WO2008040126A1 - Stabilizing compositions and methods for extraction of ribonucleic acid - Google Patents
Stabilizing compositions and methods for extraction of ribonucleic acid Download PDFInfo
- Publication number
- WO2008040126A1 WO2008040126A1 PCT/CA2007/001785 CA2007001785W WO2008040126A1 WO 2008040126 A1 WO2008040126 A1 WO 2008040126A1 CA 2007001785 W CA2007001785 W CA 2007001785W WO 2008040126 A1 WO2008040126 A1 WO 2008040126A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- acid
- composition
- rna
- sample
- weeks
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the field of the invention generally relates to compositions and methods for storage and/or isolation of ribonucleic acids from bodily fluid(s), and/or secretion(s), (e.g., saliva, mucous), and/or tissue(s).
- RNA ribonucleic acid
- pathogenic mammalian viruses e.g. SARS-CoA, Influenza virus, Measles virus, Rabies virus, Dengue fever virus, Respiratory Syncytial Virus (RSV), HIV and Hepatitis A, C-E virus
- SARS-CoA pathogenic mammalian viruses
- Influenza virus e.g. SARS-CoA, Influenza virus, Measles virus, Rabies virus, Dengue fever virus, Respiratory Syncytial Virus (RSV), HIV and Hepatitis A, C-E virus
- RSV Respiratory Syncytial Virus
- HIV Hepatitis A, C-E virus
- RNA is a labile compound and the widespread adoption for routine use of RNA as an analyte in detection and analysis of RNA has been limited because of its labile nature.
- the sugar-phosphate backbone of RNA is particularly sensitive to breakdown (degradation, hydrolysis) by alkaline solutions. It is also sensitive to breakdown by acidic solutions.
- the pH of maximum stability of RNA is generally assumed to be about neutral, but this has not previously been determined precisely.
- RNA can also be degraded enzymatically by endoribonucleases (e.g., pancreatic ribonuclease). Ribonuclease activity has previously been identified in human saliva (Bardon and Shugar, 1980), but the biochemical properties of this enzyme have not been well characterized. Brandon and Shugar (1980) suggest that salivary ribonuclease is pancreatic ribonuclease-like, but this has not been established. At least in part as result of its instability RNA is often considered as an unsuitable analyte for diagnosis or detection. In the case of RNA viruses, methods have been devised for detection that do not require direct detection of RNA.
- endoribonucleases e.g., pancreatic ribonuclease.
- liquid culturing systems are used to 'grow up' sufficient quantities of virus/bacteria to confirm a diagnosis.
- Bacterial infection is typically diagnosed by direct staining and microscopic examination of samples. Electron microscopy is also used to identify bacteria and virus containing samples. In serology, diagnosis may be accomplished by detection of antibodies directed against pathogens (e.g. viruses, bacteria, parasites) in blood serum by employing indirect fluorescent antibody testing and enzyme-linked immunosorbent assays
- pathogens e.g. viruses, bacteria, parasites
- Reverse transcriptase PCR (RT-PCR) procedures are sensitive for detecting pathogens, and in some cases before the onset of symptoms. Rapid viral diagnosis will become increasingly critical, both for the control of epidemics and for the management of patients with viral infections.
- IFA immunofluorescence assay
- BSL-3 biosafety level 3
- RNA can be extracted from most, if not all, cell types in the human body (except erythrocytes) and from a variety of cell-containing bodily fluids and/or secretions as well as tissues. In some cases, it is also be desirable to be able to obtain RNA from other sources, including feces, urine, cerebral spinal fluid, animal tissues, bone marrow aspirates, plants, plant extracts, microorganisms, virus, soil samples, sewage, wastewater, and/or foodstuffs (including milk).
- sources including feces, urine, cerebral spinal fluid, animal tissues, bone marrow aspirates, plants, plant extracts, microorganisms, virus, soil samples, sewage, wastewater, and/or foodstuffs (including milk).
- RNA-containing sample typically, once a RNA-containing sample is collected, it must either be frozen (e.g., with liquid nitrogen) or quickly transported in the unfrozen state at 4°C to a laboratory for extraction of RNA.
- the requirement for rapid transportation and/or the requirement of freezing may be problematic in terms of cost and storage space. Additionally, in the case of remote locations and/or large-scale sample collection, rapid transportation and/or freezing may not be feasible. Importantly, rapid processing/testing of clinical samples may not be feasible during an epidemic; back-logged samples will likely degrade over time and/or under sub-optimal storage conditions.
- a simpler procedure for collecting RNA in a form that would not require the sample be frozen or transported immediately to a laboratory including equipment such as freezers, refrigerators, centrifuges, etc., would be desirable.
- RNA sources from the oral cavity are conveniently obtained from samples of saliva.
- Saliva can be collected 'passively' by spitting and/or 'actively' with the aid of implements (e.g., swabs).
- Nasal mucosal samples are conveniently obtained and are a rich source or epithelial and immune cells (e.g., lymphocytes). This procedure is not as invasive compared to, for example, taking of venous blood and a simple procedure based on saliva would permit self-collection by individuals with essentially no prior training. However, once collected, the time that useable RNA can be recovered may be limited because of the presence of ribonucleases in most tissues and bodily fluids.
- compositions and methods that would allow RNA to be reliably recovered from bodily fluids and/or secretions and tissues.
- Cationic compounds such as tetradecyltrimethylammonium oxalate
- US20020146677 includes tetradecyltrimethylammonium oxalate plus tartaric acid to stabilize nucleic acid in blood.
- cationic compounds including tetradecyltrimethylammonium oxalate, have been found to be unsatisfactory in terms of ease of use and long term stability of RNA. It has been found that once the cationic detergent is bound to nucleic acids, the nucleic acids are difficult to dissolve.
- RNA in the collected sample it would be desirable for the amount of RNA in the collected sample to be sufficiently large to allow for the detection of low copy number RNA species such as messenger RNA and some viruses.
- An object of the present invention is to provide a composition and method for prolonged storage of RNA from bodily fluids and/or tissues at room temperature, which compositions and methods further facilitate extraction of the RNA in as high a yield and as nearly intact state as is possible.
- compositions for extracting and storing ribonucleic acid from a sample such that the ribonucleic acid within said sample remains stable at room temperature
- said composition comprises: an anionic detergent; and a buffering agent at a pH of about 5 to about 8.2; wherein said composition stabilizes said ribonucleic acid at room temperature.
- a method for preserving ribonucleic acid from a biological sample comprising the steps of: a. obtaining the sample from a subject; b. contacting said sample with a composition comprising an anionic denaturing agent and a buffering agent at a pH of about 5 to about 8.2 to form a mixture; c. storing the mixture at room temperature; and d. heating the mixture at greater than or about equal to 50°C prior to subsequent processing, wherein said composition stabilizes said ribonucleic acid at room temperature.
- RNA storage kit comprising: a. a composition according to the present invention.
