WO2009040726A2 - Antagonistes du rhamnose et utilisation de ceux-ci - Google Patents

Antagonistes du rhamnose et utilisation de ceux-ci Download PDF

Info

Publication number
WO2009040726A2
WO2009040726A2 PCT/IB2008/053851 IB2008053851W WO2009040726A2 WO 2009040726 A2 WO2009040726 A2 WO 2009040726A2 IB 2008053851 W IB2008053851 W IB 2008053851W WO 2009040726 A2 WO2009040726 A2 WO 2009040726A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
rhamnose
amino acid
sequence
acid sequence
Prior art date
Application number
PCT/IB2008/053851
Other languages
English (en)
Other versions
WO2009040726A3 (fr
Inventor
Laurence Zulianello
Paolo Meda
Original Assignee
Universite De Geneve
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite De Geneve filed Critical Universite De Geneve
Publication of WO2009040726A2 publication Critical patent/WO2009040726A2/fr
Publication of WO2009040726A3 publication Critical patent/WO2009040726A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to new molecules capable of inhibiting rhamnolipids and especially epithelial infiltration by Gram-negative bacteria.
  • the invention provides proteins useful in the prevention and/or treatment of Gram-negative bacteria induced infections or disorders, including nosocomial infections.
  • the present invention provides novel proteins and antibodies, DNA encoding thereof, processes for production thereof, pharmaceutical compositions, kits containing thereof and use of these in the preparation of pharmaceutical compositions for the prevention and/or treatment of Gram-negative bacteria induced infections or disorders, including nosocomial infections, such as pneumonia, cystic fibrosis (CF) and other mucosal infections such as urinary tractus infections (e.g. cystitis).
  • nosocomial infections such as pneumonia, cystic fibrosis (CF) and other mucosal infections such as urinary tractus infections (e.g. cystitis).
  • Pseudomonas aeruginosa is an opportunistic, Gram-negative bacterium which does not invade normal mucosa but causes serious nosocomial infections in immunodepressed individuals, such as patients suffering from HIV, cancer or cystic fibrosis.
  • This organism is not only the most commonly isolated pathogen in cystic fibrosis patients, but it is also a leading cause of severe infections in hospitals, especially pneumonia in mechanically ventilated patients.
  • Current medications for preventing and treating nosocomial infections are extensive antibiotherapy, which however often develops into lethal infections due to the high resistance of the bacteria to many antibiotics and their shielding by biofilms that protect it from the action of both drugs and immune system.
  • LPSj lipopolysaccharides
  • elastase elastase
  • Rhamnolipids which are soluble virulence factors produced by activation of the quorum sensing system of gene expression are produced by the RhI quorum- sensing system of Pseudomonas, which is activated when bacteria reach high density.
  • Rhamnolipids are glycolipids formed by to one or two molecules of rhamnose (L- rhamnose) most commonly linked to a hydroxyl group of a hydroxydecanoic acid which is esterified by another hydroxy fatty acid (Hisatsuka et al., Agric. Biol. Chem., 1971, 35, 686).
  • amphiphilic molecules are usually considered as biosurfactants, acting as solubilizing agents (Nitschke et al., 2005, Biotechnol. Prog., 21:1593-1600) that insert into cell membranes (Zulianello et al, 2006, above).
  • the present invention is directed towards new molecules capable of decreasing or altering the epithelial infiltration by Gram-negative bacteria.
  • the invention is directed towards new molecules which can act as anti-virulence molecules and inhibit the initial stages of Pseudomonas infections, limit the adhesion of bacteria to substratum mimicking medical devices used for patient ventilation, and reduce the initial stages of biofilm formation.
  • the present invention provides novel proteins and antibodies, DNA encoding thereof, processes for production thereof, pharmaceutical compositions, kits containing thereof and use of these in the preparation of pharmaceutical compositions for the prevention and/or treatment of conditions related to Gram-negative bacteria related infections, especially involving the epithelial infiltration by Gram-negative bacteria, notably into the respiratory epithelia.
  • a first aspect of the invention provides an isolated polypeptide having at least 80% identity or homology with a sequence of amino acids selected from an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 43, or variants or fragments thereof for use as a medicament.
  • a second aspect of the invention relates to nucleic acid molecules encoding a polypeptide as defined above as described herein for use as a medicament.
  • Such nucleic acids also include vectors containing said molecules, in particular expression vectors.
  • a third aspect of the invention resides in host cells expressing a polypeptide as defined above, as well as methods of producing such cells.
  • a sixth aspect of the invention is a process for preparing a polypeptide as defined above, typically using recombinant technologies.
  • a fourth aspect of the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide or a nucleic acid as defined above and a pharmaceutically acceptable carrier or vehicle.
  • An fifth aspect of the invention is a use of a rhamnose antagonist for the preparation of a medicament for the prevention and/or treatment of conditions related to Gram- negative bacteria related infections, especially involving the epithelial infiltration by Gram-negative bacteria, notably into the respiratory epithelia.
  • a sixth aspect of the invention is a kit comprising at least one rhamnose antagonist according to the invention.
  • An seventh aspect of the invention relates to a method of preventing and/or treating of a disease comprising the administration of a therapeutically effective amount of a rhamnose antagonist according to the invention in a mammal in need thereof and wherein the disease is a Gram-negative bacteria related infection, especially involving the epithelial infiltration by Gram-negative bacteria, notably into the respiratory epithelia.
  • An eighth aspect of the invention relates to a method of preventing a disease comprising the coating of a therapeutically effective amount of a rhamnose antagonist according to the invention on a surface of a material such as a tubings (e.g.
  • the disease is a nosocomial infection such as pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders such as urinary tractus infections (e.g. cystitis).
  • nosocomial infection such as pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders such as urinary tractus infections (e.g. cystitis).
  • a ninth aspect of the invention is a method of antagonizing epithelial infiltration by Gram-negative bacteria, notably into the respiratory epithelia.
  • a tenth aspect of the invention is a method for in vitro detection of the level/ concentration of rhamnose and rhamnolipids in a biological sample.
  • An eleventh aspect is a method for screening for a rhamnose antagonist.
  • Figure 1 shows the amino acid (SEQ ID NO: 1) sequence of a protein according to the invention (CSLl) isolated from chum salmon eggs (Oncorhynchus keta).
  • Figure 2 shows the amino acid sequences of a protein according to the invention (SML) (SEQ ID NO: 2 (A); SEQ ID NO: 44 (B)) isolated from eggs of Spanish mackerel (Scomberomorous niphonius).
  • Figure 3 shows the amino acid (SEQ ID NO: 3) (A) and nucleic acid sequences (SEQ ID NO: 4) (B) of a protein according to the invention (STLl) isolated from steelhead trout (Oncorhynchus mykiss) eggs.
  • Figure 4 represents transepithelial resistance variations versus time (in the absence of and presence rhamnolipids) in presence of CSLl as compared to other lectins such as described in Example 2.
  • Figure 5 represents the inhibitory effect of A. Pseudomonas infiltration of airway epithelia by CSLl (and SFL) such as described in Example 2.
  • A In face and profile views (left panels) of reconstituted epithelium infected for 16 hr by PAOl which efficiently invade and infiltrate the airway epithelium (intercellular passage of the GFP expressing bacteria). Reconstituted epithelia are not susceptible to an overnight infection by PAOl in the presence of 4 ⁇ M CSLl (right panels).
  • B Quantitative analyses (Metamorph software) confirmed that the presence of CSLl (SEQ ID NO: 1) and SFL (SEQ ID NO: 43) were efficient in reducing bacterial infiltration by a factor 6.
  • Figure 6 represents the amino acid sequences of lectins CSL2 (SEQ ID NO: 5) (A), CSL3 (SEQ ID NO: 6) (B) isolated from chum salmon eggs, used as references in the assays and SFL (SEQ ID NO: 43) (C) isolated from ayu (Plecoglossus altivelis), as described in Examples 1 and 2.
  • Figure 7 shows the amino acid (SEQ ID NO: 7 and SEQ ID NO: 8) sequences (A and B) and nucleic acid (SEQ ID NO: 9 and SEQ ID NO: 10) sequences (C and D) of a fragment of a protein according to the invention (STLl fragment 130-211 and 227-305, respectively) as described in Example 4.
  • Figure 8 shows the ability of a protein according to the invention (CSLl) isolated from chum salmon eggs to prevent biofilm formation (Fig 8A) and bacterial adherence on PVC substrates (Fig 8B) as described in Example 6.
  • A Biofilm volume formed within a reconstituted epithelium infected by Pa-GFP in absence (PAOl) or presence of rhamnolipids (+Rha) or CSLl (+CLS1).
  • B Bacterial adherence of PAOl (left panel) and rhamnose-deficient strain PT712 (rhlA-) (right panel) on PVC plates in the absence and presence of either rhamnolipids (Rha) or CSLl.
  • Figure 9 shows the amino acid sequences (SEQ ID NO: 11 and SEQ ID NO: 12) (A and B) used for the synthesis of a protein according to the invention (His tagged); the amino acid sequences (SEQ ID NO: 40 and SEQ ID NO: 41) (E and F) and the corresponding nucleic acid sequences (SEQ ID NO: 13 and SEQ ID NO: 14) (C and D) of fragments of a protein according to the invention as described in Example 4.
  • amino acid sequences SEQ ID NO: 11 and SEQ ID NO: 12
  • a and B used for the synthesis of a protein according to the invention (His tagged
  • the amino acid sequences (SEQ ID NO: 40 and SEQ ID NO: 41) E and F
  • the corresponding nucleic acid sequences SEQ ID NO: 13 and SEQ ID NO: 14
  • Gram-negative bacteria induced or “Gram-negative bacteria related” infections or disorders or the term “nosocomial” infections, comprises a disease or a state characterized by a bacterial colonization, notably the epithelia, by a Gram-negative bacteria.
