WO2008152816A1 - Methods of identifying agents that modulate methylation of vegfr1 by smyd3 - Google Patents
Methods of identifying agents that modulate methylation of vegfr1 by smyd3 Download PDFInfo
- Publication number
- WO2008152816A1 WO2008152816A1 PCT/JP2008/001516 JP2008001516W WO2008152816A1 WO 2008152816 A1 WO2008152816 A1 WO 2008152816A1 JP 2008001516 W JP2008001516 W JP 2008001516W WO 2008152816 A1 WO2008152816 A1 WO 2008152816A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vegfrl
- polypeptide
- amino acid
- acid sequence
- smyd3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57525—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the liver or pancreas
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5753—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the stomach or small intestine
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/71—Assays involving receptors, cell surface antigens or cell surface determinants for growth factors; for growth regulators
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/91005—Transferases (2.) transferring one-carbon groups (2.1)
- G01N2333/91011—Methyltransferases (general) (2.1.1.)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
Definitions
- the present invention relates to transcriptional regulation, more particularly to the identification of agents that modulate methyltransferase activity, such as agents that modulate methylation of VEGFRl by SMYD3 (also known as "ZNFN3A1").
- SMYD3 also known as "ZNFN3A1”
- ZNFN3A1 agents that modulate methylation of VEGFRl by SMYD3
- SMYD3 modulators so identified may prove useful in the treatment of cancer, including, for example, colorectal carcinoma, hepatocellular carcinoma, bladder cancer and breast cancer.
- H3K4, H3K36, and H3K79 are associated with euchromatin structure, whereas that of H3K9, H3K27, and H4K20 is associated with heterochromatin structure (Strahl BD and Allis CD, Nature 2000, 403(6765): 41-5.; Jenuwein T and Allis CD, Science 2001, 293(5532): 1074-80.).
- Conformation of chromatin is one of the key regulators of transcription; un- transcribed genes are compacted in heterochromatin, while transcribed genes are in euchromatin, where transcriptional complexes are accessible to the target DNA (Li B et al., Cell 2007, 128(4): 707-19.).
- H3 serine 10 H3S10
- H3K9 methylation of H3K9
- Phosphorylation of H3S10 promotes acetylation of H3K14 by GCN5 (Zhang Y and Reinberg D, Genes & development 2001, 15(18): 2343-60.).
- H3K9 The methylation of H3K9 is involved in the transport of HPl to distinct chromosomal areas, which, in turn, is crucial for establishing and maintaining domains of heterochromatin (Nakayama J et al., Science 2001, 292(5514): 110-3.; Lachner M et al., Nature 2001, 410(6824): 116-20.; Bannister AJ et al., Nature 2001, 410(6824): 120-4.).
- Recruitment of HPl proteins to certain sites of the genome involves interactions with multiple components of chromatin (Nielsen SJ et al., Nature 2001, 412(6846): 561-5.).
- H3K4 a protein that is crucial for transcriptional activation.
- H3K4 histone methyltransferase activity
- Vascular endothelial growth factor receptor- 1 (VEGFRl) (Accession No.: NM_002019) is a receptor tyrosine kinase (RTK) that plays a role in physiological and pathological an- giogenesis in the context of receptor dimerization and an interaction with its ligands (Shibuya M et al., Oncogene 1990, 5(4): 519-24.; Rahimi N, Experimental eye research 2006, 83(5): 1005-16).
- RTK receptor tyrosine kinase
- VEGFRl shares structural similarity with the FMS/KIT/PDGFR family, containing an extracellular domain, seven immunoglobulin (Ig)-like sequences, and a cytoplasmic tyrosine kinase domain with a long kinase insert.
- VEGFRl is expressed in two forms, as a full-length tyrosine kinase receptor and in a soluble form that carries only the extracellular domain.
- RTKs such as VEGFR2 and VEGFR3
- the full-length form of VEGFRl positively mediates signaling on binding with its ligands.
- VEGFRl acts as an inhibitor through ligand trapping, and suppresses angiogenesis (Shibuya M, Journal of biochemistry and molecular biology 2006, 39(5): 469-78.). The regulatory mechanism of these opposite functions remains unclear.
- VEGFR ligand vascular endothelial growth factor-A (VEGFA)
- VEGFRl vascular endothelial growth factor-A
- the affinity of VEGFA to VEGFRl is at least one order of magnitude higher than that to VEGFR2 (Sawano A et al., Cell Growth Differ 1996, 7(2): 213-21.).
- the endogenous tyrosine kinase activity of VEGFRl is extremely low as compared with that of VEGFR2.
- VEGFRl tyrosine-phosphorylation sites have been described in different expression models (Shibuya M, Journal of biochemistry and molecular biology 2006, 39(5): 469-78.), the downstream signaling events remain to be delineated, primarily due to the low biological activity of this receptor.
- SMYD3 (Accession No.: AB057595) has di- and tri-methyltransferase activity on lysine 4 of histone H3 (H3-K4) (See WO 2005/071102, the entire contents of which are incorporated by reference herein).
- H3-K4 histone H3
- previous reports demonstrate that elevated SMYD3 expression plays a crucial role in the proliferation of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC) cells (See WO 2003/027143, the entire contents of which are incorporated by reference herein; see also Hamamoto, R.
- retinoblastoma protein (RBl) is methylated through interaction with the SET domain of SMYD3, and that such methylation facilitates phosphorylations of RBl at threonines 821/826 and serines 807/811 by CDK2/cyclinE or CDK6/cyclinD3 complex in vitro and in vivo (See WO2007/004526, the entire contents of which are incorporated by reference herein).
- Patent Citation 1 WO2003/027143 (JP 2005-511023)
- Patent Citation 2 WO2004/076623 (JP 2006-519009)
- Patent Citation 3 WO2005/071102 (JP 2007-519391)
- Patent Citation 4 WO 2006/092958, Al Patent Citation 5 : WO 2007/004526, A2 Non Patent Citation 1 : Kunizaki, et al. Cancer Res. 2007 Nov 15;67 (22): 10759-65
- the present invention is based, at least in part, on the discovery of a novel mechanism of VEGFRl regulation, through lysine 831 methylation by SMYD3.
- SMYD3 also known under the gene name "ZNFN3A1”
- ZNFN3A1 is a histone H3 methyl- transferase that is up-regulated in a great majority of colorectal and hepatocellular carcinomas (See, for example, WO 2003/027143 cited above) as well as bladder and breast cancers (See, for example, WO 2006/085684 and WO 2006/092958) each of which in incorporated by reference herein in its entirety.
- VEGFRl interacts with the SET domain of SMYD3. This interaction results in the methylation of VEGFRl, which, as shown herein, results in enhanced kinase activity in vitro.
- step (c) comparing the methylation level detected in step (b) with a control level detected in the absence of the agent. wherein an increase or decrease in the methylation level as compared to the control level indicates that the agent modulates methylation of VEGFRl by SMYD3.
- kits for detecting for the ability of a test compound to regulate methylation of VEGFRl such a kit including (a) an SMYD3 polypeptide having methyltransferase activity, (b) a VEGFRl peptide capable of being methylated by the SMYD3 polypeptide, and (c) a cofactor for the methylation of the VEGFRl peptide.
- the kit may optionally include S-adenosyl homocysteine hydrolase (SAHH).
- the present invention further provides a method of screening for a compound for treating a cancer, such as colorectal cancer, hepatocellular carcinoma, bladder and breast cancer, such a method including the steps of: (a) identifying a test compound that modulates methylation according to the method described above, and (b) selecting the test compound that decreases the methylation level of the substrate to be methylated as compared to a control methylation level detected in the absence of the test compound.
- a cancer such as colorectal cancer, hepatocellular carcinoma, bladder and breast cancer
- the present invention further provides a method of measuring methyltransferase activity of a polypeptide, said method including the steps of: a. contacting a polypeptide selected from the group consisting of: i. a polypeptide having the amino acid sequence of SEQ ID NO: 2 (SMYD3); ii. a polypeptide having the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are substituted, deleted, or inserted, and said polypeptide has a biological activity equivalent to the polypeptide having the amino acid sequence of SEQ ID NO: 2; iii. a polypeptide having an amino acid sequence that is at least about 80% homologous to SEQ ID NO: 2; vi.
- a polypeptide selected from the group consisting of: i. a polypeptide having the amino acid sequence of SEQ ID NO: 2 (SMYD3); ii. a polypeptide having the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are substituted, deleted, or
- polypeptide that includes the amino acid sequence of positions 117 to 246 of the amino acid sequence of SEQ ID NO: 2, wherein said polypeptide has a methyl- transferase activity equivalent to the polypeptide having the amino acid sequence of SEQ ID NO:2; with a VEGFRl peptide to be methylated and a cofactor under the condition capable of methylation of the VEGFRl peptide; b. detecting the methylation level of the VEGFRl peptide; and c. measuring the methyltransferase activity by correlating the methylation level of step (b) with the methyltransferase activity.
- the present invention also provides a kit for measuring the methyltransferase activity of SMYD3, said kit including the following components: a. a VEGFRl peptide capable of being methylated by the SMYD3, b. a cofactor for the methylation of the VEGFRl peptide, and c. a detection regent for detecting methylated of lysine 831.
- Figure 1 depicts the methylation of the cytoplasmic region of VEGFRl in vitro.
- Part a depicts the results of an in vitro MTase assay of SMYD3 using as a substrate recombinant proteins VEGFR1#1, #2, and #3, each of which contain different cytoplasmic regions of VEGFRl.
- Ig-LD corresponds to an immunoglobulin-like domain, TM to a transmembrane domain, TK to a tyrosine kinase domain.
- Recombinant VEGFR1#1, #2, and #3 proteins were incubated with 3 H-labeled SAM, a methyl donor, in the presence (closed box) or absence of immunoprecipitated Flag- tagged SMYD3. Methylated substrates were quantified by liquid scintillation counter. Immunoprecipitants from cells transfected with mock plasmid were used for control (opened box). Independent experiments were carried out three times with different immunoprecipitants. Part b depicts the detection of methylated VEGFRl by fluorogram.
- Recombinant SMYD3 was incubated with recombinant VEGFRl in the presence or absence of S-(5'-Adenosyl)-L-homocysteine hydrolase (SAHH).
- SAHH S-(5'-Adenosyl)-L-homocysteine hydrolase
- the substrates were quantified by immunoblot analysis with anti-GST antibody (lower panel).
- Part c depicts the determination of the methylated region in VEGFR 1#1.
