WO2009095517A2 - Métodos y composiciones capaces de provocar un silenciamiento post-transcripcional de la expresión génica de forma sinérgica - Google Patents
Métodos y composiciones capaces de provocar un silenciamiento post-transcripcional de la expresión génica de forma sinérgica Download PDFInfo
- Publication number
- WO2009095517A2 WO2009095517A2 PCT/ES2009/000045 ES2009000045W WO2009095517A2 WO 2009095517 A2 WO2009095517 A2 WO 2009095517A2 ES 2009000045 W ES2009000045 W ES 2009000045W WO 2009095517 A2 WO2009095517 A2 WO 2009095517A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mrna
- polynucleotide
- composition
- target
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
Definitions
- the invention relates to methods for silencing gene expression in a post-transcriptional manner and, more specifically, to compositions that make it possible to achieve higher levels of silencing than those obtained using the components of said compositions separately.
- Effective and specific inhibition of gene expression is the basis of some gene therapy protocols and functional gene studies.
- the expression of certain genes is sometimes toxic to the cell, generating diseases, such as the expression of viral genes in infected cells, dominant dominant in hereditary diseases, or genes whose expression should be restricted, such as oncogenes.
- the inhibition of the expression of these toxic genes would allow the cure of the disease they trigger.
- genomic and proteomic studies allow the isolation of a large number of genes, some of them, of unknown function. These techniques allow classifying these genes according to their expression levels or according to the circumstances that allow them, but they do not say much about their function. The systematic and specific inhibition of the expression of these genes would allow the development of simple protocols to determine their function.
- RNA that is transcribed from it or block its translation into protein The simplest way to specifically inhibit the expression of a gene is to decrease the stability of the RNA that is transcribed from it or block its translation into protein.
- siRNAs small interfering RNAs
- RISC a multiproteic complex
- siRNAs gene silencing methods based on the use of siRNAs are hampered by the high cost of preparing siRNAs by chemical synthesis, especially when large quantities are required for use in animal models or, in the future, in human
- strategies have been developed that allow siRNAs to be produced in the cell itself from shRNAs.
- this technique has yet to be developed to facilitate the selection of sequences that guarantee the highest specificity and the lowest toxicity.
- siRNA is hindered by the excessive experimentation required for the identification of the optimal site in the target mRNA so that the siRNA that will hybridize with it has the highest specificity and least toxicity and due to side effects such as the activation of the response to interferon, and the "off-targets", where non-completely complementary (nonspecific) junctions of the RNAi strand to transcripts other than the target cause a series of unwanted effects.
- snRNPs small nuclear ribonucleoproteins
- snRNP Ul it is formed by the UlA, 7OK, UlC and seven Sm proteins bound to an RNA molecule (snRNA Ul).
- snRNA Ul RNA molecule
- the 5 'end of its hybrid RNA by base pairing with the 5' end of the sequences to be removed, the introns, at the splice site of the pre-mRNA. This interaction is stabilized by proteins that interact directly or indirectly with snRNA Ul and with the mRNA to be processed.
- snRNP Ul interacts with the pre-mRNA, a series of junctions of other proteins and snRNPs are triggered that will determine intron clearance. For this to be possible, it is necessary that snRNP Ul be separated from the pre-mRNA.
- snRNP Ul by binding to RNA, inhibits the action of breakage and polyadenylation machinery on nearby sequences.
- the 7OK protein of snRNP Ul is capable of binding to the carboxy terminal end of the poly (A) polymerase (PAP) subunit of the polyadenylation complex, inhibiting its function (Gunderson et al., 1997, Genes & Dev. 11: 761-773. ).
- the inhibition snRNP Ul exerts on breakage and polyadenylation machinery has been used to control gene expression.
- it has been described that it is possible to modify the region of the RNA RNA involved in the recognition of the intronic region of splicing and cutting so that it specifically joins the 3 'terminal exon of a
- Target mRNA resulting in the degradation of said target mRNA.
- This method has been applied to cause decreased expression of reporter genes (US20030082149, Beckley, SA et al., 2001, Mol.Cell.Biol., 21: 2815-2825, Furth, PA et al., 1994, Mol .Cell. Biol., 14: 5278-5289, Fortes, P. Et al., 2003,
- the invention relates to a composition formed by one or more containers or a kit of parts comprising (i) a first component comprising at least one Ul snRNA or a polynucleotide encoding an Ul snRNA, in wherein said Ul snRNA is modified in its sequence of binding to the consensus consensus GU of the 5 'end of the intron so that it specifically binds to a preselected region of the 3' terminal exon of a target pre-mRNA and is capable of inhibiting maturation of said target pre-mRNA; Y
- a second component comprising at least one gene expression silencing agent specifically targeting a preselected region of the mRNA resulting from the processing of the target snRNA Ul pre-mRNA encoded by the polynucleotide defined in (i) and which is capable of causing the in vivo silencing of said target mRNA.
- the invention in a second aspect, relates to a polynucleotide comprising (i) a sequence encoding at least one modified snRNA Ul in its binding sequence to the consensus consensus GU of the 5 'end of the intron so that it specifically binds to a preselected region of the 3 'terminal exon of a target pre-mRNA and that is capable of inhibiting the processing of the target pre-mRNA and (ii) a sequence encoding a silencing agent specifically directed to a preselected region of the mRNA resulting from the processing of the snRNA Ul pre-mRNA encoded by the polynucleotide defined in (i) and which is capable of causing the in vivo silencing of said MRNA target.
- the invention relates to an expression vector comprising a polynucleotide of the invention, a cell comprising a vector of the invention and a transgenic animal comprising a polynucleotide of the invention.
- the invention relates to a composition or kit of the invention, a polynucleotide of the invention, a vector of the invention or a cell of the invention for use as a medicament.
- the invention relates to a composition or kit of the invention, a polynucleotide of the invention, a vector of the invention or a cell of the invention for the treatment or prevention of infectious, tumor, neoplastic diseases. or neurodegenerative.
- the invention in another aspect, relates to a non-therapeutic method for post-transcriptional inhibition in vitro or in vivo of the expression of a target gene in a biological system comprising contacting said system with a composition or kit of the invention. , with a polynucleotide of the invention, with a vector of the invention or with a cell of the invention for the treatment or prevention of infectious, tumor, neoplastic or neurodegenerative diseases.
- Fig. 1 Representative scheme of the RNAu inhibition mechanism.
- the 5 'end of the snRNA of an snRNP Ul molecule has been modified so that its sequence is complementary to a preselected region in the 3' terminal exon of a target pre-mRNA.
- the polyadenylation (pA) inhibition of the target RNA occurs and hence the inhibition of gene expression.
- Ul snRNA molecules modified according to this scheme will also be called UIi.
- Fig. 2. The inhibition of the expression of a reporter gene using a strong shRNA synergizes with the inhibition of its expression using UIi.
- the luciferase activity of cells transfected with a control plasmid with one or a half dose of a plasmid expressing shRNA against target sequence 158 of luciferase (shRNA ⁇ Lucl58 and shRNA ⁇ Lucl58 12, respectively), with one or a half dose of a plasmid has been calculated which expresses a UIi against luciferase (Uli ⁇ Luc and Uli ⁇ Luc 12, respectively), and with half dose of shRNA ⁇ Lucl58 and half dose of Uli ⁇ Luc (shRNA ⁇ Lucl58 / 2 + Uli ⁇ Luc / 2).
- the inhibition factor resulting from dividing the luciferase activity of the control cells is represented by the luciferase activity obtained in the rest of the cases. Error bars represent the standard deviation of 9 independent measurements.
- Fig. 3 The inhibition of the expression of a reporter gene using strong shRNAs synergizes with the inhibition of its expression using UIi.
- the luciferase activity of cells transfected with a control plasmid has been calculated, with one or a half dose of a plasmid expressing shRNA against the target sequence 1546 of luciferase (shRNA ⁇ Lucl546 and shRNA ⁇ Lucl546 12, respectively), with one or a half dose of a plasmid expressing a UIi against luciferase (Uli ⁇ Luc and Uli ⁇ Luc 12, respectively), and with a half dose of shRNA ⁇ Lucl546 and half a dose of Uli ⁇ Luc (shRNA ⁇ Luc 1546/2 + Uli ⁇ Luc / 2).
- the inhibition factor resulting from dividing the luciferase activity of the control cells is represented by the luciferase activity obtained in the rest of the cases. Error bars represent the standard deviation of 9 independent measurements.
- Fig. 4 The inhibition of the expression of a reporter gene using medium shRNAs synergizes with the inhibition of its expression using UIi.
- Luciferase activity of cells transfected with a control plasmid has been calculated, with one or a half dose of a plasmid expressing shRNA against target sequence 163 of luciferase (shRNA ⁇ Lucl63 and shRNA ⁇ Lucl63 12, respectively), with one or half doses of a plasmid which expresses a UIi against luciferase (Uli ⁇ Luc and Uli ⁇ Luc 12, respectively), and with half dose of shRNA ⁇ Lucl63 and half dose of Uli ⁇ Luc (shRNA ⁇ Lucl63 / 2 + Uli ⁇ Luc / 2).
- Fig. 5 The inhibition of the expression of a reporter gene using weak shRNAs synergizes with the inhibition of its expression using UIi.
- the luciferase activity of cells transfected with a control plasmid, with one or a half dose of a plasmid expressing shRNA against the target sequence 154 of luciferase (shRNA ⁇ Lucl54 and shRNA ⁇ Lucl54 12, respectively), with one or a half dose of a plasmid has been calculated expressing a UIi against luciferase (Uli ⁇ Luc and Uli ⁇ Luc 12, respectively), and with a half dose of shRNA ⁇ Lucl54 and half a dose of Uli ⁇ Luc (shRNA ⁇ Luc 154/2 + Uli ⁇ Luc / 2).
- the inhibition factor resulting from dividing the luciferase activity of the control cells is represented by the luciferase activity obtained in the rest of the cases. Error bars represent the standard deviation of 9 independent measurements.
- Fig. 6 Analysis of the robustness of the synergy using strong shRNAs.
- Luciferase activity of cells transfected with a control plasmid, with decreasing doses (1, Vz, 1 A, 1/8 and 1/20) of a plasmid expressing shRNA against target sequence 1546 of luciferase (1546) has been calculated , with decreasing doses (1, Vz, 1 A, 1/8 and 1/20) of a plasmid expressing the UIi against luciferase (Uli ⁇ Luc), with a half dose of Uli ⁇ Luc and decreasing doses of shRNA ⁇ Lucl546 ( 1 A, 1 A, 1/8 yl / 20) and with half dose of shRNA ⁇ Lucl546 and decreasing doses of Uli ⁇ Luc (Vz, 1 A, 1/8 and 1/20).
- the inhibition factor resulting from dividing the luciferase activity of the control cells is represented by the luciferase activity obtained in the rest of the cases. Error
- Fig. 7 Analysis of the robustness of the synergy using medium shRNAs.
- Luciferase activity of cells transfected with a control plasmid, with decreasing doses (I 9 Vz, 1 A, 1/8 and 1/20) of a plasmid expressing shRNA against target sequence 163 of luciferase (163) has been calculated , with decreasing doses (I 9 Vz, 1 A, 1/8 and 1/20) of a plasmid expressing the UIi against luciferase (Uli ⁇ Luc), with a half dose of Uli ⁇ Luc and decreasing doses of shRNA ⁇ Lucl63 (Vz, 1 A, 1 / 8 and 1/20) and with half dose of shRNA ⁇ Lucl63 and decreasing doses of Uli ⁇ Luc ( 1 A, 1 A, 1/8 and 1/20).
- the inhibition factor resulting from dividing the luciferase activity of the control cells is represented by the luciferase activity obtained in the rest of the cases. Error bars represent
- Fig. 8 The inhibition of the expression of an endogenous gene using shRNAs synergizes with the inhibition of its expression using UIi.