  • Gram-negative bacteria induced infections include pneumonitis, pneumonia, cystic fibrosis (CF), endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • Nosocomial infections are especially common in patients in intensive care units as these people often have weakened immune systems and are frequently on ventilators and/or catheters. Catheter-associated urinary tract infections are the most common nosocomial infection.
  • Gram-negative bacteria includes bacteria presenting a cell wall composed of an outer membrane surrounding a thin peptidoglycan layer.
  • Gram-negative bacteria as used in the context of the invention include P. aeruginosa, K. pneumoniae, Haemophilus influenzae and Moraxella.
  • epithelia comprises for example lung epithelia (bronchi mucosae), skin epithelia (epidermis), intestine epithelia (intestinal mucosae) and urinary epithelia (bladder mucosae).
  • efficacy of a treatment according to the invention can be measured based on changes in the course of disease in response to a use according to the invention.
  • the efficacy of a treatment according to the invention can be measured by a decreased number of bacteria, reduced infiltration of bacteria in experimental epithelia, a decreased production of rhamnolipids/elastase, a decrease and/or prevention of biofilm formation, a decrease and/or prevention of bacterial adherence to medical material such as hydrophobic substratum and/or a decreased adherence of bacteria to cell and non cellular substrates.
  • treatment and “treating” and the like generally mean obtaining a desired pharmacological and physiological effect.
  • the effect may be prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof and/or may be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease.
  • treatment covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or relieving the disease, i.e., causing regression of the disease and/or its symptoms or conditions.
  • mammals contemplated by the present invention include human, primates, domesticated animals such as cattle, sheep, pigs, horses laboratory rodents and the like.
  • immunodepressed subjects is defined as subject in a state of diminished or impaired immunity, such as may be brought on by cytotoxic chemotherapy or irradiation or by certain disease processes such as HIV, a cancer, or in the case of heavy skin burns, elderly, or preemies where the immune system is diminished or impaired.
  • isolated is used to indicate that the molecule is free of association with other proteins or polypeptides, for example as a purification product of recombinant host cell culture or as a purified extract.
  • antibody comprises antibodies binding to the rhamnose part of rhamnolipids or fragment thereof, chimeric antibodies recognizing and/or binding selectively to the rhamnose part of rhamnolipids or fragment thereof, fully human, humanized, genetically engineered or bispecific or multispecific antibodies as well as fragments thereof such as single chain antibodies (scFv), proteins with binding affinities similar to antibodies (affibodies) or domain antibodies against the rhamnose part of rhamnolipids or fragment thereof and the like.
  • Antibodies of this invention may be monoclonal or polyclonal antibodies, or fragments or derivative thereof having substantially the same antigen specificity.
  • the term "selectively" indicates that the antibodies preferentially recognize and/or bind the target polypeptide or epitope, i.e., with a higher affinity than any binding to any other antigen or epitope, i.e. the binding to the target polypeptide can be discriminated from non-specific binding to other antigens.
  • the binding affinity of an antibody can be readily determined by one of ordinary skill in the art, for example, by Scatchard analysis (Scatchard et al, 1949, Ann NY Acad. ScL, 51, 660-672).
  • monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. The modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • protein includes proteins and glycosylated proteins (e.g. glycoproteins).
  • antagonists is defined as a molecule that antagonizes completely or partially the activity of biological molecule.
  • peptidomimetic is defined as a peptide analog containing non-peptidic structural elements, which peptide is capable of mimicking or antagonizing the biological action(s) of a natural parent peptide. A peptidomimetic does no longer have classical peptide characteristics such as enzymatically scissile peptide bonds.
  • biofilm is intended to include biological films that develop and persist at interfaces in aqueous environments or at the air-liquid interface.
  • Biofilms are composed of microorganisms embedded in an organic gelatinous structure composed of one or more matrix polymers which are secreted by the resident microorganisms.
  • biofilm development or “biofilm formation” is intended to include the formation, growth, and modification of the bacterial colonies contained with the biofilm structures as well as the synthesis and maintenance of the exopolysaccharide matrix of the biofilm structures.
  • CSLl and homologues is a L-rhamnose binding lectin (RBL) which has been isolated from chum salmon (Oncorhynchus keta) eggs and the sequence (amino acid sequence of SEQ ID NO: 1; Figure 1) has been identified by Shiina et ah, 2002, Fisheries Science, 68:13-52-1366.
  • STLl is a L-rhamnose binding lectin (RBL) which has been isolated from steelhead trout (Oncorhynchus mykiss) eggs has been identified by Tateno et al, 1998, J. Biol. Chem., 273:19190-19197.
  • STLl sequences are highly identical to those of CSLl (94-97 % identity).
  • CSLl encompasses polypeptides having an amino acid sequence of SEQ ID NO: 1 and fragments thereof.
  • CSLl encompasses CSLl variants, i.e. polypeptides that have a high degree of similarity or a high degree of identity with the amino acid sequence of SEQ ID NO: 1, or with the amino acid sequence of SEQ ID NO: 3 and which polypeptides are biologically active.
  • STLl is a variant of CSLl according to the invention.
  • STLl encompasses polypeptides having an amino acid sequence of SEQ ID NO: 3 and fragments thereof.
  • STLl encompasses STLl variants, i.e. polypeptides that have a high degree of similarity or a high degree of identity with the amino acid sequence of SEQ ID NO: 3 and which polypeptides are biologically active.
  • a STLl fragment is a polypeptide having the sequence of amino acid selected from the group comprising SEQ ID NO: 7 and SEQ ID NO: 8 (STLl fragment 130-211 and 227-305, respectively).
  • a STLl fragment is a polypeptide having the sequence of amino acid selected from the group comprising SEQ ID NO: 40 and SEQ ID NO: 41.
  • SML is another L-rhamnose binding lectin (RBL) which has been isolated from eggs of Spanish mackerel (Scomberomorous niphonius) and which sequence (amino acid sequence of SEQ ID NO: 2; Figure 2) has been identified by Terada et ah, 2007. Biochim. Biophys. Acta 1770:617-629.
  • RBL L-rhamnose binding lectin
  • SML encompasses polypeptides having an amino acid sequence of SEQ ID NO: 2 and fragments thereof.
  • SML encompasses SML variants, i.e. polypeptides that have a high degree of similarity or a high degree of identity with the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 44 and which polypeptides are biologically active.
  • SFL is another L-rhamnose binding lectin (RBL) which has been isolated from eggs of ayu (Plecoglossus altivelis) and which sequence (amino acid sequence of SEQ ID NO: 43; Figure 10) has been identified by Watanabe et ah, 2008, Dev. Comp. Immunol, 32(5):487-99.
  • RBL L-rhamnose binding lectin
  • SFL encompasses polypeptides having an amino acid sequence of SEQ ID NO: 42 and fragments thereof.
  • SFL encompasses SFL variants, i.e. polypeptides that have a high degree of similarity or a high degree of identity with the amino acid sequence of SEQ ID NO: 43 and which polypeptides are biologically active.
  • CSLl variant or “SML variant” or “STLl variant” or “SFL variant” as referred to herein means a polypeptide substantially homologous to native CSLl or SML or STLl or SFL, but which has an amino acid sequence different from that of native CSLl, SML, STLl or SFL (other species or synthetic variants) because of one or more deletions, insertions or substitutions.
  • Substantially homologous means a variant amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the native amino acid sequences, as disclosed above.
  • CSLl, SML, STLl or SFL variants may comprise a sequence having at least one conservatively substituted amino acid, meaning that a given amino acid residue is replaced by a residue having similar physiochemical characteristics.
  • substitutions for one or more amino acids present in the native polypeptide should be made conservatively. Examples of conservative substitutions include substitution of amino acids outside of the active domain(s), and substitution of amino acids that do not alter the secondary and/or tertiary structure of CSLl, SML, STLl or SFL.
  • conservative substitutions include substitution of one aliphatic residue for another, such as He, VaI, Leu, or Ala for one another, or substitutions of one polar residue for another, such as between Lys and Arg; GIu and Asp; or GIn and Asn.
  • Other such conservative substitutions for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known (Kyte et ah, 1982, J. MoI. Biol, 157: 105- 131).
  • Naturally occurring variants are also encompassed by the invention. Examples of such variants are proteins that result from alternate mRNA splicing events or from proteolytic cleavage of the native protein, wherein the native biological property is retained.
  • a "conservative amino acid substitution” may involve a substitution of a native amino acid residue with a non native residue such that there is little or no effect on the polarity or charge of the amino acid residue at that position. Desired amino acid substitutions (whether conservative or non-conservative) can be determined by those skilled in the art at the time such substitutions are desired. Exemplary amino acid substitutions are presented in Table 1 below: Table 1
  • CSLl, SML, STLl or SFL include but is not limited to variants, biologically active fragments, fragments and fragments of variants.
  • CSLl, SML, STLl, or SFL may be used as antagonists of rhamnose activity or be used to develop rhamnose antagonists, such as antibodies, chimaeric proteins or fusion proteins.
  • rhamnose antagonist comprises all antagonists of all suitable forms of rhamnose which that antagonize one or more biological activity of rhamnolipids, notably the epithelial infiltration ability of Gram-negative bacteria.
