins are raised (lOOg/1), as also is her IgG level (30 g/1). The Schirmer test is markedly abnormal (only 3 mm of the filter strip in the right eye and 1 mm of that in the left eye became wet).
  • She is treated with methylcellulose eye drops to prevent corneal ulceration, and over the next year shows a steady elevation of rheumatoid factor titer and anti-nuclear antibodies, and also develops evidence of polyarthritic changes in her hands and wrists. She is considered to have a mild Sjogren's syndrome and receives non-steroidal anti-inflammatory drugs (NSAIDs) for the arthritis, but these have no effect on the sicca complex. She is then given a course of veltuzumab, starting with an intravenous infusion of 15 mg, followed after a week by three more subcutaneous injections of 40 mg veltuzumab weekly.
  • NSAIDs non-steroidal anti-inflammatory drugs
  • SW is a 56-year-old, 55 kg, woman with 5 previous living births and with end-stage renal disease and is waiting for a transplant to replace her left kidney. .
  • She is highly HLA sensitized, showing high titers of anti-HLA antibodies. She is undergoing regular hemodialysis.
  • she requires desensitization to the anti-HLA antibodies, and therefore is administered one intravenous dose of 120 g of human polyclonal immune globulin (10% formulation), followed 4 days later by an s.c. injection of 40 mg veltuzumab.
  • the veltuzumab s.c. injection is repeated on day 8, day 12, and again on day 21. After the first injection, the blood CD 19+ B-cells totally disappear, and 8 weeks after the 4 th s.c. injection of veltuzumab, they remain depleted.
  • the patient receives a kidney transplant from a deceased donor, and a typical induction therapy immediately thereafter (30 mg alemtuzumab s.c.) and then immunosuppressive therapy consisting of prednisone, mycophenolate mofetil, and tacrolimus, tapered over the next year, as well as prophylactic antibiotics, are given.
  • She has no rejection episode as monitored for the year post transplantation, and her renal functions normalize. This appears to be a successful case of desensitizing a patient in need of a renal transplant quite effectively, resulting in a successful transplant.
  • rituximab induces objective responses, mostly partial responses, in about half of patients with follicular lymphoma (Castillo et al., Exp Hematol. 2008, 36:755-768), yet both the optimal therapeutic dose and schedule still remain undefined.
  • rituximab in virtually all NHL patients for the past decade, its mechanisms of action, as well as those of other anti-CD20 MAbs, either in model systems or patients, remain debated among numerous studies demonstrating cell killing mediated by CDC, ADCC, and direct signaling with apoptotic effects. (Glennie et al, MoI Immunol. 2007, 44:3823-37; Maloney, Hematology Am Soc Hematol Educ Program.2007 ' :226-232; Martin et al, Semin Hematol. 2008;45:126-132.)
  • Veltuzumab crossblocks binding by rituximab (Stein et al., CHn Cancer Res. 2004, 10:2868-78), suggesting either the same epitope is recognized by both MAbs or binding to an adjacent epitope could result in steric hindrance.
  • rituximab or DlOlN were found in a slower off-rate (i.e., longer cell-surface retention) in all 3 human lymphoma cell lines tested (Example 5), and a higher CDC-mediated cell killing in Daudi lymphoma cells by veltuzumab (Example 8), compared to rituximab or DlOlN.
  • veltuzumab and cA20 both containing Aspioi instead of ASn 1 Oi in CDR3-V H , yielded significantly (P ⁇ 0.0001) slower off rates ( ⁇ 2.5-fold) than rituximab or DlOlN (Example 5).
  • V H and V K chains of cA20 differ from those of rituximab in six positions, but except for the 101-residue in CDRH3, the remaining five residues (two in FR4-V H and three in FRI-V K ) are unlikely to be responsible for the differential off-rates.
  • Du et al MoI Immunol.
  • Example 24 Low-dose veltuzumab in recurrent Non-Hodgkin's lymphoma (NHL)
  • Second-generation anti-CD20 antibodies have been constructed in order to increase efficacy, decrease toxicity (primarily infusion reactions) or immunogenicity, and allow more rapid administrations (D ⁇ rner & Burmester, Curr Opin Rheumatol 20:263-268, 2008; Martin et al, Semin Hematol 45:126-132, 2008; Genovese et al, Arthritis & Rheumatism 54:S66, 2006; Morschhauser et al, Blood 110:199a, 2007; Hagenbeek et al, Blood 111:5486-5495, 2008; Coiffier et al, Blood 111:1094-1100, 2008).
  • Veltuzumab (hA20) is a CDR (complementarity-determining region)-grafted, humanized, anti-CD20 IgG-kappa MAb that was constructed with light chain CDRs and heavy chain CDRl and CDR2 identical to rituximab, but a different CDR3-variable -region- heavy-chain construct, and with the remaining framework regions taken from epratuzumab, a humanized anti-CD22 MAb (Goldenberg et al, F roc Am Soc Clin Oncol 22:595, 2003; Goldenberg et al, ProcAm Soc Clin Oncol 26:142s, 2008; Example 1).
  • mice bearing human lymphoma xenografts found that very low doses of veltuzumab not only given intravenously, but also subcutaneously, were very effective in depleting B -cells and controlling tumor growth, respectively, even curing a significant number of mice (Examples 13 and 14; Goldenberg et al, Proc Am Soc Clin Oncol 26:142s, 2008).