- A. HeLa cells have been transfected with two doses of plasmids expressing a shRNA against the Notchl target sequence 1 or 2 (shRNAl ⁇ Notchl x2 and shRNA2 ⁇ Notchl x2, respectively), or a mixture of a dose of the plasmids expressing the shRNAs and a doses of plasmids expressing Uli ⁇ Mock or Uli ⁇ Notchl. Cell extracts have been collected 48 hours after transfection and the amount of Notchl has been evaluated by Western blotting.
- the synergistic effect is due to the fact that the two components act at different points in the pre-mRNA processing process.
- the modified Ul act in the nucleus inhibiting the polyadenylation of the pre-mRNA and, consequently, preventing its export to the cytosol
- the gene expression silencing agents would act in the cytosol on those mRNAs that have managed to mature in the presence of Ul inhibitor causing their degradation or inhibition of their translation.
- the modified Ul capable of inhibiting the polyadenylation of the pre-target mRNAs are referred to hereinafter as UIi.
- the invention relates to a composition formed by one or more containers or a kit of parts comprising:
- a first component comprising at least one Ul snRNA or a polynucleotide encoding an Ul snRNA, wherein said Ul snRNA is modified in its binding sequence to the consensus consensus sequence GU of the 5 'end of the intron so that specifically binds to a preselected region in the 3 'terminal exon of a target pre-mRNA and that is capable of inhibiting the maturation of the target pre mRNA;
- a second component comprising at least one gene expression silencing agent specifically directed to a preselected region of the mRNA resulting from the processing of the pre-
- compositions of the invention thus comprise two components, which can be found together in the same container or physically separated. Additionally, the invention relates to a composition comprising components (i) and (ii) as defined above.
- the first component of the composition or kit of the invention is a polynucleotide encoding a modified Ul snRNA in its binding sequence to the consensus consensus GU of the 5 'end of the intron so that it specifically binds to a pre-selected region in the exon 3 'terminal of a target pre-mRNA and prevents the processing of the 3' end of said pre-mRNA, understanding as processing of the 3 'end any of the steps necessary for the formation of the polyadenylated mRNA from a pre-mRNA without polyadenylate (site processing polyadenylation consensus, and addition of the polyA + tail).
- modified Ul snRNAs are incorporated into the corresponding snRNP to give rise to modified snRNP which, instead of binding to the pre-mRNA at the intron processing site, binds to the pre-mRNA in a given region thereof depending on the sequence specificity of the modified region in the snRNA Ul.
- This interaction causes a stop of the polyadenylation machinery that results in the sequestration of the pre-mRNA in the nucleus, a decrease in the maturation of the pre-mRNA and, in turn, a decrease in the production of the encoded protein.
- these modified Ul are known as UIi. The effect of UIi is therefore to cause a decrease or inhibition of gene expression.
- Consensus binding sequence GU of the 5 'end of the intron of the modified snRNA Ul is understood the region formed by the 5' end of the UIi that interacts by base pairing with the so-called Ul site or 5 'processing site (5'-splice site) that appears in the pre-mRNA in the 5 'region of introns, characterized by the consensus sequence AG / GURAGU (where R is a purine and / indicates the exon / intron limit) and that allows to the pre-mRNA processing machinery the location of the exon-intron boundary
- This region corresponds to nucleotides at positions 1 to 11 at the 5 'end of the snRNA Ul sequence (Zhuang, Y and Weiner, AM: 1986, CeIl, 46: 827-835).
- modified of the consensus sequence of binding to the Ul site in the pre-mRNA it is understood that said consensus sequence contains a number of mutations that result in a substantial loss in the ability of snRNA Ul to bind to the Ul site in the pre- MRNA while said Ul snRNA acquires a new complementarity that allows it to form a duplex by base pairing with a preselected region in a pre-mRNA target.
- the degree of complementarity between the modified Ul site binding sequence according to the present invention and the preselected region in the target pre-mRNA may vary between 3 and 16 nucleotides, preferably between 8 and 16 nucleotides and, more preferably, between 10 and 11 nucleotides.
- the UIi is modified in all those nucleotides at positions 1 to 11 or 2 to 11 so that said region is fully complementary to 11 or 10 consecutive nucleotides at the pre-selected site of the target pre-mRNA.
- the region in the target mRNA that is preselected for incorporation as a complementary sequence in the 5 'region of the modified Ul is found in the terminal exon of the corresponding pre-mRNA.
- the distance from the target sequence to the polyadenylation site is not particularly relevant as demonstrated by Fortes et al (supra.) Where it was shown that modified Ul directed to the RNA terminal exon of a reporter gene were able to cause degradation of said RNA even when the target sequence was more than 1000 nucleotides from the polyadenylation sequence.
- the binding sites for a sequence of that length will appear randomly once every 10 6 nucleotides, implying that they will appear about 3000 times in the human genome.
- exons constitute only 2% of the human genome and that snRNP-mediated inhibition with modified Ul requires mating to unstructured regions in the terminal exons of transcripts containing polyadenylation signals (AAUAAA)
- the specificity of inhibition is much greater.
- those target sites that appear less often in the 3 'terminal exons of the organism from which the cells in which the silencing is to be carried out are chosen.
- the frequency of occurrence of possible targets can be determined by sequence comparison.
- a sequence acts as the reference sequence, with which the test sequences are compared.
- a sequence comparison algorithm is used, the test and reference sequences are entered into a computer, sub-sequence coordinates are designated, if necessary, and the program sequence algorithm parameters are designated. Preferably, default program parameters may be used, or alternative program parameters may be designated.
- the sequence comparison algorithm calculates the percentages of the sequence identities of the test sequences with respect to the reference sequence, based on the program parameters.
- a “comparison window”, in the context of the present invention, refers to a segment of any of the contiguous positions selected from the group consisting of 19 to 600, preferably about 50 to about 200, more preferably about 100 to about 150, in which a sequence can be compared to a reference sequence with the same number of contiguous positions, once the two sequences have been optimally aligned.
- Sequence alignment methods for comparison are widely known in the art. Optimal sequence alignments can be performed for comparison, eg, with the local homology algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2: 482), with the homology alignment algorithm of Needleman and Wunsch , (J. Mol.
- BLAST and BLAST 2.0 are used, with the parameters described here, to determine the percentage of sequence identity.
- the software to carry out the BLAST analysis is available to the public through the "National Center for Biotechnology Information".
- This algorithm implies, first, to identify pairs of sequences with high score (HSPs), identifying short words of length W in the problem sequence, which either adjust or satisfy some positive threshold values of T score, when aligned with a word of the same length in the sequence database.
- T refers to the word punctuation threshold in the vicinity (Altschul et al, supra).
- a matrix of scores is used to calculate the cumulative score.
- the extension of the positive words selected in all directions is interrupted when: the cumulative alignment score falls out by the amount X from its maximum value achieved; the cumulative score is near zero or below, due to the accumulation of one or more residue alignments with a negative score; or the end of each sequence is reached.
- the BLAST W, T and X algorithm parameters determine the sensitivity and speed of the alignment.
- the modified Ul snRNAs used in the composition of the invention are selected such that their binding sequence to the consensus consensus sequence of the 5 'end of the intron, which has been modified according to the sequence of the target pre-mRNA, It is identical or substantially identical to the target sites.
- nucleic acids or polypeptide sequences refer to two or more sequences or sub-sequences that are the same (identical) or have a percentage of residues of amino acids or nucleotides which is the same (for example, in at least 70% similarity, preferably 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%,
- a consensus region will be designed that can be used as a target to design the specific Ul snRNAs for a family of proteins.
- the design of Ul inhibitors whose 5 'sequence is directed to the sequences conserved among the different family members will result in the simultaneous silencing of several family members.
- family members show a high degree of identity and there are multiple conserved regions that can be chosen as a target for the design of the inhibitor Ul, those that appear less often in the exon 3 'terminal will be chosen of the RNAs of the organism in which the silencing is carried out, determined as indicated in the previous paragraph.
- the polynucleotide encoding the snRNA Ul according to the invention may be operatively coupled to a promoter that allows transcription of said polynucleotide in the cell in which UIi expression is desired.
- Promoters Suitable for carrying out the present invention include, but are not necessarily limited to, constitutive promoters such as the Ul promoter or derivatives of eukaryotic virus genomes such as polyoma virus, adenovirus, SV40, CMV, avian sarcoma virus, virus of hepatitis B, the metallothionein gene promoter, the herpes simplex virus thymidine kinase gene promoter, retrovirus LTR regions, the immunoglobuin gene promoter, the actin gene promoter, the EF-lalpha gene promoter as well as inducible promoters in which gene expression depends on the addition of a molecule or an exogenous signal, such as the tetracycline system, the NFkappaB / UV
- tissue specific promoters in case the gene whose expression is to be silenced is expressed in a tissue in a specific way:
- stomach specific promoter such as the H / K-ATPase beta subunit promoter, Kl 9 promoter, metallothionein promoter, TFF 1 promoter, TFF2 promoter, FOXa / HNF2 promoter gamma
- a specific pancreas promoter such as the elastase promoter, the Pdx-1 promoter, the insulin promoter or the phosphoglycerate kinase promoter, a lung specific promoter, such as the secretory protein promoter of Clara cell, the protein C promoter of the surfactant.
- a specific breast promoter such as the mouse mammary tumor virus promoter or the whey acid protein promoter.
- a specific skin promoter including the keratin promoter or K 14 promoter, - an esophage specific promoter, such as EBV promoter 12
- liver promoter such as the main urinary protein promoter or the albumin promoter
- a specific colon promoter such as the villin promoter or the FABP-TS4 promoter
- prostate specific promoter such as the cryptidine-2 promoter, the prostate specific antigen promoter, the C (3) l promoter, the 94 amino acid prostate secreted protein promoter (PSP94) or the promoter of probasin.
- a specific kidney promoter such as the uromodulin promoter, the Tamm-Horsfall protein promoter or the gamma-glutamyl transpeptidase type 1 promoter - a bladder specific promoter, such as the uroplachin promoter or promoter of urohingin ,
- a specific uterus promoter such as the uteroglobin promoter.
- the second component of the composition according to the invention is a gene expression silencing agent or a combination of said gene expression specific silencers (s) for the mRNA that comes from the processing of the target pre mRNA against which it was directed the UIi that is part of the first component of the invention and that is capable of causing the silencing of the expression of said mRNA.
- RNA silencing agents are meant those compounds that cause degradation of a target mRNA or inhibit its translation by a process called RNA interference (RNAi).
- RNAi RNA interference
- dsRNA double stranded RNA
- Dicer RNase type III
- One of the siRNA chains is incorporated into a complex ribonucleoproteinco called RNA silencing inducer complex (RISC).
- RISC RNA silencing inducer complex
- the RISC complex uses this simple RNA chain to identify mRNA molecules that are at least partially complementary to the siRNA RNA chain incorporated into the RISC that are degraded or suffer an inhibition in their translation.
- the siRNA chain that is incorporated into the RISC is known as the guide chain or antisense chain.
- the other chain which is known as the passing chain or sense chain, is removed from the siRNA and is partially homologous to the target mRNA.
- the degradation of a target mRNA by means of the RISC complex results in a decrease in the expression levels of said mRNA and the corresponding protein encoded by it. Additionally, RISC can also cause decreased expression by inhibiting translation of the target mRNA.
- an agent “capable of causing the silencing of the expression of said mRNA” is understood, in the context of the present invention, an agent that, when inside a cell, is capable of encoding an agent capable of or that It is itself capable of binding to the target mRNA containing the preselected sequence and causing degradation of it.
- Silencers that induce the RNAi response against a target mRNA and that could be incorporated into the second component of the invention include:
- agents (i), (ii) and (iii) are RNA based and component (iv) is DNA based.