- Figure 2 depicts the methylation of VEGFRl lysine 831 both in vitro and in vivo.
- Part a depicts the alignment of flanking sequences of methylated lysines by histone methyltransferases and candidate lysines in VEGFRl (asterisks).
- Part b depicts the in vitro methylation of wild type and mutant forms (K819A and K831A) of VEGFRl-Nl (upper panel).
- Part c depicts the in vitro methylation of VEGFRl mutants containing different substitutions of VEGFR1-K831.
- Part d depicts the in vitro methylation of VEGFRl was detected by immunoblot analysis with anti-methylated K831 (K831me2)-specific antibody (middle panel). Methylation was confirmed in a different experiment by fluorogram (upper panel).
- VEGFRl was quantified by immunoblot analysis with anti-GST antibody (lower panel).
- Part e depicts the methylation of VEGFRl in 293-SMYD3 cells expressing HA-tagged VEGFRl and 293-Mock cells. The cells were treated with L-[methyl- 3 H] methionine in the presence of protein synthesis inhibitor. VEGFRl was immunoprecipitated with anti-HA antibody, and examined by fluorogram (upper panel). Part f depicts the methylation of VEGFRl detected by immunoblot analysis with anti-methylated K831 (K831me2)-specific antibody. Part g depicts the suppression of K831 methylation by knockdown of SMYD3. Whole cell extracts from 293-SMYD3 cells, treated with SMYD3-specific siRNA or control siRNA, were used for immunoblot analysis.
- Figure 3 depicts the interaction between SMYD3 and VEGFRl.
- Part a depicts the interaction between SMYD3 and VEGFRl, examined by a co-immunoprecipitation assay using extract from HEK293 cells expressing HA-tagged SMYD3 and different regions of Flag-tagged VEGFRl (VEGFR1#1, #2, and #3).
- Part b depicts the interaction of endogenous SMYD3 with VEGFRl.
- Whole cell extracts from SNU423, SW480, and MCF7 cells expressing both SMYD3 and VEGFRl were precipitated with anti-SMYD3 antibody.
- the precipitants were immunoblotted with anti- VEGFR-I antibody (upper panel) or anti-SMYD3 antibody (lower panel).
- Part c depicts the association of VEGFRl with the SET domain of SMYD3. Wild type or deleted forms of Flag-tagged SMYD3 (N-20, delta 2, or delta 3) were co-expressed with HA-tagged VEGFRl in HEK293 cells. IP was performed with either anti-HA or anti-Flag antibody, and the precipitants were analyzed by western blot analysis with anti-Flag (upper panel) or anti-HA (lower panel) antibody.
- Part d depicts the interaction of the cytoplasmic region of VEGFRl with the SET domain of SMYD3 in vivo.
- Flag-tagged wild type or the SET domain of SMYD3 was co-expressed with HA-tagged VEGFRl in HEK293 cells. Extracts from the cells were precipitated with anti-Flag (upper panel) or anti-HA (lower panel) antibodies, and the precipitants were analyzed by western blot analysis with anti-HA antibody.
- Part a depicts the results of an in vitro kinase assay carried out using methylated or unmethylated VEGFRl.
- Recombinant GST-fused VEGFRl was treated with (closed box) or without (opened box) SMYD3. Its kinase activity was subsequently analyzed using its peptide substrates. Phosphorylated substrates were detected with anti-phospho-Tyrosine antibody and quantified by fluoroimmunoassay with specific secondary antibody.
- the results shown in Part b demonstrate that the autophosphorylation of recombinant VEGFRl protein is enhanced by SMYD3.
- VEGFRl was separated on PAGE-SDS and subsequently transferred to nitrocellulose membrane. Immunoblot analysis was carried out with anti- phosphotyrosine or anti- VEGFRl antibody.
- the SMYD3 cDNA consists of 1622 nucleotides that contain an open reading frame of 1284 nucleotides as set forth in SEQ. ID. NO.:1.
- the open reading frame encodes a 428-amino acid protein with a zinc finger motif and a SET domain, as shown in SEQ. ID. NO.:2.
- the zinc finger domain extends from amino acid 49 to amino acid 87 and the SET (Su 3-9, Enhancer-of-zeste, Trihorrax) domain extends from amino acid 117 to amino acid 246.
- the subcellular localization of the SMYD3 protein is altered during cell cycle progression and by the density of cultured cells.
- the SMYD3 protein accumulates in the nucleus when cells are in middle to late S phase or cultured in sparse conditions.
- the SMYD3 protein localizes in the cytoplasm as well as in the nucleus when cells are in other phases of the cell cycle or grown in a dense condition.
- the present invention provides a method for determining the methyltransferase activity of SMYD3 for methylating a VEGFRl substrate.
- the method may be practiced by contacting an SMYD3 polypeptide, or a functional equivalent thereof having methyltransferase activity, with a VEGFRl protein, and assaying the methyltransferase activity of the contacted SMYD3 or its functional equivalent.
- the methyltransferase activity of SMYD3 corresponds to the degree of VEGFRl methylation. Accordingly, methyltransferase activity can be measured by detecting the methylation level of the VEGFRl substrate.
- the methyltransferase activity to be measured can be calibrated to methylation level of the VEGFRl peptide through correlation with a reference sample.
- a reference sample any biological sample having known methyltransferase activity may be used as the reference sample.
- the requisite calibration curve may be obtained through the serial dilution of purified SMYD3 peptide.
- a method for screening for modulators of methyltransferase activity is also provided.
- the present invention thus provides a method of screening for an agent that modulates SMYD3 methyltransferase activity.
- the method may be practiced by contacting an SMYD3 polypeptide, or a functional equivalent thereof having methyltransferase activity, with a VEGFRl protein, and assaying the methyltransferase activity of the contacted SMYD3 or its functional equivalent.
- An agent that modulates the methyltransferase activity of the SMYD3 or functional equivalent can be thereby identified.
- the term "functionally equivalent” means that the subject protein or polypeptide has the same or substantially the same methyltransferase activity as SMYD3.
- the protein catalyzes the methylation of a VEGFRl protein or a fragment of a VEGFRl protein that includes lysine 831. Whether a subject protein has the target activity can be routinely determined by the present invention.
- the methyltransferase activity can be determined by (a) contacting a polypeptide with a substrate (e.g., a VEGFRl protein or a fragment that includes lysine 831) and a co-factor (e.g., S-adenosyl-L-methionine) under conditions suitable for methylation of the substrate, and (b) detecting the methylation level of the substrate.
- a substrate e.g., a VEGFRl protein or a fragment that includes lysine 831
- a co-factor e.g., S-adenosyl-L-methionine
- VEGFRl peptide refers to full length VEGFRl proteins
- functional fragments include, but are not limited to, C-terminal fragment such as the fragment composed of amino acids 800 to 841 of SEQ ID NO: 4.
- Preferred fragments include the lysine residue at position 831.
- functional mutants include, but are not limited to, the following VEGFRl mutants that retain the methylation capacity of the full length VEGFRl protein: K819A, K819E and K819R.
- Methods for preparing proteins that are functional equivalents of a given protein are well known to those skilled in the art and include conventional methods of introducing mutations into the protein.
- one skilled in the art can prepare proteins functionally equivalent to the human SMYD3 protein by introducing an appropriate mutation in the amino acid sequence of the human SMYD3 protein using site-directed mutagenesis for example (Hashimoto-Gotoh, T. et al. (1995), Gene 152, 271-275; Zoller, MJ, and Smith, M. (1983), Methods Enzymol. 100, 468-500; Kramer, W. et al. (1984), Nucleic Acids Res. 12, 9441-9456; Kramer W, and Fritz HJ.
- An SMYD3 polypeptide useful in the context of the present invention includes those proteins having the amino acid sequences of the human SMYD3 protein in which one or more amino acids are mutated, provided the resulting mutated proteins are functional equivalents of the human SMYD3 protein, more particularly retain the methyltransferase activity of the human SMYD3 protein.
- the number of amino acids to be mutated in such a mutant is generally 20 amino acids or less, typically 10 amino acids or less, preferably 6 amino acids or less, and more preferably 3 amino acids or less.
- the SET-domains "NHSCXXN” and "GEELXXXY” are preferably conserved in the amino acid sequence of the mutated proteins ("X" indicates any amino acid).
- the SMYD3 polypeptide includes the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are substituted, deleted, or inserted, further wherein said polypeptide has a methyltransferase activity equivalent to that of the polypeptide having the amino acid sequence of SEQ ID NO: 2, further wherein the SET-domains "NHSCXXN" and "GEELXXXY” are conserved. More specifically, positions from 117 to amino acid 246 of the amino acid sequence of SEQ ID NO: 2 are preferably conserved.
- Mutated or modified proteins i.e., proteins having amino acid sequences modified by deleting, adding and/or replacing one or more amino acid residues of a certain amino acid sequence, are known to retain the biological activity of the original protein (Mark, D. F. et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, M. J. & Smith, M., Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al., Science (1984) 224, 1431-1433, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).
- the SMYD3 polypeptide is expected to retain its methyltransferase activity so long as it retains the SET-domains.
- the methods of the present invention can be performed using a polypeptide that comprises the amino acid sequence of positions 117 to 246 of the amino acid sequence of SEQ ID NO: 2, for example, a polypeptide comprising the amino acid sequence of positions 110 to 250 of the amino acid sequence of SEQ ID NO: 2 as shown in the Example.
- the amino acid residue to be mutated is preferably mutated into a different amino acid that allows the properties of the amino acid side-chain to be conserved (a process known as conservative amino acid substitution).
- properties of amino acid side chains include following groups. hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T)
- side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (F, H, Y, W).
- G, A, V, L, I, P a hydroxyl group containing side-chain
- S, T, Y a sulfur atom containing side-chain
- C, M sulfur atom containing side-chain
- D, N, E, Q carboxylic acid and amide containing side-chain
- R, K, H base containing side-chain
- F aromatic containing side-chain
- grouping of amino acids is also well known as mutational matrix (Taylor 1986, J, Theor. Biol. 119, 205-218, Sambrook, J. et al., Molecular Cloning 3rd ed. A7.6-A7.9, Cold Spring Harbor Lab. Press, 2001). Such grouping may be summarized as follows:
- Aromatic amino acids H, W, Y, F
- Hydrophobic amino acids H, W, Y, F, M, L, I, V, C, A, G, T, K
- Polar amino acids T, S, N, D, E, Q, R, K, H, W, Y
- Tiny amino acids A, G, S
- a protein in one or more amino acids residues are added to the amino acid sequence of human SMYD3 protein is a fusion protein containing the human SMYD3 protein.