  • Eligibility also required hemoglobin > 10 g/dL, ANC > 1.5 x 10 9 /L, platelets > 100 x 10 9 /L (all without transfusional support), creatinine and bilirubin ⁇ 1.5 x institutional upper limit of normal (IULN), AST and ALT ⁇ 2.5 x IULN, 0-1 ECOG or KPS > 70 performance status, life expectancy > 6 months, 12 weeks beyond any autologous stem cell transplant, and 4 weeks any beyond chemotherapy, other experimental treatments, or any radiation therapy to the index lesion(s).
  • IULN institutional upper limit of normal
  • AST and ALT ⁇ 2.5 x IULN
  • 0-1 ECOG or KPS > 70 performance status
  • life expectancy > 6 months, 12 weeks beyond any autologous stem cell transplant, and 4 weeks any beyond chemotherapy, other experimental treatments, or any radiation therapy to the index lesion(s).
  • Treatment - Veltuzumab was given on a weekly basis for 4 consecutive weeks. All patients were premedicated each week with an anti-histamine and an anti-pyretic, but no steroids were given routinely.
  • cohorts of 3-6 patients received veltuzumab at increasing dose levels of 120, 200, 375, and 750 mg/m 2 , while subsequent patients received veltuzumab at 80, 120, 200 or 375 mg/m 2 .
  • guidelines for veltuzumab infusions allowed the infusion rate to be advanced every 15-30 minutes in increments of 50 mg/h for the 1 st infusion and 100-200 mg/h for subsequent infusions.
  • recommended actions included slowing the infusion rate for mild toxicity; interrupting the infusion for moderate toxicity for at least 15 minutes or until symptoms resolve and then resuming at the slowed infusion rate, if the patient was stable; and permanently discontinuing the infusion for more serious toxicity.
  • Blood samples for B -cell counts were obtained prior to each infusion, at 1, 4, 8 and 12 weeks after last infusion, and during follow-up every 3 months until decreased levels returned towards baseline.
  • Urinalysis blood samples for T-cell levels (CD3+) and serum immunoglobulins were determined at baseline, prior to last infusion, 4 and 12 weeks after last infusion, and then during follow-up every 3 months until resolution of any treatment-related abnormalities.
  • Blood samples for veltuzumab serum levels were obtained prior to and 30 minutes after each infusion, at 24, 48, 72 and 96 hours after the first and last infusions, and then at 1, 2, 3, 4, 8 and 12 weeks after last infusion.
  • HAHA human anti-veltuzumab antibodies
  • Study Evaluations - Treatment responses were determined using international workshop criteria (Cheson et al., J Clin Oncol. 1999, 17:1244-1253), with each patient's best response classified as either complete response (CR), complete response unconfirmed (CRu), partial response (PR), stable disease, or progressive disease.
  • Adverse events (AEs) were classified according to MedDRA system organ class and preferred term. Toxicity grading of AEs and laboratories utilized National Cancer Institute (NCI) Common Toxicity Criteria (CTC), version 3.0.
  • Dose-limiting toxicity was defined as any treatment-related Grade 3 or 4 toxicity or the following Grade 2 events: autoimmune reaction, asymptomatic bronchospasm, or generalized urticaria. All laboratory values were determined locally, except for veltuzumab serum levels and HAHA determinations, which were performed by the sponsor using an ELISA test. Pharmacokinetics following last infusion was evaluated with a single compartment model using WinNonLin 2.1 (Pharsight Corporation, Mountain View, CA).
  • PFS Progression-free survival
  • CRC physical or radiological
  • Duration of response defined as the duration from the first day of onset of an objective response (OR), ie, CR, CRu, or PR, to the day of disease progression, death, or last contact, whichever occurred earliest, was summarized using similar methods.
  • Patient Characteristics A total of 82 patients (34 men, 48 women, median age 64 years) were enrolled. They were a median of 5 years from initial diagnosis and 1.8 years from last treatment. Most patients were in good performance status (83% ECOG 0) at study entry, but with widespread disease (79% Stage IWYV), and with 17 patients (21%) having elevated LDH, and 30 (40%) having at least one tumor mass > 5 cm. All patients received at least one prior treatment regimen (range, 1-7), and most patients (89%) had received at least one prior rituximab-containing regimen.
  • FCL follicular lymphoma
  • MCL mantle cell lymphoma
  • SLL small lymphocytic lymphoma
  • MZL marginal zone lymphoma
  • the OR and CR/CRu rates were 44% (24/55) and 27% (15/55), respectively, with both ORs and CR/CRu' s occurring even after 2-5 prior rituximab-regimens, among follicular patients with less favorable prognosis (FLIPI >2, elevated LDH, bulky disease >5 cm), and at all dose levels including 80 mg/m .
  • the overall OR and CR/CRu rates were 35% (9/26) and 27% (7/26), respectively.
  • the Kaplan-Meier estimated median DR and TTP were 19.7 months (95% CI: 8.7 - 32.5 mos.) and 24.2 months (95% CI: 13.8 - 34.4 mos.), respectively, including 5 patients still continuing long-lived responses 15.9 to 37.6 months from the date of 1 st infusion.
  • the sample sizes are small, there was no decrease in the durability of complete responses at lower doses, and the single follicular patient with a complete response at 80 mg/m 2 is still in remission 15.9 months after the 1 st infusion.
  • the 2 complete responses that occurred one at 80 mg/m 2
  • one long-lived stable response all in marginal zone lymphoma