  • the rhamnose antagonists of the invention are able to antagonize the ability of Gram- negative bacteria to infiltrate epithelia.
  • the rhamnose antagonists of the invention are able to prevent or inhibiting biofilm formation on a surface.
  • rhamnose antagonist includes but is not limited to: rhamnose specific antibodies of any sort (polyclonal, monoclonal, antibody fragments, antibody variants), chimaeric proteins, natural or unnatural proteins with rhamnose antagonizing activities, small molecules, nucleic acid derived polymers (such as DNA and RNA ap tamers, PNAs, or LNAs), peptidomimetics, fusion proteins, or gene therapy vectors driving the expression of such rhamnose antagonists.
  • Rhamnose antagonist may target (e.g. bind) the rhamnose part of rhamnolipids and the epithelial infiltration ability of the related Gram-negative bacteria.
  • An antibody that is immunoreactive with rhamnose may be used as a rhamnose antagonist.
  • a rhamnose antagonist is a "CSLl" polypeptide and fragments or variants thereof, e.g. polypeptides having an amino acid sequence of SEQ ID NO: 1, fragments and variants thereof, such as a polypeptides having an amino acid sequence of SEQ ID NO: 3, fragments and variants thereof.
  • Another example according to the invention of a rhamnose antagonist is a "SML" polypeptide and fragments or variants thereof, e.g. polypeptides having an amino acid sequence of SEQ ID NO: 2, fragments and variants thereof, such as a polypeptide having an amino acid sequence of SEQ ID NO: 44.
  • a rhamnose antagonist is a "SML" polypeptide and fragments or variants thereof, e.g. polypeptides having an amino acid sequence of SEQ ID NO: 44, fragments and variants thereof.
  • Another example according to the invention of a rhamnose antagonist is a "STLl” or "CSLl” fragment or variant thereof e.g. a polypeptide having an sequence of amino acid selected from the group comprising SEQ ID NO: 7 and SEQ ID NO: 8 (STLl fragment 130-211 and 227-305, respectively).
  • a rhamnose antagonist is a "STLl” or “CSLl” fragment or variant thereof e.g. a polypeptide having an sequence of amino acid selected from the group comprising SEQ ID NO: 11 and SEQ ID NO: 12 (STLl his tagged fragments (S/Mng-215) and (A/M 214 -314), respectively).
  • Another example according to the invention of a rhamnose antagonist is a "STLl” or “CSLl” fragment or variant thereof e.g. a polypeptide having an sequence of amino acid selected from the group comprising SEQ ID NO: 40 and SEQ ID NO: 41 (STLl fragments (S/M ⁇ s-215) and (A/M 214 -314), respectively).
  • Another example according to the invention of a rhamnose antagonist is a "SFL" polypeptide and fragments or variants thereof, e.g. polypeptides having an amino acid sequence of SEQ ID NO: 43, fragments and variants thereof.
  • a rhamnose antagonist such as a CSLl polypeptide and fragments or variants thereof, a SML polypeptide, a SFL polypeptide and fragments or variants thereof, as an isolated, purified or homogeneous protein according to the invention, may be produced by recombinant expression systems as described herein or purified from naturally occurring cells.
  • rhamnose antagonist such as a CSLl polypeptide and fragments or variants thereof, a SML polypeptide, a SFL polypeptide and fragments or variants thereof
  • prokaryotes such as E. CoIi or Bacilli.
  • Suitable prokaryotic host cells include for example E. CoIi BL21 strain. In prokaryotic host cells, such as E.
  • a rhamnose antagonist such as a CSLl polypeptide and fragments or variants thereof, a SML polypeptide, a SFL polypeptide and fragments or variants thereof may include a N-terminal methionine residue to facilitate the expression of recombinant polypeptide in the prokaryotic host cell.
  • the N- terminal Met may be cleaved from the expressed peptide.
  • codon usage and preferences in E.coli to favor a proper expression in bacterial strains.
  • the invention provides pharmaceutical or therapeutic agents as compositions and methods for treating a patient, preferably a mammalian patient, and most preferably a human patient who is suffering from a medical disorder, and in particular a disorder mediated by Gram-negative bacteria, such as nosocomial or immunodepressed patients.
  • the invention provides methods for preventing a medical disorder, and in particular a disorder mediated by Gram-negative bacteria, such as nosocomial or immunodepressed patients, especially undergoing surgery or intensive care.
  • Pharmaceutical compositions of the invention can contain one or more rhamnose antagonist (including from recombinant and non-recombinant sources) in any form described herein.
  • compositions of this invention may further comprise one or more pharmaceutically acceptable additional ingredient(s) such as alum, stabilizers, antimicrobial agents, buffers, coloring agents, flavoring agents, adjuvants, and the like.
  • additional ingredient(s) such as alum, stabilizers, antimicrobial agents, buffers, coloring agents, flavoring agents, adjuvants, and the like.
  • the compounds of the invention, together with a conventionally employed adjuvant, carrier, diluent or excipient may be placed into the form of pharmaceutical compositions and unit dosages thereof, and in such form may be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, or capsules filled with the same, all for oral use, or in the form of sterile injectable solutions for parenteral (including subcutaneous) use.
  • compositions and unit dosage forms thereof may comprise ingredients in conventional proportions, with or without additional active compounds or principles, and such unit dosage forms may contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed.
  • Compositions according to the invention are preferably sprayable or inhalable in case of respiratory infections and solutions topically applicable in case of urinary infections
  • compositions of this invention may also be liquid formulations including, but not limited to, aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs.
  • Liquid forms suitable for oral administration may include a suitable aqueous or non-aqueous vehicle with buffers, suspending and dispensing agents, colorants, flavors and the like.
  • the compositions may also be formulated as a dry product for reconstitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain additives including, but not limited to, suspending agents, emulsifying agents, non-aqueous vehicles and preservatives.
  • Suspending agent include, but are not limited to, sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats.
  • Emulsifying agents include, but are not limited to, lecithin, sorbitan monooleate, and acacia.
  • Nonaqueous vehicles include, but are not limited to, edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol.
  • Preservatives include, but are not limited to, methyl or propyl p-hydroxybenzoate and sorbic acid. Further materials as well as processing techniques and the like are set out in Part 5 of Remington 's Pharmaceutical Sciences, 20* Edition, 2000, Mack Publishing Company, Easton, Pennsylvania, which is incorporated herein by reference.
  • Solid compositions of this invention may be in the form of tablets or lozenges formulated in a conventional manner.
  • tablets and capsules for oral administration may contain conventional excipients including, but not limited to, binding agents, fillers, lubricants, disintegrants and wetting agents.
  • Binding agents include, but are not limited to, syrup, accacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone.
  • Fillers include, but are not limited to, lactose, sugar, microcrystalline cellulose, maizestarch, calcium phosphate, and sorbitol.
  • Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica.
  • Disintegrants include, but are not limited to, potato starch and sodium starch glycollate.
  • Wetting agents include, but are not limited to, sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.
  • injectable compositions are typically based upon injectable sterile saline or phosphate- buffered saline or other injectable carriers known in the art.
  • Compositions of this invention may also be formulated as suppositories, which may contain suppository bases including, but not limited to, cocoa butter or glycerides.
  • compositions of this invention may also be formulated for inhalation, which may be in a form including, but not limited to, a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifluoromethane or trichlorofluoromethane.
  • Compositions of this invention may also be formulated transdermal formulations comprising aqueous or non-aqueous vehicles including, but not limited to, creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.
  • compositions of this invention may also be formulated for parenteral administration including, but not limited to, by injection or continuous infusion.
  • Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents.
  • the composition may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water.
  • compositions of this invention may also be formulated as a depot preparation, which may be administered by implantation or by intramuscular injection.
  • the compositions may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives
  • compositions of this invention may also be formulated as a liposome preparation.
  • the liposome preparation can comprise liposomes which penetrate the cells of interest or the stratum corneum, and fuse with the cell membrane, resulting in delivery of the contents of the liposome into the cell.
  • Other suitable formulations can employ niosomes.
  • Niosomes are lipid vesicles similar to liposomes, with membranes consisting largely of non-ionic lipids, some forms of which are effective for transporting compounds across the stratum corneum.
  • the compounds of this invention can also be administered in sustained release forms or from sustained release drug delivery systems. A description of representative sustained release materials can also be found in the incorporated materials in Remington's
  • compositions of this invention may also be formulated as an aerosolable solution or an inhalable pharmaceutically acceptable composition, e.g. suitable for prevention and/or treatment of pulmonary bacterial infections caused by gram-negative bacteria.
  • the rhamnose antagonist is prepared for example as an inhalable dry powder or as an aerosolable solution.
  • compositions of this invention may be administered in any manner including, but not limited to, orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal or intranasal administration or intra bladder, or combinations thereof.
  • Parenteral administration includes, but is not limited to, intravenous, intra-arterial, intra-peritoneal, subcutaneous, intramuscular, intra-thecal, and intra-articular.