- Fusion proteins include fusions of the human SMYD3 protein and other peptides or proteins, and are used in the present invention. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the human SMYD3 protein of the invention with DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins fused to the protein of the present invention.
- peptides that can be used as peptides to be fused to the SMYD3 protein include, for example, FLAG (Hopp, T. P. et al., Biotechnology (1988) 6, 1204-1210), 6xHis containing six His (histidine) residues, lOxHis, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, pi 8HIV fragment, T7-tag, HSV-tag, E- tag, SV40T antigen fragment, lck tag, alpha- tubulin fragment, B -tag, Protein C fragment, and the like.
- FLAG Hopp, T. P. et al., Biotechnology (1988) 6, 1204-1210
- 6xHis containing six His (histidine) residues lOxHis
- Influenza agglutinin (HA) Influenza agglutinin
- human c-myc fragment VSP-GP fragment
- pi 8HIV fragment T7-
- Fusion proteins can be prepared by fusing commercially available DNA, encoding the fusion peptides or proteins discussed above, with the DNA encoding the protein of the present invention and expressing the fused DNA prepared.
- the proteins used for the present invention include those that are encoded by DNA that hybridize with a whole or part of the DNA sequence encoding the human SMYD3 protein and that are functional equivalents of the human SMYD3 protein.
- These proteins include mammal homologues corresponding to the protein derived from human or mouse (for example, a protein encoded by a monkey, rat, rabbit and bovine gene).
- mammal homologues corresponding to the protein derived from human or mouse for example, a protein encoded by a monkey, rat, rabbit and bovine gene.
- tissues from skeletal muscle, testis, HCC, or colorectal tumors In isolating a cDNA highly homologous to the DNA encoding the human SMYD3 protein from animals, it is particularly preferable to use tissues from skeletal muscle, testis, HCC, or colorectal tumors.
- hybridization for isolating a DNA encoding a functional equivalent of the human SMYD3 protein can be routinely selected by a person skilled in the art.
- hybridization may be performed by conducting prehybridization at 68°C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68°C for 1 hour or longer.
- the following washing step can be conducted, for example, in a low stringent condition.
- a low stringency condition is, for example, 42°C, 2X SSC, 0.1% SDS, or preferably 50 0 C, 2X SSC, 0.1% SDS. More preferably, highly stringent conditions are used.
- a highly stringent condition includes, for example, washing 3 times in 2X SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in Ix SSC, 0.1% SDS at 37°C for 20 min, and washing twice in Ix SSC, 0.1% SDS at 50 0 C for 20 min.
- factors such as temperature and salt concentration can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency.
- a gene amplification method for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a protein that is functionally equivalent to the human SMYD3 protein, using a primer synthesized based on the sequence information of the DNA (SEQ ID NO: 1) encoding the human SMYD3 protein (SEQ ID NO: 2).
- PCR polymerase chain reaction
- “High homology” typically refers to the degree of identity between two optimally aligned sequences (either polypeptide or polynucleotide sequences).
- high homology or identity refers to homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 85%, 90%, 95%, 98%, 99%, or higher.
- the degree of homology or identity between two polypeptide or polynucleotide sequences can be determined by following the algorithm in "Wilbur, W. J. and Lipman, D. J. Proc. Natl. Acad. Sci. USA (1983) 80, 726-730".
- a protein useful in the context of the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it is a functional equivalent of human SMYD3 protein (SEQ ID NO: 2), it is useful in the present invention.
- the proteins useful in the context of the present invention can be prepared as recombinant proteins or natural proteins, by methods well known to those skilled in the art.
- a recombinant protein can be prepared by inserting a DNA encoding a protein of the present invention (for example, the DNA corresponding to the nucleotide sequence of SEQ ID NO: 1), into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the protein by subjecting the extract to chromatography, for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed, or by combining more than one of aforementioned columns.
- chromatography for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed, or by combining more than one of aforementioned columns.
- a protein useful in the context of the present invention when expressed within host cells (for example, animal cells and E. coli) as a fusion protein with glutathione-S-transferase protein or as a recombinant protein supplemented with multiple histidines, the expressed recombinant protein can be purified using a glutathione column or nickel column.
- host cells for example, animal cells and E. coli
- the expressed recombinant protein can be purified using a glutathione column or nickel column.
- a natural protein can be isolated by methods known to a person skilled in the art, for example, by contacting an affinity column, in which antibodies binding to the SMYD3 protein described below are bound, with the extract of tissues or cells expressing the protein of the present invention.
- the antibodies can be polyclonal antibodies or monoclonal antibodies.
- the methyltransferase activity of an SMYD3 polypeptide can be determined by methods known in the art.
- an SMYD3 polypeptide and a VEGFRl peptide substrate can be incubated with a labeled methyl donor, under suitable assay conditions.
- a labeled methyl donor include, but are not limited to, S-adenosyl-[methyl- 14 C]-L-methionine, and S-adenosyl-[methyl- 3 H] -L- methionine.
- Transfer of the radiolabel to the VEGFRl peptide can be detected, for example, by SDS-PAGE electrophoresis and fluorography.
- the VEGFRl peptides can be separated from the methyl donor by filtration, and the amount of radiolabel retained on the filter quantitated by scintillation counting.
- Other suitable labels that can be attached to methyl donors, such as chromogenic and fluorescent labels, and methods of detecting transfer of these labels to VEGFRl peptides, are known in the art.
- the methyltransferase activity of SMYD3 can be determined using an unlabeled methyl donor (e.g. S-adenosyl-L-methionine) and reagents that selectively recognize methylated VEGFRl peptides.
- methylated substrate can be detected using conventional immunological methods. Any immunological techniques that use an antibody to recognize a methylated substrate can be used for the detection.
- an antibody against methylated VEGFRl K831 e.g. anti-K831me2 may be used as the antibody.
- Such antibodies recognizing the methylation of VEGFRl, in particular, the methylation at K831 of VEGFRl are also provided by the present invention.
- ELISA or immunoblotting analysis using an antibodies recognizing methylated VEGFRl K831 may be suitable for the present invention.
- the methylation of VEGFRl at Lys 831 enhanced the phosphorylation of VEGFRl.
- the methylation level of VEGFRl may be estimated via phosphorylation of VEGFRl.
- the phosphorylation of VEGFRl may be detected using radiolabeled phosphate donor.
- an antibody that recognizes the phosphorylation site of VEGFRl may be used for estimating phosphorylation level of VEGFRl.
- the above-described characteristic of the VEGFRl peptide to be phosphorylated by SMYD3 may be utilized for measuring the methyl- transferase activity of SMYD3 and other H3K4 methy transferases.
- Such methods for measuring the methyltransferase activity of a peptide comprise the steps of: a. contacting a H3K4 methyltransferase with a VEGFRl peptide to be methylated and a cofactor under the condition capable of methylation of the VEGFRl peptide; b. detecting the methylation level of the VEGFRl peptide; and c. measuring the methyltransferase activity by correlating the methylation level of step (b) with the methyltransferase activity.
- the H3K4 methyltransferase may be any polypeptide so long as it has the ability to transfer a methyl group on the VEGFRl peptide including, but are not limited to, the aforementioned SMYD3 polypeptides.
- the steps of this method may be performed using the same VEGFRl peptide, reaction conditions (addition of cofactors, enhancing agents, etc.), detection means and such as the above explained method for identifying a compound that modulates methylation of VEGFRl by SMYD3.
- the present invention further provides a method of screening for a compound for treating a cancer which over expresses SMYD3, said method including the step of identifying a test compound that modulates methylation using the method(s) described above, and selecting the test compound that decreases the methylation level of a substrate to be methylated as compared to a control methylation level detected in the absence of the test compound.
- the screening may also be performed by (a) contacting a VEGFRl peptide or fragment comprising SMYD3 binding region thereof and an SMYD3 polypeptide or fragment comprising VEGFRl binding region thereof under a condition that allows the binding of the VEGFRl peptide and the SMYD3 polypeptide and in the presence of a test compound; and (b) selecting the test compound that inhibits the binding between the or fragment comprising SMYD3 binding region thereof and an SMYD3 polypeptide or fragment comprising VEGFRl binding region thereof as a candidate compound for treating cancer.
- a cancer which over expresses SMYD3 includes cancers of which the expression level of SMYD3 is high compare to nomal region of same organ of the cancer.
- the present inventors have revealed over expression of SMYD3 in various cancers, e.g.
- a cancer which over expresses SMYD3 may be selected from the group consisting of colorectal cancer, hepatocellular carcinoma, bladder cancer and breast cancer.
- a test compound can be determined to inhibit the binding of the VEGFRl peptide and the SMYD3 polypeptide by comparing the binding level of the VEGFRl peptide and the SMYD3 polypeptide with that detected in the absence of the compound, and selecting a compound that reduced the binding level of the VEGFRl peptide and the SMYD3 polypeptide.
- Any VEGFRl peptide and SMYD3 polypeptide including equivalents thereof may be used for this screening so long as they retain their binding ability to each other.
- fragments comprising SMYD3 binding region of VEGFRl peptide may be used as the peptide equivalent to VEGFRl.
- such peptide equivalent to VEGFRl may comprises the amino acid sequence of positions 800-1000 of the amino acid sequence of SEQ ID NO: 4, preferably.
- fragments comprising VEGFRl binding region of SMYD3 peptide may be used as the peptide equivalent to SMYD3.
- such peptide equivalent to SMYD3 may comprises the amino acid sequence of positions 100-250 of the amino acid sequence of SEQ ID NO: 2.
- inhibit the binding between two proteins refers to at least reducing binding between the proteins.
- the percentage of binding pairs in a sample will be decreased compared to an appropriate (e.g., not treated with test compound or from a non-cancer sample, or from a cancer sample) control.
- the reduction in the amount of proteins bound may be, e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 25%, 10%, 5%, 1% or less (e.g., 0%), than the pairs bound in a control sample.
- any method that determines the ability of a test compound to interfere with such association is suitable for use with the present invention.
- competitive and non-competitive inhibition assays in an ELISA format may be utilized. Control experiments should be performed to determine maximal binding capacity of system (e.g., contacting bound VEGFRl peptide with SMYD3 polypeptide, and determining the amount of protein bound to VEGFRl peptide, or vice versa).
- identifying compounds that inhibit the binding of the present invention many methods well known by one skilled in the art can be used. Such identification can be carried out as an in vitro assay system, for example, in a cellular system.