- Figure 1 is photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA from saliva stored in compositions of the present invention
- Figure 2 is a is photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA from saliva stored in compositions of the present invention and stored in OrageneTM;
- Figure 3 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA samples stored in compositions having a range of pH's;
- Figure 4 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA combined with a cell-free fraction of saliva;
- Figure 5 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA combined with a cell-free fraction of saliva over a range of pH's;
- Figure 6 is photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA in saliva stored in a composition of the present invention over a range of SDS concentrations;
- Figure 7 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA in saliva when stored at room temperature compared to 37°C, using a composition of the present invention
- Figure 8 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA in saliva stored at room temperature in a composition of the present invention
- Figure 9 is a photograph of an ethidium bromide- stained, transilluminated agarose gel showing the results of electrophoresis of RNA in saliva stored at room temperature in a composition of the present invention
- Figure 10 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA samples stored in compositions of the present invention and heated at various temperatures subsequent to storage at room temperature;
- Figure 11 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA samples stored in compositions of the present invention and heated at various temperatures subsequent to storage at room temperature;
- Figure 12 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RNA samples stored at room temperature for 10- 16 days at room temperature in a composition of the present invention;
- Figure 13 is a photograph of an ethidium bromide-stained, transilluminated agarose gel showing the results of electrophoresis of RT-PCR products;
- Figure 14 is a photograph of ethidium bromide-stained, transilluminated agarose gels showing the results of electrophoresis of RNA samples from saliva stored at the indicated temperature for 1 week (Panel A) and 8 weeks (Panel B); and
- Figure 15 is a diagram depicting steps that may be followed to collect saliva from a subject.
- the present invention relates to compositions and methods for prolonged storage, and extraction, of ribonucleic acid (RNA) from bodily fluids such as saliva, nasal secretions and/or tissues, wherein the RNA in the resulting composition remains stable at room temperature for extended periods of time.
- RNA ribonucleic acid
- body fluid refers to a naturally occurring fluid from a human or an animal, and includes, but is not limited to saliva, sputum, serum, plasma, blood, pharyngeal, nasal/nasal pharyngeal and sinus secretions, urine, mucous, gastric juices, pancreatic juices, bone marrow aspirates, cerebral spinal fluid, feces, semen, products of lactation or menstruation, cervical secretions, vaginal fluid, tears, or lymph.
- tissue refers to an aggregate of cells usually of a particular kind together with their intercellular substance that form one of the structural materials of a plant or an animal and that in animals include connective tissue, epithelium, mucosal membrane, muscle tissue, and nerve tissue, and the like.
- Ct value is as defined in the Operator Manual for our Rotor-GeneTM 6000 (real-time genetic amplification detection system; manufactured by Corbett Life Science) and refers to the fractional cycle number at the point where the amplification curve crosses a threshold of detection.
- the threshold line is set in the exponential phase of the run, significantly above the background level to avoid noise and below the onset of signal plateau in later cycles.
- nucleic acid refers to a chain of nucleotides, including deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), typically found in chromosomes, chromatin, mitochondria, ribosomes, cytoplasm, nucleus, microorganisms (e.g., bacteria) or viruses.
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- RNA refers to a wide range of RNA species, including, but not limited to high molecular RNA, large and small ribosomal RNAs, messenger RNA, pre-messenger RNA, small regulatory RNAs, RNA viruses (single and double-stranded, positive stranded or negative stranded) and the like.
- the RNA may be from a variety of sources, including, but not limited to human, non-human, viral, bacterial, fungal, protozoan, parasitic, single-celled, multi-cellular, in vitro, in vivo, natural, and/or synthetic sources.
- primer refers to an oligonucleotide acting as a starting point from which the synthesis begins in the presence of a DNA template or a RNA template, reagents for polymerization and so on.
- a primer is preferably single-stranded, double- stranded primers may also be used. When double-stranded primers are used, it is desirable to convert them into their single-stranded forms before use in an amplification reaction.
- a primer may be chemically or enzymatically synthesized using well known methods, or may be isolated from an organism.
- saliva refers to the secretion, or combination of secretions, from any of the salivary glands, including the parotid, submaxillary, and sublingual glands, optionally mixed with the secretions from the numerous small labial, buccal, and palatal glands that line the mouth.
- subject refers to a variety of organisms/sources, including, but not limited to human, non-human mammals, other animal species, viral, bacterial, fungal, protozoan, parasitic, single-celled, multi-cellular, in vitro, in vivo, natural, and/or synthetic sources.
- suitable subjects include human and bovine sources.
- Specific non-limiting examples include beef cattle, dairy cattle, sheep, goats, hogs, poultry and horses.
- Specific non-limiting examples also include companion animals, such as dogs, cats and the like.
- Prolonged storage refers to storage for at least about one day, two days, three days, four days, six days, one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, or eight weeks, from about one day to about eight weeks, or greater than about eight weeks.
- composition of the present invention is a composition for extracting RNA from a bodily fluid or tissue and maintaining the RNA contained therein stable at room temperature for prolonged periods.
- composition of the present invention includes an anionic detergent and a buffer.
- Selection of the specific components of the composition is made based on various criteria, including, for example, efficacy for stabilizing ribonucleic acid, cost, safety for the subject and the laboratory worker, availability, and compatibility with downstream applications.
- efficacy for stabilizing ribonucleic acid for example, cost, safety for the subject and the laboratory worker, availability, and compatibility with downstream applications.
- concentration should be appropriate to stabilize the RNA in the biological sample at room temperature.
- composition of the present invention permits storage of the sample at room temperature and subsequent processing to isolate and purify the RNA contained therein.
- processing refers to mechanical or chemical steps used to isolate or purify the ribonucleic acid from composition mixed with biological sample.
- a major cause of nucleic acid instability in biological samples is the presence of deoxyribonucleases and ribonucleases.
- Deoxyribonucleases and ribonucleases are enzymes that break down DNA or RNA, respectively. Their main source in the digestive tract is secretions of the pancreas, although these enzymes may also be present in secretions and cells of the salivary gland and buccal mucosa.
- microorganisms resident in the mouth or from recently ingested foods may release deoxyribonucleases or ribonucleases. Over time, the nucleic acid within a biological sample (e.g., saliva) stored in water would be expected to degrade or break down.
- compositions of the present invention provides inhibition of nucleases, including ribonucleases, and chemical stabilization of RNA.
- Ribonuclease inhibition and the ability to store a ribonuclease-containing RNA sample at room temperature is achieved through the use of an anionic detergent and a buffer wherein the appropriate pH is maintained ⁇ followed by an incubation step at about 50 0 C or above, prior to subsequent processing of samples.
- proteinase K is included in the incubation step.
- An appropriate pH is (i) a pH at which RNase activity is minimized or eliminated and (ii) a pH at which RNA remains chemically stable.
- anionic detergents can be included in the composition of the present invention.
- suitable anionic detergents include sodium dodecyl sulfate (SDS), sodium sarcosinate (sarkosyl), lithium dodecyl sulfate, sodium 1-octane sulfonic acid, and the like.
- the composition contains the anionic detergent SDS at a concentration such as when it is mixed with saliva, the SDS is in the range of about 0.5% to about 8%.
- the composition contains the anionic detergent SDS at a concentration such as when it is mixed with saliva, the denaturing agent is in the range of about 1% to about 8% or 2% to about 8%.