  • the compositions of this invention may also be administered in the form of an implant, which allows slow release of the compositions as well as a slow controlled i.v. infusion.
  • a rhamnose antagonist according to the invention is administered by inhalation or spraying.
  • the method according to the invention is a method of administering a rhamnose antagonist to the lungs of a subject, comprising: dispersing a dry powder composition or an inhalable formulation comprising a rhamnose antagonist according to the invention to form an aerosol; and delivering the aerosol to the lungs of the subject by inhalation of the aerosol by the subject, thereby ensuring delivery of the rhamnose antagonist to the lungs of the subject.
  • the aerosol is delivered to the endobronchial space of airways from the patient.
  • the rhamnose antagonist according to the invention is delivered by a dry powder inhaler or by a metered dose inhaler.
  • the uses and methods according to the invention for preventing Gram-negative bacteria related infections or disorders comprise a step of coating the apparatus and materials used in intensive care and surgery (such as surgical material, tubings, ventilators etc...) by a composition comprising a rhamnose antagonist according to the invention.
  • a composition comprising a rhamnose antagonist according to the invention is sprayed onto the surface of the said apparatus and materials used in intensive care and surgery.
  • the dosage administered, as single or multiple doses, to an individual will vary depending upon a variety of factors, including pharmacokinetic properties, patient conditions and characteristics (sex, age, body weight, health, size), extent of symptoms, concurrent treatments, frequency of treatment and the effect desired.
  • a rhamnose antagonist according to the invention can be administered alone or in combination with a co- agent useful in the prevention and/or treatment of Gram-negative bacteria related infections or disorders, including nosocomial infections.
  • a rhamnose antagonist according to the invention can be administered or in combination with a co-agent useful in the treatment of immunodepressed patients, e.g. for example a co-agent selected from anti-HIV drug, anti-cancerous drug.
  • the invention encompasses the administration of a rhamnose antagonist of the invention wherein the rhamnose antagonist is administered to an individual prior to, simultaneously or sequentially with other therapeutic regimens or co-agents useful in the prevention and /or treatment of Gram-negative bacteria related infections or disorders or in the treatment of immunodepressed patients (e.g. multiple drug regimens), in a therapeutically effective amount.
  • the rhamnose antagonists according to the invention that are administered simultaneously with said co-agents can be administered in the same or different compositions and in the same or different routes of administration.
  • patients according to the invention are patients suffering from a Gram-negative bacteria induced infection or disorder, including nosocomial infections, such as pneumonia, cystic fibrosis (CF) endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • nosocomial infections such as pneumonia, cystic fibrosis (CF) endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • patients according to the invention are immunodepressed patients such as patients suffering from HIV, a cancer, or heavy skin burns, elderly, or preemies.
  • patients according to the invention are patients in intensive care, such as those undergoing surgery, artificial ventilations or intubation.
  • the nucleic acids encoding rhamnose antagonists and fragments thereof may be used to express recombinant polypeptides for analysis, characterization and therapeutic use.
  • Rhamnose antagonist according to the invention are useful in the prevention and/or treatment of disorders, Gram-negative bacteria induced infections or disorders, including nosocomial infections, such as pneumonia, cystic fibrosis (CF) endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • Rhamnose antagonists according to the invention are useful to antagonize one or more biological activity of rhamnose such as epithelial infiltration by Gram-negative bacteria properties.
  • the disclosed nucleic acid sequences or fragments thereof and combinations of fragment thereof may be used as probes or primers.
  • the disclosed sequences, variants thereof, fragments thereof and combinations thereof may be used in a process for the preparation of rhamnose antagonists according to the invention.
  • the disclosed rhamnose antibodies may be used in assays relating for example to the analysis and the identification of Gram negative specific pathogens or production of rhamnose-associated toxin/proteins associated to bacteria cell wall or extracellular factors such as in Elisa and immunodetection assays.
  • the beneficial effect includes but is not limited to an attenuation, reduction, decrease or diminution of the pathological development after onset of the disease.
  • One process for producing rhamnose antagonists according to the invention comprises culturing a host cell transformed with an expression vector comprising a DNA sequence that encodes a rhamnose antagonist under conditions sufficient to promote expression of rhamnose antagonists.
  • a rhamnose antagonist according to the invention is then recovered from culture medium or cell extracts, depending upon the expression system employed.
  • procedures for purifying a recombinant protein will vary according to such factors as the type of host cells employed and whether or not the recombinant protein is secreted into the culture medium.
  • the culture medium first may be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit.
  • the concentrate can be applied to a purification matrix such as a gel filtration medium.
  • a purification matrix such as a gel filtration medium.
  • an anion exchange and/or an affinity resin can be employed.
  • the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
  • a cation exchange step can be employed.
  • one or more reversed-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media can be employed to further purify rhamnose antagonists, such as CSLl or SML, or SFL or fragments or variants thereof.
  • Recombinant protein produced in bacterial culture can be isolated by initial disruption of the host cells, centrifugation, extraction from cell pellets if an insoluble polypeptide, or from the supernatant fluid if a soluble polypeptide, followed by one or more concentration, salting-out, ion exchange, affinity purification or size exclusion chromatography steps.
  • Microbial cells can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
  • a desired DNA sequence may be chemically synthesized using techniques known per se. DNA fragments also may be produced by restriction endonuclease digestion of a full length cloned DNA sequence, and isolated by electrophoresis on agarose gels.
  • Linkers containing restriction endonuclease cleavage site(s) may be employed to insert the desired DNA fragment into an expression vector, or the fragment may be digested at cleavage sites naturally present therein.
  • the well known polymerase chain reaction procedure also may be employed to amplify a DNA sequence encoding a desired protein fragment.
  • known mutagenesis techniques may be employed to insert a stop codon at a desired point, e.g. immediately downstream of the codon for the last amino acid of the receptor-binding domain.
  • the rhamnose antagonists are antibodies to rhamnose, they may be prepared according to known processes. Methods of preparing polyclonal antibodies from various species have been described for instance in Vaitukaitis et ah, 1971, J. Clin. Endocrinol. Metab., 33, 988. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • the immunizing agent may include rhamnose or rhamnolipids.
  • immunogenic proteins and glycoproteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). Repeated injections may be performed. Blood samples are collected and immunoglobulins or serum are separated. Methods of producing monoclonal antibodies may be found, for instance, in Kohler et ah, 1975, Nature, 256, 495 incorporated therein by reference in its entirety.
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in US 4,816,567.
  • the preparation of the polyclonal antibodies according to the invention is performed by using the original rhamnose associated toxin produced by Gram negative bacteria.
  • the preparation of the polyclonal antibodies according to the invention is produced in E. coli to immunize rabbits.
  • the same fragment is coupled to NHS activated Sepharose 4 Fast Flow and used for affinity purification of antibodies from rabbit sera.
  • the binding to the rhamnose part of rhamnolipids can be assayed in assays such as described in Example 3 or in Zulianello et ah, 2006, Infect. Immun., 74(6):3134-4.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1, amino acid sequence of SEQ ID NO: 2 and amino acid sequence of SEQ ID NO: 43 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1 and amino acid sequence of SEQ ID NO: 2 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide according to the invention wherein the isolated polypeptide binds to the rhamnose part of rhamnolipids.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 1 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 2 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 3 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 43 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 44 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide according to the invention comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 3 for use as a medicament
  • the isolated polypeptide comprises an amino acid sequence of SEQ ID NO: 1 for use as a medicament.
  • the isolated polypeptide comprises an amino acid sequence of SEQ ID NO: 2 for use as a medicament.
  • the isolated polypeptide comprises an amino acid sequence of SEQ ID NO: 3 for use as a medicament.
  • the isolated polypeptide comprises an amino acid sequence of SEQ ID NO: 43 for use as a medicament.