- VEGFRl peptide or the SMYD3 polypeptide partner is bound to a support, and the other protein is contacted together with a test compound thereto. Next, the mixture is incubated, washed and the other protein bound to the support is detected and/or measured.
- Example of supports that may be used for binding the proteins include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercially available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used. When using beads, they may be filled into a column. Alternatively, the use of magnetic beads is also known in the art, and enables to readily isolate proteins bound on the beads via magnetism.
- binding of a protein to a support may be conducted according to routine methods, such as chemical bonding and physical adsorption.
- a protein may be bound to a support via antibodies specifically recognizing the protein.
- binding of a protein to a support can also be conducted by means of interacting molecules, such as the combination of avidin and biotin.
- the binding between proteins is carried out in buffer, for example, but are not limited to, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding between the proteins.
- a biosensor using the surface plasmon resonance phenomenon may be used as a means for detecting or quantifying the bound protein.
- the interaction between the proteins can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between the VEGFRl peptide and the SMYD3 polypeptide using a biosensor such as BIAcore.
- either the VEGFRl peptide or the SMYD3 polypeptide may be labeled, and the label of the bound protein may be used to detect or measure the bound protein. Specifically, after pre-labeling one of the proteins, the labeled protein is contacted with the other protein in the presence of a test compound, and then bound proteins are detected or measured according to the label after washing.
- Labeling substances such as radioisotope (e.g., 3 H, 14 C, 32 P, 33 P, 35 S, 125 1, 131 I), enzymes (e.g., alkaline phosphatase, horseradish peroxidase, beta-galactosidase, beta- glucosidase), fluorescent substances (e.g., fluorescein isothiosyanete (FITC), fluorescein, Texas red, green fluorescent protein, and rhodamine), magnetic beads (e.g., DYNAB EADSTM), calorimetric labels (e.g., colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads), and biotin/avidin, may be used for the labeling of a protein in the present method.
- radioisotope e.g., 3 H, 14 C, 32 P, 33 P, 35 S, 125 1, 131 I
- enzymes
- Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241.
- the present invention is not restricted thereto and any label detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means may be used.
- the detection or measurement can be carried out by liquid scintillation.
- proteins labeled with enzymes can be detected or measured by adding a substrate of the enzyme to detect the enzymatic change of the substrate, such as generation of color, with absorptiometer.
- the bound protein may be detected or measured using fluorophotometer.
- the binding in the present screening method can be also detected or measured using an antibody against the VEGFRl peptide or the SMYD3 polypeptide.
- an antibody against the VEGFRl peptide or the SMYD3 polypeptide For example, after contacting the VEGFRl peptide immobilized on a support with a test compound and the SMYD3 polypeptide, the mixture is incubated and washed, and detection or measurement can be conducted using an antibody against the SMYD3 polypeptide.
- the SMYD3 polypeptide may be immobilized on a support, and an antibody against the VEGFRl peptide may be used as the antibody.
- the antibody is preferably labeled with one of the labeling substances mentioned above, and detected or measured based on the labeling substance.
- the antibody against the SMYD3 polypeptide or the VEGFRl peptide may be used as a primary antibody to be detected with a secondary antibody that is labeled with a labeling substance.
- the antibody bound to the protein in the screening of the present invention may be detected or measured using protein G or protein A column.
- a two-hybrid system utilizing cells may be used ("MATCHMAKER Two- Hybrid system", “Mammalian MATCHMAKER Two-Hybrid Assay Kit”, “MATCHMAKER one-Hybrid system” (Clontech); “HybriZAP Two-Hybrid Vector System” (Stratagene); the references “Dalton and Treisman, Cell 1992, 68: 597-612", “Fields and Sternglanz, Trends Genet 1994, 10: 286-92").
- the SMYD3 polypeptide is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells.
- the VEGFRl peptide is fused to the VP 16 or GAL4 transcriptional activation region and also expressed in the yeast cells in the existence of a test compound.
- the VEGFRl peptide may be fused to the SRF-binding region or GAL4-binding region, and the SMYD3 polypeptide to the VP 16 or GAL4 transcriptional activation region.
- a reporter gene for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used besides HIS3 gene.
- the binding level between the SMYD3 polypeptide and the VEGFRl peptide can be also measured as any change occurring after the binding of the SMYD3 polypeptide and the VEGFRl peptide.
- screening can be performed by contacting a test compound with a cell that expresses the SMYD3 polypeptide and the VEGFRl peptide.
- the suppression of cell proliferation may be detected to determine the influence of a test compound on the binding of the SMYD3 polypeptide and the VEGFRl peptide.
- a competitive ELISA format may include the SMYD3 polypeptide (or the VEGFRl peptide) bound to a solid support.
- the bound SMYD3 polypeptide (or the VEGFRl peptide) would be incubated with the VEGFRl peptide (or the SMYD3 polypeptide) and a test compound. After sufficient time to allow the test compound and/or the VEGFRl peptide (or the SMYD3 polypeptide) to bind SMYD3 polypeptide (or the VEGFRl peptide), the substrate would be washed to remove unbound material.
- the amount of the VEGFRl peptide bound to the SMYD3 polypeptide is then determined. This may be accomplished in any of a variety of ways known in the art, for example, by using the VEGFRl peptide (or the SMYD3 polypeptide) species tagged with a detectable label, or by contacting the washed substrate with a labeled antibody against the VEGFRl peptide (or the SMYD3 polypeptide).
- the amount of the VEGFRl peptide (or the SMYD3 polypeptide) bound to the SMYD3 polypeptide (or the VEGFRl peptide) will be inversely proportional to the ability of the test compound to interfere with the association of the VEGFRl peptide to the SMYD3 polypeptide.
- Protein including but not limited to, antibody, labeling is described in Harlow & Lane, Antibodies, A Laboratory Manual (1988).
- the VEGFRl peptide (or the SMYD3 polypeptide) is labeled with an affinity tag.
- the labeled the VEGFRl peptide (or the SMYD3 polypeptide) is then incubated with a test compound and the SMYD3 polypeptide (or the VEGFRl peptide), then immunoprecipitated.
- the immunoprecipitate is then subjected to Western blotting using an antibody against the SMYD3 polypeptide (or the VEGFRl peptide).
- the amount of the SMYD3 polypeptide (or the VEGFRl peptide) found associated with the VEGFRl peptide (or the SMYD3 polypeptide) is inversely proportional to the ability of the test compound to interfere with the association of the VEGFRl peptide and the SMYD3 polypeptide.
- Non-competitive binding assays may also find utility as an initial screen for testing agent libraries constructed in a format that is not readily amenable to screening using competitive assays, such as those described herein.
- An example of such a library is a phage display library (see, e.g., Barret et al., Anal Biochem 1992, 204: 357-64).
- Phage libraries find utility in being able to produce quickly working quantities of large numbers of different recombinant peptides. Phage libraries do not lend themselves to competitive assays of the invention, but can be efficiently screened in a non-competitive format to determine which recombinant peptide test compounds bind to the VEGFRl peptide or the SMYD3 polypeptide. Test compounds identified as binding can then be produced and screened using a competitive assay format.
- An exemplary non-competitive assay would follow an analogous procedure to the one described for the competitive assay, without the addition of one of the components (the VEGFRl peptide or the SMYD3 polypeptide).
- the ability of test agent to bind both the VEGFRl peptide and the SMYD3 polypeptide needs to be determined for each candidate.
- binding of the test compound to immobilized the VEGFRl peptide may be determined by washing away unbound test compound; eluting bound test compound from the support, followed by analysis of the eluate; e.g., by mass spectroscopy, protein determination (Bradford or Lowry assay, or Abs. at 280nm determination.).
- the elution step may be eliminated and binding of test compound determined by monitoring changes in the spectroscopic properties of the organic layer at the support surface.
- Methods for monitoring spectroscopic properties of surfaces include, but are not limited to, absorbance, reflectance, transmittance, birefringence, refractive index, diffraction, surface plasmon resonance, ellipsometry, resonant mirror techniques, grating coupled waveguide techniques and multipolar resonance spectroscopy, all of which are known to those of skill in the art.
- a labeled test compound may also be used in the assay to eliminate need for an elution step. In this instance, the amount of label associated with the support after washing away unbound material is directly proportional to test agent binding.
- a number of well-known robotic systems have been developed for solution phase chemistries. These systems include automated workstations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and many robotic systems utilizing robotic arms (Zymate II, Zymark Corporation, Hopkinton, Mass.; Orca, Hewlett Packard, Palo Alto, Calif.), which mimic the manual synthetic operations performed by a chemist. Any of the above devices are suitable for use with the present invention. The nature and implementation of modifications to these devices (if any) so that they can operate as discussed herein will be apparent to persons skilled in the relevant art.
- VEGFRl peptide substrate can conveniently be immobilized on a solid support, such as a multiwell plate, slide or chip.
- the methylated product can be detected on the solid support by the methods described above.
- the methyltransferase reaction can take place in solution, after which the VEGFRl peptide can be immobilized on a solid support, and the methylated product detected.
- the solid support can be coated with strep tavidin and the VEGFRl labeled with biotin, or the solid support can be coated with anti- VEGFRl antibodies.
- the skilled person can determine suitable assay formats depending on the desired throughput capacity of the screen.
- the present invention also contemplates the use of partial peptides of a protein of the present invention.
- a partial peptide has an amino acid sequence specific to the SMYD3 protein and preferably consists of less than about 400 amino acids, usually less than about 200 and often less than about 100 amino acids, and at least about 7 amino acids, preferably about 8 amino acids or more, and more preferably about 9 amino acids or more.
- the partial peptide can be used, for example, in the screening for an agent or compound that binds to the SMYD3 protein, and the screening for inhibitors of the binding between SMYD3 and a co-factor thereof, such as, for example, SAM. In the context of such screening methods, a partial peptide containing the SET-domain is preferred.
- a partial peptide useful in the context of the present invention can be produced by genetic engineering, by known methods of peptide synthesis, or by digesting the protein of the invention with an appropriate peptidase.
- peptide synthesis for example, solid phase synthesis or liquid phase synthesis may be used.
- a partial peptide of SMYD3 preferably includes the SET- domain "NHSCXXN" and/or "GEELXXXY".
- test agent can be used. Examples include, but are not limited to, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts from marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds and natural compounds.
- the test agents or compounds of the present invention can also be obtained using combinatorial library methods known in the art, including, but not limited to, (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring decon volution, (4) the "one-bead one-compound” library method and (5) synthetic library methods using affinity chromatography selection.