  • Adverse Events Seventy-eight patients had one or more adverse events during the study. Of 48 patients with events considered at least possibly treatment-related, only one patient had a Grade 3 event, hypogobulinemia which developed during long-term remission > 1 year after treatment. Otherwise, all events considered at least possibly treatment-related were mild-moderate (Grades 1-2), most of which were infusion reactions that occurred predominantly at first infusion, with ⁇ 11 patients having such events at each of the subsequent infusions. Table 8 summaries the most frequent events.
  • Grade 3 events 3 patients had abnormal laboratories (grade 2 creatinine, grade 2 ANC, grade 1 hemoglobin) at study entry which became Grade 3 at week 12, while the other patient maintained normal WBC and ANC levels until week 12.
  • the mean peak levels at the first infusion exceeded the 25- ⁇ g/mL value considered important for maintaining efficacy with rituximab (Berinstein et al, Ann Oncol 9: 995-1001, 1998; Gordon et al, J Clin Oncol 23:1096-1102, 2005; Cartron et al, Crit Rev in Oncol Hematol 62:43-52, 2007).
  • the antibody accumulated with infusion number at all doses, and even at 80 mg/m 2 , the mean trough serum levels exceeded the 25- ⁇ g/mL value by the last infusion. Post-treatment serum samples were scheduled to be collected 30 min after last infusion, 1, 2, 3 and 4 days later, and at 1, 2, 3, 4, 8 and 12 weeks.
  • Veltuzumab Serum Levels (Mean ⁇ SD): Pre- and Post-Infusion Results ( ⁇ g/mL).
  • B-cell and Other Immunological Changes - Peripheral blood B -cell levels were to be determined at baseline, prior to each infusion, at 4 weeks following the last infusion, and then at 3-month intervals until recovery to baseline.
  • 68 patients had low or low-normal peripheral blood B-cell levels (1-256 cells/ ⁇ l, median 60), 9 patients (including all 5 SLL patients) had elevated levels (572-14,712 cells/ ⁇ l, median 1,782), and 5 patients did not have baseline levels determined.
  • FIG. 15 graphs the course of B-cell levels for all patients who had non-elevated B- cell levels at baseline and at least one sample obtained during treatment.
  • B-cell levels were reported as percentage of total lymphocytes, decreases below the lower limit of quantitation (typically 1%) could not be determined and for analysis were conservatively set at the limit prior to converting results to absolute cell counts.
  • the actual extent of B-cell depletion is likely more complete, but nonetheless, the results appear comparable for all the dose levels, including the lowest dose level of 80 mg/m 2 .
  • ADCC antibody dependent cellular cytotoxicity
  • CDC complement dependent cytotoxicity
  • direct signaling with apoptosis effects the clinically relevant mechanisms of action of anti-CD20 immunotherapy in B -cell malignancies or various autoimmune disorders remains uncertain (Glennie et al, MoI Immunol 44:3823-3837, 2007).
  • veltuzumab responses including complete responses, occurred in patients who had received multiple prior rituximab-regimens as well in patients generally considered at risk for less-favorable outcome (higher FLIPI scores, elevated LDH, tumor masses >5 cm).
  • the highest response rates occurred in the small number of rituximab-na ⁇ ve patients, achieving 57% ORs and 43% CR/CRu' s.
  • veltuzumab may likely be more refractory and require more time for veltuzumab to be effective, consistent with the median time to onset of response of 3.3 months in this study compared to 1.6 months in both of the other rituximab studies (McLaughlin et al., 1998; Davis et al., 2000), and also consistent with the relatively long median TTP for responders of 15.2 months seen in this study.
  • veltuzumab achieved an overall objective response rate of 35% with 27% CR/CRu' s.
  • Veltuzumab did particularly well in marginal zone lymphoma, with ORs in 5/6 patients (83%) having either extranodal MALT or nodal type disease, including 3 long-term responses (15-24 months), one at a dose level of only 80 mg/m .
  • rituximab shows promising activity for use in marginal zone lymphoma.
  • veltuzumab may be useful in combination with chemotherapy in this population, similar to what has been found with rituximab (Czuczman et al., J Clin Oncol 22:4711-4716, 2004; Coiffier et al, N Engl J Med 346:235-242, 2002; Habermann et al, J Clin Oncol 24:3121-3127, 2006), which is approved for use in DLBCL in combination with CHOP.
  • veltuzumab did have other evidence of activity in SLL, since all the patients had elevated B-cell levels at study entry (3 above 10,000/mm 3 ) which decreased after the first veltuzumab infusion and remained decreased for at least 4 weeks after the last infusion, and this included one patient treated at 80 mg/m 2 with initial levels >10,000/mm 3 subsequently decreased by 94%.
  • PCR were performed according to the standard PCR protocol. DNA sequencing was performed by Seq Wright (Houston, TX). The restriction enzymes were purchased from New England Biolabs. The primers were made through Fisher Scientific. A. Variant V102Y
  • V102Y is the variant of hA20 with one amino acid change of VaI to Tyr at the 102 position (Rabat's numbering) in the CDR3 of VH.
  • CDRH3 in V102Y is STYYGGDWYFDY (SEQ ID NO:21).
  • V 102 Y primer (40 mers) CGGTGACTGGTACTTCGATTACTGGGGCCAAGGCACCACG (SEQ ID NO:22)
  • V102Y primer (40 mers) CGTGGTGCCTTGGCCCCAGTAATCGAAGTACCAGTCACCG (SEQ ID NO:23