- the composition contains the denaturing agent Sarkosyl at a concentration such that when it is mixed with saliva, the concentration of sarkosyl is in the range of about 0.5% to about 8%. In another example, the concentration of sarkosyl is in the range of about 2% to about 4%. Buffer
- the composition comprises an anionic detergent and a buffer to maintain the pH within the range of 5 - 8.2.
- the composition comprises a denaturing agent and a buffer to maintain the pH within the range of 5.1 - 7.0.
- the pH of the composition is in the range of about 5.5 to about 7.5.
- the pH of the composition is in the range of about 6.5 to about 7.0.
- the pH of the composition is about 6.8.
- the pH of the composition can be maintained at the desired pH using a buffer.
- Non-limiting examples of suitable buffering agents include sodium cyclohexane diaminetetraacetate (CDTA), N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES), A- (2-Hydroxyethyl)piperazine-l-ethanesulfonic acid (HEPES), acetic acid or acetate (e.g.
- buffering agent examples include buffering agents having a pKa at 25°C of from about 4.7 to about 8.0.
- the buffer is CDTA.
- the buffer is citrate/citric acid.
- compositions according to the present invention comprise 4% SDS, 50 mM CDTA adjusted to pH 6.2.
- the composition comprises 4% SDS, 50 mM CDTA adjusted to pH 6.6.
- the composition comprises: 16% SDS or 12% SDS or 8% SDS, 50 mM CDTA buffered to pH 6.2.
- the composition comprises 1% SDS, 50 mM CDTA adjusted to pH 6.6. ;
- the composition comprises 4% SDS, 50 mM citric acid buffered to pH 6.6.
- the composition comprises 4 % Sarkosyl, 50 mM CDTA buffered to pH 6.6.
- the composition comprises 8 % Sarkosyl, 50 mM CDTA buffered to pH 6.6.
- the composition comprises 4% SDS, 50 mM LiCDTA, 250 mM LiCl adjusted to pH 6.8.
- the composition of the present invention can stabilize RNA, such as high molecular weight RNA, present in biological samples such as sputum or saliva or nasal, anterior nasal, and/or nasopharyngeal samples for prolonged periods of time at room temperature.
- RNA can be purified using a variety of methods, and can be purified without a requirement for phenol extraction, guanidinium salts, or any column or binding matrix.
- the purified RNA is sufficiently pure to be used directly in downstream applications such as, for example, the preparation of complementary DNA (cDNA).
- cDNA complementary DNA
- phenol extraction, guanidinium salts, or any column or binding matrix may be used, if desired.
- the anionic detergent for exmaple SDS binds, denatures and inhibits salivary ribonuclease(s) and the buffer, for example CDTA, keeps the pH of the saliva sample neutral or slightly acidic. Buffering the sample in a relatively narrow range helps to ensure the RNA is chemically stable, despite the fact that ribonuclease(s), such as salivary ribonuclease(s), are potentially active in this pH range.
- salivary RNA is stable for extended periods of time (e.g., weeks to months) in this composition, it has been discovered that salivary ribonuclease activity is robust in some samples may not be permanently inactivated.
- salivary ribonuclease activity is robust in some samples may not be permanently inactivated.
- the Applicant has surprisingly discovered that heating the sample at temperatures above about 50°C following storage at room temperature and prior to subsequent processing allows the RNA within the sample to be extracted in a substantially intact form. Again, while not wishing to be bound by theory, it appears that this heating step largely or completely inactivates salivary ribonuclease activity while assisting in the liberation of RNA from cells.
- the Applicant has determined a pH range that, on the one hand, is optimal for minimizing chemical degradation of the RNA and, on the other hand, permits SDS to strongly inhibit the salivary ribonuclease activity.
- the composition of the present application reduces ribonuclease activity nearly completely while maintaining the chemical stability of RNA.
- the denaturing agent is not a guanidinium salt.
- RNA extracted and stored using the compositions of the present invention is substantially intact, suitable for RT-PCR analysis, and is recoverable from samples without the aid of any nucleic acid-binding matrix such as paramagnetic silica- coated beads or a silica-based membrane.
- the method of the present invention promotes recovery of intact, high molecular weight RNA.
- RNA for prolonged periods at room temperature.
- Samples may be obtained from variety of sources including, but not limited to humans, non-human primates, livestock (e.g., cattle, pigs, sheep, goats, domestic birds such as chicken, turkey,, pheasant, duck, geese), game and wild animals (e.g., deer, elk, moose, fish, birds, bear), laboratory and companion animals (e.g., non-human primates, rodents such as mice, rats, rabbits, guinea pigs, gerbils, hamsters), pigs, goats, sheep, dogs, cats, fish, snakes, lizards, turtles, a horse and the like. Samples may also be obtained from plants, cell lines, soil microorganisms, sewage microorganisms, pathogenic microorganisms (e.g, virus, bacteria, parasites) and the like.
- livestock e.g., cattle, pigs, sheep, goats, domestic birds such as chicken, turkey,, phe
- the sample is obtained from a human source.
- the sample is obtained from a bovine source.
- the RNA is within saliva.
- the method comprises the steps of mixing a sample of saliva with the composition of the present invention, then storing the saliva-composition mixture at room temperature.
- the method comprises the steps of mixing a sample of saliva with approximately an equal volume of the composition of the present invention, then storing the saliva-composition mixture at room temperature. Prior to subsequent processing, the sample is heated above about 50°C for a short period of time.
- the RNA is within a nasal, anterior nasal and/or nasopharyngeal sample.
- the method comprises the steps of mixing the nasal, anterior nasal and/or nasopharyngeal sample with the composition of the present invention, then storing the mixture at room temperature.
- the RNA is stable for at least about one day and at least about four weeks. Prior to subsequent processing, the sample is heated above 50°C for a short period of time.
- a saliva sample or nasal, anterior nasal and/or nasopharyngeal sample rather than a blood sample as a source of ribonucleic acid
- a pin-prick to obtain a drop of blood is sufficient to recover a useable amount of DNA, the expected amount of RNA is too small to be useable for most purposes.
- Saliva, sputum, nasal, anterior nasal and/or nasopharyngeal samples have a further advantage of not requiring specialized personnel for collection, thereby reducing cost where mass sample collection is being carried out (e.g., during a epidemic/pandemic).
- RNA is one source of RNA
- other bodily fluids including blood, and bodily tissues
- the present invention is not intended to be limited to the collection and storage of RNA obtained from sputum, saliva, nasal, anterior nasal and/or nasopharyngeal samples.
- the mouth be rinsed before sampling.
- Food particles can introduce foreign RNA and saliva transferred by kissing can be a source of foreign human RNA or viral RNA.
- the mouth can be rinsed with about 50 ml of tepid water by vigorous swishing or by brushing with a toothbrush without toothpaste.
- Unstimulated saliva is usually of the mucinous type and is secreted at a slow rate.
- Stimulated saliva is of the serous (watery) type and secreted at a faster rate.
- the subject may spit a volume (for example, about 1-2 ml) of saliva, preferably stimulated saliva, into the receiving tube.