  • the isolated polypeptide comprises an amino acid sequence of SEQ ID NO: 44 for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 7 and SEQ ID NO: 8 or variants or fragments thereof.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 11 and SEQ ID NO: 12 or variants or fragments thereof.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 40 and SEQ ID NO: 41 or variants or fragments thereof.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 7 or variants or fragments thereof.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 8 or variants or fragments thereof.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 11 or variants or fragments thereof.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 12 or variants or fragments thereof.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 40 or variants or fragments thereof. In a further embodiment, the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 41 or variants or fragments thereof.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 7.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 8.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 11.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 12.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 40.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 41.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 7 and SEQ ID NO: 8 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 11 and SEQ ID NO: 12 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 40 and SEQ ID NO: 41 or variants or fragments thereof for use as a medicament.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 7 for use as a medicament.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 8 for use as a medicament.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 11 for use as a medicament.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 12 for use as a medicament.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 40 for use as a medicament.
  • the invention provides an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 41 for use as a medicament.
  • the invention provides an isolated polypeptide comprising an amino acid sequence selected from an amino acid sequence of SEQ ID NO: 11, 12, 31, 32, 33, 37, 38 and 39.
  • An isolated polypeptide comprising an amino acid sequence selected from an amino acid sequence of SEQ ID NO: 11, 12, 31, 32, 33, 37, 38 and 39 are particularly useful in the preparation of a polypeptide according to the invention.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1, amino acid sequence of SEQ ID NO: 2 and SEQ ID NO: 43 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1 and amino acid sequence of SEQ ID NO: 2 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 1 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 2 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 3 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 43 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 44 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 3.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequences of SEQ ID NO: 7 and amino acid sequence of SEQ ID NO: 8 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequences of SEQ ID NO: 40 and amino acid sequence of SEQ ID NO: 41 or variants or fragments thereof.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 7 and SEQ ID NO: 8.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide comprising an amino acid sequence selected from the group of amino acid sequences consisting of: SEQ ID NO: 40 and SEQ ID NO: 41.
  • the invention provides an isolated nucleic acid selected from the group of nucleic acid sequences consisting of: SEQ ID NO: 9 and 10.
  • the invention provides an isolated nucleic acid selected from the group of nucleic acid sequences consisting of: SEQ ID NO: 13, 14, 28, 29, 30, 34, 35 and 36.
  • An isolated nucleic acid selected comprising a nucleic acid sequence selected from the group of nucleic acid sequences of SEQ ID NO: 11, 12, 31, 32, 33, 37, 38 and 39 are particularly useful in the preparation of a polypeptide according to the invention.
  • the invention provides an isolated nucleic acid selected from the group of nucleic acid sequences consisting of: SEQ ID NO: 13 and 14.
  • the invention provides an isolated antibody or an immunologically active fragment of a monoclonal antibody that binds to rhamnose.
  • the invention provides a use of an antibody according to the invention for the analysis and the identification of Gram negative specific pathogens or production of rhamnose-associated toxin/proteins associated to bacteria cell wall or extracellular factors such as in Elisa and immunodetection assays.
  • the invention provides a kit comprising at least one rhamnose antagonist according to the invention. More especially, the invention provides a kit comprising at least one rhamnose antagonist according to the invention wherein the rhamnose antagonist is a protein according to the invention.
  • the kit according to the invention may be used for measuring the activity/or the presence of rhamnose or its ligand.
  • the invention provides a recombinant expression vector comprising a nucleic acid molecule according to the invention, wherein the vector optionally comprises an expression control sequence, allowing expression in prokaryotic or eukaryotic host cells of the encoded polypeptide, operably linked to the nucleic acid molecule.
  • the invention provides a host cell (e.g. prokaryotic or eukaryotic) transfected or transformed with a recombinant expression vector or a nucleic acid according to the invention.
  • a host cell e.g. prokaryotic or eukaryotic
  • the invention provides a process for producing cells capable of expressing a polypeptide according to the invention, comprising genetically engineering cells with a vector or a nucleic acid according to the invention
  • the invention provides a process for producing a polypeptide according to the invention, comprising transfecting an expression vector according to the invention into a host cell according to the invention under conditions allowing the expression of said polypeptide according to the invention and recovering the said polypeptide.
  • the invention provides a pharmaceutical composition comprising a rhamnose antagonist according to the invention, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition wherein the rhamnose antagonist is selected from a polypeptide according to the invention and a rhamnose specific binding agent of the invention and a physiologically acceptable carrier, diluent or excipient. More especially, the invention provides a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1, amino acid sequence of SEQ ID NO: 2 and amino acid sequence SEQ ID NO: 43 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1 and amino acid sequence of SEQ ID NO: 2 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 1 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 2 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 3 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 43 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 44 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide with a sequence of amino acids of SEQ ID NO: 43, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition wherein the rhamnose antagonist is selected from a according to the invention and a rhamnose specific binding agent of the invention and a physiologically acceptable carrier, diluent or excipient. More especially, the invention provides a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 7 and amino acid sequence of SEQ ID NO: 8 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 7, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 8, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide comprising a sequence of amino acids selected from the group of: SEQ ID NO: 7 and SEQ ID NO: 8, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequences of SEQ ID NO: 11 and amino acid sequence of SEQ ID NO: 12 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequences of SEQ ID NO: 40 and amino acid sequence of SEQ ID NO: 41 or variants or fragments thereof, and a physiologically acceptable carrier, diluent or excipient.
  • the invention provides a pharmaceutical composition wherein the pharmaceutical composition is an inhalable pharmaceutically acceptable composition or as an aerosolable solution.
  • the invention provides a use of a rhamnose antagonist for the preparation of a medicament for the prevention and/or treatment of conditions related to Gram-negative bacteria infections, especially involving the epithelial infiltration by Gram-negative bacteria, notably into the respiratory epithelia.
  • the invention provides a rhamnose antagonist for the prevention and/or treatment of conditions related to Gram-negative bacteria infections, especially involving the epithelial infiltration by Gram-negative bacteria, notably into the respiratory epithelia.
  • the invention provides a use according to the invention wherein the condition is selected from pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • the condition is selected from pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • the invention provides a use according to the invention wherein the condition is selected from pneumonitis, pneumonia, cytitis and cystic fibrosis.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1, amino acid sequence of SEQ ID NO: 2 and amino acid sequence of SEQ ID NO: 43 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1 and amino acid sequence of SEQ ID NO: 2 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 1 or variants or fragments thereof. In a further embodiment, the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 2 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 3 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 43 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids of SEQ ID NO: 44 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide with a sequence of amino acids selected from the group consisting of amino acid sequence of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 43. In another further embodiment, the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 44.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequence of SEQ ID NO: 7 and amino acid sequence of SEQ ID NO: 8 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequences of SEQ ID NO: 11 and amino acid sequence of SEQ ID NO: 12 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acid sequences of SEQ ID NO: 40 and amino acid sequence of SEQ ID NO: 41 or variants or fragments thereof.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 7.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 8.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 11. In another further embodiment, the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 12.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 40.
  • the invention provides a use according to the invention wherein the rhamnose antagonist is a polypeptide comprising a sequence of amino acids of SEQ ID NO: 41.