- SiRNAs are agents capable of inhibiting the expression of a target gene by RNA interference.
- a siRNA can be chemically synthesized or can be obtained by in vitro transcription.
- siRNAs consist of a double chain RNA between 15 and 40 nucleotides in length and may contain a 3 'and / or 5' protruding region of 1 to 6 nucleotides. The length of the protuberant region is independent of the total length of the siRNA molecule.
- the siRNAs act by degradation or post-transcriptional silencing of the target messenger.
- the siRNAs of the invention are substantially homologous to a preselected region of the target mRNA.
- substantially homologous is meant that they have a sequence that is sufficiently complementary or similar to the target mRNA so that the siRNA is capable of causing degradation of the latter by RNA interference. "Substantially homologous” can be understood as “substantially identical” as explained above. Suitable siRNAs to cause such interference include siRNAs formed by RNA, as well as siRNAs that contain different chemical modifications such as:
- siRNA in which the bonds between nucleotides are different from those that appear in nature, such as phosphorothioate bonds.
- Nucleotides with modified bases such as halogenated bases (for example 5-bromouracil and 5-iodouracil), alkylated bases (for example 7- methylguanosine).
- halogenated bases for example 5-bromouracil and 5-iodouracil
- alkylated bases for example 7- methylguanosine
- siRNAs of the invention can be obtained using a series of techniques known to the person skilled in the art.
- siRNA can be chemically synthesized from ribonucleosides protected with forphoramidite groups in a conventional DNA / RNA synthesizer.
- the second component of the invention is shRNA (short hairpin RNA).
- ShRNA means, in the context of the present invention, a RNA molecule formed two antiparallel chains connected by a hairpin region and where the sequence of one of the antiparallel chains is complementary to a preselected region in the target mRNA.
- the shRNAs are composed of a short antisense sequence (from 19 to 25 nucleotides), followed by a loop of between 5 and 9 nucleotides followed by the sense chain.
- the shRNAs can be chemically synthesized from ribonucleosides protected with forsphoramidite groups in a conventional DNA / RNA synthesizer or they can be obtained from a polynucleotide by in vitro transcription.
- the shRNAs are processed inside the cell by the RNase Dicer that eliminates the region of the hairpin giving rise to siRNAs as described above.
- the shRNAs may also contain different chemical modifications as described above in the case of siRNAs.
- miRNA MiRNA or microRNA are small RNA molecules that naturally appear in the cell and are responsible for controlling the specificity of gene expression by regulating the degradation and translation of mRNA.
- the miRNAs are 22-stranded single-stranded RNA molecules that are synthesized as large primary transcripts (pri-miRNA) that are processed in the nucleus by Drosha type III RNase to give rise to 60 pairs "hairpin" precursors of bases (pre-miRNA). These molecules are transported to the cytoplasm and processed by a second nuclease (Dicer) to give rise to mature forms (miRNA).
- the miRNAs are incorporated into the RISC ribonucleoprotein complex, where they act causing degradation of target mRNA by pairing between the mature mRNA-RISC complex and a homologous region of the target mRNA, in particular between the so-called “seed” region of the miRNA chain ( nucleotides 2 to 7 of the 5 'end), resulting in degradation of mRNA and / or translational attenuation.
- miRNAs are endogenous molecules that act by regulating the half-life of cellular mRNAs
- the structure of an endogenous miRNA for example miR-30
- siRNA sequences incorporated in the mir-26a stem region function as RNAi effectors causing the degradation of homologous mRNAs (McManus, MT et al., 2002, RNA, 8: 842-850).
- the nucleotide sequence introduced into the stem of the miRNA showed 100% identity with the target gene.
- MiRNAs suitable for use in the compositions of the invention consist of 19-24 nucleotides, preferably 21 or 22 nucleotides.
- the miRNAs can be designed so that they hybridize to an RNA transcript with a high degree of specificity.
- the miRNA is designed so that it shows 100% identity or shows a high degree of identity (for example, accepting at least 1, at least 2, at least 3 or more of bad pairings) with the given target mRNA. that a single non-complementary nucleotide may, depending on its location in the miRNA chain, decrease inhibition levels.
- the miRNAs can be designed to address the 5 'untranslated region, the coding region or the 3' region of a target mRNA.
- the miRNA are derived from pre-miRNA processing that comprise a stem-loop region (stem loop).
- This structure can be designed to be recognized by a ribonuclease, preferably by a type III ribonuclease such as Dicer resulting in the formation of mature miRNA.
- the stem-loop structures may be from 40 to 100 nucleotides, preferably from 50 to 70 nucleotides and, more preferably, from 20 to 30 nucleotides.
- the stem may comprise a perfectly complementary duplex or may contain additional non-complementary areas in at least one of the chains that form in duplex.
- said zones of non-complementarity are not very abundant (for example, 1, 2 or 3) and consist of 3 nucleotides or less in size.
- the terminal loop may comprise 4 or more nucleotides (preferably, no more than 25).
- the loop is preferably 6 to 15 nucleotides in size.
- the miRNAs of the invention are based on the structure of miR-30 in which the stem region has been replaced by preselected mRNA target sequences.
- the presence of the miR-30 loop region although desirable, it is not absolutely necessary since it can tolerate certain variations so that the loop region has more than 70%, preferably more than 79%, even more preferably more than 86% and even more preferably more than 93% identity with respect to the loop sequence that appears in miR-30. Identity percentage determination can be carried out using any of the methods mentioned above.
- miRNA suitable for carrying out the present invention correspond to those based on the endogenous miRNA miR-30, as described in WO03093441 or based on the endogenous miRNA as described in WO03029459.
- the second component of the invention can be provided as a polynucleotide whose transcription of place to the siRNA, shRNA and / or miRNA described above.
- polynucleotides encoding a shRNA or a miRNA they comprise a single promoter region that regulates the transcription of a sequence comprising the sense and antisense chains of the shRNA and miRNA connected by a hairpin or by a stem-loop region.
- any promoter can be used for the expression of shRNA and miRNA provided that said promoters are compatible with the cells in which it is desired to express the siRNAs.
- suitable promoters for the realization of the present invention include those mentioned above for the expression of the UIi.
- the promoters are RNA polymerase III promoters that act constitutively.
- RNA polymerase III promoters appear in a limited number of genes such as 5S RNA, tRNA, 7SL RNA and U6 RNAs.
- the polynucleotides encoding siRNAs comprise two transcriptional units each formed by a promoter that regulates the transcription of one of the chains that forms in siRNA (sense and antisense).
- Polynucleotides encoding siRNAs may contain convergent or divergent transcriptional units.
- divergent transcription polynucleotides the transcriptional units encoding each of the DNA strands that form the siRNAs are located in tandem in the polynucleotide so that the transcription of each DNA chain depends on its own promoter, which can be the same or different (Wang, J. et al., 2003, Proc.Natl.Acad.Sci.
- Suitable combinations of promoters for polynucleotides comprising inverted transcriptional units include 2 U6 promoters (Tran, N.
- the sense and antisense chains of the siRNA are regulated by different promoters.
- both transcriptional units are convergently oriented.
- type III RNA polymerase promoters are promoters of the Hl and U6 genes of human or murine origin.
- the promoters are 2 human or murine U6 promoters, a mouse U6 promoter and a human Hl promoter or a human U6 promoter and a mouse Hl promoter.
- the second component of the invention may be formed by one or more of the components indicated in (i), (ii), (iii) and (iv).
- the invention contemplates the combined use of one or more siRNA, one or more shRNA, one or more miRNA and / or one or more of the polynucleotides encoding said polynucleotides.
- the different silencing agents may be directed against different regions of the same mRNA.
- component (ii) of the composition or kit Parts of the invention is a polynucleotide comprising a sequence encoding at least one shRNA.
- Both the polynucleotides that form the first component of the invention and the polynucleotides encoding siRNA, miRNA and / or shRNA and that form the second component of the invention can be isolated as such or as part of vectors that allow the propagation of said polynucleotides in suitable host cells.
- Suitable vectors for the insertion of said polynucleotides are vectors derived from prokaryotic expression vectors such as pUC18, pUC19, Bluescript and their derivatives, mpl8, mpl9, ⁇ BR322, pMB9, CoIEl, pCRl, RP4, phage and shuttle vectors such as pSA3 and pAT28, yeast expression vectors such as 2 micron plasmid type vectors, integration plasmids, YEP vectors, centromeric plasmids and the like, insect cell expression vectors such as pAC series vectors and pVL series, plant expression vectors such as pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE and the like vectors and expression vectors in higher eukaryotic cells, including baculoviruses suitable for cell transfection of insects using any commercially available bac
- Eukaryotic cell vectors preferably include viral vectors (adenovirus, adenovirus-associated viruses as well as retroviruses and, in particular, lentiviruses) as well as non-viral vectors such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1 / hyg pHCMV / Zeo, ⁇ CR3.1, pEFl / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAXl, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and pTDTl.
- viral vectors adenovirus, adenovirus-associated viruses as well as retroviruses and, in particular, lentiviruses
- non-viral vectors such as pS
- the polynucleotide encoding the UIi RNA and the polynucleotide encoding the siRNA, shRNA or miRNA are part of the same vector.
- the polynucleotide encoding the UIi RNA and the polynucleotide encoding the siRNA, shRNA or miRNA are part of a single vector.
- the vectors comprise a reporter or marker gene that makes it possible to identify those cells that have incorporated the vector after having been contacted with it. Reporter genes useful in the context of the present invention include lacZ, luciferase, thymidine kinase, GFP and the like.
- Marker genes useful in the context of the present invention include, for example, the neomycin resistance gene, which confers resistance to G418 aminoglycoside, the hygromycin phosphotransferase gene that confers hygromycin resistance, the ODC gene, which confers resistance to the inhibitor of Ornithine decarboxylase (2- (difluoromethyl) -DL-ornithine (DFMO), the dihydrofolate reductase gene that confers resistance to metrotexate, the puromycin-N-acetyl transferase gene, which confers puromycin resistance, the ble gene that confers resistance to zeocin, the adenosine deaminase gene that confers resistance to 9-beta-D-xylofuranosyl adenine, the cytosine deaminase gene, which allows cells to grow in the presence of N- (phosphonacetyl) -L-aspartate, Thym
- the selection gene is incorporated into a plasmid which may additionally include a promoter suitable for the expression of said gene in eukaryotic cells (for example, CMV or SV40 promoters), an optimized translation initiation site (for example a site that follows the so-called Kozak rules or an IRES), a polyadenylation site such as, for example, the polyadenylation site of SV40 or phosphoglycerate kinase, introns such as, for example, the intron of the beta-globulin gene.
- a promoter suitable for the expression of said gene in eukaryotic cells for example, CMV or SV40 promoters
- an optimized translation initiation site for example a site that follows the so-called Kozak rules or an IRES
- a polyadenylation site such as, for example, the polyadenylation site of SV40 or phosphoglycerate kinase
- introns such as, for example, the intron of the beta-globulin
- the vectors are viral vectors.
- the vectors used for the expression of the first or second component of the invention is a viral vector selected from the group of adenovirus, adeno-associated virus, retrovirus, lentivirus , herpesvirus, SV40 and alphavirus.
- the region of the target mRNA that is taken as the basis for designing the siRNAs is not limiting and may contain a region of the coding sequence (between the initiation codon and the termination codon) or, alternatively, may contain sequences from the non-translated region 5 'or 3'. It will preferably be between 21 and 50 nucleotides in length.
- siRNAs, shRNA and miRNA are widely known to the person skilled in the art (see for example Birmingham, A. et al., 2007, Nature Protocols, 2: 2068-2078, Ladunga, L, 2006, Nucleic Acids Res 35: 433-440 and Martineau, H, Pyrah, L, 2007, Toxicol.Pathol., 35: 327-336 and Pei and Tuschl, 2006, Nature Methods, 3: 670-676).