  • DNA template hA20-IgG-pdHL2 5' Xho I primer & 3' V102Y primer PCR product #1: 510 bp
  • DNA template hA20-IgG-pdHL2 5' V102Y primer & 3' Hind III primer PCR product #2: 210 bp
  • PCR product #1& #2 were purified from gel, mixed in equal molar amounts as template and PCR with 5' Xho I & 3' Hind III as primers to generate PCR product #3 (680 bp), which was cloned into pGEMT and confirmed with Xhol and HindIII digestion, followed by sequencing.
  • Ligating PCR product #3 with the Xho I/Hind III restricted fragment of hA20-IgG-pdHL2 completed the expression vector for V102Y, designated as V102Y- hA20-IgG-pdHL2).
  • V102Y-hA20-pdHL2 (30 ⁇ g) was linearized by digestion with Sal I, followed by phenol, chloroform extraction, and precipitate with 100% ethanol and ammonium acetate.
  • the DNA pellet was resuspended into electroporation buffer (20 mM HEPES, pH 7.0; 137 mM NaCl, 5mM KCl, 0.7 mM Na 2 HPO 4 , and 6 mM Dextrose), then mixed with 2.8x 10 6 SpESF cells and electroporated with electroporator GenePulser Xcell BioRad @ capacitance 25 ⁇ F, 450 V, resistance infinite ohms, 4 mm cuvette. The medium was added and plated on 96- wells plates.
  • V102Y was made in roller bottles, purified with protein A, and its purity shown by SDS-PAGE and size-exclusion HPLC. Other characterizations included off -rate determination and ADCC assay.
  • YDE is a mutant of V102Y with two 2 amino acid mutations on the CH2 domain of Fc: S 239 D (TCA -> GAT) & I 332 E (ATC -> GAA)
  • CDRH3 in YDE is STYYGGDWYFDY (SEQ ID NO:21).
  • DNA template 1826-SV3 (an in-house staging vector)
  • PCR#1 5' PstI-Fc & 3' S239D primers-> 207 bp
  • PCR#4 was gel-purified, mixed in equal molar concentration to obtain PCR#4 (941 bp) using 5' PstI-Fc and 3' PstI-Fc as primers.
  • PCR#4 was cloned into pGEMT and confirmed by sequencing. The fragment was then digested from pGEMT with Pstl and cloned into an intermediate vector, 1826-SV3, which was also digested with Pstl.
  • Ligating PCR#4 cut from the staging vector with Eagl with the Eagl-restricted V102Y-hA20-IgG- pdHL2 completed the construction of the final YDE-hA20-pdHL2.
  • v-mab-DE is a Fc variant of v-mab, with the same amino acid mutations on the CH2 domain of Fc as YDE.
  • the same primers and cloning scheme as described for YDE in Example 2 were used in the construction of the expression vector v-mab-DE-hA20-pdHL2, which has not been transfected.
  • ADCC assay was performed as follows. Briefly, Daudi cells were plated at 10 4 cells/well in 50 ⁇ L of assay media (RPMI 1640 no phenol red, 1% Glutamax, 1% PenStrep). One set of wells received only the media for background control and another set of wells received cells only and served as the control for maximum cell lysis.
  • the PBMC collected from one donor was used. Blood was drawn into heparinized tubes (approximately 5OmL of blood/donor) at which time UNI-SEP maxi tubes (NOVAmed, LTD.) were used for density gradient separation of the lymphocytes. Approximately 3 mL of PBMC at 1.6xlO 7 cells /mL was obtained with each donor. [0273] Each assay used an effector to target ratio of 40 to 1, 5 ⁇ g/mL of antibody.
  • % Lysis [Experimental - (Effector + Target Control)] x 100 (Maximum Lysis - Target Control)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Rheumatology (AREA)
  • Diabetes (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Dermatology (AREA)
  • Transplantation (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Urology & Nephrology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Zoology (AREA)
  • Pain & Pain Management (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2009/051321 2008-07-21 2009-07-21 Structural variants of antibodies for improved therapeutic characteristics Ceased WO2010011697A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
UAA201101684A UA108735C2 (uk) 2008-07-21 2009-07-21 Структурні варіанти антитіл для покращення терапевтичних характеристик
AU2009274129A AU2009274129B2 (en) 2008-07-21 2009-07-21 Structural variants of antibodies for improved therapeutic characteristics
EP09800909.5A EP2318048B1 (en) 2008-07-21 2009-07-21 Structural variants of antibodies for improved therapeutic characteristics
CN200980136900.6A CN102159243B (zh) 2008-07-21 2009-07-21 用于改良的治疗特征的抗体的结构变体
EA201100228A EA201100228A1 (ru) 2008-07-21 2009-07-21 Структурные варианты антител для улучшения терапевтических характеристик
CA2731255A CA2731255C (en) 2008-07-21 2009-07-21 Structural variants of antibodies for improved therapeutic characteristics
MX2011000891A MX2011000891A (es) 2008-07-21 2009-07-21 Variantes estructurales de anticuerpos para caracteristicas terapeuticas mejoradas.
BRPI0917204A BRPI0917204A2 (pt) 2008-07-21 2009-07-21 variantes estruturais de anticorpos para melhores características terapêuticas
JP2011520147A JP6049163B2 (ja) 2008-07-21 2009-07-21 改善された治療上の特徴のための抗体の構造変異体
HK11109726.9A HK1155388B (en) 2008-07-21 2009-07-21 Structural variants of antibodies for improved therapeutic characteristics
NZ590330A NZ590330A (en) 2008-07-21 2009-07-21 Structural variants of anti-cd20 antibodies for improved therapeutic characteristics
IL210307A IL210307B (en) 2008-07-21 2010-12-28 Structural variants of antibodies to improve medicinal properties
ZA2011/00013A ZA201100013B (en) 2008-07-21 2011-01-03 Structural variants of antibodies for improved therapeutic characteristics