  • the invention provides a method of preventing and/or treating of a disease comprising the administration of a therapeutically effective amount of rhamnose antagonist according to the invention in a mammal in need thereof and wherein the disease is a Gram-negative bacteria infection, especially involving the epithelial infiltration by Gram-negative bacteria, notably the respiratory epithelia.
  • the invention provides a method according to the invention wherein the disease is a Gram-negative bacteria related infection such as pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • a Gram-negative bacteria related infection such as pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • the invention provides a method of preventing a disease comprising coating of a therapeutically effective amount of rhamnose antagonist according to the invention on a surface of a material such as a tubings (e.g. catheter, PVC tubes, intubation devices) used in surgery or intensive care and wherein the disease is a Gram-negative bacteria related infection such as pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections (e.g. cystitis).
  • a material such as a tubings (e.g. catheter, PVC tubes, intubation devices) used in surgery or intensive care and wherein the disease is a Gram-negative bacteria related infection such as pneumonitis, pneumonia, cystic fibrosis, endocarditis, meningitis, external otitis, eye, bone, joint, gastrointestinal, urinary and skin diseases and disorders, such as urinary tractus infections
  • the invention provides a material such as tubings (e.g. catheter, PVC tubes, intubation devices) used in surgery or intensive care coated with a protein or pharmaceutical formulation according to the invention.
  • the mammal is human.
  • the human suffers from respiratory epithelia.
  • the invention provides a use or a method according to the invention wherein the rhamnose antagonist is to be administered in combination with a co-agent useful in the prevention and/or treatment of Gram-negative bacteria related disorders or a co-agent useful in the treatment of immunodepressed patients.
  • the rhamnose antagonist according to the invention and the co- agent are used simultaneously or sequentially.
  • the invention provides a method of administering a rhamnose antagonist to the lungs of a subject, comprising: dispersing a dry powder composition comprising a rhamnose antagonist to form an aerosol; and delivering the aerosol to the lungs of the subject by inhalation of the aerosol by the subject, thereby ensuring delivery of the rhamnose antagonist to the lungs of the subject.
  • the invention provides a method of preventing or treating a Gram-negative bacteria related condition, comprising: a) providing an inhalable formulation comprising a rhamnose antagonist according to the invention, or a pharmaceutically acceptable salt thereof; and b) delivering said formulation to the lung endobronchial space of airways of a patient in need thereof by a nebulization in an aerosol.
  • the invention provides a method according to the invention wherein the formulation according to the invention is delivered by a dry powder inhaler or by a metered dose inhaler.
  • the invention provides a method of antagonizing rhamnolipid-dependent epithelial infiltration by Gram-negative bacteria, notably the respiratory epithelia, comprising exposing bacterial cells that express rhamnolipids, to a rhamnolipid antagonist according to the invention, such that the internation of said rhamnolipid with the apical surface of a mammalian epithelium is antagonized.
  • the invention provides a method for screening for a rhamnose antagonist, comprising the following steps: (i) Providing Gram-negative bacteria to an epithelium surface in vitro in presence or absence of a compound to be screened;
  • the ability of the rhamnose antagonist to inhibit rhamnolipid-dependent infiltration of the epithelium from a Gram-negative bacteria such as P. aeruginosa should be tested as described in Zulianello et al, 2006, above.
  • the invention provides a method for screening for a rhamnose antagonist according to the invention whether the method further comprises a step of testing the absence of cytotoxic effects of the compound to be screened on human cells.
  • the invention provides a method for screening for a rhamnose antagonist according to the invention whether the method further comprises a step of determining the ability of the compound to bind specifically to rhamnose.
  • the specific binding of the rhamnose antagonist should be assayed on a substrate such as a column or a multiwell plate such as described in Shiina et al, 2002, above.
  • the "specific" binding to rhamnose should be specific as compared to binding to other sugars or the surface of the epithelium in general and could be assayed on a model epithelium such as described in Zulianello et al, 2006, above.
  • the invention provides a method for in vitro detection of the level of rhamnose in a biological sample comprising the steps of contacting said biological sample with an antibody according to the invention.
  • the invention provides an assay for the detection of rhamnose in a sample, which assay comprises (i) contacting said sample with an antibody specific for rhamnose according to the invention; (iii) determining the presence and/or amount of rhamnose in said sample.
  • a diagnostic kit for use in an assay according to the invention comprising a probe for receiving a sample and a rhamnose antagonist according to the invention.
  • the rhamnose antagonist according to the invention is selected from a polypeptide according to the invention and an antibody according to the invention.
  • aa amino acid
  • bp base pair
  • cm centimeter
  • hr hour
  • ⁇ l microliter
  • ⁇ M micromolar
  • mM millimolar
  • mg milligram
  • min minute
  • nm nanometer
  • Cystic fibrosis CF
  • DMEM Dulbecco's Modified Eagle Medium
  • EDC/NHS N- ethyl-N' -(dimethyl aminopropyl) carbodiimide-N-hydroxy succinimide
  • EDTA ethylene diamine tetraacetic acid
  • FITC fluorescein isothiocyanate
  • GFP Green Fluorescent Protein
  • HEPES N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid
  • IPTG Isopropyl-Beta d-Thiogalactoside
  • LB Lia Broth
  • the activity of the isolated sequences of the invention may be tested for their ability to inhibit or decrease epithelia infiltration by Gram-negative bacteria such as P. aeruginosa on models of epithelia such as primary mucosae reconstituted in vitro as described in Zulianello et al, 2006, above.
  • Example 1 Inhibitory activity of proteins of SEO ID NO: 1 and SEO ID NO: 5 on rhamnolipid effects on respiratory epithelia
  • the isolated sequences of the invention have been tested to determine their ability to prevent the rhamnolipid effects on respiratory epithelia in comparison with other L- rhamnose binding lectins extracted from eggs of various fishes such as CSL2 (SEQ ID NO: 5) extracted from chum salmon eggs and CSL3 (SEQ ID NO: 6) extracted from chum salmon eggs on the basis of their effect on the transepithelial resistance (TER).
  • Airway epithelia were obtained as follows: Biopsies of non-involved nasal mucosa were performed according to the guide-lines of the Ethical Committee for Clinical Studies of the Geneva State Hospital (authorization no 04/019). Informed consent was obtained from all patients.
  • Epithelial cells were processed as described previously (Zulianello et al., 2006, above). Briefly, dispersed cells were seeded onto 0.6 cm 2 collagen-coated filters at a density of 5 X 10 6 cells/ cm 2 . Cells were cultured at air- liquid interface in DMEM-F12 (InVitrogen, Basel, Switzerland) supplemented with 2% UltroserG (Biosepra, Ciphergen Biosystems, Cery- Saint-Christophe, France), 100 U/ml penicillin and 100 mg/ml streptomycin.
  • the TER of the reconstituted epithelia was assessed using a Millicell ERS Volt-ohm meter (World Precision Instruments, New Haven, CT) as described previously (Zulianello et al, 2006, above) and only filters featuring similar transepithelial resistances were processed further. Twenty-four hours prior to the infection assay with bacteria expressing GFP ⁇ Zulianello et al, 2006, above), penicillin and streptomycin were removed from the culture media.
  • CSLl SEQ ID NO: 1
  • CSL2 SEQ ID NO: 5
  • CSL3 SEQ ID NO: 6
  • SFL SEQ ID NO: 43
  • Viability and cytotoxicity was assessed using the LIVE/DEAD Kit assay (Molecular Probes, InVitrogen). To this end, epithelia were stained with 4 ⁇ M calcein and 2 ⁇ M ethidium for 30 min at 37°C. Filters were then cut off and mounted for live confocal microscopy analysis. Reconstituted epithelia as described above were treated with 0.04-4 ⁇ M CSLl, CSL2 or CSL3 in the presence or absence of 150 ⁇ g/ml rhamnolipids.
  • Fig 4C shows that the viability of epithelial cells is unaffected in the presence of 4 ⁇ M CSLl (Fig 4C, left middle panel) and 4 ⁇ M CSLl combined to 150 ⁇ g/ml rhamnolipids (Fig 4C, left lower panel), as compared to control untreated epithelia (Fig 4C, left top and right lower panels).
  • treatment with 4 ⁇ M CSL3 for 1 hr induced cell death, as indicated by the staining with ethidium bromide (Fig 4C, middle panel) with was also observed after treatment with 0.1% saponin for 1 hr, which leads to 90% cell death.
  • Example 2 Protective activity of proteins of SEO ID NO: 1 and SEO ID NO: 3 on P. aeruginosa challenged respiratory epithelia
  • the isolated sequences of the invention have been tested to determine their ability to have a protective effect towards Gram-negative bacterial infection over a long period of time.
  • P. aeruginosa strains (PAOl and rhamnose-deficient strain PT712 (rhlA-)) were transformed with plasmis pIAX2 to express the gene coding for green fluorescence protein (GFP) as described previously (Zulianello et ah, 2006, above).
  • GFP green fluorescence protein
  • Bacteria were inoculated in Luria-Bertani (LB) medium overnight at 37°C, diluted in LB, and grown to an optical density at 600 nm of 0.5, under which conditions all strains grew similarly. Cultures were then centrifuged and resuspended in DMEM-F12 20 mM HEPES pH 7.00.
  • Reconstituted epithelia were fixed in 4% paraformaldehyde, permeabilized in 0.1 % saponin and incubated for 1 hr with labeled phalloidins (Molecular Probes, In Vitrogen) to stain epithelial cells, respectively. After washes, filters were cut off from culture inserts and mounted in Vectorshield-DAPI (Vector Laboratories) between glass coverslips and observed with LSM 510 or MetaLSM confocal microscopes (Zeiss). For live imaging, filters of control epithelia and of epithelia exposed to various treatments were cut off and mounted in culture media. Time laps video microscopy was performed on LSM510 microscope. *** P ⁇ 0.001, versus control value (bars).