- the region of the target preRNA that is taken as the basis for designing the UIi comprises only the 3 'terminal region as demonstrated by Fortes et al (si ⁇ ra.).
- the first component of the invention comprises several polynucleotides that code for different IUIs all being directed against different regions of the same target mRNA.
- UIi a synergistic inhibitory effect of UIi can be achieved as demonstrated in Fortes et al (supra.) And Sajic et al (supra.).
- component (ii) of the parts kit or composition of the invention comprises different gene expression silencing agents specifically directed against different pre-selected regions of the mRNA resulting from the processing of the pre-mRNA which is the Diana of snRNA Ul defined in (i) and which are capable of causing the in vivo silencing of said target mRNA.
- component (i) of the parts kit or composition of the invention comprises several Ul snRNAs or several polynucleotides encoding modified Ul snRNAs in their consensus region binding sequences GU of the 5 'end of the intron so that they specifically bind to different preselected regions of the same pre-mRNA target and component (ii) of the kit of parts or the composition of the invention comprises different gene expression silencing agents directed at different preselected regions of the mRNA resulting from pre-ATNm processing which is the snRNA Ul target defined in (i) and which are capable of causing in vivo silencing of said target mRNA.
- compositions of the invention may contain both components in a single container or the two components may be physically separated in several containers, in which case, the composition is known as "kit of the invention".
- kit is meant, in the context of the present invention, a product containing the various components of the composition of the invention packaged to allow transport and storage.
- Suitable materials for packaging kit components include glass, plastic (polyethylene, polypropylene, polycarbonate and the like), bottles, vials, paper, envelopes and the like.
- the kits of the invention may contain instructions for simultaneous, sequential or separate administration of the various components found in the kit.
- Said instructions may be in the form of printed material or in the form of an electronic support capable of storing instructions so that they can be read by a subject, such as electronic storage media (magnetic discs, tapes and the like), optical media (CD- ROM, DVD) and the like. Additionally or alternatively, the media may contain Internet addresses that provide such instructions.
- electronic storage media magnetic discs, tapes and the like
- optical media CD- ROM, DVD
- the media may contain Internet addresses that provide such instructions.
- the invention relates to a polynucleotide (in hereinafter bifiinational polynucleotide of the invention) comprising
- component (ii) of the bifunctional polynucleotide comprises the sense and antisense chains of at least one siRNA, encodes at least one pre-miRNA or encodes at least one shRNA wherein said siRNA, miRNA and shRNA bind specifically the Ul RNA encoded by the sequence defined in (i) and which is capable of causing the in vivo silencing of said target mRNA.
- the invention relates to a polynucleotide (hereinafter bifunctional polynucleotide of the invention) comprising
- the Ammunition polynucleotides of the invention are usually coupled to regulatory regions of their expression that may be identical for the sequences encoding the UIi and for the sequences encoding the silencing agent or may be different. Suitable promoters for the expression of said polynucleotides are the same (constitutive, regulable and tissue specific) mentioned above for the expression of the UIi.
- the bifunctional polynucleotides of the invention may be part of an expression vector.
- the invention relates to expression vectors comprising a bifunctional polynucleotide of the invention.
- Suitable vectors for cloning and propagation of the polynucleotides of the invention are substantially the same as mentioned above for the expression of the polynucleotides encoding the UIi or polynucleotides encoding the siRNA, shRNA and / or miRNA.
- the expression vectors of the polynucleotides of the invention are viral vectors, even more preferably vectors selected from the group of adenovirus, adeno-associated virus, retrovirus, lentivirus, herpesvirus, SV40 and alphavirus.
- the invention in another aspect, relates to a cell comprising a bifunctional polynucleotide of the invention or a vector comprising a bifunctional polynucleotide of the invention.
- Suitable host cells for the expression of the compositions of the invention include, but are not limited to, mammalian cells, plants, insects, fungi and bacteria.
- Bacterial cells include, but are not limited to, Gram positive bacteria cells such as species of the genus Bacillus, Streptomyces and Staphylococcus and Gram negative bacteria cells such as cells of the genus Escherichia and Pseudomonas.
- Fungal cells preferably include yeast cells such as Saccharomyces, Pichia pastoris and Hansenula polymorpha.
- Insect cells include, without limitation, Drosophila cells and Sf9 cells.
- Plant cells include, among others, crop plant cells such as cereals, medicinal, ornamental or bulb plants. Said cells are transfected with the bifunctional polynucleotides of the invention by known techniques such as Agrobacterium-mediated gene transfer, transformation of leaf discs, transformation induced by polyethylene glycol, electroporation, sonication, microinjection, biolistic transfer.
- Suitable mammalian cells for the insertion of the bifunctional polynucleotides of the invention include CHO cells (Ch ⁇ nese Hmaster Ovary), COS cells, BHK cells, HeLa, 911, AT1 080, A549, 293 or PER.C6 cells.
- the invention relates to a non-human transgenic animal comprising, integrated into its genome, a bifunctional polynucleotide according to the invention.
- the method of obtaining a non-human animal can only be carried out when the bifunctional polynucleotide of the invention is inserted into the genome of a stem cell that can be differentiated into all cell types, including germline cells. These are embryonic cells (EC) or embryonic germ cells (CGE). Embryonic stem cells (CTE) are derived from the internal cell mass of the embryo in the blastocyst stage before implantation. Various types of mouse and human embryonic stem cells are known and established, such as CTE TB V2, Rl, D3 CTE cells.
- CTE Embryonic stem cells
- CGE Embryonic germ cells
- CGP primordial germ cells
- the CTE and CGE cells of the invention that carry a modified GDNF locus are injected into a host blastocyst, that is, the blastocele of the host blastocyst, or cultured together with ovules from eight cells to the morula stage, is that is, zone-free morula, so that the modified CTE cells are preferentially incorporated into the internal cell mass of the developing embryo.
- the transgenic bait is called chimeric, since some of its cells are derived from the host blastocyst and some are derived from modified CTE cells.
- Host embryos are transferred to pseudo-pregnant substitute females or intermediate hosts for continuous development.
- chimeric animals whose somatic line tissue and Germinal comprises a mixture of cells derived from CTE cells obtained by genetic engineering and the receptor blastocyst.
- stem cells and blastocysts are obtained from animals that have different pigmentations on the skin, so that chimeric animals can wear spots of different colors. Therefore, these chimeric animals then cross again with their siblings until a transgenic animal is obtained in the germ line, that is, an animal in which the modified transgene is present in the germ cells of the animal, so that the Trait can pass to the bait of the animal through reproduction.
- Transgenic animals in the germ line can be identified, for example, by observing the bait to determine the presence of the trait or by examining the germ cells of the transgenic animal to determine the presence of a transgene, incorporated in a manner that matches With heritability. These animals then intersect with other animals, so that monozygotic animals are obtained for the desired trait, but they no longer show mosaicism.
- non-human transgenic animals described herein can be produced by methods other than the CTE cell method described above, for example by pronuclear injection of the selection construct as a target into the pronuclei of unicellular embryos or other methods of target selection of genes that are not based on the use of a transfected CTE cell.
- a suitable mammal may be a rodent (eg, mouse, rat, hamster, guinea pig, gerbil), a rabbit, a pig, a sheep, a goat, a cow, a cat, a dog, a pig or a primate, provided that the specific line (s) of the animal are selected to obtain good general health, good embryo yields, good pronuclear visibility in the embryo and good reproductive capacity.
- the animal is a mouse.
- Varieties such as C57BL / 6 or C57BL / 6 x DBA / 2 Fit, or FVB (commercially obtained from Charles River Labs, Boston, Mass., The Jackson Laboratory, Bar Harbor, ME, or Taconic Labs are often used. ).
- the preferred varieties are the 129sv variety, as well as those with varieties that they have haplotypes H 2b, H-26 or H-2q, such as C57BL / 6 or DBA / 1.
- compositions of the invention are described.
- compositions of the invention are capable of inhibiting the expression of a target gene synergistically more efficiently than each of the components acting separately. Therefore, the compositions in which the components are directed against mRNA of proteins involved in pathologies allow the use of said compositions in medicine.
- the invention relates to the compositions of the invention and to the bifunctional polynucleotides of the invention described above for use in medicine or as a medicine.
- the compositions can be used for the treatment of all those diseases or conditions that result from the overexpression of a certain gene or that require a decrease in the expression of a particular gene.
- composition of the invention can be administered as separate molecules or as a single molecule.
- both the first and second components can be administered in the form of inhibitory molecules as is, that is, component (i) can be administered in the form of snRNA Ul and component (ii) can be administered as a muffler based agent in RNA (siRNA, miRNA, shRNA).
- the first component may be provided as a polynucleotide encoding the snRNA Ul and / or the second component may be DNA based, that is, it comprises a polynucleotide encoding the silencing agent.
- the polynucleotides can be administered as a single polynucleotide comprising components (i) and (ii) or as separate polynucleotides, simultaneously-, separately- or sequentially.
- - Simultaneous administration or component (i) is an Ul RNAs as such and component (ii) is an RNA-based silencing agent, or component (i) is an Ul RNAs as such and component (ii) is a silencing agent DNA-based, that is, comprises a polynucleotide that encodes the silencing RNA molecule.
- component (i) is a polynucleotide encoding the RNAs Ul and component (ii) is an RNA-based silencing agent, or component (i) is a polynucleotide encoding the RNAs Ul and component (ii) is a silencing agent DNA-based, that is, comprises a polynucleotide that encodes the silencing RNA molecule.
- component (i) is an Ul RNAs as such and component (ii) is an RNA-based silencing agent, or component (i) is an Ul RNAs as such and component (ii) is an agent DNA-based silencer, that is, comprises a polynucleotide that encodes the silencer RNA molecule.
- component (i) is a polynucleotide encoding the RNAs Ul and component (ii) is an RNA-based silencing agent, or component (i) is a polynucleotide encoding the RNAs Ul and component (ii) is a silencing agent DNA-based, that is, comprises a polynucleotide that encodes the silencing RNA molecule. in this case, both components must be found as separate polynucleotides.
- both the first and second components are used in the form of DNA, that is, as polynucleotides that encode the active RNA molecules
- said polynucleotides can be provided as part of a vector, in the case of Separate or sequential administration, each polynucleotide will be part of a different vector. In the case of simultaneous administration, it is possible that both polynucleotides form part of different vectors or of the same vector.
- genes that can be used as a target for the design of the compositions of the invention include, without limitation, oncogenes, genes encoding transcription factors, receptors, enzymes, structural proteins, cytokines, cytokine receptors, lectins, selectins, immunoglobulins. , kinases, phosphatases.
- prions proangiogenic polypeptides, proteases and proteins involved in the apoptosis process, genes encoding adhesion molecules, genes encoding surface receptors, genes encoding proteins involved in metastasis or in invasive processes of tumor cells, genes encoding factors of growth, the multiple drug resistance gene (MDRl), genes encoding lymphokines, cytokines, immunoglobulins, T cell receptors, MHC antigens, DNA and RNA polymerases, genes involved in metabolic processes such as amino acid synthesis, nucleic acids, tumor suppressor genes, 5-li ⁇ ooxygenase, phospholipase A2, protein kinase C, p53, pl6, p21, MMACl, p73, zacl, C-CAM, BRCAl, Rb, Harakiri, Ad El B, protease ICE-CED3, IL-2 , IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL
- compositions of the present invention may be directed against genes involved in infectious, neoplastic or neurodegenerative diseases. Therefore, in another aspect, the invention provides a composition or kit of the invention, a functional polynucleotide of the invention, a vector or a cell of the invention comprising the bifunctional polynucleotide for the treatment or prevention of an infectious, neoplastic or neurodegenerative
- the invention relates to the use of a composition or kit of the invention, of a functional polynucleotide of the invention, of a vector or of a cell of the invention comprising the bifunctional polynucleotide for the preparation of a medicament for the treatment of an infectious, neoplastic or neurodegenerative disease.