- Saliva flow can conveniently be stimulated with a few grains/pinch of table sugar placed on top of the tongue, or any other such saliva-stimulatory substance that does not interfere with RNA stability or subsequent amplification.
- Saliva may also be obtained from subjects such as infants, young children and people with disabilities and/or illness that may be unable to directly spit into a collection device.
- an implement e.g., a swab etc.
- saliva is collected from subjects such as infants, young children and people with disabilities and/or illness that may be unable to directly spit into a collection device.
- an implement e.g., a swab etc.
- Saliva may also be obtained from non-human animals such as livestock, companion animals and the like, which may be unable or unwilling to directly spit into a collection device, hi this instance, an implement (e.g., a swab etc.) is used to collect saliva.
- an implement e.g., a swab etc.
- Mucosal cells can be scraped using rigid or flexible brushes, swabs, or plastic/wood scrapers and cells may be flushed from the nasal cavity by introducing a liquid (e.g., saline) and recovering the liquid.
- a liquid e.g., saline
- a rigid swab/brush can be placed in the. anterior of the nose and a flexible swab/brush into the posterior nasopharyngeal cavity and used to collect mucosal secretions and to gently rub off cells from the mucosal membrane.
- Samples collected with said liquid and/or implement(s) can be delivered into a collection device containing the composition of the present invention.
- a cutting device e.g. scissors
- swabs or brushes with handles that snap under pressure as well as swabs or brushes with a moulded breakpoint in the handle/shaft, can be used to facilitate sample collection.
- the 'full length' handle facilitates the collection of a sample and shortening of the swab/brush at the engineered break point permits a better fit into the collection device.
- RNA samples taken from the nasal cavity Fresh tissue specimens/biopsies (e.g., normal nasal mucosa or nasal polyp tissue) obtained from patients undergoing rhinoplasty or endoscopic sinus surgery can be collected in the composition of the present invention for subsequent RNA isolation.
- Fresh tissue specimens/biopsies e.g., normal nasal mucosa or nasal polyp tissue
- RNA isolation e.g., endoscopic sinus surgery
- kits preferably contains appropriate composition and may include swabs to facilitate sample collection.
- At least one type of positive control or standard may be provided that can be a nucleic acid (DNA or RNA) template for demonstrating the suitability of the sample for the detection of a target gene or nucleic acid sequence (e.g. transcript).
- a kit preferably contains instructions for the use there of.
- the kit includes a container, such as that described in International PCT Application No. WO 03/104251, the contents of which are incorporated herein by reference in its entirety.
- the kit includes a container, such as that described in U.S. Application Serial no. 60/748,977, or PCT/CA2006/002009 the contents both of which are incorporated herein by reference in their entirety.
- the kit includes a collection assembly, such as that described in PCT/US2007/64240, the contents of which are incorporated herein by reference in its entirety.
- the container facilitates collection in the field, without the requirement of a clinic or hospital, and is sized to be mailed to a collection site and/or an analysis site.
- compositions and methods of the present invention are suitable for use in a wide range of applications.
- the methods and compositions of the present invention are expected to be valuable for the wide-scale field collection, transport, storage, purification and subsequent analysis in a diagnostic laboratory of biological samples, such as nasal, nasopharyngeal, sputum and/or saliva samples. Stability of said samples in the composition of the present invention at room temperature is expected to be extremely valuable in situations (e.g. epidemics) when laboratories are overwhelmed with large numbers of patient samples.
- compositions and methods of the present application are suitable for collection, storage and archiving of livestock samples for disease surveillance and livestock monitoring.
- the compositions and methods of the present application are also suitable for use with companion animals, such as dogs, cats, and the like.
- Saliva is expected to surpass blood as the sample of choice for many clinical diagnostic and genetic tests.
- a sputum, saliva, nasal, anterior nasal and/or nasopharyngeal sample is a less hazardous specimen to collect and process than blood; both saliva collection and nasal, anterior nasal and/or nasopharyngeal collection is non-invasive or minimally-invasive for the patient and can be easily collected on multiple occasions.
- sample collection does not require a skilled technician.
- Nasal, anterior nasal and nasopharyngeal samples have been shown herein to be suitable for use with the methods and compositions of the present invention.
- the nasal cavity is considered part of the upper respiratory tract.
- Nasal mucosa is a rich source of epithelial and immune cells (e.g. lymphocytes).
- Airway mucosa (nasal cavity and lungs) is the first site of exposure to inhaled pathogens (e.g. bacteria and virus).
- T cells present in respiratory mucosa are believed to play an important role in the regulation of mucosal immune responses to foreign antigens (e.g. infectious microbial antigens) bombarding the mucosal surface.
- Respiratory viruses e.g. Respiratory Syncytial Virus, RSV
- RSV Respiratory Syncytial Virus
- Nasal samples stabilized in the composition of the present invention are useful for the analysis of gene expression profiles of normal nasal mucosa and nasal polyp tissue to understand the pathophysiology of a variety of rhinopathies/ inflammatory diseases (1).
- mucosal secretions/samples can provide important insights into mucosal (and systemic) humoral and cellular responses induced by infection and/or immunization (2, 9).
- Both saliva and nasal samples collected into the composition of the present invention can also be used for the 'diagnosis/identification of pathogen(s), e.g. SARS-CoA, RSV, measles virus, influenza virus, rabies virus, Dengue fever virus, HIV, Hepatitis A, Hepatitis C-E virus, Mycobacterium, etc.
- pathogen(s) e.g. SARS-CoA, RSV, measles virus, influenza virus, rabies virus, Dengue fever virus, HIV, Hepatitis A, Hepatitis C-E virus, Mycobacterium, etc.
- RNA viruses which infect livestock include.
- Non-limiting examples include: foot-and-mouth disease virus (FMDV) (which infects domesticated and wild ruminants and pigs; most commonly spread of infection via inhalation of infectious droplets originating in breath of infected animals); bovine leukosis virus (BLV); bovine parainfluenza virus (e.g.
- FMDV foot-and-mouth disease virus
- BLV bovine leukosis virus
- bovine parainfluenza virus e.g.
- SARS-associated coronavirus SARS-associated coronavirus
- BHVl virus bovine rhinotracheitis, respiratory disease
- equine arteritis virus aerosol infection
- Nipah virus porcine respiratory and neurologic syndrome
- PRCV Porcine Respiratory Corona Virus Infection
- rabies virus mimals
- Jaagsiekte Sheep Retrovirus contagious lung cancer in sheep
- infectious bronchitis virus IBV
- AAV avian pneumovirus
- NDV newcastle disease virus
- compositions of the present invention are suitable for the stabilization and subsequent detection/analysis of ribonucleic acids from bacteria, fungi, cells infected with virus, isolated virus, tissue cultures, cell lines and bodily fluids and/or tissues that are contaminated with, or suspected of being contaminated with, virus, bacterial, protozoa, fungi and the like, and combinations thereof.
- compositions and methods of the present invention are suitable for use in cytoplasmic, nuclear and/or mitochondrial RNA stability and analysis, archival (e.g., banking) of samples (fluids and/or tissues), tracking the source for the RNA (e.g. placental/fetal versus maternal origin), tracing the lineage of the ribonucleic acid (e.g. identification and characterization of the infected source and subsequent transmission pathways of a virus).