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8239908P 2008-07-21 2008-07-21
US61/082,399 2008-07-21

Publications (1)

Publication Number Publication Date
WO2010011697A1 true WO2010011697A1 (en) 2010-01-28

Family

ID=41570576

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/051321 Ceased WO2010011697A1 (en) 2008-07-21 2009-07-21 Structural variants of antibodies for improved therapeutic characteristics

Country Status (15)

Country Link
US (2) US7919273B2 (https=)
EP (1) EP2318048B1 (https=)
JP (1) JP6049163B2 (https=)
KR (1) KR20110033233A (https=)
CN (1) CN102159243B (https=)
AU (1) AU2009274129B2 (https=)
BR (1) BRPI0917204A2 (https=)
CA (1) CA2731255C (https=)
EA (1) EA201100228A1 (https=)
IL (1) IL210307B (https=)
MX (1) MX2011000891A (https=)
NZ (1) NZ590330A (https=)
UA (1) UA108735C2 (https=)
WO (1) WO2010011697A1 (https=)
ZA (1) ZA201100013B (https=)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010151526A1 (en) * 2009-06-23 2010-12-29 Alexion Pharmaceuticals, Inc. Bispecific antibodies that bind to complement proteins
WO2012025536A1 (en) 2010-08-25 2012-03-01 F. Hoffmann-La Roche Ag Antibodies against il-18r1 and uses thereof
WO2013085893A1 (en) 2011-12-05 2013-06-13 Immunomedics, Inc. Therapeutic use of anti-cd22 antibodies for inducing trogocytosis
WO2013171287A1 (en) * 2012-05-16 2013-11-21 Boehringer Ingelheim International Gmbh Combination of cd37 antibodies with ice (ifosfamide, carboplatin, etoposide)
US20140120086A1 (en) * 2012-10-31 2014-05-01 Takeda Gmbh Method for preparation of a high concentration liquid formulation of an antibody
WO2014140361A1 (en) * 2013-03-15 2014-09-18 Takeda Gmbh Formulation of an antibody and use thereof
WO2014173570A1 (en) * 2013-04-26 2014-10-30 Philogen S.P.A. Il4 conjugated to antibodies against extracellular matrix components
US9078879B2 (en) 2007-08-09 2015-07-14 Boehringer Ingelheim International Gmbh Anti CD37 antibodies
US9468689B2 (en) 2011-05-02 2016-10-18 Immunomedics, Inc. Ultrafiltration concentration of allotype selected antibodies for small-volume administration
US10322176B2 (en) 2002-03-01 2019-06-18 Immunomedics, Inc. Subcutaneous administration of anti-CD74 antibody for systemic lupus erythematosus
US10392425B2 (en) 2015-02-05 2019-08-27 Molecular Templates, Inc. Multivalent CD20-binding molecules comprising Shiga toxin A subunit effector regions and enriched compositions thereof
US10450354B2 (en) 2013-03-12 2019-10-22 Molecular Templates, Inc. CD20-binding immunotoxins for inducing cellular internalization and methods using same
US10799597B2 (en) 2017-04-03 2020-10-13 Immunomedics, Inc. Subcutaneous administration of antibody-drug conjugates for cancer therapy
US10815469B2 (en) 2014-06-11 2020-10-27 Molecular Templates, Inc. Cell-targeting molecules comprising protease-cleavage resistant, Shiga toxin A subunit effector polypeptides and carboxy-terminal moieties
US11142584B2 (en) 2014-03-11 2021-10-12 Molecular Templates, Inc. CD20-binding proteins comprising Shiga toxin A subunit effector regions for inducing cellular internalization and methods using same
US11180559B2 (en) 2005-03-03 2021-11-23 Immunomedics, Inc. Subcutaneous anti-HLA-DR monoclonal antibody for treatment of hematologic malignancies
US11225509B2 (en) 2018-04-17 2022-01-18 Molecular Templates, Inc. HER2-targeting molecules comprising de-immunized, Shiga toxin A subunit scaffolds
US11312751B2 (en) 2014-01-27 2022-04-26 Molecular Templates, Inc. MHC class I epitope delivering polypeptides
US11365223B2 (en) 2015-05-30 2022-06-21 Molecular Templates, Inc. De-immunized, Shiga toxin a subunit scaffolds and cell-targeting molecules comprising the same
US11389542B1 (en) 2016-12-07 2022-07-19 Molecular Templates, Inc. Shiga toxin a subunit effector polypeptides, Shiga toxin effector scaffolds, and cell-targeting molecules for site-specific conjugation
US11406692B2 (en) 2017-01-25 2022-08-09 Molecular Templates, Inc. Cell-targeting molecules comprising de-immunized, Shiga toxin a subunit effectors and CD8+ t-cell epitopes
WO2023046322A1 (en) * 2021-09-24 2023-03-30 Janssen Pharmaceutica Nv Proteins comprising cd20 binding domains, and uses thereof

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8034352B2 (en) * 2005-04-06 2011-10-11 Ibc Pharmaceuticals, Inc. Tetrameric cytokines with improved biological activity
EP1914242A1 (en) 2006-10-19 2008-04-23 Sanofi-Aventis Novel anti-CD38 antibodies for the treatment of cancer
EP2478110B1 (en) 2009-09-16 2016-01-06 Immunomedics, Inc. Class i anti-cea antibodies and uses thereof
EP2409989A1 (en) * 2010-07-19 2012-01-25 International-Drug-Development-Biotech Method to improve glycosylation profile for antibody
EP2663331A4 (en) * 2011-01-10 2015-07-15 Glaxosmithkline Intellectual Property Man Ltd NEW USES
EP3604339B1 (en) 2011-01-14 2021-03-10 The Regents Of The University Of California Therapeutic antibodies against ror-1 protein and methods for use of same
US9013184B2 (en) 2011-07-18 2015-04-21 Siemens Medical Solutions Usa, Inc. MR imaging system for automatically providing incidental findings
CA2861428A1 (en) * 2012-01-19 2013-07-25 Therapeutic Proteins International, LLC Stabilization of the anti-cd20 antibody rituximab
US9447160B2 (en) 2012-01-19 2016-09-20 University Of Miami Compositions, methods and kits for treatment of cancer and autoimmune diseases
US9777067B2 (en) 2012-09-27 2017-10-03 Massachusetts Institute Of Technology HER2- and VEGF-A-binding proteins with enhanced stability
MX338711B (es) 2012-10-12 2016-04-28 Medimmune Ltd Pirrolobenzodiazepinas y conjugados de las mismas.
CA2891764A1 (en) * 2012-11-19 2014-05-22 Baliopharm Ag Recombinant bispecific antibody binding to cd20 and cd95
MX362970B (es) 2013-03-13 2019-02-28 Medimmune Ltd Pirrolobenzodiazepinas y conjugados de las mismas.
CA2935748A1 (en) 2014-02-25 2015-09-03 Immunomedics, Inc. Humanized rfb4 anti-cd22 antibody
EP3193940A1 (en) 2014-09-10 2017-07-26 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
EP3313885A1 (en) * 2015-06-29 2018-05-02 H. Hoffnabb-La Roche Ag Type ii anti-cd20 antibody for use in organ transplantation
US10898522B2 (en) * 2015-08-19 2021-01-26 Children's Research Institute, Children's National Medical Center Compositions and methods for treating graft versus host disease
CN109154600A (zh) * 2016-06-16 2019-01-04 豪夫迈·罗氏有限公司 用于确定cdc诱导抗体的测定法和方法
EP3525829A1 (en) 2016-10-11 2019-08-21 Medimmune Limited Antibody-drug conjugates with immune-mediated therapy agents
WO2018071624A1 (en) * 2016-10-12 2018-04-19 Alexion Pharmaceuticals, Inc. Efficacy of an anti-c5 antibody in the prevention of antibody mediated rejection in sensitized recipients of a kidney transplant
CN107384963A (zh) * 2017-07-31 2017-11-24 山东兴瑞生物科技有限公司 一种可控型cd20嵌合抗原受体修饰t细胞的制备方法及其应用
CN107693804A (zh) * 2017-10-10 2018-02-16 天津市肿瘤医院 一种靶向肿瘤乏氧微环境的超声微泡制备方法
CA3098103A1 (en) 2018-05-23 2019-11-28 Adc Therapeutics Sa Molecular adjuvant
WO2021041678A1 (en) * 2019-08-30 2021-03-04 Qilu Puget Sound Biotherapeutics Corporation Anti-cd20 antibodies, anti-cd37 antibodies, and mixtures thereof
WO2022042494A1 (zh) * 2020-08-27 2022-03-03 深圳市菲鹏生物治疗股份有限公司 Cd22抗体及其应用
US20230372528A1 (en) 2020-10-16 2023-11-23 University Of Georgia Research Foundation, Inc. Glycoconjugates
GB202102396D0 (en) 2021-02-19 2021-04-07 Adc Therapeutics Sa Molecular adjuvant
CA3224171A1 (en) * 2021-07-01 2023-01-05 Rallybio Ipa, Llc Administration of anti-hpa-1a antibodies
US12441816B2 (en) 2021-09-21 2025-10-14 Qilu Puget Sound Biotherapeutics Corporation Heterodimeric Fc for making fusion proteins and bispecific antibodies
EP4426727A2 (en) 2021-11-03 2024-09-11 Hangzhou Dac Biotech Co., Ltd. Specific conjugation of an antibody