- a test compound of the present invention may be a single compound or a combination of compounds. When a combination of compounds is used in the screening methods of the invention, the compounds may be contacted sequentially or simultaneously.
- Test agents or compounds useful in the assays described herein can also take the form of antibodies that specifically bind to SMYD3 or partial SMYD3 peptides that lack methyltransferase activity.
- antibodies e.g., monoclonal antibodies
- An agent or compound isolated by the screening methods of the present invention is a candidate for drugs that inhibit the methyltransferase activity of SMYD3 and, thus, can be applied to the treatment or prevention of hepatocellular, colorectal, bladder and/ or breast cancer.
- agents or compounds in which a part of the structure of the agent or compound inhibiting the methyltransferase activity of SMYD3 is converted by addition, deletion and/or replacement are also included in the agents and compounds obtainable by the screening methods of the present invention.
- the agents or compounds that inhibit the methyltransferase activity of SMYD3 can be either partial peptides that lack the methyltransferase activity of SMYD3 or can be antibodies against SMYD3.
- the term "antibody” refers to an immunoglobulin molecule having a specific structure, that interacts (i.e., binds) only with the antigen that was used for synthesizing the antibody or with an antigen closely related thereto.
- an antibody may be a fragment of an antibody or a modified antibody, so long as it binds to the proteins encoded by SMYD3 gene.
- the antibody fragment may be Fab, F(ab') 2 , Fv, or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston J. S. et al. Proc. Natl. Acad. Sci. U.S.A. 85:5879-5883 (1988)). More specifically, an antibody fragment may be generated by treating an antibody with an enzyme, such as papain or pepsin. Alternatively, a gene encoding the antibody fragment may be constructed, inserted into an expression vector, and expressed in an appropriate host cell (see, for example, Co M. S. et al. J. Immunol. 152:2968-2976 (1994); Better M.
- An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG).
- PEG polyethylene glycol
- the present invention provides such modified antibodies.
- the modified antibody can be obtained by chemically modifying an antibody. Such modification methods are conventional in the field.
- an antibody may take the form of a chimeric antibody having a variable region derived from a nonhuman antibody and a constant region derived from a human antibody, or a humanized antibody, composed of a complementarity determining region (CDR) derived from a nonhuman antibody, a frame work region (FR) derived from a human antibody and a constant region.
- CDR complementarity determining region
- FR frame work region
- Humanization can be performed by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody (see e.g., Verhoeyen et al., Science 239:1534-1536 (1988)). Accordingly, such humanized antibodies are chimeric antibodies, wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- Fully human antibodies composed of human variable regions in addition to human framework and constant regions, can also be used. Such antibodies can be produced using various techniques that are known in the art. For example, in vitro methods involving the use of recombinant libraries of human antibody fragments displayed on bacteriophage may be used (e.g., Hoogenboom & Winter, J. MoI. Biol. 227:381 (1991)). Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. This approach is described, e.g., in U.S. Patent Nos. 6,150,584, 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016.
- the isolated agent or compound can be directly administered or can be formulated into a dosage form using known pharmaceutical preparation methods.
- the drugs can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules, or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid.
- the agents or compounds can be mixed with pharmaceutically acceptable carriers or media, specifically, sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation.
- pharmaceutically acceptable carriers or media specifically, sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation.
- the amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
- additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; and flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry.
- a liquid carrier such as an oil, can also be further included in the above ingredients.
- Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
- Physiological saline, glucose, and other isotonic liquids including adjuvants can be used as aqueous solutions for injections.
- adjuvants such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride
- Suitable solubilizers such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non-ionic surfactants, such as Polysorbate 80 (TM) and HCO-50.
- Sesame oil or soy-bean oil can be used as a oleaginous liquid and may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizer and may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain- killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol and phenol; and an anti-oxidant.
- the prepared injection may be filled into a suitable ampoule.
- Methods well known to one skilled in the art may be used to administer a pharmaceutical composition of the present invention to patients, for example as intraarterial, intravenous, or percutaneous injections and also as intranasal, intramuscular or oral administrations.
- the dosage and method of administration vary according to the body- weight and age of a patient and the administration method; however, one skilled in the art can routinely select a suitable method of administration.
- the agent or compound of interest is encodable by a DNA
- the DNA can be inserted into a vector for gene therapy and the vector administered to a patient to perform the therapy.
- the dosage and method of administration vary according to the body- weight, age, and symptoms of the patient but one skilled in the art can suitably select them.
- a typical dose ranges from about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg).
- the present invention further provides a method for treating cancer in a subject, such as hepatocellular carcinoma, colorectal carcinoma, bladder and breast cancer.
- Administration can be prophylactic or therapeutic to a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant the methyltransferase activity of SMYD3.
- the method includes decreasing the function of SMYD3 in a suitable cancer cell. Function can be inhibited through the administration of an agent or compound obtained by a screening method of the present invention.
- the present invention includes pharmaceutical, or therapeutic, compositions containing one or more therapeutic agents or compounds described herein.
- the present invention also provides use of one or more therapeutic agents or compounds described herein for manufacturing a pharmaceutical, or therapeutic, compositions for treating and/or preventing of cancer, more particularly hepatocellular carcinoma, colorectal carcinoma, bladder and breast cancer.
- Pharmaceutical formulations may include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration, or for administration by inhalation or insufflation.
- the formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. All such pharmacy methods include the steps of bringing into association the active compound with liquid carriers or finely divided solid carriers or both as needed and then, if necessary, shaping the product into the desired formulation.
- compositions suitable for oral administration may conveniently be presented as discrete units, such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; or as a solution, a suspension or as an emulsion.
- the active ingredient may also be presented as a bolus electuary or paste, and be in a pure form, i.e., without a carrier.
- Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, dis integrant or wetting agents.
- a tablet may be made by compression or molding, optionally with one or more formulational ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free- flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art. Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
- the tablets may optionally be formulated so as to provide slow or controlled release of the active ingredient therein.
- Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- the formulations may be presented in unit dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline, water-for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion.
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
- Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter or polyethylene glycol.
- Formulations for topical administration in the mouth include lozenges that contain the active ingredient in a flavored base such as sucrose and acacia or tragacanth, and pastilles that contain the active ingredient in a base such as gelatin and glycerin or sucrose and acacia.
- the compounds obtained by the invention may be used as a liquid spray or dispersible powder or in the form of drops. Drops may be formulated with an aqueous or non-aqueous base and may also include one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays are conveniently delivered from pressurized packs.
- the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray.
- Pressurized packs may include a suitable propellant such as dichlorodi- fluoromethane, trichlorofluoromethane, dichiorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- the compounds may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch.
- the powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
- compositions adapted to give sustained release of the active ingredient, may be employed.
- the pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
- formulations of the present invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents.
- Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, of the active ingredient.
- the compositions may be administered orally or via injection at a dose of from about 0.1 to about 250 mg/kg per day.
- the dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day.
- Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple of the same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg.
- the pharmaceutical composition preferably is administered orally or by injection (intravenous or subcutaneous), and the precise amount administered to a subject will be the responsibility of the attendant physician.
- the dose employed will depend upon a number of factors, including the age and sex of the subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity.
- the present invention further provides a kit for detecting for the ability of a test compound to regulate methylation of VEGFRl, said kit including the following components: a. an SMYD3 polypeptide having methyltransferase activity selected from the group consisting of: i. a polypeptide having the amino acid sequence of SEQ ID NO: 2; ii. a polypeptide having the amino acid sequence of SEQ ID NO: 2 wherein one or more amino acids are substituted, deleted, or inserted, further wherein said polypeptide has a methyltransferase activity equivalent to the polypeptide having the amino acid sequence of SEQ ID NO: 2; iii.
- polypeptide that includes the amino acid sequence of positions 117 to 246 of the amino acid sequence of SEQ ID NO: 2, wherein said polypeptide has a methyltransferase activity equivalent to the polypeptide having the amino acid sequence of SEQ ID NO: 2; b. a VEGFRl peptide capable of being methylated by the polypeptide of (a), and c. a cofactor for the methylation of the VEGFRl peptide.
- preferred VEGFRl peptides include the polypeptide composed of the amino acid sequence of SEQ ID NO: 4, or a functional mutant or fragment thereof.
- Preferred fragments include, but are not limited to, a polypeptide comprising or consisting of the amino acid sequence of positions 800 to 841 of the amino acid sequence of SEQ IN NO: 4, or polypeptides comprising the lysine 831 of VEGFRl.
- a preferred cofactor is S-adenosyl homocysteine hydrolase (SAHH).
- SAHH S-adenosyl homocysteine hydrolase
- the kit of the present invention may further include a reagent for detecting methylated VEGFRl peptide.
- an antibody that recognizes methylated VEGFRl peptide can be used as the detection reagent.
- Instructions e.g., written, tape, VCR, CD-ROM, etc.
- the assay format of the kit is a methyltransferase assay or binding assay known in the art.
- HEK293 and 293T Human embryonic kidney cell lines
- SW480 human colon cancer cell line
- ATCC American Type Culture Collection
- SNU423 HCC cells and MCF7 breast cancer cells were kindly provided from the Korea cell-line bank and the Cancer Institute of the Japanese Foundation for Cancer Research, respectively. All cell lines were grown in monolayers in appropriate media.
- Plasmids expressing SMYD3 were prepared as described previously in the literature (Hamamoto R et al., S Nature cell biology 2004, 6(8): 731-40.). The present inventors also prepared plasmids expressing HA-tagged or 3xFlag-tagged VEGFRl by cloning various RT-PCR products containing either wild type or deleted forms of VEGFRl into an appropriate site of pCMV-HA (Clutch, Palo Alto, CA), p3xFlag-CMV14 (sigma), or pGEX6P-3 vector (Amersham Biosciences). RT-PCR experiments were carried out using sets of primers (Table 1). Mutant VEGFRl plasmids containing sub- stitution of amino acid sequence were generated using Quickchange II XL Site- directed Mutagenesis kit according to the supplier's protocol (Strata gene, La Jolla, CA).