- archival e.g., banking
- the source for the RNA e.g. placental/fetal versus maternal origin
- tracing the lineage of the ribonucleic acid e.g. identification and characterization of the infected source and subsequent transmission pathways of a virus.
- compositions of the present invention render pathogens (viruses and bacteria) non-infectious, making for safe handling of clinical samples. This is particularly the case once samples have been heated.
- clinical specimens collected in 'traditional' sterile transport medium e.g., Viral transport media (VTM) - Annex 8.
- VTM Viral transport media
- "Collecting, preserving and shipping specimens for the diagnosis of avian influenza A (H5N1) virus infection Guide for field operations, October 2006. WHO) and suspected of containing a pathogen(s) must be processed in biosafety level 3 or 4 containment facilities. These facilities are not numerous and would be overwhelmed in the event of an epidemic.
- remote areas e.g. some countries in Africa, do not have biosafety level 3 or 4 containment facilities/laboratories.
- compositions and methods of the present invention are suited to collection and isolation of RNA from healthy and infected individuals in the field, over wide geographical areas, which can provide vital surveillance information for the prediction and prevention of large-scale epidemics. Such samples would be invaluable for identifying candidate vaccine strains and identification of virus genotypes for molecular epidemiological studies.
- the compositions and methods of the present invention are suitable for diagnosis of an infection in the early phase of an illness (e.g., before seroconversion). This aspect is important for 1) managing patient care and improving disease outcome, and 2) preventing/reducing transmission.
- the sensitivity of 'traditional' serological testing (as noted above) is too low for early detection of infection.
- SARS-CoA can not be detected by this traditional method until 14-28 days after the onset of symptoms (e.g. fever).
- a reverse transcription (RT)-PCR-based assay was advocated by the World Health Organization (WHO) and is being routinely used for detecting virus-specific RNA (4, 5).
- WHO World Health Organization
- a loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus has been developed (3). While significant progress has been made in PCR-based diagnostic techniques, the success of these assays relies heavily upon the collection of clinical specimens into sterile transport medium and rapid transport to biosafety level 3/4 containment facilities at 4°C for immediate processing.
- these samples are collected from patients already admitted to hospital and precious time (days) is often 'wasted' replicating the virus in cell cultures, followed by monitoring for cytopathic effects.
- days precious time
- the 'traditional' methods of sample collection into transport medium is inadequate during an epidemic/pandemic when diagnostic laboratories would be overwhelmed with samples.
- Laboratories have limited capacities for refrigerating and/or freezing samples, so the degradation of back-logged samples during an epidemic would be anticipated. Samples would need to be recollected and precious time would be wasted.
- compositions and methods of the present invention are also suitable for use in the diagnosis of subclinical disease.
- RT-PCR tests have detected measles virus (MV) RNA in throat-swab specimens from 5 days BEFORE until 12 days after the onset of rash (7).
- Oral fluid proved to be the most practical specimen for the simultaneous detection of MV-specific IgM antibody and viral RNA.
- Viral RNA was also detected in oropharyngeal specimens from 3 healthy contact persons with serological proof of MV infection.” Hence, samples collected from the nasal and oral cavity can be used for the diagnosis of clinical and subclinical MV infection.
- throat swab specimens were optimal/the preferred specimen for detection of measles virus RNA during the first 2 weeks after the rash.
- the tip of the throat swab was placed in 3 mL of sterile viral transport medium and was transported to the laboratory at 4 0 C.
- RNA human and/or bacterial and/or viral transcript
- EXAMPLE 1 PROTOCOL FOR OBTAINING SALIVA SAMPLES FROM HUMAN SUBJECTS
- the subject is instructed to wait for a period of 30 - 60 minutes before last eating. If possible, the subject will brush his teeth (without using toothpaste). If possible, the subject will rinse his/her mouth with 50 ml of water. The subject will be requested to wait for 5-10 minutes to allow the mouth to clear of water. For subjects able to spit, they will be instructed to spit saliva into the special collection tube until the level of saliva reaches the 1 or 2 ml mark. Waiting after last eating and rinsing the mouth is desirable but not essential. Collection of saliva may take several minutes.
- an implement e.g., swab, brush, transfer pipette
- a subject may be provided a liquid (e.g., mouthwash, water, saline) to gargle his/her mouth and throat or saline to flush his/her nasal cavity. Samples collected with said liquid would be delivered into the collection tube.
- composition of the present invention In situations where the saliva/sputum/nasal secretions have been substantially diluted by said liquid, a correspondingly larger amount of composition of the present invention would be provided.
- the subject is asked to deliver small amounts of saliva alternating between two or more tubes until each tube is filled to the 1 ml mark. This is necessary because the composition of saliva from the subject can vary during the process of spitting.
- RNA-containing sample can be maintained at room temperature for prolonged periods of time.
- a portion of the RNA-containing sample in aqueous solution can be used as a RNA template for a reverse transcription reaction to produce complementary DNA (cDNA), which can then be used in a PCR reaction.
- cDNA complementary DNA
- a single subject provided two sputum/saliva samples (2 ml each) within a short period of time.
- One sample was collected into a vial containing 2 ml of a composition of the present invention comprising: 4% SDS, 50 mM CDTA, pH 6.6.
- the same subject provided a second sample into a vial containing 2 ml of OrageneTM solution. Samples were shaken and left at room temperature (RT) for 3 days before purification of nucleic acids.
- Nucleic acids were purified from this subject's saliva in OrageneTM or in the composition of the present invention.
- a portion of the subject's sample in OrageneTM was mixed with proteinase K and heated at 50 0 C for 2 hours, without ( Figure 1 and 2) and with ( Figure 2) an additional, subsequent heating at 90°C for 15 minutes.
- a portion of the subject's sample in the composition was mixed with proteinase K, heated at 50°C for 2 hours and then at 90°C for 15 minutes ( Figure 1).
- the inclusion of a short incubation at a temperature above 50°C was found to be necessary for some saliva samples to facilitate the extraction of intact, high molecular weight RNA from saliva collected in the composition of the present invention, but had no effect on saliva collected in Oragene .
- RNA ( Figure 1). Note that in Figure 1, genomic high molecular weight DNA present in the saliva sample is indicated by an arrow (" ⁇ ), the characteristic ribosomal RNA doublet is indicated by an asterisk (*), and low molecular weight RNA is represented by a plus sign (+).
- This example demonstrates i) the ability of the composition of the present invention to preserve salivary ribonucleic acid for at least 3 days at room temperature and ii) the suitability of the extraction/purification procedure for the recovery of substantially intact ribonucleic acids.
- This example demonstrates the superiority of the composition of the present invention over OrageneTM, in terms of RNA stability.
- EXAMPLE 3 OPTIMIZING pH RANGE FOR MAINTAINING THE STABILITY OF PURE RNA DERIVED FROM SPUTUM/SALIVA.