  • the protein according to the invention of SEQ ID NO: 3 was as efficient as a protein according to the invention of SEQ ID NO: 1 in preventing bacterial infiltration of the reconstituted epithelia.
  • the apical application of PAOl, pre-treated with other lectins either CSL2 (SEQ ID NO: 5) or CSL3 (SEQ ID NO: 6) at 4 ⁇ M resulted in a massive bacterial infiltration and in the destruction of the epithelium layer.
  • FITC-labeled glycoprotein was incubated with 4 ⁇ M of a protein according to the invention of SEQ ID NO: 1 (CSLl) for 15 min prior apical treatment of reconstituted epithelia in the presence of 10 Texas-red beads.
  • CSLl blocked the interactions of rhamnolipids to apical cell surface membranes, therefore inhibiting the opening of the paracellular route, thus, the infiltration of inert beads.
  • the isolated sequences of the invention have been tested confirm their direct interaction and binding properties to rhamnolipids.
  • a protein of SEQ ID NO: 1 (CSLl) was serially diluted with 50 ⁇ L of PBS on 96-well microtiter plates, and mixed with 50 ⁇ L of 4% rabbit erythrocyte suspension. The mixture was incubated at room temperature for 30 min and then the hemagglutinating activity was measured visually. The hemagglutinating activity was defined as the titer value of maximum dilution with positive agglutination of 2% rabbit erythrocytes.
  • the inhibitory effect of rhamnolipids on hemagglutination was assayed as follows. Rhamnolipids were diluted two-fold in series on microtiter plates and incubated with 25 ⁇ L of the solutions containing the protein according to the invention having hemagglutination titer values 2-3 for 30 min. A 4% rabbit erythrocyte solution (50 ⁇ L) was added to the mixture and incubated for another 30 min. The inhibitory activity was estimated by the minimum concentration of rhamnolipids needed to cause negative hemagglutination.
  • the specific hemagglutinating activities of CSLl against rabbit erythrocytes has been reported to be the minimal CSLl concentration needed to agglutinate 2% of a 4% solution of erythrocytes (Shiina et al, 2002, above). It was observed that 25 ⁇ M rhamnolipids was the minimal concentration required to inhibit the CSLl hemagglutinating activity (7.5 nM) while, in the same conditions, 400 ⁇ M L- rhamnose were necessary to inhibit, to the same extend, this hemagglutinating activity.
  • a dextran matrix CM5 sensor chip was activated with the mixture of N-ethyl-N'-(dimethylaminopropyl) carbodiimide-N-hydroxysuccinimide (EDC/NHS) for 7 min at a flow rate of 5 ⁇ L/min. Then, 0.02 M ethylenediamine containing 50 mM sodium borate (pH 8.5) and 0.8 M ethanolamine was loaded for 7 min and 1 M ethanolamine for 7 min to the chip. Rhamnolipids ( ⁇ 1 mM) were mixed with EDC/NHS at room temperature for 30 min to activate.
  • EDC/NHS N-ethyl-N'-(dimethylaminopropyl) carbodiimide-N-hydroxysuccinimide
  • the chip was incubated with activated-rhamnolipids at room temperature for 30 min and washed with water. The unreacted species on the surface of the chip was blocked with ethanolamine.
  • the sensor chip was regenerated with 0.2 M rhamnose and 50 mM sodium acetate buffer (pH 4.0) containing 0.15 M NaCl.
  • the various concentrations of a protein of SEQ ID NO:1 (CSLl) dissolved in HBS-EP (10 mM HEPES (pH 7.4) containing 0.15 M NaCl, 3 mM EDTA and 0.005% surfactant P-20) were injected onto the rhamnolipid-immobilized sensor chip at a flow rate of 20 ⁇ L/min.
  • the constant of association between CSLl and rhamnolipids was then analyzed by surface plasmon resonance (SPR) to adjust more precisely the concentration of lectins that should be used to inhibit bacterial infiltrations in our assay.
  • the dissociation constant (Kd) value for CSLl was estimated to be 21 nM by bivalent analysis mode using BIAcore's software, suggesting that CSLl bind quickly to and dissociate slowly from rhamnolipids.
  • L-rhamnose was unable to efficiently compete these interactions, even at higher concentrations.
  • Example 4 Expression of a protein of SEQ ID NO: 3 and fra2ments thereof (SEQ ID: 13: SEQ ID NO: 14) by PCR, resulting in protein fragments of SEQ ID NO: 11 and 12
  • Oligo F2 and R2 (PCR product 2) (SEQ ID NO: 29)
  • Oligo F3 and R3 (PCR product 3) (SEQ ID NO: 30)
  • PCR Product 1 (encoding for a STLl fragment (S/Mng-150) of
  • SEQ ID NO: 31 SEQ ID NO: 31
  • 2 encoding for a STLl fragment (146-190) of SEQ ID NO: 32
  • ligation explain main steps
  • PCR Product 1 (encoding for a STLl fragment (A/M 2 i 4 -246) of SEQ ID NO: 37) and 2 (encoding for a STLl fragment (243-285) of SEQ ID NO: 38) were then linked together by ligation (explain main steps) and later to PCR product 3 (encoding for a STLl fragment (282-314) of SEQ ID NO: 39) was added (explain main steps) to create the full 300 bp product (SEQ ID NO: 14), encoding for a protein Domain 2 below.
  • Domain 1 (SEQ ID NO: 11) : his tagged STLl fragment (S/M 118 -215) from SEQ ID
  • R2 cacgcatgttcacctcacacgtctgcttcccgtcacagcgctgaccagagtgccagggtaccttcctgggaac (SEQ ID NO: 18)
  • SEQ ID NO: 12 his tagged STLl fragment (A/M 2 i 4 -305) from SEQ ID NO: 3 Fl ggggacaagtttgtacaaaaagcaggcttaatgaagaccagtatcacctgcgaaggctcaaccagctccctgg
  • full length gene was amplified using R3 from domain 2 (SEQ ID NO: 26) and the following oligo:
  • PCR products SEQ ID NO: 13 and 14 were cloned by Gateway technology (Invitrogen) into pENTR223. After sequencing the genes were subcloned by Gateway technology (Invitrogen) into pEXP17 which has an N-terminal histidine tag, namely sequence of SEQ ID NO: 42.
  • E.coli strain BL21 (DE3) was transformed with the expression vectors.
  • Cells were grown in LB till the OD 0.6 and expression was induced by adding IPTG in a final concentration of 0.4 mM.
  • Cells were spun down and were lysed overnight in a 100 mM Na 2 HPO 4 , 10 mM Tris.HCL and 6 M GuHCl buffer pH 8.0. Suspension was cleared by centrifugation and Ni- NTA beads were added to the lysate. After a minimal of 1 hour binding by tumbling the tube a column was poured.
  • the column was washed with buffer B (100 mM Na 2 HPO 4 , 10 mM Tris.HCL and 8 M Urea, 500 mM NaCl, 20 mM Imidazole pH 8.0), buffer C (100 mM Na 2 HPO 4 , 10 mM Tris.HCL and 8 M Urea, 500 mM NaCl, 20 mM Imidazole pH 6.3), and 3 times alternating with buffer B and buffer B with 50% isopropanol.
  • the proteins were eluted with buffer C with 1 M Imidazole.
  • the proteins were dialyzed against acetic acid and lyophilized.
  • the expression products Domain 1 and Domain 2 (SEQ ID NO: 11 and SEQ ID NO: 12), corresponding respectively to the target fragments (SEQ ID NO: 40 and SEQ ID NO: 41) with an His tag sequence for purification, i.e. having a His tag sequence MSYYHHHHHHLESTSLYKKAGL (SEQ ID NO: 42) at the N-terminus, lead to the target STLl fragments (SEQ ID NO: 40 and SEQ ID NO: 41) after purification and His tag removal.
  • the STL fragments (SEQ ID NO: 40 and 41) are preferably obtained directly through the cloning of the fragments without his tag.
  • the his tag can be removed after the purification of the his tagged frgament (e.g. TAGZyme DAPase Enzyme from Quiagen). Refolding
  • a 50 ml buffer was made with 400 mM L-arginine HCl, 5 mM reduced glutathione, 0.5 mM oxidized glutathione, 100 mM Tris.HCl pH 8.0, 2 mM EDTA, 5 % glycerol, 0.5 tablet protease inhibitors.
  • Protein (STLl fragments of SEQ ID NO: 11 and SEQ ID NO: 12) was dissolved in 1 ml 20 mM Tris.HCl, 8M urea pH 8.0. The protein was added to the buffer and incubated 5 days at 10 0 C.
  • the synthetic fragments of STLl (SEQ ID NO: 11 and SEQ ID NO: 12) showed similar properties as full length STLl as purified from chum salmon eggs such as the absence of cytotoxicity, the prevention of P. aeruginosa invasion and reduction of biofilm formation measured such as described in the Examples. In addition, it has been demonstrated by gel chromatography assays that those synthetic fragments do not form multimers as the full length does.
  • Example 5 Raising of antibodies against rhamnolipids
  • Antibodies against rhamnolipids have been prepared as follows: rhamnolipids from Pseudomonas (Jeneil's facility in Saukville, WI, USA) was used to immunize rabbits SPF through 4 immunizations: at day 0, 14, 28 and 56.
  • Pre-immune serum (PPI) was taken just before the first immunization in a volume of 2 ml.
  • Small Bleed (PP) from day 31 was taken in a volume 2 ml.
  • Large Bleed from day 59 was taken in a volume 20 ml.
  • Serum from final Bleed, unpurified was taken in a volume 50 ml.
  • Antibodies were purified by affinity against the rhamnolipids. Affinity purified antibodies against the antigen, provided in PBS solution with sodium azide (0.01%) as preservative were quantified with an Elisa test, dilution 1/100 as starting dilution. The flow through serum collected from the affinity purification was also quantified for reactivity towards antibodies against rhamnolipids. The pre-immune serum was tested versus small bleed samples by immunofluorescence in FITC-rhamnolipids treated cells. In the presence of the antibodies against rhamnolipids, it could be visualized co-localization between these antibodies and the FITC-labeled rhamnolipids anchored to the cell surface of human epithelia.
  • P.aeruginosa-GW obtained as described in Example 2 were inoculated in LB medium overnight at 37 0 C, diluted 1/100 in media and added to the apical surface of the reconstituted epithelia obtained such as described in Example 1. Biofilms were allowed to develop for 1- 6 days in the absence or presence of 150 ⁇ g/ml rhamnolipids and 4 ⁇ M of CSLl (SEQ ID NO: 1) or and 4 ⁇ M of SFL (SEQ ID NO: 44).
  • PAOl control culture
  • aggregates with the ball and tower shapes characteristic of biofilms detectable by confocal microscopy which did not form in the presence of CSLl (or of SFL) or with rhamnose-deficient strain PT712 (rhlA-).
  • Quantitative analyses revealed that the volumes of aggregates were similar in untreated and rhamnolipid-treated cultures, and significantly reduced in the presence of 4 ⁇ M CSLl (Fig 8A).
  • Concanavalin A (Con A) staining showed that PAOl -aggregates formed a mannose-rich extra-polysaccharide matrix characteristic of biofilms, documenting the production of exopolysaccharides by the bacterial aggregates. Transmission electron microscopy showed that this material formed a compact, electron-dense structure not observed in cultures of planktonic PAOl, and less developed in the presence of 4 ⁇ M CSLl.
  • Example 7 Prevention of bacterial adherence on medical devices