- the present inventors transfected cultured cells with the mammalian plasmids using FuGENETM 6 reagent according to the supplier's protocol (Roche, Indianapolis, IN). Recombinant GST-fused VEGFRl protein was purified from Escherichia coli, BL21 bacterial cells using Glutathione Sepharose 4B (Amersham Biosciences). Primers used in the instant Examples are set forth below;
- VEGFRl-K819A(F) CTCCCTTATGATGCCAGCGCGTGGGAGTTTGCCCGGGAG 17
- VEGFRl-K819A(R) CTCCCGGGCAAACTCCCACGCGCTGGCATCATAAGGGAG 18
- VEGFRl-K83IA(F) GACTTAAACTGGGCGCATCACTTGGAAGAGGGGCTTTTGG 19
- VEGFRl-K83IA(R) CCAAAAGCCCCTCTTCCAAGTGATGCGCCCAGTTTAAGTC 20
- VEGFRl-K819E(F) CTCCCTTATGATGCCAGCGAGTGGGAGTTTGCCCGGGAG 21
- VEGFRl-K819E(R) CTCCCGGGCAAACTCCCACTCGCTGGCATCATAAGGGAG 22
- VEGFRl-K83IE(R) CCAAAAGCCCCTCTTCCAAGTGATTCGCCCAGTTTAAGTC 24
- VEGFRl-K819R(F) CTCCCTTATGATGCCAGCCGGTGGGAGTTTGCCCGGGAG 25
- VEGFR1--K819R(R) CTCCCGGGCAAACTCCCACCGGCTGGCATCATAAGGGAG 26
- VEGFRl-K83IR(R) CCAAAAGCCCCTCTTCCAAGTGATCGGCCCAGTTTAAGTC 28
- HA-VEGFRl(F) CGGAATTCACCCAGATGAAGTTCCTTTGGATGAG 29 flag-SMYD3-wt(F) AAGCTTGCGGCCGCGATGGAGCCGCTGAAGGTGGAAAAG 30 flag-SMYD3-wt(R) GGTACCTCTAGATTAGGATGCTCTGATGTTGGCGTC 31 flag-VEGFRl#l(R) GGGGTACCTCAAATCAGATCTTCCATAGTGATGGGCTC 32 flag-VEGFRl#2(R) GGGGTACCTCAAGCTGAAATACTTTCCTTGAAGAAGTC 33 flag-VEGFRl#3(R) GGGGTACCCTAGATGGGTGGGGTGGAGTACAGG 34 flag-SMYD3-N20(F) CGGAATTCCGCCGTGACCCCGCTGGCGCCCCGGAG 35 flag-SMYD3-N20(R) GGGGTACCTTAGGATGCTGGCGTC 36 flag-SMYD3-D2(F)
- 293T cells were transfected with plasmids expressing Flag-tagged wild-type SMYD3 (P3XFLAG-CMV-SMYD3).
- Tagged-SMYD3 protein was purified by immuno- precipitation using anti-Flag antibody.
- Recombinant SMYD3 protein was prepared in Sf9 cells using Baculovirus system (Invitrogen, Carlsbad, CA). In vitro MTase assay was performed with a slight modification as described elsewhere (Hamamoto R et al., S Nature cell biology 2004, 6(8): 731-40.).
- SMYD3 protein was mixed with 1 meg of recombinant his tone H3, or VEGFR-I protein in the presence of 2 micro Ci of [methyl- ⁇ ] -labeled S-adenosyl-L-methionine (SAM, Amersham Biosciences) as methyl donor with or without S-(5'-Adenosyl)-L-homocysteine hydrolase (SAHH; Sigma) in methyltransferase buffer (50 mM Tris-HCl pH 8.5, 100 mM NaCl, 10 mM DTT), and was incubated at 30 degrees Celsius for 1 h.
- SAM S-adenosyl-L-methionine
- SAHH S-(5'-Adenosyl)-L-homocysteine hydrolase
- Labeled protein was measured by liquid scintillation counter or detected after SDS-PAGE by fluorography.
- In vitro kinase assay was carried out using GST-fused VEGFRl and HTScanTM VEGFRl Kinase Assay Kit according to the supplier's protocol (Cell Signaling, Danvers, MA). Phosphorylation of the substrates was quantified by 615 nm fluorescence emission using Time-Resolved Plate Reader. (Perkin-Elmer, Wellesley, MA).
- VEGFRl In vivo methylation of VEGFRl was analyzed according to the method described by Liu and Dreyfuss (Liu Q and Dreyfuss G., Molecular and cellular biology 1995, 15(5): 2800-8.) with slight modifications. Briefly, HEK293 cells expressing HA-tagged VEGFRl were incubated with 100 mcg/ml of cycloheximide at 37 degrees Celsius for 30 min, and then further maintained in medium containing 10 micro Ci/ml of L- [methyl- ⁇ ] methionine for 3 h. VEGFRl was precipitated with anti-HA antibody from the cell extract, separated by SDS-PAGE, and subsequently analyzed by BAS imaging system (BAS-TR2040, FUJI) or by immunoblot analysis.
- BAS imaging system BAS-TR2040, FUJI
- RNA interference [0109]
- RNAi experiments were performed with double- strand oligonucleotides of SMYD3-specific or control siRNAs that were purchased from Dharmacon (Chicago, IL).
- IxIO 5 of HEK293-SMYD3 cells were transfected with each siRNA at a final concentration of 100 nM using Oligofectamine. 48 h after transfection, proteins were extracted from the cells, and subjected to western blot analysis.
- Example 1 SMYD3 methylates VEGFRl in vitro
- VEGFRl was investigated herein as a candidate methylation target of SMYD3 using an in vitro MTase assay.
- the inventors prepared recombinant proteins of three cytoplasmic regions of VEGFRl for the substrates, VEGFR1#1 (codons 800-1000), VEGFR1#2 (codons 1000-1200) and VEGFR1#3 (codons 1200-1338).
- SMYD3 or control protein was immunoprecipitated with anti-Flag antibody from HEK293 cells transfected with Flag-tagged SMYD3 or mock plasmids, respectively.
- VEGFR1#1 was significantly methylated in vitro by SMYD3 compared to control protein (Fig. Ia). However, no methylation was observed in VEGFR1#2 or VEGFR1#3, suggesting that VEGFR1#1 contained the methylated residues. Approximately three-fold higher methylation of VEGFR1#1 was detected as compared to recombinant histone H3 in vitro (data not shown).
- Example 2 VEGFRl lysine 831 is methylated by SMYD3
- lysines within this region were investigated. It was determined that lysines 819, 828, 831, and 840, are conserved among VEGFRl orthologues in other species (data not shown).
- K/R-S/T/A-K is a consensus methylation motif of histone methy transferase SET7/9 (Couture JF et al., Nat Struct MoI Biol 2006, 13(2): 140-6.)
- other target lysines of histone methyltransferases such as p53 K370, histone H3K4 and H3K27 were not flanked by K/ R-S/T/A-K but SAT-K-X or X-K-S (Fig. 2a). Therefore, lysines 819 and 831 that matched these motifs and were conserved in other species were the focus of the instant assays.
- FIG. 2b An in vitro MTase assay was performed using wild type and mutant VEGFRl-Nl protein containing a substitution of the lysines to alanine (Fig. 2b). Although the assay showed methylated band in wild type and K819A mutant, K831A mutant did not demonstrate any methylated band (Fig. 2b). Additional mutant proteins in which the VEGFRl K831 is substituted for other amino acids did not show methylation as well (Fig. 2c). To confirm the methylation of lysine 831 in vivo, methylation-specific antibody against the lysine (anti-K831me2) was prepared. In vitro MTase assay confirmed the methylated lysine 831 of recombinant VEGFRl by fluorogram as well as western blot analysis with the anti-K831me2 antibody (Fig. 2d).
- an in vivo methylation assay was carried out using HEK293 cells expressing Flag-tagged SMYD3 (293-SMYD3) stably and control cells (293-Mock).
- the cells were transfected with HA-tagged VEGFRl, and subsequently incubated with L-[methyl- 3 H] methionine in the presence of protein synthesis inhibitors.
- Immunoprecipitants of the cells with anti-HA antibody were separated by PAGE-SDS to examine the methylated VEGFRl by fluoroimager.
- augmented methylation of VEGFRl was detected in the precipitants from 293-SMYD3 cells compared to that from 293-Mock cells (Fig. 2e).
- im- munoblot analysis of the precipitants with anti-K831me2 antibody confirmed elevated methylation of lysine 831 compared to control cells (Fig. 2f).
- SMYD3-dependent methylation 293-SMYD3 cells were treated with SMYD3-siRNA or control siRNAs. Immunoblot analysis with anti-SMYD3 antibody showed that SMYD3-siRNA effectively decreased expression of SMYD3 protein compared to control siRNA (Fig. 2g, upper panel). Correlated to the knockdown of SMYD3, the SMYD3-siRNA decreased methylation of K831 in the cells compared to the control siRNA (Fig. 2g, second panel), while VEGFRl expression was almost unchanged between the siRNAs (Fig. 2g, third panel). These data suggest that lysine 831 is methylated by SMYD3 in vivo.
- VEGFRl was methylated by SMYD3, the inventors investigated whether SMYD3 interacts with VEGFRl.
- the present inventors expressed Flag-tagged cytoplasmic regions of VEGFRl together with HA-tagged SMYD3 in HEK293 cells. Immunoprecipitation with anti-HA antibody, and subsequent immunoblot analysis with anti-Flag antibody disclosed that SMYD3 associates with VEGFR1#1 (codons 800-1000) but not VEGFR1#2 or VEGFR1#3 (Fig 3a). Consistently, IP with anti-Flag antibody and subsequent immunoblot analysis with anti-HA antibody corroborated the interaction between SMYD3 and VEGFR1#1 (Fig. 3a).
- the inventors To examine the interaction of endogenous SMYD3 with VEGFRl, the inventors additionally performed immunoprecipitation with anti-SMYD3 antibody using extracts from SNU423, SW480, or MCF7 cells that expressed both SMYD3 and VEGFRl. As a result, the inventors found that endogenous SMYD3 co-immunoprecipitates with VEGFRl by IP with anti- SMYD3 antibody (Fig. 3b), suggesting the in vivo interaction between SMYD3 and VEGFRl. Since antibodies against VEGFRl are not applicable for IP, the inventors did not carry out IP with the anti- VEGFRl antibodies.
- VEGFR 1 -# 1 contains lysine 831 that is methylated by SMYD3.
- the present inventors also searched a responsible region of SMYD3 for the binding using plasmids expressing wild type and three deleted forms of SMYD3; SMYD3-N20 (codons 20-428), SMYD3-delta 2 (codons 100-428) and SMYD3-delta 3 (codons 250-428).