- RNA was diluted 6-fold into solutions buffered over a wide range of pH values (pH 3.0, 5.0, 6.0, 7.0, 8.2 and 10.0). Following a 16 hour period of incubation at 50°C, to allow partial hydrolysis of the phosphodiester backbone of the RNA to occur, an aliquot of the RNA buffered to each pH value (noted below) was analyzed by electrophoresis on a 0.9% agarose gel and stained with ethidium bromide (Figure 3).
- RNA is stable chemically at neutral to slightly acid pH, as indicated by the preservation of the stained double bands characteristic of ribosomal RNA seen in treatments at pH 5.0 - 8.2. Note that a decrease in intensity of the upper band is expected before a decrease in the lower band. While not wishing to be bound by theory, this is likely due to larger species of ribosomal RNA having a higher probability of suffering one phosphodiester backbone cleavage compared to the shorter RNA species (lower band). The characteristic banding pattern of the 2 ribosomal RNA species disappears entirely at more extreme acid and basic pH values of 3.0 and 10.0, respectively.
- RNA samples and saline were mixed and subjected to a high speed centrifugation to pellet the cells contained within the saliva.
- the resultant supernatant or cell-free saliva fraction (CFSF) was diluted and then mixed in increasing amounts with a fixed amount (1.0 ⁇ g) of pure RNA.
- the pure RNA mixed with CFSF was incubated at 37°C for 30 min and then analyzed by agarose gel (1.0 %) electrophoresis. The gel was stained with ethidium bromide to visualize the integrity of the RNA ( Figure 4).
- RNA is rapidly degraded when incubated with a fraction of a microlitre of cell-free saliva.
- potent ribonuclease activity exists in the extracellular fraction of saliva.
- This example also demonstrates the existence of considerable variability in salivary ribonuclease among between subjects. Compared to subjects 1 and 2, a much smaller volume of CFSF from subject 3 was required to degrade an equal amount of RNA.
- EXAMPLE 5 OPTIMAL pH FOR SALIVARY RIBONUCLEASE ACTIVITY
- RNA in the absence of CFSF (lane 10), was included in this example to illustrate the state or intact nature of the RNA utilized in this example. Following incubation at 37°C for 30 min, the samples were analyzed by agarose gel (0.9 %) electrophoresis and stained with ethidium bromide ( Figure 5).
- Indications of RNA degradation include 1) the disappearance of one or both ribosomal RNA subunits, the distinct double bands at the mid-point of the gel, 2) the appearance of an elongated smear of ethidium bromide-stained material, and/or 3) the hastened mobility of ethidium bromide-stained material on the gel with respect to the control RNA marker.
- EXAMPLE 6 STABILITY OF RNA OVER A RANGE OF SDS CONCENTRATION.
- RNA extracted from saliva taken from 5 subjects into one of 3 compositions of the present invention are shown ( Figure 6).
- Saliva was collected and immediately mixed with an equal volume of the indicated composition.
- the compositions contained SDS (sodium dodecyl sulphate, at the concentration indicated in the table below) and were buffered at pH 6.2 with 50 mM CDTA (sodium salt of cyclohexane diaminetetraacetic acid).
- SDS sodium dodecyl sulphate, at the concentration indicated in the table below
- CDTA sodium salt of cyclohexane diaminetetraacetic acid
- Proteinase K was added to each diluted aliquot and then incubated at 50°C for 1 hour to allow the protease to digest proteins. After cooling to room temperature, 10 ⁇ l of a 2.5 M solution of KCl was added to precipitate the SDS; the sample was then centrifuged to remove the precipitated SDS. Cold 95% ethanol (2 volumes) was added to the clear supernatant to precipitate the nucleic acids. After standing for 1 hour at -2O 0 C, the precipitated nucleic acids were dissolved in 25 ⁇ l of a dilute buffer. 10 ⁇ l of this solution (equivalent to about 10 ⁇ l of the original saliva) was applied to a 0.9% agarose gel and subjected to electrophoresis for 1 hour. The gel was stained with ethidium bromide and photographed under transillumination. In each sample lane, the upper band is genomic DNA. The 2 bands in the middle of the gel represent ribosomal RNA that was present in saliva and preserved by the indicated compositions.
- RNA in saliva is stable for at least 3 weeks at room temperature when mixed 1:1 with compositions including a range of anionic detergent concentrations (8-16 % SDS), buffered to a slightly acidic pH (6.2). These data also illustrate considerable variability between subjects in the amount of RNA present in saliva.
- EXAMPLE 7 STABILITY OF RNA IN SALIVA USING THE COMPOSITION OF THE PRESENT INVENTION AT ROOM TEMPERATURE AND 37°C.
- the composition comprised 16 % SDS, 50 mM CDTA, buffered at pH 6.2.
- Saliva samples were mixed 1:1 with the composition and stored for 7 days at either room temperature (RT) or 37°C. Incubating samples at 37 0 C, compared to RT, is expected to accelerate the degradation of RNA by salivary ribonuclease, if present, should it retain activity in the composition of the present invention.
- the samples were heated at 90 0 C for 15 min, then diluted 5-fold and incubated at 50 0 C for 1 hour with proteinase K.
- SDS was precipitated with potassium chloride and, after the precipitate was removed by centrifugation, nucleic acids were precipitated from the supernatant with 2 volumes of cold 95 % ethanol. A portion of each precipitated nucleic acid sample was analyzed by agarose gel electrophoresis, stained with ethidium bromide and photographed under transillumination (Figure 7).
- the sample order of Figure 7 is as follows:
- This example demonstrates the efficacy of the composition of the present invention for stabilizing RNA in samples of saliva. After 1 week at 37°C, saliva samples from 4 subjects showed no appreciable degradation of high molecular weight RNA.
- EXAMPLE 8 TESTING A RNA-ST ABILIZING COMPOSITION CONTAINING A DIFFERENT BUFFER
- RNA present in the saliva/composition mixture the samples were incubated at 50°C for 1 hour with proteinase K, heated at 90 0 C for 15 min, SDS was precipitated with potassium chloride and, after the precipitate was removed by centrifugation, nucleic acids were precipitated from the supernatant with 2 volumes of cold ethanol.
- This example demonstrates the suitability of substituting citric acid for CDTA to buffer the pH of the composition.
- EXAMPLE 9 TESTING THE RNA-STABILIZING SOLUTION USING A DIFFERENT ANIONIC DETERGENT.
- Sarkosyl N-Lauroylsarcosine sodium salt or sodium lauroyl sarcosinate
- Saliva was collected from 3 subjects and mixed 1:1 with two compositions, i) 4 % Sarkosyl, 50 mM CDTA buffered to pH 6.6 and ii) 8 % Sarkosyl, 50 mM CDTA buffered to pH 6.6. Samples were then stored at room temperature for 3 weeks. To extract RNA present in the saliva/composition mixture, a portion of the samples were incubated at 50°C for 1 hour with proteinase K, heated at 90 0 C for 15 min, treated with potassium chloride and centrifuged.
- EXAMPLE 10 DEMONSTRATION THAT A STEP INVOLVING BRIEF HEATING ABOVE 50°C IS BENEFICIAL IN THE EXTRACTION OF RNA FROM SALIVA.