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des nouvelles molécules capables d'inhiber les rhamnolipides et en particulier l'infiltration épithéliale par des bactéries à Gram négatif. En particulier, l'invention concerne des protéines utiles dans la prévention et/ou le traitement d'infections ou de troubles induits par des bactéries à Gram négatif, notamment les infections nosocomiales.
PCT/IB2008/053851 2007-09-24 2008-09-23 Antagonistes du rhamnose et utilisation de ceux-ci WO2009040726A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP07117077.3 2007-09-24
EP07117077 2007-09-24

Publications (2)

Publication Number Publication Date
WO2009040726A2 true WO2009040726A2 (fr) 2009-04-02
WO2009040726A3 WO2009040726A3 (fr) 2009-09-24

Family

ID=40361523

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2008/053851 WO2009040726A2 (fr) 2007-09-24 2008-09-23 Antagonistes du rhamnose et utilisation de ceux-ci

Country Status (1)

Country Link
WO (1) WO2009040726A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113648409A (zh) * 2021-06-23 2021-11-16 山东第一医科大学(山东省医学科学院) L-鼠李糖抗体在制备预防和/或治疗耐药细菌感染的药物中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003066679A1 (fr) * 2002-02-07 2003-08-14 Solbec Pharmaceuticals Limited Proteine fixant le rhamnose

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003066679A1 (fr) * 2002-02-07 2003-08-14 Solbec Pharmaceuticals Limited Proteine fixant le rhamnose

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BABAOGLU KERIM ET AL: "Novel inhibitors of an emerging target in Mycobacterium tuberculosis; substituted thiazolidinones as inhibitors of dTDP-rhamnose synthesis." BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 13, no. 19, 6 October 2003 (2003-10-06), pages 3227-3230, XP002516869 ISSN: 0960-894X *
TATENO HIROAKI ET AL: "A novel rhamnose-binding lectin family from eggs of steelhead trout (Oncorhynchus mykiss) with different structures and tissue distribution" BIOSCIENCE BIOTECHNOLOGY AND BIOCHEMISTRY, vol. 65, no. 6, June 2001 (2001-06), pages 1328-1338, XP002517665 ISSN: 0916-8451 cited in the application *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113648409A (zh) * 2021-06-23 2021-11-16 山东第一医科大学(山东省医学科学院) L-鼠李糖抗体在制备预防和/或治疗耐药细菌感染的药物中的应用
CN113648409B (zh) * 2021-06-23 2024-03-01 山东第一医科大学(山东省医学科学院) L-鼠李糖抗体在制备预防和/或治疗耐药细菌感染的药物中的应用

Also Published As

Publication number Publication date
WO2009040726A3 (fr) 2009-09-24

Similar Documents

Publication Publication Date Title
KR101684447B1 (ko) 면역애쥬번트인 플라겔린 기반의 화합물 및 이의 용도
CA2362153C (fr) Polypeptide antimicrobien/neutralisant des endotoxines
US11814422B2 (en) Polypeptides and medical uses thereof
JP5763113B2 (ja) モラクセラ・カタラーリスと上皮細胞、細胞外マトリックス蛋白質及び補体系の相互作用
JPH11137267A (ja) 新規化合物
US10098942B2 (en) Targets of Acinetobacter baumannii
RU2426745C2 (ru) Рекомбинантный химерный белок фактора ингибирования нейтрофилов и гиругена и содержащая его фармацевтическая композиция
US5939279A (en) Inhibition of bacterial binding by high-mannose oligosaccharides
EP1299724B1 (fr) Peptide de synthese pour traiter des troubles neurologiques
US10975131B2 (en) Factor H-Fc immunotheraphy
JPS6122A (ja) 尿路感染症のための化学的に規定されたワクチン
Hao et al. Proventriculus-specific cDNAs characterized from the tsetse, Glossina morsitans morsitans
JP2018510870A (ja) Ｂ７リガンド二量体界面に由来する単離されたペプチドおよびそれらの使用
WO2009040726A2 (fr) Antagonistes du rhamnose et utilisation de ceux-ci
EP1005487B1 (fr) Proteine 74 kilodalton de membrane externe provenant de moraxella catarrhalis
KR20080026085A (ko) 곤충세포에서 제조한 재조합 ｅ-셀렉틴
JP2001186887A (ja) サソリ毒由来の抗菌ペプチド
US6072048A (en) DNA molecule encoding for cellular uptake of Mycobacterium tuberculosis and uses thereof
KR20070001274A (ko) 치료학적 펩타이드
US20210008193A1 (en) Protein antigens for vaccinating against nontypeable haemophilus influenzae
KR20090012237A (ko) 황색포도상구균 감염 치료용 의약을 제조하기 위한 활성 성분으로서의 ｔｒａｐ 자체의 용도
US20160030544A1 (en) Immunogenic composition to neisseria
EP2915543B1 (fr) Polypeptides dérivés de enterococcus et leur utilisation pour la vaccination et la génération d'anticorps thérapeutiques
JP5086633B2 (ja) 細胞内に侵入する能力を有するペプチド及び核酸、物質を細胞内に侵入させるための物質移送用剤及び物質移送方法、並びに、らい菌による感染症を予防又は治療するためのワクチン、抗体及び医薬
JP5685562B2 (ja) らい菌による感染症を予防又は治療するためのワクチン、抗体及び医薬

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08833319

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08833319

Country of ref document: EP

Kind code of ref document: A2