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050025764A1 (en) * 2003-05-20 2005-02-03 Watkins Jeffry D. CD20 binding molecules
US20070264257A1 (en) * 2004-10-08 2007-11-15 Kyriaki Dunussi-Joannopoulos Immunotherapy of autoimmune disorders
US20080089885A1 (en) * 2006-10-10 2008-04-17 Vaccinex, Inc. Anti-cd20 antibodies and methods of use

Family Cites Families (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1541435A (en) 1975-02-04 1979-02-28 Searle & Co Immunological materials
US4036945A (en) 1976-05-03 1977-07-19 The Massachusetts General Hospital Composition and method for determining the size and location of myocardial infarcts
US4331647A (en) 1980-03-03 1982-05-25 Goldenberg Milton David Tumor localization and therapy with labeled antibody fragments specific to tumor-associated markers
US4824659A (en) 1985-06-07 1989-04-25 Immunomedics, Inc. Antibody conjugates
US5776093A (en) 1985-07-05 1998-07-07 Immunomedics, Inc. Method for imaging and treating organs and tissues
US5057313A (en) 1986-02-25 1991-10-15 The Center For Molecular Medicine And Immunology Diagnostic and therapeutic antibody conjugates
US4699784A (en) 1986-02-25 1987-10-13 Center For Molecular Medicine & Immunology Tumoricidal methotrexate-antibody conjugate
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US4704692A (en) 1986-09-02 1987-11-03 Ladner Robert C Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides
US5567610A (en) 1986-09-04 1996-10-22 Bioinvent International Ab Method of producing human monoclonal antibodies and kit therefor
IL85035A0 (en) 1987-01-08 1988-06-30 Int Genetic Eng Polynucleotide molecule,a chimeric antibody with specificity for human b cell surface antigen,a process for the preparation and methods utilizing the same
US5734033A (en) 1988-12-22 1998-03-31 The Trustees Of The University Of Pennsylvania Antisense oligonucleotides inhibiting human bcl-2 gene expression
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5229275A (en) 1990-04-26 1993-07-20 Akzo N.V. In-vitro method for producing antigen-specific human monoclonal antibodies
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
GB9019812D0 (en) * 1990-09-11 1990-10-24 Scotgen Ltd Novel antibodies for treatment and prevention of infection in animals and man
WO1992007466A1 (en) 1990-11-05 1992-05-14 Bristol-Myers Squibb Company Synergistic therapy with combinations of anti-tumor antibodies and biologically active agents
US5667988A (en) * 1992-01-27 1997-09-16 The Scripps Research Institute Methods for producing antibody libraries using universal or randomized immunoglobulin light chains
DK0752248T3 (da) 1992-11-13 2000-11-13 Idec Pharma Corp Terapeutisk anvendelse af kimæriske og radioaktivt mærkede antistoffer mod humant B-lymfocytbegrænset differentieringsantig
US5736137A (en) 1992-11-13 1998-04-07 Idec Pharmaceuticals Corporation Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocyte restricted differentiation antigen for treatment of B cell lymphoma
US5443953A (en) 1993-12-08 1995-08-22 Immunomedics, Inc. Preparation and use of immunoconjugates
US5827690A (en) 1993-12-20 1998-10-27 Genzyme Transgenics Corporatiion Transgenic production of antibodies in milk
DE69534530T2 (de) 1994-08-12 2006-07-06 Immunomedics, Inc. Für b-zell-lymphom und leukämiezellen spezifische immunkonjugate und humane antikörper
US5798554A (en) 1995-02-24 1998-08-25 Consorzio Per La Ricerca Sulla Microelettronica Nel Mezzogiorno MOS-technology power device integrated structure and manufacturing process thereof
ATE267610T1 (de) 1996-03-20 2004-06-15 Immunomedics Inc Glykosylierte igg antikörper
EP0954340B1 (en) 1996-05-03 2007-06-27 Immunomedics, Inc. Targeted combination immunotherapy of cancer
US6183744B1 (en) 1997-03-24 2001-02-06 Immunomedics, Inc. Immunotherapy of B-cell malignancies using anti-CD22 antibodies
AU1728800A (en) 1998-11-18 2000-06-05 Genentech Inc. Antibody variants with higher binding affinity compared to parent antibodies
US6897044B1 (en) 1999-01-28 2005-05-24 Biogen Idec, Inc. Production of tetravalent antibodies
HK1048138B (zh) 1999-04-15 2009-06-12 荷兰克鲁塞尔公司 用编码腺病毒e1蛋白的序列在人体细胞中生产重组蛋白
DE60042785D1 (de) 1999-06-09 2009-10-01 Immunomedics Inc Immuntherapie von autoimmunerkrankungen durch die verwendung von b-zell spezifischen antikörpern
JP2003528155A (ja) 2000-03-24 2003-09-24 カイロン コーポレイション Cd20に対する抗体とインターロイキン−2との組み合わせを用いる非ホジキンリンパ腫の治療方法
JP2003531588A (ja) 2000-04-11 2003-10-28 ジェネンテック・インコーポレーテッド 多価抗体とその用途
AU2001259142C1 (en) 2000-04-25 2006-11-23 Biogen Idec Inc. Intrathecal administration of rituximab for treatment of central nervous system lymphomas
RU2420537C2 (ru) 2001-01-17 2011-06-10 Трабьон Фармасьютикалз Инк. Слитые белки связывающий домен-иммуноглобулин
US7321026B2 (en) 2001-06-27 2008-01-22 Skytech Technology Limited Framework-patched immunoglobulins
JP2005289809A (ja) * 2001-10-24 2005-10-20 Vlaams Interuniversitair Inst Voor Biotechnologie Vzw (Vib Vzw) 突然変異重鎖抗体
WO2003068821A2 (en) 2002-02-14 2003-08-21 Immunomedics, Inc. Anti-cd20 antibodies and fusion proteins thereof and methods of use
JP4745242B2 (ja) * 2003-05-20 2011-08-10 アプライド モレキュラー エボリューション,インコーポレイテッド Cd20結合分子
AU2005274905B2 (en) * 2004-08-04 2010-12-23 Mentrik Biotech, Llc Variant Fc regions
ZA200708857B (en) * 2005-04-22 2009-01-28 Genentech Inc Method for treating dementia or alzheimer's disease with a CD30 antibody
CA2631327C (en) * 2005-12-02 2015-10-13 Genentech, Inc. Her2 binding polypeptides and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050025764A1 (en) * 2003-05-20 2005-02-03 Watkins Jeffry D. CD20 binding molecules
US20070264257A1 (en) * 2004-10-08 2007-11-15 Kyriaki Dunussi-Joannopoulos Immunotherapy of autoimmune disorders
US20080089885A1 (en) * 2006-10-10 2008-04-17 Vaccinex, Inc. Anti-cd20 antibodies and methods of use