- wild type SMYD3, SMYD3-N20, and SMYD3-delta 2 interacted with VEGFRl
- SMYD3-delta 3 lacking the SET domain did not (Fig. 3c).
- Additional plasmids expressing the SET domain (100-250) showed an association with the cytoplasmic domain of VEGFRl (Fig. 3d). This data suggests that the SET domain is responsible for the interaction.
- Example 5 Enhanced kinase activity of VEGFRl through its methylation by SMYD3
- Lysine 831 localizes within the kinase domain. Accordingly, the effect of VEGFRl methylation on its kinase activity was further explored.
- the kinase activity was investigated using a VEGFRl kinase assay kit that recognizes phospho-tyrosine of the substrates. Recombinant protein of the cytoplasmic region of VEGFRl was treated with 3 H-labeled SAM in the presence or absence of SMYD3, and subsequently analyzed the kinase activity. As expected, methylation of VEGFRl by SMYD3 was detected using 3 H-BAS system (data not shown).
- VEGFRl treated with SMYD3 showed significantly increased level of kinase activity compared to that with control (Fig. 4a). No phosphorylation was observed by SMYD3 alone without VEGFRl (data not shown).
- Western blot analysis with anti-phosphotyrosine antibody also revealed enhanced phosphorylation of recombinant human VEGFRl protein fused to the Fc region with recombinant human VEGF 165 protein in the presence of SMYD3 compared to the absence of SMYD3 (Fig. 4b).
- VEGFRl may affect the phosphorylation of VEGFRl -target molecules resulting in its enhanced signaling.
- VEGFRl is a novel non-histone target of SMYD3 histone methyltransferase. Modification of histone tails plays crucial roles in transcription, DNA repair, telomere maintenance, DNA replication, and chromosome segregation through in part alteration of chromatin structure. Recent molecular studies have disclosed the importance of lysine modifications in histone tails, and its dynamic regulation by histone methyltransferases and demethylases (Volkel P and Angrand PO, Biochimie 2007, 89(1): 1-20.). More than 17 histone methyltransferases have been identified so far, and these methyltransferases have specificity for their substrate.
- H3K4 is mono-di-or tri-methylated by SET7/9, Setl, MLLl, MLL2, MLL3, MLL4, MLL5, ASHl and SMYD3 (Kouzarides T, Cell 2007, 128(4): 693-705.; Volkel P and Angrand PO, Biochimie 2007, 89(1): 1-20.).
- SET7/9 also showed me thy transferase activity on lysine 189 of TAFlO (Kouskouti A et al., MoI Cell 2004, 14(2): 175-82.) and lysine 5 of TAF7 (human TATA box- binding protein-associated factors) (Couture JF et al., Nat Struct MoI Biol 2006, 13(2): 140-6.).
- methylation of non-histone protein may be also modulated by histone demethylases. Accordingly, it is expected that the methylated lysine 831 in VEGFR will be catalyzed by H3K4 demethylases such as LSDl (Shi Y et al., Cell 2004, 119(7): 941-53.) and JARIDl (Seward DJ et al., Nat Struct MoI Biol 2007, 14(3): 240-2.).
- VEGFRs are receptor tyrosine kinases (RTKs) composed of an extracellular ligand- binding domain, a transmembrane domain, a kinase domain, and a carboxyl-terminal region. All RTKs including VEGFRl contain an evolutionary conserved kinase domain containing GXGXXG, ATP binding site, HRDLA, a motif essential for catalysis, and one or two tyrosine autophosphorylation sites (Rahimi N, Experimental eye research 2006, 83(5): 1005-16.; Shibuya M, Journal of biochemistry and molecular biology 2006, 39(5): 469-78.).
- RTKs receptor tyrosine kinases
- SMYD3 induced methylation of lysine 831 results in an enhanced kinase activity of VEGFR-I in vitro. Although not wishing to be bound by theory, it is believed that this result stems from the fact that the lysine residue is located three amino-acid N-terminal from "GXGXXXG" motif in the kinase domain. Thus, methylation of lysine 831 may alter conformation of the kinase domain.
- methylation of VEGFRl may suppress the inhibitory domain to increase the kinase activity since the C-terminal region of the cytoplasmic domain of VEGFRl has an inhibitory role for the kinase activity (Shibuya M, Journal of biochemistry and molecular biology 2006, 39(5): 469-78.).
- methylated H3S10 recruits GCN5, PVAF, and p300
- methylated H3K9 recruits heterochromatin protein 1 (HPl)
- methylated H3K4 recruits CHDl, SNF2MSWI, WDR5, BPTF/NURF301, and ING2. Therefore, methylated lysine 831 may recruit methylation-specific protein complex(es) that may affect the kinase activity to VEGFRl.
- H3S 10 Phosphorylation of H3S 10 facilitates GCN5-mediated acetylation of H3K14, but inhibits methylation of H3K9 by SUV39H1. On the contrary, methylation of H3K9 suppresses phosphorylation of H3S10. Similarly, methylation of H4K3 facilitates acetylation of H4K8 and H4K12 (Zhang Y and Reinberg D, Genes & development 2001, 15(18): 2343-60.).
- VEGFR2 methylated lysine 831 in VEGFRl is in good agreement with this notion.
- kinase domain of VEGFR2 shared 70.1% amino acid similarity with that of VEGFRl, VEGFR2 was not methylated by SMYD3. This result is compatible with the conserved motifs, because the corresponding lysine to lysine 831 in VEGFR2 was not flanked by the consensus sequences. It is interesting to note that the VEGFR2 that showed high kinase activity as compared to VEGFRl was not methylated by SMYD3.
- SMYD3 may not affect the methylation of VEGFR2, it may affect phos- phorylation of VEGFR2 through the phosphorylation of VEGFRl, because these two molecules form a heterodimer (Rahimi N, Experimental eye research 2006, 83(5): 1005-16.; Shibuya M, Journal of biochemistry and molecular biology 2006, 39(5): 469-78.)- It is well known that phosphorylation of one receptor affects phosphorylation of the other receptor by intramolecular phosphorylation (Shibuya M, Journal of biochemistry and molecular biology 2006, 39(5): 469-78.).
- yeast Rkml a SET domain-containing enzyme, revealed methyltransferase activity to Rpl23a and Rpl23b (Porras-Yakushi TR et al., J Biol Chem 2007, 282(17): 12368-76.).
- the comparison of the target sequences around the methylated lysines suggested that N/P-P-K might be a target for the methylation. Therefore the flanking sequence of lysine may be different among methyltransferases.
- VEGFRl had been believed to be expressed exclusively on vascular endothelial cells, recent studies have shown VEGFRl expression in non-EC cells. VEGFRl is expressed in a wide range of human tissues including colon (Lesslie DP et al., Br J Cancer 2006, 94(11): 1710-7.; Fan F et al., Oncogene 2005, 24(16): 2647-53.; Duff SE et al., Eur J Cancer 2006, 42(1): 112-7.; Andre T et al., International journal of cancer 2000, 86(2): 174-81.), breast (Li YS et al., Pathology international 2006, 56(5): 256-61.; Wu Y et al., International journal of cancer 2006, 119(7): 1519-29.), pancreatic (Chung GG et al., Cancer 2006, 106(8): 1677-84.; Yang AD et al., Cancer Res 2006, 66(1): 46-
- VEGFRl is implicated in tumor growth and progression; exogenous expression of VEGFRl enhanced migration and invasion of pancreatic cancer cells.
- enhanced expression of SMYD3 may render invasive and/or metastasizing property to cancer cells.
- therapeutic approaches targeting VEGFRl methylation may benefit patients by inhibiting invasion and metastasis of cancer cells. Suppression of the methyltransferase activity of SMYD3 may help the inhibition of VEGFRl mediated cancer progression.
- SMYD3 methylates lysine 831 of VEGFRl in vitro and in vivo, and methylated VEGFRl has augmented its kinase activity compared to unmethylated VEGFRl. Therefore, cancer cells expressing abundant SMYD3 protein may show enhanced signal transduction pathway mediated by VEGFRl. This data may shed light on the novel regulatory mechanism of VEGFRl and the deregulated VEGFRl signaling that is involved in human carcinogenesis.