- the composition comprised 4 % SDS, 50 rnM CDTA, buffered at pH 6.6.
- Saliva sample from one subject was mixed 1:1 with the composition and incubated for 6 days at room temperature.
- the samples were first incubated at 50°C for 1 hour with proteinase K to digest protein. Aliquots were taken and heated for 15 minutes at 50 0 C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C or 90 0 C.
- SDS was precipitated from heated aliquots with potassium chloride and, after the precipitate was removed by centrifugation, nucleic acids were precipitated from the supernatant with 2 volumes of cold ethanol.
- a portion of each precipitated nucleic acid sample was analyzed by agarose gel electrophoresis, stained with ethidium bromide and photographed under transillumination (Figure 10).
- the sample order of Figure 10 is as follows:
- EXAMPLE 11 DEMONSTRATION THAT A STEP INVOLVING BRIEF HEATING AT 9O 0 C IS BENEFICIAL IN THE EXTRACTION OF RNA FROM SALIVA.
- the composition comprised 4 % SDS, 50 mM CDTA, buffered at pH 6.6.
- Saliva samples from 2 subjects were mixed 1:1 with the composition and incubated for 4 days at room temperature.
- the samples were first incubated at 5O 0 C for 1 hour with proteinase K to digest protein. Aliquots were taken and heated at 90 0 C for 0, 5, 15, 30 or 60 min, then diluted 4-fold with water and incubated for an additional 18 hours at room, temperature. Dilution of the sample permitted testing the efficiency of the heating step by decreasing the concentration of SDS to a level that would normally permit RNase activity.
- EXAMPLE 12 HUMAN niRNA IS EXTRACTED AND PURIFIED FROM SAMPLES COLLECTED IN THE PRESENT COMPOSITION.
- RT-PCR Reverse Transcriptase-Polymerase Chain Reaction
- Saliva samples from 6 subjects were mixed 1:1 with the composition (4 % SDS, 50 mM CDTA, buffered at pH 6.6) and stored for 10-16 days at room temperature. Following storage at room temperature, a portion of each saliva/composition mixture was heated at 50 0 C for 1 hour with proteinase K, followed by 90 0 C for 15 min. SDS was precipitated with potassium chloride and, after the precipitate was removed by centrifugation, nucleic acids were precipitated from the supernatant with 2 volumes of cold 95 % ethanol. A portion of each precipitated nucleic acid sample was analyzed by agarose gel electrophoresis, stained with ethidium bromide and photographed under transillumination ( Figure 12).
- mRNA messenger RNA
- Figure 13 a portion of purified sample from each subject served as template in RT-PCR analysis using human-specific primers for ⁇ 2-microglobulin messenger RNA ( Figure 13). Specifically, a portion of precipitated nucleic acid sample from each subject ( Figure 12) was treated with DNase to digest DNA. The DNA-free sample was then mixed with random hexanucleotide primers and M-MVL reverse transcriptase to synthesize complementary DNA (cDNA).
- cDNA complementary DNA
- EXAMPLE 13 PRESERVATION, RELEASE AND PURIFICATION OF VIRAL RNA MIXED WITH SALIVA COLLECTED IN THE COMPOSITION OF THE PRESENT INVENTION.
- RT-PCR Reverse Transcriptase-Polymerase Chain Reaction
- VSV Vesicular Stomatitis Virus
- RNA was used as template in RT-PCR, primed with random hexanucleotide. Specifically, a portion of the sample was mixed with random hexanucleotide primers and M-MVL reverse transcriptase to synthesize complementary DNA (cDNA). A portion of the cDNA was mixed with virus-specific primers (VSV-forward 5' ggattattccctctgcc and VSV-reverse 5' gttccctttctgtggtag), Taq DNA polymerase and SybrGreen and analysed by quantitative real-time PCR analysis.
- virus-specific primers VSV-forward 5' ggattattccctctgcc and VSV-reverse 5' gttccctttctgtggtag
- the Ct value is inversely proportional to the amount of virus template RNA in the sample.
- Plasmid DNA encoding the virus sequences served as a positive control for RT-PCR analysis. Negative controls include reactions in which no M-MVL RT (-RT) or no cDNA was added. RT-PCR results are shown for three separate experiments (Tables III- V). Table III
- This example demonstrates that viral RNA in saliva is stabilized by the composition of the present invention and the extracted material is suitable for RT-PCR analysis.
- the composition comprised 4% SDS, 50 mM LiCDTA, 250 mM LiCl, adjusted to pH 6.8.
- Saliva samples (2 mL) from 10 subjects were collected and mixed 1:1 with the composition. Immediately after collection, the samples were vigorously shaken and 100 ⁇ L aliquots were removed. Individual aliquots were stored at room temperature (RT), 4 0 C, and -20°C. Following 1 week and 8 weeks storage at RT, 4°C, and -20°C, the samples were analysed. To extract RNA from the saliva/composition mixture, the aliquots were heated at 50°C for 1 hour in the presence of proteinase K, then at 9O 0 C for 15 min.
- cDNA complementary DNA
- human-specific primers human 18S-165 forward 5' gtggagcgatttgtctggtt and human 18S-165 reverse 5' ggacatctaagggcatcacag
- Taq DNA polymerase and SybrGreen for quantitative real-time PCR analysis.
- the Ct (Crossing Threshold) values are inversely proportional to the amount of 18S RNA in the sample.
- RNA purified from a human colon carcinoma cell line, HCT-116 served as a positive control for RT-PCR analysis.
- Negative controls include reactions in which no M-MVL RT (-RT) or no cDNA/template was added.
- EXAMPLE 15 EXTRACTION AND PURIFICATION OF HUMAN RNA FROM INFANTS AND YOUNG CHILDREN.
- RT-PCR can be used to detect human-specific messenger RNA in RNA recovered from the saliva of 11 infants and young children in the composition of the present invention.
- Saliva sample collection was facilitated using foam- tipped swabs (5 swabs per subject) since said subjects were not capable of delivering 1-2 mL of saliva directly into a collection device.
- a small amount of sugar was used to stimulate the secretion of saliva from young children.
- scissors were used to cut the foam tips of each swab into a collection device containing the composition (2 mL) of the present invention, comprised of 4% SDS, 50 mM LiCDTA, 250 mM LiCl, adjusted to pH 6.8.
- the samples were vigorously shaken and stored at room temperature (RT). Following storage at RT for up to a week, the samples were heated at 50 0 C for 1 hour in the presence of proteinase K. Saliva/composition was recovered from the foam tips by low-speed centrifugation as follows. The tips were transferred into the barrel of a 5 mL plastic syringe placed inside a 15 mL conical tube, which was subjected to low-speed centrifugation. The recovered liquid was pooled with the sample remaining in the collection device.
- RNA from saliva samples were heated at 90°C for 15 min, SDS was precipitated with potassium chloride and, after the precipitate was removed by centrifugation, nucleic acids were precipitated from the supernatant with 2 volumes of cold 95 % ethanol.
- RT-PCR Reverse Transcriptase-PCR
- a portion of precipitated nucleic acid sample from each subject was treated with DNase to remove DNA prior to the Reverse Transcriptase step.