- the invention in another aspect, relates to a method of treating an infectious, neoplastic or neurodegenerative disease comprising the administration to a patient in need of a composition or kit of the invention, of a functional polynucleotide of the invention, of a vector or of a cell of the invention comprising the bifunctional polynucleotide.
- the compositions of the invention may be directed against genes of pathogenic organisms necessary for their pathogenicity as well as host genes necessary for the pathogen to interact with said host.
- the compositions are suitable for the treatment of infectious diseases, including viral and bacterial infections.
- the invention relates to a composition or kit of the invention, with a bifunctional polynucleotide of the invention, with a vector or a cell of the invention for the treatment or prevention of infectious diseases.
- the invention relates to the use of a composition or kit of the invention, to a bifunctional polynucleotide of the invention, to a vector or a cell of the invention for the preparation of a medicament for the treatment or treatment. Infectious disease prevention.
- Viral diseases that can be treated with the compositions of the invention include, but are not necessarily limited to, disorders or diseases associated with the coronavirus responsible for severe acute respiratory syndrome (SARS), herpes simplex virus (HSV), hepatitis B virus (HBV ), hepatitis C virus (HCV), human T-cell lymphotrophic virus (HTLV) types I and II, human immunodeficiency virus (HIV) types I and II, cytomegalovirus, papillomavirus, polyoma virus, adenovirus, Epstein-Barr, poxvirus, influenza virus, measles virus, rabies virus, sendai virus, polio virus, coxsackie virus, rhinovirus, reovirus and rubella virus.
- SARS severe acute respiratory syndrome
- HSV herpes simplex virus
- HBV hepatitis B virus
- HCV hepatitis C virus
- HCV human T-cell lymphotrophic virus
- HMV human immunodeficiency virus
- Bacterial diseases (for reasons of simplicity also include yeast and fungal diseases and disorders) that can be treated with the compositions of the invention include, without necessarily being limited, disorders or diseases associated with Acinetobacter sp., Aeromonas hydrophila, Alcaligenes faecalis, Bac ⁇ llus cereus, Bacteroides fi'agilis, Bacteroides ovatus, Bacteroides ureolyticus, Bacteroides vulgatus, Borrelia burgdorferi, Borrelia vincentii, Brucella abortus, Brucella melitensis, Brucella suis, Campylobacter (Vibrio) fetus, Campylobacter jejuni, Chlamydrobacter bacteria, Chlamydrobacter bacteria , Corynebacterium jeikeium, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium ramosum, Clostridium sporogenes
- compositions and kits of the invention and the bifunctional polynucleotides of the invention are directed against genes involved in tumor and / or neoplastic processes to give rise to active compositions against neoplastic processes and different types of cancer such as hematological cancers.
- hematological cancers eg leukemia or lymphomas
- neurological tumors eg astrocytomas or glioblastomas
- melanoma breast cancer
- lung cancer head and neck cancer
- gastrointestinal tumors eg stomach cancer, pancreas or colon
- liver cancer renal cell cancer
- genitourinary tumors eg ovarian cancer, vaginal cancer, cervical cancer, bladder cancer, testicular cancer, prostate cancer
- bone tumors and vascular tumors eg ovarian cancer, vaginal cancer, cervical cancer, bladder cancer, testicular cancer, prostate cancer
- the invention relates to a composition or kit of the invention, to a bifunctional polynucleotide of the invention, to a vector or a cell of the invention for the treatment or prevention of tumor or neoplastic diseases.
- the invention relates to the use of a composition or kit of the invention, to a bifunctional polynucleotide of the invention, to a vector or a cell of the invention for the preparation of a medicament for the treatment or treatment. prevention of tumor or neoplastic diseases.
- the bifunctional compositions and polynucleotides of the invention are directed against genes involved in neurodegenerative processes such as retinitis pigmentosa, Alexander's disease, Alper's disease, Alzheimer's disease, amyotrophic lateral sclerosis, ataxia telangiectasia, Batten's disease, bovine spongiform encephalopathy (BSE), Canavan's disease, Cockayne's syndrome, corticobasal degeneration, Creutzfeldt-Jakob's disease, Huntington's disease, HIV-associated dementia, disease Kennedy, Krabbe disease, Lewy body dementia, Machado-Joseph disease (spinocerebelar ataxia type 3), multiple sclerosis, multiple systemic atrophy, neuroborreliosis, Parkinson's disease, Pelizaeus-Merzbacher disease, Pick's disease, lateral sclerosis primary, prion diseases, Refsum disease, Sandhoff disease, Schilder's disease, schizophrenia
- the invention relates to a composition or kit of the invention, to a bifunctional polynucleotide of the invention, to a vector or a cell of the invention for the treatment or prevention of neurodegenerative diseases.
- the invention relates to the use of a composition or kit of the invention, to a bifunctional polynucleotide of the invention, to a vector or a cell of the invention for the preparation of a medicament for the treatment or treatment. prevention of neurodegenerative diseases.
- the invention relates to pharmaceutical preparations comprising the compositions of the invention or the bifunctional polynucleotides of the invention together with one or more pharmaceutically acceptable carriers.
- the pharmaceutically effective support can be solid or liquid.
- a solid support may include one or more substances that can also act as flavoring agents, lubricants, solubilizers, suspending agents, fillers, sliding agents, compression assistants, binding agents or tablet disintegrating agents; It can also be encapsulation material.
- the support is a finely divided solid that is in a mixture with the finely divided active ingredient.
- the active ingredient is mixed with a support that has the necessary understanding properties in suitable proportions and is compacted in the desired shape and size. Powders and tablets may contain up to 99% active ingredient.
- Suitable solid supports include, for example, calcium phosphate, stearate. magnesium, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, methyl cellulose, sodium carboxymethyl cellulose, polyvinylpyrrolidone, low melting waxes and ion exchange resins.
- Liquid carriers are used to prepare solutions, suspensions, emulsions, syrups, elixirs or pressurized compositions.
- the active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid support such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats.
- the liquid support may contain other pharmaceutically suitable additives such as solubilizers, emulsifiers, surface active agents, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickening agents, colorants, viscosity regulators, stabilizers or osmo-regulators.
- liquid carriers for oral and parenteral administration include water (which partially contains additives according to the above, for example, cellulose derivatives, possibly a solution of sodium carboxymethyl cellulose), alcohols (including monohydric alcohols and polyhydric alcohols, for example glycols ) and its derivatives, and oils (for example, fractionated coconut oil and arachis oil).
- the support can also be an oil ester such as ethyl oleate and isopropyl mistado.
- Sterile liquid carriers are useful in sterile compositions in liquid form for parenteral administration.
- the liquid support for pressurized compositions may be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.
- Liquid pharmaceutical compositions that are sterile solutions or suspensions are suitable for intramuscular, intraperitoneal and subcutaneous injection. Sterile solutions can also be administered intravenously. The compounds can also be administered orally in the form of a liquid or solid composition. Pulmonary administration is also contemplated.
- the pharmaceutical composition may be in the form of dosage units, for example, as tablets or capsules.
- the composition is subdivided into dosage units containing appropriate amounts of the active ingredient;
- the dosage unit forms may be packaged compositions, by for example, packaged powders, vials, ampoules, pre-filled syringes, or sachets containing liquid.
- the dosage unit form may be, for example, a capsule or a tablet itself, or it may be the appropriate number of any of those compositions in packaged form.
- the dose that should be used in the treatment should be subjectively determined by the doctor.
- the compounds of this invention can be used as a solution, cream, or lotion by a formulation with pharmaceutically acceptable carriers and applied in the affected area.
- the invention contemplates pharmaceutical compositions specially prepared for the administration of the nucleic acids that form the first and second components of the invention or for the administration of the bifunctional polynucleotides of the invention.
- the pharmaceutical compositions can comprise both the first component and the second component, whether it is based on DNA or RNA in a naked form, that is, in the absence of compounds that protect nucleic acids from their degradation by the body's nucleases, which entails the advantage that the toxicity associated with the reagents used for transfection is eliminated.
- Suitable routes of administration for naked compounds include intravascular, intratumoral, intracranial, intraperitoneal, intrasplenic, intramuscular, subretinal, subcutaneous, mucosa, topical and oral (Templeton, 2002, DNA CeIl Biol., 21: 857-867).
- Initial fears regarding the ability of these compounds to induce an immune response when administered nude have been investigated by Heidel et al. (Nat. Biotechnol., 2004, 22: 1579-1582).
- an immune response could not be observed while it was observed that the systemic administration of siRNA was well tolerated.
- compositions and polynucleotides of the invention are administered by the so-called "hydrodynamic administration" in which the compounds are introduced into the body intravascularly at high speed and volume, resulting in high levels of transfection. with a distribution more diffuse
- hydrodynamic administration in which the compounds are introduced into the body intravascularly at high speed and volume, resulting in high levels of transfection. with a distribution more diffuse
- a modified version of this technique has allowed positive results for silencing by means of naked siRNAs from exogenous genes (Lewis et al., 2002, NatGen., 32: 107-108; McCafrrey et al., 2002, Nature, 418: 38- 39) and endogenous (Song et al., 2003, Science, NatMed., 9: 347-351) in multiple organs.
- mice have been shown that the effectiveness of intracellular access depends directly on the volume of fluid administered and the speed of injection (Liu et al., 1999, Science, 305: 1437-1441). In mice, administration has been optimized in lml / 10 g body weight values over a period of 3-5 seconds (Hodges et al., 2003, Exp.Opin.Biol.Ther, 3: 91-918). The exact mechanism that allows cell transfection in vivo with siRNAs after hydrodynamic administration is not fully known. In the case of mice, it is thought that administration by the tail vein takes place at a rate that exceeds the heart rate, which causes the administered fluid to accumulate in the superior vena cava.
- both the UIi that forms the first component of the composition of the invention, and the RNA-based components that form the second component of the composition of the invention may contain modifications of their structure that contribute to increasing their stability.
- Suitable modifications to decrease nuclease sensitivity include 2'-O-methyl (Czauderna et al., 2003, Nucleic Acids Res., 31: 2705-2716), 2'-fluoropyrimidines (Layzer et al, 2004, RNA, 10: 766-771).
- compositions and polynucleotides of the invention can be administered as part of liposomes, cholesterol-conjugated or conjugated to compounds capable of promoting translocation through cell membranes such as the Tat peptide derived from the HIV-I TAT protein, the third helix of the homeodomain of the Antennapedia protein of D.melanogaster, the VP22 protein of the herpes simplex virus, arginine oligomers and peptides such as those described in WO07069090 (Lindgren, A. et al, 2000, Trends Pharmacol. Sci, 21: 99-103 , Schwarze, SR et al., 2000, Trends Pharmacol.
- the second component of the invention when based on DNA, can be administered as part of a plasmid vector or a viral vector, preferably adenovirus-based vectors, adeno-associated viruses or retroviruses, particularly viruses based on murine leukemia virus. (MLV) or in lentivirus (HIV, IVF, EIAV).
- a viral vector preferably adenovirus-based vectors, adeno-associated viruses or retroviruses, particularly viruses based on murine leukemia virus. (MLV) or in lentivirus (HIV, IVF, EIAV).
- the composition in the event that the pharmaceutical composition is formed by a first component and a second component, the composition may include instructions for simultaneous, sequential or separate use of the first and second components of the composition of the invention.
- the invention relates to a composition or kit of the invention comprising instructions for the joint, sequential or separate use of the first and second component of the composition.