- the present invention is useful in the identification of additional molecular targets for prevention, diagnosis and treatment of various cancers, including colorectal cancer, hepatocellular carcinoma, bladder cancer and breast cancer. Furthermore, the data reported herein add to a comprehensive understanding of cancer, facilitate development of novel diagnostic strategies, and provide clues for identification of molecular targets for therapeutic drugs and preventative agents. Such information contributes to a more profound understanding of tumorigenesis, and provides indicators for developing novel strategies for diagnosis, treatment, and ultimately prevention of cancer.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08764111A EP2171082B1 (en) | 2007-06-14 | 2008-06-13 | Methods of identifying agents that modulate methylation of vegfr1 by smyd3 |
| US12/664,378 US8354223B2 (en) | 2007-06-14 | 2008-06-13 | Methods of identifying agents that modulate methylation of VEGFR1 by SMYD3 |
| JP2009550134A JP5272134B2 (ja) | 2007-06-14 | 2008-06-13 | Smyd3によるvegfr1のメチル化調整因子を同定する方法 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US94407107P | 2007-06-14 | 2007-06-14 | |
| US60/944,071 | 2007-06-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2008152816A1 true WO2008152816A1 (en) | 2008-12-18 |
Family
ID=40129430
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2008/001516 Ceased WO2008152816A1 (en) | 2007-06-14 | 2008-06-13 | Methods of identifying agents that modulate methylation of vegfr1 by smyd3 |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US8354223B2 (https=) |
| EP (1) | EP2171082B1 (https=) |
| JP (1) | JP5272134B2 (https=) |
| TW (1) | TW200909587A (https=) |
| WO (1) | WO2008152816A1 (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7767392B2 (en) | 2001-09-25 | 2010-08-03 | Oncotherapy Science, Inc. | Gene and protein relating to hepatocellular carcinoma and methods of use thereof |
| US7939254B2 (en) | 2005-02-28 | 2011-05-10 | Oncotherapy Science, Inc. | Breast cancer related gene ZNFN3A1 |
| US7968281B2 (en) | 2005-07-01 | 2011-06-28 | Oncotherapy Science, Inc. | Methods of modulating SMYD3 for treatment of cancer |
| US8221993B2 (en) | 2004-01-23 | 2012-07-17 | Onco Therapy Science, Inc. | Methods of detecting methyl transferase activity and methods of screening for methyl transferase activity modulators |
| JP2013506687A (ja) * | 2009-09-30 | 2013-02-28 | プレジデント アンド フェロウズ オブ ハーバード カレッジ | オートファジー促進遺伝子産物の変調によりオートファジーを変調する方法 |
| US8975229B2 (en) | 2009-06-11 | 2015-03-10 | Oncotherapy Science, Inc. | Methods for treating a disease caused by choroidal neovascularization |
| CN108624574A (zh) * | 2018-04-11 | 2018-10-09 | 苏州汇桢生物技术有限公司 | 一种s-腺苷同型半胱氨酸水解酶突变体及其应用和制法、核酸、表达载体及宿主细胞 |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101175862A (zh) | 2005-02-10 | 2008-05-07 | 肿瘤疗法科学股份有限公司 | 诊断膀胱癌的方法 |
| WO2017061957A1 (en) | 2015-10-09 | 2017-04-13 | Agency For Science, Technology And Research | Compounds for treatment of cancer and epigenetics |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003027143A2 (en) | 2001-09-25 | 2003-04-03 | Japan As Represented By The President Of The University Of Tokyo | Gene and protein relating to hepatocellular carcinoma |
| WO2005071102A2 (en) * | 2004-01-23 | 2005-08-04 | Oncotherapy Science, Inc. | Methods of detecting methyl transferase activity and methods of screening for methyl transferase activity modulators |
| WO2006085684A2 (en) | 2005-02-10 | 2006-08-17 | Oncotherapy Science, Inc. | Method of diagnosing bladder cancer |
| WO2006092958A1 (en) | 2005-02-28 | 2006-09-08 | Oncotherapy Science, Inc. | Breast cancer related gene znfn3a1 |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000017355A2 (en) | 1998-09-18 | 2000-03-30 | Incyte Pharmaceuticals, Inc. | Human cytoskeleton associated proteins |
| JP2003521231A (ja) | 1999-01-29 | 2003-07-15 | インサイト・ファーマスーティカルズ・インコーポレイテッド | 核酸結合タンパク質 |
| JP2005503760A (ja) | 2001-01-24 | 2005-02-10 | プロテイン デザイン ラブス, インコーポレイテッド | 乳癌の診断方法、組成物および乳癌のモジュレーターのスクリーニング方法 |
| GB0111218D0 (en) | 2001-05-08 | 2001-06-27 | Cancer Res Ventures Ltd | Assays methods and means |
| US6989245B2 (en) | 2001-05-11 | 2006-01-24 | The Burnham Institute | Screening, diagnostic and therapeutic methods relating to RIZ |
| DK2280070T3 (en) | 2001-07-23 | 2015-08-24 | Univ Leland Stanford Junior | Methods and compositions for use in RNAi-mediated inhibition of gene expression in mammals |
| JP3742415B2 (ja) | 2003-02-10 | 2006-02-01 | 三洋化成工業株式会社 | Rb1遺伝子産物に対する自己抗体を検出するための免疫測定用試薬 |
| DE602004032114D1 (de) | 2003-02-28 | 2011-05-19 | Oncotherapy Science Inc | Rna-interferenz für das gen znfn3a1 als verfahren zur hemmung des wachstums von krebszellen |
| TW200741009A (en) | 2005-07-01 | 2007-11-01 | Oncotherapy Science Inc | Methods of modulating SMYD3 for treatment of cancer |
-
2008
- 2008-06-13 EP EP08764111A patent/EP2171082B1/en not_active Not-in-force
- 2008-06-13 JP JP2009550134A patent/JP5272134B2/ja not_active Expired - Fee Related
- 2008-06-13 WO PCT/JP2008/001516 patent/WO2008152816A1/en not_active Ceased
- 2008-06-13 TW TW097122119A patent/TW200909587A/zh unknown
- 2008-06-13 US US12/664,378 patent/US8354223B2/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003027143A2 (en) | 2001-09-25 | 2003-04-03 | Japan As Represented By The President Of The University Of Tokyo | Gene and protein relating to hepatocellular carcinoma |
| WO2005071102A2 (en) * | 2004-01-23 | 2005-08-04 | Oncotherapy Science, Inc. | Methods of detecting methyl transferase activity and methods of screening for methyl transferase activity modulators |
| WO2006085684A2 (en) | 2005-02-10 | 2006-08-17 | Oncotherapy Science, Inc. | Method of diagnosing bladder cancer |
| WO2006092958A1 (en) | 2005-02-28 | 2006-09-08 | Oncotherapy Science, Inc. | Breast cancer related gene znfn3a1 |
Non-Patent Citations (19)
| Title |
|---|
| BETTER M.; HORWITZ A. H., METHODS ENZYMOL., vol. 178, 1989, pages 476 - 496 |
| BIRD R. E.; WALKER B. W., TRENDS BIOTECHNOL., vol. 9, 1991, pages 132 - 137 |
| CO M. S. ET AL., J. IMMUNOL., vol. 152, 1994, pages 2968 - 2976 |
| HAMAMOTO R ET AL., S NATURE CELL BIOLOGY, vol. 6, no. 8, 2004, pages 731 - 40 |
| HAMAMOTO R. ET AL.: "SMYD3 encodes a histone methyltransferase involved in the proliferation of cancer cells", NAT. CELL BIOL., vol. 6, no. 8, 2004, pages 731 - 740, XP002385375 * |
| HOPP, T. P. ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 1204 - 1210 |
| HUSTON J. S. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 5879 - 5883 |
| KUNIZAKI M. ET AL.: "The Lysine 831 of Vascular Endothelial Growth Factor Receptor 1 Is a Novel Target of Methylation by SMYD3", CANCER RES., vol. 67, no. 22, November 2007 (2007-11-01), pages 10759 - 10765, XP008131446 * |
| LAMOYI E., METHODS ENZYMOL., vol. 121, 1986, pages 652 - 663 |
| NOZAKI T. ET AL.: "Involvement of the VEGFR-1 in prostatic carcinogenesis", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, vol. 45, no. SUPPL. S, 2004, pages 213 + ABSTR. NO. #934, XP008133544 * |
| PLUCKTHUN A.; SKERRA A., METHODS ENZYMOL., vol. 178, 1989, pages 497 - 515 |
| ROUSSEAUX J. ET AL., METHODS ENZYMOL., vol. 121, 1986, pages 663 - 669 |
| SAMBROOK, J. ET AL.: "Molecular Cloning", 1989, COLD SPRING HARBOR LAB. PRESS, pages: 9.47 - 9.58 |
| SAMBROOK, J. ET AL.: "Molecular Cloning", 2001, COLD SPRING HARBOR LAB. PRESS, pages: A7.6 - A7.9 |
| See also references of EP2171082A4 |
| SHIBUYA M.: "Differential Roles of Vascular Endothelial Growth Factor Receptor-1 and Receptor-2 in Angiogenesis", J. BIOCHEM. MOL. BIOL., vol. 39, no. 5, 2006, pages 469 - 478, XP002468233 * |
| TAYLOR, J, THEOR. BIOL., vol. 119, 1986, pages 205 - 218 |
| VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536 |
| WILBUR, W. J.; LIPMAN, D. J., PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 726 - 730 |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7767392B2 (en) | 2001-09-25 | 2010-08-03 | Oncotherapy Science, Inc. | Gene and protein relating to hepatocellular carcinoma and methods of use thereof |
| US8148080B2 (en) | 2001-09-25 | 2012-04-03 | Oncotherapy Science, Inc. | Gene and protein relating to hepatocellular carcinoma and methods of use thereof |
| US8221993B2 (en) | 2004-01-23 | 2012-07-17 | Onco Therapy Science, Inc. | Methods of detecting methyl transferase activity and methods of screening for methyl transferase activity modulators |
| US7939254B2 (en) | 2005-02-28 | 2011-05-10 | Oncotherapy Science, Inc. | Breast cancer related gene ZNFN3A1 |
| US7968281B2 (en) | 2005-07-01 | 2011-06-28 | Oncotherapy Science, Inc. | Methods of modulating SMYD3 for treatment of cancer |
| US8975229B2 (en) | 2009-06-11 | 2015-03-10 | Oncotherapy Science, Inc. | Methods for treating a disease caused by choroidal neovascularization |
| JP2013506687A (ja) * | 2009-09-30 | 2013-02-28 | プレジデント アンド フェロウズ オブ ハーバード カレッジ | オートファジー促進遺伝子産物の変調によりオートファジーを変調する方法 |
| CN108624574A (zh) * | 2018-04-11 | 2018-10-09 | 苏州汇桢生物技术有限公司 | 一种s-腺苷同型半胱氨酸水解酶突变体及其应用和制法、核酸、表达载体及宿主细胞 |
| CN108624574B (zh) * | 2018-04-11 | 2021-09-03 | 苏州汇桢生物技术有限公司 | 一种s-腺苷同型半胱氨酸水解酶突变体及其应用和制法、核酸、表达载体及宿主细胞 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2171082B1 (en) | 2012-11-28 |
| EP2171082A4 (en) | 2010-10-06 |
| US8354223B2 (en) | 2013-01-15 |
| US20100184088A1 (en) | 2010-07-22 |
| TW200909587A (en) | 2009-03-01 |
| JP5272134B2 (ja) | 2013-08-28 |
| EP2171082A1 (en) | 2010-04-07 |
| JP2010528584A (ja) | 2010-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8354223B2 (en) | Methods of identifying agents that modulate methylation of VEGFR1 by SMYD3 | |
| US20110263012A1 (en) | Screening and therapeutic method for nsclc targeting cdca1-kntc2 complex | |
| US20140134637A1 (en) | Methods of modulating smyd3 for treatment of cancer | |
| JP4614954B2 (ja) | メチルトランスフェラーゼ活性の検出方法およびメチルトランスフェラーゼ活性調節因子のスクリーニング方法 | |
| US20110014615A1 (en) | METHOD FOR DIAGNOSING NON-SMALL CELL LUNG CANCERS BY tRNA-DIHYDROURIDINE SYNTHASE ACTIVITY OF URLC8 | |
| WO2008023841A1 (en) | Breast cancer-associated gene, melk, and its interactions with bcl-g | |
| EP2785870B1 (en) | Smyd2 as a target gene for cancer therapy and diagnosis | |
| CA2661662A1 (en) | Methods of screening for agents that inhibit binding between mphosph1 and prc1 | |
| CN101528768A (zh) | 与乳腺癌相关的基因和多肽 | |
| Wiechmann et al. | Competitive inhibitors of Ras effector binding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08764111 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009550134 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008764111 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12664378 Country of ref document: US |