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
QU ET AL.: "Bispecific anti-CD20/22 antibodies inhibit B-cell lymphoma proliferation by a unique mechanism of action", BLOOD, vol. 111, no. 4, 19 November 2007 (2007-11-19), pages 2211 - 2219, XP008143615 *
See also references of EP2318048A4 *

Cited By (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10322176B2 (en) 2002-03-01 2019-06-18 Immunomedics, Inc. Subcutaneous administration of anti-CD74 antibody for systemic lupus erythematosus
US11180559B2 (en) 2005-03-03 2021-11-23 Immunomedics, Inc. Subcutaneous anti-HLA-DR monoclonal antibody for treatment of hematologic malignancies
US9932399B2 (en) 2007-08-09 2018-04-03 Boehringer Ingelheim International Gmbh Anti CD37 antibodies
US9078879B2 (en) 2007-08-09 2015-07-14 Boehringer Ingelheim International Gmbh Anti CD37 antibodies
WO2010151526A1 (en) * 2009-06-23 2010-12-29 Alexion Pharmaceuticals, Inc. Bispecific antibodies that bind to complement proteins
WO2012025536A1 (en) 2010-08-25 2012-03-01 F. Hoffmann-La Roche Ag Antibodies against il-18r1 and uses thereof
US8883975B2 (en) 2010-08-25 2014-11-11 Hoffmann-La Roche, Inc. Antibodies against IL-18R1 and uses thereof
US9963516B2 (en) 2011-05-02 2018-05-08 Immunomedics, Inc. Stable compositions of high-concentration allotype-selected antibodies for small-volume administration
US9683050B2 (en) 2011-05-02 2017-06-20 Immunomedics, Inc. Stable compositions of high-concentration allotype-selected antibodies for small-volume administration
US9468689B2 (en) 2011-05-02 2016-10-18 Immunomedics, Inc. Ultrafiltration concentration of allotype selected antibodies for small-volume administration
EP2788020A4 (en) * 2011-12-05 2015-04-29 Immunomedics Inc THERAPEUTIC USE OF ANTI-CD22 ANTIBODIES FOR THE INDUCTION OF TROGO CYTOSIS
WO2013085893A1 (en) 2011-12-05 2013-06-13 Immunomedics, Inc. Therapeutic use of anti-cd22 antibodies for inducing trogocytosis
US9192664B2 (en) 2011-12-05 2015-11-24 Immunomedics, Inc. Therapeutic use of anti-CD22 antibodies for inducing trogocytosis
US9475883B2 (en) 2011-12-05 2016-10-25 Immunomedics, Inc. Therapeutic use of anti-CD22 antibodies for inducing trogocytosis
US9663576B2 (en) 2011-12-05 2017-05-30 Immunomedics, Inc. Therapeutic use of anti-CD22 antibodies for inducing trogocytosis
US9963507B2 (en) 2011-12-05 2018-05-08 Immunomedics, Inc. Therapeutic use of anti-CD22 antibodies for inducing trogocytosis
WO2013171287A1 (en) * 2012-05-16 2013-11-21 Boehringer Ingelheim International Gmbh Combination of cd37 antibodies with ice (ifosfamide, carboplatin, etoposide)
US8992915B2 (en) 2012-05-16 2015-03-31 Boehringer Ingelheim International Gmbh Combination of CD37 antibodies with ICE
CN104955478A (zh) * 2012-10-31 2015-09-30 塔科达有限责任公司 用于制备抗体的高浓度液体制剂的方法
WO2014068021A1 (en) * 2012-10-31 2014-05-08 Takeda Gmbh Method for preparation of a high concentration liquid formulation of an antibody
EP2727602A1 (en) * 2012-10-31 2014-05-07 Takeda GmbH Method for preparation of a high concentration liquid formulation of an antibody
US20140120086A1 (en) * 2012-10-31 2014-05-01 Takeda Gmbh Method for preparation of a high concentration liquid formulation of an antibody
US10450354B2 (en) 2013-03-12 2019-10-22 Molecular Templates, Inc. CD20-binding immunotoxins for inducing cellular internalization and methods using same
WO2014140361A1 (en) * 2013-03-15 2014-09-18 Takeda Gmbh Formulation of an antibody and use thereof
CN105189559A (zh) * 2013-03-15 2015-12-23 塔科达有限责任公司 抗体制剂及其用途
CN105189559B (zh) * 2013-03-15 2021-07-13 塔科达有限责任公司 抗体制剂及其用途
US11576863B2 (en) 2013-03-15 2023-02-14 Takeda Pharmaceutical Company Limited Formulation of an antibody and use thereof
US11433029B2 (en) 2013-03-15 2022-09-06 Takeda Pharmaceutical Company Limited Formulation of an antibody and use thereof
WO2014173570A1 (en) * 2013-04-26 2014-10-30 Philogen S.P.A. Il4 conjugated to antibodies against extracellular matrix components
US12065469B2 (en) 2014-01-27 2024-08-20 Molecular Templates, Inc. De-immunized Shiga toxin a subunit effector polypeptides for applications in mammals
US11312751B2 (en) 2014-01-27 2022-04-26 Molecular Templates, Inc. MHC class I epitope delivering polypeptides
US12037367B2 (en) 2014-01-27 2024-07-16 Molecular Templates, Inc. MHC class I epitope delivering polypeptides
US11142584B2 (en) 2014-03-11 2021-10-12 Molecular Templates, Inc. CD20-binding proteins comprising Shiga toxin A subunit effector regions for inducing cellular internalization and methods using same
US10815469B2 (en) 2014-06-11 2020-10-27 Molecular Templates, Inc. Cell-targeting molecules comprising protease-cleavage resistant, Shiga toxin A subunit effector polypeptides and carboxy-terminal moieties
US11248061B2 (en) 2015-02-05 2022-02-15 Molecular Templates, Inc. Multivalent CD20-binding molecule comprising Shiga toxin A subunit effector polypeptides and enriched compositions thereof
US11104707B2 (en) 2015-02-05 2021-08-31 Molecular Templates, Inc. Multivalent CD20-binding molecules comprising Shiga toxin a subunit effector regions and enriched compositions thereof
US10392425B2 (en) 2015-02-05 2019-08-27 Molecular Templates, Inc. Multivalent CD20-binding molecules comprising Shiga toxin A subunit effector regions and enriched compositions thereof
US11365223B2 (en) 2015-05-30 2022-06-21 Molecular Templates, Inc. De-immunized, Shiga toxin a subunit scaffolds and cell-targeting molecules comprising the same
US11389542B1 (en) 2016-12-07 2022-07-19 Molecular Templates, Inc. Shiga toxin a subunit effector polypeptides, Shiga toxin effector scaffolds, and cell-targeting molecules for site-specific conjugation
US11857628B2 (en) 2016-12-07 2024-01-02 Molecular Templates, Inc. Shiga toxin A subunit effector polypeptides, Shiga toxin effector scaffolds, and cell-targeting molecules for site-specific conjugation
US11406692B2 (en) 2017-01-25 2022-08-09 Molecular Templates, Inc. Cell-targeting molecules comprising de-immunized, Shiga toxin a subunit effectors and CD8+ t-cell epitopes
US10799597B2 (en) 2017-04-03 2020-10-13 Immunomedics, Inc. Subcutaneous administration of antibody-drug conjugates for cancer therapy
US11225509B2 (en) 2018-04-17 2022-01-18 Molecular Templates, Inc. HER2-targeting molecules comprising de-immunized, Shiga toxin A subunit scaffolds
WO2023046322A1 (en) * 2021-09-24 2023-03-30 Janssen Pharmaceutica Nv Proteins comprising cd20 binding domains, and uses thereof