- the invention relates to a composition or kit of the invention as a combined preparation for sequential, separate or sequential use.
- the dose regimen and the corresponding patients to be treated can be determined in accordance with the present invention.
- the recommended doses will be indicated on the product label allowing the prescriber to anticipate dose adjustments depending on the group of patients considered, with information that avoids prescribing the wrong drug to the wrong patients at the wrong dose.
- the dose regimen will be determined by the doctor and other clinical factors; preferably according to any of the methods described above. As is well known in medical science, doses for any patient depend on many factors, including patient size, body surface area, age, the particular compound to be administered, sex, time and route. of administration, general health, and if other drugs are being administered at the same time. Progress can be observed by periodic evaluation.
- compositions of the invention can be administered in doses of less than 10 mg per kilogram of body weight, preferably less than 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg per kg of body weight and less than 200 nmol of RNA agent, that is, around 4.4 x 10 16 copies per kg of body weight or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5 , 0.75, 0.15 or 0.075 nmol per kg of body weight.
- the unit dose can be administered by injection, by inhalation or by topical administration.
- compositions and polynucleotides of the invention can be administered directly to the organ in which the target mRNA is expressed in which case doses of between 0.00001 mg to 3 mg per organ are administered, or preferably between 0.0001 and 0.001 mg per organ, in around 0.03 and 3.0 mg per organ, around 0.1 and 3.0 mg per organ or between 0.3 and 3.0 mg per organ.
- the dose depends on the severity and response of the condition to be treated and may vary between several days and several months or until it is observed that the condition remits.
- the optimal dosage can be determined by periodic measurements of the agent concentrations in the patient's organism.
- the optimal dose can be determined from the EC50 values obtained by previous tests in vitro or in vivo in animal models.
- the unit dose can be administered once a day or less than once a day, preferably, less than once every 2, 4, 8 or 30 days. Alternatively, it is possible to administer an initial dose followed by one or several maintenance doses, generally of less quantity than the initial dose.
- the maintenance regimen may involve treating the patient with doses ranging from 0.01 ⁇ g to 1.4 mg / kg body weight per day, for example 10, 1, 0.1, 0.01, 0.001, or 0, 00001 mg per kg body weight per day. Maintenance doses are preferably administered at most once every 5, 10 or 30 days.
- the treatment should be continued for a time that will vary according to the type of alteration suffered by the patient, its severity and the patient's condition. After treatment, the evolution of the patient should be monitored to determine if the dose should be increased in case the disease does not respond to the treatment or the dose is decreased if an improvement in the disease is observed or if unwanted side effects are observed.
- the daily dose can be administered in a single dose or in two or more doses depending on the particular circumstances. If repeated administration or administrations is desired Frequently, it is advisable to implant a delivery device such as a pump, a semi-permanent catheter (intravenous, intraperitoneal, intracisternal or intracapsular) or a reservoir.
- a delivery device such as a pump, a semi-permanent catheter (intravenous, intraperitoneal, intracisternal or intracapsular) or a reservoir.
- the invention relates to in vitro and in vivo non-therapeutic methods of post-transcriptional inhibition of the expression of a target gene comprising contacting the bifunctional compositions or polynucleotides of the invention with a biological model.
- the biological model is a cell culture or an animal.
- compositions and polynucleotides of the invention suitable for application on a cell culture there are different methods for getting the polynucleotides to access the cell interior.
- the contact of the cells with the polynucleotides although it allows access to the endosomal compartment, does not allow the cytoplasm to be reached in a functional state (Lingor, P. e tal., 2004, Biochem.Biophys, Res.Commun. 315: 1123- 1133).
- polynucleotides are preferably administered by microinjection or electroporation.
- polynucleotides of the invention can be administered using expression vectors Obviously, this approach is possible only when the second component of the composition of the invention is DNA based.
- the agents that form the composition of the invention can be conjugated with different types of compounds such as peptides, organic compounds.
- the conjugation can take carried out by methods known to the person skilled in the art, including the methods of Lambert et al., (Drug Deliv. 2001, Rev.:47:99-112) in which the nucleic acids are coupled to polyalkylcyanoacrylate nanoparticles (PACA )); Fattal et al., (J. Control Relay 1998, 53: 137-43) describing nucleic acids coupled to nanoparticles; Schwab et al., (Ann. Oncol., 1994, 5 Suppl.
- the agents of the invention are coupled to lipophilic moieties that may include a cationic group and that may be associated with one or both chains of the expression silencing agent.
- Suitable lipophilic agents include cholesterol, vitamin E, vitamin K, vitamin A, folic acid, a cationic dye (eg Cy3), colic acid, adamantane acetic acid, 1-pyrien butyric acid, dihydrotestosterone, l, 3-bis-O (hexadecyl ) glycerol, a geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl, palmitic acid, myristic acid, O3- (oleoyl) lithocolic acid, 03- (oleoyl) collenic acid, dimethoxytrityl, or phenoxazine.
- the effects of silencing can be observed by detecting phenotypic changes or by using biochemical techniques that allow changes in the expression levels of a particular mRNA or of the proteins encoded by it, such as RNA hybridization, nuclease protection , Northern hybridization, gene expression monitoring by DNA microarrays, Western blotting, RIA, ELISA, FACS. In animal or cell models in culture, it is possible to detect the modification of the expression of a reporter gene or of resistance to a toxic agent whose products are easily detectable.
- Suitable reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), fluorescent green protein (GFP), radish peroxidase (HRP), luciferase ( Luc), nopaline synthase (NOS), octopine synthase (OCS) and its derivatives.
- AHAS acetohydroxyacid synthase
- AP alkaline phosphatase
- LacZ beta galactosidase
- GUS beta glucuronidase
- CAT chloramphenicol acetyltransferase
- GFP fluorescent green protein
- HRP radish peroxidase
- Luc nopaline synthase
- OCS octopine synthase
- Suitable selection markers include genes encoding resistance to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromicma and tetracycline.
- the non-therapeutic method to silence gene expression in a post-transcriptional manner can be applied to an animal model in which the gene whose expression is to be silenced is expressed. In this case, it is necessary that the gene expression silencing agent access the tissue or organ in the animal in which it is desired to cause post-transcriptional silencing of the gene expression.
- any of the methods described above can be used for therapeutic administration of the agents of the invention to a patient.
- the invention contemplates the administration of compositions directed against different target mRNAs encoding proteins that are involved in the same functional route.
- Functional routes that may be inhibited through the use of combinations of compositions of the invention include, but are not necessarily limited to, glycolysis, gluconeogenesis, Krebs cycle, pentose phosphate pathway, glycogen synthesis, Calvin cycle, degradation of triacylglycerides, activation of fatty acids, beta oxidation, de novo synthesis of fatty acids, cholesterol synthesis, urea cycle, shikimato route, amino acid synthesis, oxidative phosphorylation, photosynthesis, purine synthesis, pyrimidine synthesis, metabolism of histidine, porphyrin metabolism, inositol metabolism and the like.
- Gene therapy which is based on introducing therapeutic genes into cells using ex vivo or in vivo techniques, is one of the most important applications of gene transfer.
- vectors and methods suitable for in vitro or in vivo gene therapy have been described and are known to the person skilled in the art; see, for example, Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res. 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res.
- the gene can be designed for direct introduction or for introduction by liposomes, or viral vectors (eg, adenoviral, retroviral) in the cell.
- said cell is a non-human germline cell, non-human embryonic cell, non-human egg cell or a cell derived therefrom, more preferably said cell is an adult stem cell or a non-human embryonic stem cell.
- the nucleic acid sequence be operably linked to the regulatory elements that allow the expression and / or integration of the polypeptides of the invention into specific cells.
- Suitable gene distribution systems may include liposomes, receptor-mediated distribution systems, naked DNA, and viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses, among others.
- the distribution of nucleic acids to a specific site in the body for gene therapy can also be achieved using a biolistic distribution system, such as that described by Williams (Proa Nati. Acad. Sci. USA 88 (1991), 2726-2729) .
- Standard methods for transfecting cells with recombinant DNA are well known to those skilled in the field of molecular biology, see, for example, WO 94/29469; See also above.
- Gene therapy can be carried out by directly administering the recombinant DNA molecule or vector of the invention to a patient or transfecting the cells with the polynucleotide or vector of the invention ex vivo and administering the transfected cells in the patient.
- Particularly preferred gene therapy vectors in the context of the present invention are parvoviral vectors.
- the invention relates to the use of animal parvoviruses, in particular dependoviruses such as infectious human or ape AAV and their components (for example, an animal parvovirus genome) for use as vectors for the introduction and / or expression of the composition of the invention.
- Viruses of the Parvoviridae family are small animal DNA viruses.
- the Parvoviridae family can be divided into two subfamilies: the Parvovirinae, which infect vertebrates, and the Densovirinae, which infect insects.
- Members of the Parvovirinae subfamily are referred to herein as parvoviruses and include the genus Dependovirus.
- the members of the genus Dependovirus are unique in that they normally require co-infection with a helper virus, such as adenoviruses or herpesviruses, to produce infection in cultured cells.
- the genus Dependovirus includes AAV, which normally infects humans (for example, serotypes 2, 3A, 3B, 5 and 6) or primates (for example, serotypes 1 and 4, which are thought to have originated from monkeys , but that also infect humans), and related viruses that infect other warm-blooded animals (for example, bovine, canine, equine, and sheep adeno-associated viruses). More information on AAV serotypes and strategies for making AAV hybrid vectors derived from AAV is described in Wu et al. (2006, Molecular Therapy 14: 316-327).
- the invention is not limited to AAV but can be applied equally to hybrid AAV vectors derived from two or more different AAV serotypes and other parvoviruses and hybrids thereof. Techniques related to the use of AAV vectors in gene therapy are described, for example, in WO2007 / 046703 and WQ2007 / 148971.
- a composition or polynucleotide of the invention can thus be transported (delivered) using a "parvoviral recombinant vector or AAV ('Vector rAAV") which here would refer to a vector comprising a polynucleotide of the invention (or one) sequence of interest that is flanked by at least one parvoviral or AAV terminal repetitive sequence (ITRs).
- a composition of the invention can be transported using two rAAV vectors, each encoding one of the components of said composition.
- Vectors valid for use in the present invention can be replicated and packaged in infectious viral particles when they are present in a host insect cell that expresses the products of the AAV rep and cap genes (e.g., AAV Rep and Cap proteins) .
- the rAAV vector When the rAAV vector is incorporated into a larger nucleic acid construct (eg, in a chromosome or another vector such as a plasmid or baculovirus used for cloning or transfection), then the rAAV vector is typically referred to as a "pro-vector" that it can be "rescued” by means of encapsidation, in the presence of the packing functions and the necessary help functions.
- a pro-vector that it can be "rescued” by means of encapsidation, in the presence of the packing functions and the necessary help functions.
- A 5 'sequence
- B Sense (passing chain);
- C Loop;
- D Antisense (Guide chain);
- E Termination signal.
- Sequences 1 to 4 were obtained from Sigma. Sequence 5 (described by Purow and cois. Cancer Res. (2005) 65: 2353-63) and 6 were obtained in the laboratory by cloning in the plasmid pSuper (Brummelkamp et al. Science (2002) 296: 550-3) of an oligo containing the sequences:
- SEQ ID NO: 6 GATCCCCACACCAACGTGGTCTTCAATTCAAGAGATTGAAGACCACGTTGGTGTTTTTTGGAAA
- sequences are cloned into the BgllI-HindII site of plasmid pSuper designed to express them when they are transfected into the cell.
- ShRNA expression occurs in the nucleus of the cell, from there it is transported to the cytoplasm where it is processed to give rise to a siRNA. This interacts with the silencing machinery that activates it to recognize the target mRNA by base pairing and activate its degradation.
- the target RNA is the firefly luciferase [Photinus pyralis (GenBank Accession No. Ml 5077)].
- Sequences 6 and 7 are directed against the Notchl gene (NP_060087.3). The sequence of All clones were verified by sequencing on an ABI Prism 310 sequencer (Applied Biosystems). Plasmid DNA was purified with a Maxiprep kit (Marlingen) before transfection
- Ul snRNA (Ul ⁇ Mock) containing a sequence identical to that of endogenous Ul snRNA at its 5 'end was used as a control, with 4 point mutations in Iazo3. Two cytosines that hybridize with two guanosines in this loop have exchanged with each other. The resulting molecule has no functional difference with the endogenous snRNP Ul. Previously, it was found that adding a sequence that hybridizes with the endogenous snRNA in part 3 "UTR of a reporter gene produced an inhibition of the expression of this reporter gene. It is the proof of concept that the system works.
- the Uli ⁇ Luc was built from the sequence of the UlWT. In this sequence three positions were imitated (in bold and underlined) and it was seen that by co-transfecting a modified Ul snRNA with a reporter gene containing the target for said snRNP Ul the expression of the reporter gene is inhibited. Numerous constructions were tested in different positions of the 3 TR UTR and through numerous in vitro studies a series of conditions were established for the design of the different modified snRNA Ul. These rules are:
- HeLa cells obtained from ATCC were grown in DMEM medium supplemented with 10% FBS (fetal bovine serum) and 1% / streptomycin in an atmosphere with 5% CO 2. All culture reagents came from Invitrogen. All plasmids used were transfected in the cell using calcium phosphate according to Aparicio and cols. 2006 J. Virol. 80: 12236-47., In addition, a control plasmid expressing renilla luciferase (pSV-RL, Promega) and another expressing firefly luciferase were transfected with the siRNAs and Ulis target sequences (pGL-3 Promoter, Promega).
- FBS fetal bovine serum
- HeLa cells were transfected using Lipofectamine 2000 (Invitrogen) with pGEM plasmids (Promega) expressing Uli ⁇ Notchl or Ul ⁇ Mock as control or shRNAl ⁇ Notchl or shRNA2 ⁇ Notchl.
- Cell extracts were collected at 48 and 72 hours post transfection and Notchl accumulation was quantified with specific antibodies (C-20 (sc-6014-R, Santa Cruz Biotechnology) by Western Blot revealed by chemiluminescence (Perkin Elmer) and quantified (Image Quant ECL, Amersham). Actin levels were also quantified as load control in all cases. Notchl activity was also measured by measuring its ability to translocate to the NFKB nucleus.
- NFKB activity was quantified by measuring its ability to activate luciferase expression from a plasmid in which the luciferase gene is under an NFKB-inducible promoter (Stratagene). When this system was used, luciferase was measured as described above.
- Example 2 Effect of different snRNA Ul and RNA interference on the expression of the luciferase gene.
- the inhibition has been tested in the presence of a dose or half dose of shRNAs against Notchl, one dose (8 micrograms) or half dose (4 micrograms) of Uli ⁇ Notchl or the mixture of half dose of shRNA and half dose of Uli ⁇ Notchl.
- the result shows that there is synergy, since the inhibition obtained using both techniques is superior to the inhibition resulting from using each system separately (Fig. 8).
- the synergy is robust since the inhibition obtained with half a dose of IU + half a dose of shRNA is superior to the inhibition obtained with a dose of the same IUi or a dose of the same shRNA.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Communicable Diseases (AREA)
- Zoology (AREA)
- Oncology (AREA)
- Wood Science & Technology (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Neurology (AREA)
- Tropical Medicine & Parasitology (AREA)
- AIDS & HIV (AREA)
- Neurosurgery (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2010544739A JP2011510647A (ja) | 2008-01-29 | 2009-01-29 | 遺伝子発現の転写後抑制を相乗的に生じさせることができる方法および組成物 |
| US12/865,046 US20110030075A1 (en) | 2008-01-29 | 2009-01-29 | Methods and Compositions Capable of Causing Post-Transcriptional Silencing of Gene Expression in a Synergic Manner |
| AU2009209571A AU2009209571A1 (en) | 2008-01-29 | 2009-01-29 | Methods and compositions capable of causing post-transcriptional silencing of gene expression in a synergic manner |
| BRPI0906657-8A BRPI0906657A2 (pt) | 2008-01-29 | 2009-01-29 | Métodos e composições capazes de causar um silenciamento pós-transcricional da expressão genética de forma sinérgica |
| MX2010008326A MX2010008326A (es) | 2008-01-29 | 2009-01-29 | Metodo y composiciones capaces de provocar un silenciamiento post-transcripcional de la expresion genica de forma sinergica. |
| CN2009801118031A CN101981189A (zh) | 2008-01-29 | 2009-01-29 | 能够以协同方式引起基因表达转录后沉默的方法和组合物 |
| CA2713458A CA2713458A1 (en) | 2008-01-29 | 2009-01-29 | Methods and compositions capable of causing post-transcriptional silencing of gene expression in a synergic manner |
| EP09705069A EP2246432A2 (en) | 2008-01-29 | 2009-01-29 | Methods and compositions capable of causing post-transcriptional silencing of gene expression in a synergic manner |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES200800222 | 2008-01-29 | ||
| ESP200800222 | 2008-01-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2009095517A2 true WO2009095517A2 (es) | 2009-08-06 |
| WO2009095517A3 WO2009095517A3 (es) | 2009-09-24 |
Family
ID=40807539
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/ES2009/000045 Ceased WO2009095517A2 (es) | 2008-01-29 | 2009-01-29 | Métodos y composiciones capaces de provocar un silenciamiento post-transcripcional de la expresión génica de forma sinérgica |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20110030075A1 (https=) |
| EP (1) | EP2246432A2 (https=) |
| JP (1) | JP2011510647A (https=) |
| CN (1) | CN101981189A (https=) |
| AU (1) | AU2009209571A1 (https=) |
| BR (1) | BRPI0906657A2 (https=) |
| CA (1) | CA2713458A1 (https=) |
| MX (1) | MX2010008326A (https=) |
| RU (1) | RU2010136040A (https=) |
| WO (1) | WO2009095517A2 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8343941B2 (en) | 2007-03-30 | 2013-01-01 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
| US8907075B2 (en) | 2007-03-30 | 2014-12-09 | Samuel Ian Gunderson | Compositions and methods for gene silencing |
| US9441221B2 (en) | 2007-03-30 | 2016-09-13 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012045894A1 (es) * | 2010-10-05 | 2012-04-12 | Proyecto De Biomedicina Cima, S.L. | Compuestos y composiciones para el tratamiento de enfermedades debidas a la infección por el virus de la hepatitis b |
| KR102413498B1 (ko) * | 2013-04-20 | 2022-06-24 | 더 리서치 인스티튜트 앳 네이션와이드 칠드런스 하스피탈 | 엑손 2-표적 U7snRNA 폴리뉴클레오티드 작제물의 재조합형 아데노 부속 바이러스 전달 |
| EP2853595A1 (en) * | 2013-09-30 | 2015-04-01 | Soluventis GmbH | NOTCH 1 specific siRNA molecules |
| CN107746857B (zh) * | 2017-08-07 | 2021-02-05 | 中国农业大学 | 一种抑制基因表达的rna干扰方法 |
| CN108893487A (zh) * | 2018-07-19 | 2018-11-27 | 中国农业科学院北京畜牧兽医研究所 | 一种含有C-Myc蛋白融合标签的植物表达质粒载体及其载体的构建方法 |
| KR20220002882A (ko) * | 2019-03-08 | 2022-01-07 | 루트거스, 더 스테이트 유니버시티 오브 뉴 저지 | 헌팅톤병을 치료하기 위한 조성물 및 방법 |
| CN114159459A (zh) * | 2021-12-20 | 2022-03-11 | 塔里木大学 | miR-26a在制备治疗子宫内膜炎的药物中的应用 |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994029469A2 (en) | 1993-06-07 | 1994-12-22 | Vical Incorporated | Plasmids suitable for gene therapy |
| WO1997000957A1 (en) | 1995-06-23 | 1997-01-09 | President And Fellows Of Harvard College | Transcriptional regulation of genes encoding vascular endothelial growth factor receptors |
| WO2003029459A2 (en) | 2001-09-28 | 2003-04-10 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Micro-rna molecules |
| US20030082149A1 (en) | 1997-07-28 | 2003-05-01 | Cummings & Lockwood | Inhibition of a target messenger rna with a modified u1 small nuclear rna |
| WO2003093441A2 (en) | 2002-05-03 | 2003-11-13 | Duke University | A method of regulating gene expression |
| EP1384784A1 (en) | 2001-03-30 | 2004-01-28 | Instituto Cientifico Y Tecnologico De Navarra, S.A. | Method for reversible inhibition of gene expression by modified ribonucleoproteins |
| WO2005026322A2 (en) | 2003-09-11 | 2005-03-24 | Clontech Laboratories, Inc. | siRNA ENCODING CONSTRUCTS AND METHODS FOR USING THE SAME |
| WO2006012221A2 (en) | 2004-06-25 | 2006-02-02 | The Regents Of The University Of California | Target cell-specific short interfering rna and methods of use thereof |
| WO2006135436A2 (en) | 2004-10-22 | 2006-12-21 | University Of Florida Research Foundation, Inc. | Inhibition of gene expression and therapeutic uses thereof |
| WO2007046703A2 (en) | 2005-10-20 | 2007-04-26 | Amsterdam Molecular Therapeutics B.V. | Improved aav vectors produced in insect cells |
| WO2007069090A2 (en) | 2005-12-06 | 2007-06-21 | Centre National De La Recherche Scientifique | Cell penetrating peptides for intracellular delivery of molecules |
| WO2007148971A2 (en) | 2006-06-21 | 2007-12-27 | Amsterdam Molecular Therapeutics B.V. | Vectors with modified initiation codon for the translation of aav-rep78 useful for production of aav in insect cells |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0701722D0 (en) * | 2007-01-30 | 2007-03-07 | Scottish Crop Res Inst | Inhibition of gene expression |
-
2009
- 2009-01-29 CN CN2009801118031A patent/CN101981189A/zh active Pending
- 2009-01-29 WO PCT/ES2009/000045 patent/WO2009095517A2/es not_active Ceased
- 2009-01-29 JP JP2010544739A patent/JP2011510647A/ja active Pending
- 2009-01-29 RU RU2010136040/10A patent/RU2010136040A/ru not_active Application Discontinuation
- 2009-01-29 BR BRPI0906657-8A patent/BRPI0906657A2/pt not_active IP Right Cessation
- 2009-01-29 EP EP09705069A patent/EP2246432A2/en not_active Withdrawn
- 2009-01-29 US US12/865,046 patent/US20110030075A1/en not_active Abandoned
- 2009-01-29 CA CA2713458A patent/CA2713458A1/en not_active Abandoned
- 2009-01-29 MX MX2010008326A patent/MX2010008326A/es not_active Application Discontinuation
- 2009-01-29 AU AU2009209571A patent/AU2009209571A1/en not_active Abandoned
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1994029469A2 (en) | 1993-06-07 | 1994-12-22 | Vical Incorporated | Plasmids suitable for gene therapy |