Also Published As

Publication number Publication date
US20110236304A1 (en) 2011-09-29
ZA201100013B (en) 2011-09-28
CN102159243B (zh) 2015-08-19
HK1155388A1 (zh) 2012-05-18
AU2009274129A1 (en) 2010-01-28
MX2011000891A (es) 2011-06-01
UA108735C2 (uk) 2015-06-10
JP6049163B2 (ja) 2016-12-21
EA201100228A1 (ru) 2011-08-30
US20100034738A1 (en) 2010-02-11
KR20110033233A (ko) 2011-03-30
AU2009274129B2 (en) 2016-02-25
NZ590330A (en) 2012-08-31
US7919273B2 (en) 2011-04-05
EP2318048A4 (en) 2013-05-01
EP2318048B1 (en) 2019-05-29
EP2318048A1 (en) 2011-05-11
JP2011528720A (ja) 2011-11-24
CA2731255A1 (en) 2010-01-28
CN102159243A (zh) 2011-08-17
BRPI0917204A2 (pt) 2015-12-01
CA2731255C (en) 2018-06-05
IL210307A0 (en) 2011-03-31
IL210307B (en) 2020-11-30

Similar Documents

Publication Publication Date Title
US7919273B2 (en) Structural variants of antibodies for improved therapeutic characteristics
US8287864B2 (en) Structural variants of antibodies for improved therapeutic characteristics
US11180559B2 (en) Subcutaneous anti-HLA-DR monoclonal antibody for treatment of hematologic malignancies
US10174114B2 (en) Humanized anti-HLA-DR antibodies
EP1519959B1 (en) Anti-cd20 antibodies and fusion proteins thereof and methods of use
US9605071B2 (en) Anti-CD19 antibodies
EP3337508A1 (en) Subcutaneous anti-hla-dr monoclonal antibody for treatment of hematologic malignancies
HK1155388B (en) Structural variants of antibodies for improved therapeutic characteristics
HK1074052B (en) Anti-cd20 antibodies and fusion proteins thereof and methods of use

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980136900.6

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09800909

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 210307

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 590330

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2009274129

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 394/DELNP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2731255

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2011010118

Country of ref document: EG

ENP Entry into the national phase

Ref document number: 20117001522

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2011520147

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2011/000891

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2009274129

Country of ref document: AU

Date of ref document: 20090721

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201100228

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 2009800909

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0917204

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110121