| WO1997000957A1 (en) | 1995-06-23 | 1997-01-09 | President And Fellows Of Harvard College | Transcriptional regulation of genes encoding vascular endothelial growth factor receptors |
| US20030082149A1 (en) | 1997-07-28 | 2003-05-01 | Cummings & Lockwood | Inhibition of a target messenger rna with a modified u1 small nuclear rna |
| EP1384784A1 (en) | 2001-03-30 | 2004-01-28 | Instituto Cientifico Y Tecnologico De Navarra, S.A. | Method for reversible inhibition of gene expression by modified ribonucleoproteins |
| WO2003029459A2 (en) | 2001-09-28 | 2003-04-10 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Micro-rna molecules |
| WO2003093441A2 (en) | 2002-05-03 | 2003-11-13 | Duke University | A method of regulating gene expression |
| WO2005026322A2 (en) | 2003-09-11 | 2005-03-24 | Clontech Laboratories, Inc. | siRNA ENCODING CONSTRUCTS AND METHODS FOR USING THE SAME |
| WO2006012221A2 (en) | 2004-06-25 | 2006-02-02 | The Regents Of The University Of California | Target cell-specific short interfering rna and methods of use thereof |
| WO2006135436A2 (en) | 2004-10-22 | 2006-12-21 | University Of Florida Research Foundation, Inc. | Inhibition of gene expression and therapeutic uses thereof |
| WO2007046703A2 (en) | 2005-10-20 | 2007-04-26 | Amsterdam Molecular Therapeutics B.V. | Improved aav vectors produced in insect cells |
| WO2007069090A2 (en) | 2005-12-06 | 2007-06-21 | Centre National De La Recherche Scientifique | Cell penetrating peptides for intracellular delivery of molecules |
| WO2007148971A2 (en) | 2006-06-21 | 2007-12-27 | Amsterdam Molecular Therapeutics B.V. | Vectors with modified initiation codon for the translation of aav-rep78 useful for production of aav in insect cells |
Non-Patent Citations (65)
| Title |
|---|
| ALTSCHUL ET AL., J. MOI. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., NUCL. ACIDS RES., vol. 25, 1977, pages 3389 - 3402 |
| ANDERSON, SCIENCE, vol. 256, 1992, pages 808 - 813 |
| APARICIO ET AL., J. VIROL, vol. 80, 2006, pages 12236 - 47 |
| APARICIO ET AL., J. VIROL., vol. 1006, no. 80, pages 12236 - 47 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995 |
| BECKLEY, S.A. ET AL., MOL. CELL. BIOL., vol. 21, 2001, pages 2815 - 2825 |
| BIRMINGHAM, A. ET AL., NATURE PROTOCOLS, vol. 2, 2007, pages 2068 - 2078 |
| BRUMMELKAMP ET AL., SCIENCE, vol. 296, 2002, pages 550 - 3 |
| CHEN, X ET AL., NUCLEIC ACIDS RES., 2006, pages 34 |
| CHENNA ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 3497 - 3500 |
| CZAUDERNA ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 2705 - 2716 |
| ELBASHIR, S.M. ET AL., GENES DEV., vol. 15, 2001, pages 188 - 200 |
| FATTAL ET AL., J. CONTROL RELEASE, vol. 53, 1998, pages 137 - 143 |
| FORTES P ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 8264 - 8269 |
| FORTES P. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 8264 - 8269 |
| FORTES, P. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 8264 - 8269 |
| FURTH, P.A. ET AL., MOL. CELL. BIOL., vol. 14, 1994, pages 5278 - 5289 |
| GIORDANO, NATURE MEDICINE, vol. 2, 1996, pages 534 - 539 |
| GODARD ET AL., EUR. J. BIOCHEM., vol. 232, 1995, pages 404 - 410 |
| GUNDERSON ET AL., GENES & DEV., vol. 11, 1997, pages 761 - 773 |
| HEIDEL ET AL., NAT. BIOTECHNOL., vol. 22, 2004, pages 1579 - 1582 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SD. USA, vol. 89, 1989, pages 10915 |
| HODGES ET AL., EXP. OPIN. BIOL. THER., vol. 3, 2003, pages 91 - 918 |
| ISNER, LANCET, vol. 348, 1996, pages 370 - 374 |
| KAKIZAWA ET AL., J. CONTROL REL., vol. 97, 2004, pages 345 - 356 |
| KAYKAS, A.; MOON, R., BMC CELL BIOL., vol. 5, 2004, pages 16 |
| LADUNGA, 1., NUCLEIC ACIDS RES., vol. 35, 2006, pages 433 - 440 |
| LAMBERT ET AL., DRUG DELIV., vol. 47, 2001, pages 99 - 112 |
| LAYZER ET AL., RNA, vol. 10, 2004, pages 766 - 771 |
| LEE, N.S. ET AL., NAT. BIOTECHNOL., vol. 20, 2002, pages 500 - 505 |
| LEWIS ET AL., NAT. GEN., vol. 32, 2002, pages 107 - 108 |
| LINDGREN, A. ET AL., TRENDS PHARMACOL. SCI., vol. 21, 2000, pages 99 - 103 |
| LINGOR, P. ET AL., BIOCHEM. BIOPHYS. RES. COMMUN., vol. 315, 2004, pages 1123 - 1133 |
| LIU ET AL., SCIENCE, vol. 305, 1999, pages 1437 - 1441 |
| LIU, P ET AL., NUCLEIC ACID RES., vol. 32, 2004, pages 1512 - 1517 |
| LUNDBERG, M. ET AL., MOL. THERAPY, vol. 8, 2003, pages 143 - 150 |
| MARTINEAU, H.; PYRAH, L., TOXICOL. PATHOL., vol. 35, 2007, pages 327 - 336 |
| MCCAFFREY ET AL., NATURE, vol. 418, 2002, pages 38 - 39 |
| MCMANUS, M.T. ET AL., RNA, vol. 8, 2002, pages 842 - 850 |
| MINAKUCHI ET AL., NATL. ACIDS RES., vol. 32, 2004, pages 109 |
| MUHLHAUSER, CIRC. RES, vol. 77, 1995, pages 1077 - 1086 |
| MURATOVSKA; ECCLES, FED. EURO. BIOCHEM. SOC. LETT., vol. 558, 2004, pages 63 - 68 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| PEARSON; LIPMAN, PROC. NATL ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PEI; TUSCHL, NATURE METHODS, vol. 3, 2006, pages 670 - 676 |
| PUROW ET AL., CANCER RES., vol. 65, 2005, pages 2353 - 63 |
| SAJIC ET AL., NUCLEIC ACIDS RES., vol. 35, 2007, pages 247 - 255 |
| SAJIC, R. ET AL., NUCLEIC ACIDS RES., vol. 35, 2006, pages 247 - 255 |
| SCHAPER, CIRC. RES, vol. 79, 1996, pages 911 - 919 |
| SCHAPER, CURRENT OPINION IN BIOTECHNOLOGY, vol. 7, 1996, pages 635 - 640 |
| SCHWAB ET AL., ANN. ONCOL., vol. 5, no. 4, 1994, pages 55 - 58 |
| SCHWARZE, S.R ET AL., TRENDS PHARMACOL. SCI., vol. 21, 2000, pages 45 - 48 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| SNYDER, E.L.; DOWDY, S.F., PHARM. RES., vol. 21, 2004, pages 389 - 393 |
| SONG ET AL., SCIENCE, NAT. MED., vol. 9, 2003, pages 347 - 351 |
| TEMPLETON, DNA CELL BIOL., vol. 21, 2002, pages 857 - 867 |
| TRAN, N. ET AL., BMC BIOTECHNOL., vol. 3, 2003, pages 21 |
| WANG, J. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 5103 - 5106 |
| WANG, NATURE MEDICINE, vol. 2, 1996, pages 714 - 716 |
| WILLIAMS, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 2726 - 2729 |
| WU ET AL., MOLECULAR THERAPY, vol. 14, 2006, pages 316 - 327 |
| ZENG ET AL., RNA, vol. 9, 2003, pages 112 - 123 |
| ZHENG, L. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 101, 2004, pages 135 - 140 |
| ZHUANG, Y; WEINER, A.M, CELL, vol. 46, 1986, pages 827 - 835 |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8343941B2 (en) | 2007-03-30 | 2013-01-01 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
| US8907075B2 (en) | 2007-03-30 | 2014-12-09 | Samuel Ian Gunderson | Compositions and methods for gene silencing |
| US9078823B2 (en) | 2007-03-30 | 2015-07-14 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
| US9441221B2 (en) | 2007-03-30 | 2016-09-13 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101981189A (zh) | 2011-02-23 |
| US20110030075A1 (en) | 2011-02-03 |
| JP2011510647A (ja) | 2011-04-07 |
| WO2009095517A3 (es) | 2009-09-24 |
| RU2010136040A (ru) | 2012-03-10 |
| AU2009209571A1 (en) | 2009-08-06 |
| EP2246432A2 (en) | 2010-11-03 |
| CA2713458A1 (en) | 2009-08-06 |
| BRPI0906657A2 (pt) | 2015-07-14 |
| MX2010008326A (es) | 2010-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2009095517A2 (es) | Métodos y composiciones capaces de provocar un silenciamiento post-transcripcional de la expresión génica de forma sinérgica | |
| ES2901455T3 (es) | Compuestos oligonucleotídicos para el tratamiento de preeclampsia y otros trastornos angiogénicos | |
| ES2759317T3 (es) | Compuestos terapéuticos para la enfermedad de Huntington | |
| ES2566553T3 (es) | ARNnp U7 modificados para el tratamiento de las enfermedades neuromusculares | |
| ES2730393T3 (es) | Tratamiento contra el VHB | |
| US8252526B2 (en) | ShRNA molecules and methods of use thereof | |
| ES2549122T3 (es) | Reducción de toxicidad por interferencia de ARN desviada de su diana | |
| ES2969371T3 (es) | Interferencia por ARN para el tratamiento de trastornos de ganancia de función | |
| ES2967272T3 (es) | Expresión de miARNs en tejido placentario | |
| ES2739804T3 (es) | Compuestos terapéuticos | |
| ES2794499T5 (en) | Methods for performing antisense oligonucleotide-mediated exon skipping in the retina of a subject in need thereof | |
| US20160237430A1 (en) | Allele-specific rna silencing for the treatment of hypertrophic cardiomyopathy | |
| JP5832293B2 (ja) | 血管新生促進vegfイソ型を選択的に抑制する組成物および方法 | |
| JP2011507554A (ja) | 遺伝子発現を増加させるための方法および組成物 | |
| WO2016030501A1 (en) | Synthetic alu-retrotransposon vectors for gene therapy | |
| EP3555294A1 (en) | Reagents for treatment of oculopharyngeal muscular dystrophy (opmd) and use thereof | |
| ES2618935T3 (es) | Parvovirus modificado útil para silenciamiento génico | |
| RU2755544C2 (ru) | Реагенты для лечения окулофарингеальной мышечной дистрофии (OPMD) и их применение | |
| WO2015042435A1 (en) | Treating diseases associated with pgc1-alpha by modulating micrornas mir-130a and mir-130b | |
| JP2023532536A (ja) | miRNA-485ハンチントン病の阻害剤 | |
| JP2024147743A (ja) | 麻酔誘発性神経毒性の処置のための組成物及び方法 | |
| WO2016181011A1 (es) | Método para promover la regeneración muscular | |
| JP2016540049A (ja) | 肺動脈性高血圧症の治療のための材料及び方法 | |
| KR101595152B1 (ko) | Tctp-ptd를 포함하는 유전자 전달체 | |
| WO2012045894A1 (es) | Compuestos y composiciones para el tratamiento de enfermedades debidas a la infección por el virus de la hepatitis b |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200980111803.1 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09705069 Country of ref document: EP Kind code of ref document: A2 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2713458 Country of ref document: CA Ref document number: 2010544739 Country of ref document: JP Ref document number: MX/A/2010/008326 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2787/KOLNP/2010 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009209571 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009705069 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010136040 Country of ref document: RU |
|
| ENP | Entry into the national phase |
Ref document number: 2009209571 Country of ref document: AU Date of ref document: 20090129 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12865046 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: PI0906657 Country of ref document: BR Kind code of ref document: A2 Effective date: 20100729 |