- the DNA-free sample was then mixed with random hexanucleotide primers and M-MVL reverse transcriptase to synthesize complementary DNA (cDNA).
- Negative controls include reactions in which no M-MVL RT (-RT) or no cDNA/template was added.
- EXAMPLE 16 PROTOCOL FOR OBTAINING FROM THE NASAL CAVITY OF SUBJECTS A NOVEL SOURCE OF HUMAN RNA
- Mucosal cells may be scraped using rigid or flexible brushes, swabs, or plastic/wood scrapers and cells may be flushed from the nasal cavity by introducing a liquid (e.g., saline) and recovering the liquid.
- a liquid e.g., saline
- a rigid swab/brush can be placed in the anterior of the nose and a flexible swab/brush into the posterior nasopharyngeal cavity and used to collect mucosal secretions and to gently rub off cells from the mucosal membrane.
- Samples collected with said liquid and/or implement(s) can be delivered into a collection device containing the composition of the present invention.
- a cutting device e.g. scissors
- swabs or brushes with handles that snap under pressure as well as swabs or brushes with a moulded breakpoint in the handle/shaft, can be used to facilitate sample collection.
- the 'full length' handle facilitates the collection of a sample and shortening of the swab/brush at the engineered break point permits a better fit into the collection device.
- RNA samples taken from the nasal cavity Fresh tissue specimens/biopsies (e.g., normal nasal mucosa or nasal polyp tissue) obtained from patients undergoing rhinoplasty or endoscopic sinus surgery can be collected in the composition of the present invention for subsequent RNA isolation.
- Fresh tissue specimens/biopsies e.g., normal nasal mucosa or nasal polyp tissue
- RNA isolation e.g., endoscopic sinus surgery
- a nasal sample anterior nasal or nasopharyngeal
- the swab or implement selected to collect such samples must 1) be appropriately sized and shaped to fit within and reach the intended cavity (e.g. nostril, nasopharyngeal cavity), 2) be made from materials considered safe (e.g. free of chemical residues) and clean/sterile (e.g. nucleic acid-free), and 3) have a handle with appropriate flexibility/rigidity and length to facilitate sample collection. If the sample collection implement is a swab, the end of the swab intended to collect sample (e.g. foam mitt) should be tightly adhered to the handle.
- RNA-containing sample can be maintained at room temperature for months.
- a portion of the RNA-containing sample in aqueous solution can be used as a RNA template for a reverse transcription (RT) reaction to produce complementary DNA (cDNA), which can then be used in a PCR reaction.
- RT reverse transcription
- cDNA complementary DNA
- the composition comprised 4% SDS, 50 mM LiCDTA, 250 mM LiCl, adjusted to pH 6.8.
- Anterior nasal samples were collected with 2 foam-tipped swabs per subject. Immediately following sample collection, scissors were used to cut the foam tips of each swab into a collection device containing the composition (2 mL) of the present invention. The samples were vigorously shaken and stored at room temperature (RT). Following 1 day and 4 weeks storage at RT, an aliquot from each sample was analysed. To extract RNA from nasal samples, the aliquots were heated at 50°C for 1 hour in the presence of proteinase K, then at 90°C for 15 min. SDS was precipitated with potassium chloride and, after the precipitate was removed by centrifugation, nucleic acids were precipitated from the supernatant with 2 volumes of cold 95 % ethanol.
- RT-PCR Reverse Transcriptase-PCR
- a portion of precipitated nucleic acid sample from each subject was treated with DNase to remove DNA prior to the Reverse Transcriptase step.
- the DNA-free sample was then mixed with random hexanucleotide primers and M-MVL reverse transcriptase to synthesize complementary DNA (cDNA).
- Negative controls include reactions in which no M-MVL RT (-RT) or no cDNA/template was added.
- This example demonstrate the efficacy of the composition of the present invention for stabilizing RNA in samples collected from the nasal cavity for long periods of time at room temperature. After 4 weeks, anterior nasal samples from 7 subjects showed no significant change in the Ct value for human 18S ribosomal RNA (as shown in Table VIII). Importantly, this example demonstrates that the nasal cavity is novel source of human RNA.
- EXAMPLE 18 PROTOCOL FOR OBTAINING SALIVA FROM A HUMAN SUBJECT
- This example provides one example of the steps that may be followed to collect saliva from a subject.
- the saliva sample may be stored at room temperature (15- 30 0 C) EXAMPLE 19 - PROTOCOL FOR THE PURIFICATION OF RNA
- composition of the present invention provides one example of the steps that may be followed to isolate RNA from a sample stored using the. composition of the present invention.
- a composition of the present invention is combined with a sample (such as saliva), and stored at room temperature.
- the sample/composition mixture can be subsequently processed to purify RNA from the sample, using the following steps:
- Qiagen RNeasy Micro Kit (Cat. No. 74004) and instructions. Components of the RNeasy kit: RLT buffer, MinElute spin column, collection tubes, RWl buffer, DNase I stock solution, RDD buffer, RPE buffer and RNase-free water. Alternatively, the Qiagen RNeasy Mini Kit (Cat. No. 74104) can be used in combination with the Qiagen RNase-Free DNase Set (Cat. No. 79254).
- Samples may be stored at room temperature for up to 8 weeks or stored frozen at -20 0 C indefinitely.
- EXAMPLE 20 EXTRACTION AND PURIFICATION HUMAN RNA FROM CHILDREN FROM NASAL SAMPLES IN THE COMPOSITION OF THE PRESENT INVENTION.
- RT-PCR was used to detect human-specific messenger RNA in RNA recovered from the anterior nasal cavity of 6 young children in the composition of the present invention.
- Samples were collected using two foam-tipped swabs, one swab per nostril. Specifically, an adult inserted the foam tip into the child's anterior/lower nasal cavity and swabbed the mucosal membrane with the foam tip by moving the swab in a circular motion. The procedure was repeated for the second nostril with a fresh swab.
- each swab into a collection device containing the composition (2 mL) of the present invention, comprised of 4% SDS, 50 mM LiCDTA, 250 mM LiCl, adjusted to pH 6.8.
- the samples were vigorously shaken and stored at room temperature (RT). Following storage at RT for 1-4 days, the samples were heated at 50 0 C for 1 hour in the presence of proteinase K.
- the nasal sample/composition mixture absorbed by the foam tips was recovered by low-speed centrifugation as follows.
- the foam tips (2 per child) were transferred into the barrel of a 5 mL plastic syringe placed inside a 15 mL conical tube, which was subjected to low-speed centrifugation.
- the nasal sample/composition recovered from the foam tips into the 15 mL conical tube was pooled with the nasal sample/composition still in the collection device.
- To extract RNA from nasal samples aliquots (500 ⁇ L) were heated at 9O 0 C for 15 min, SDS was precipitated with potassium chloride, the precipitate was removed by centrifugation, and nucleic acids were precipitated from the resultant supernatant with 2 volumes of cold 95 % ethanol. The final nucleic acid pellet was dissolved in ribonuclease- free water.
- RT-PCR Reverse Transcriptase-PCR
- S rRNA human 18S ribosomal RNA
- a portion of precipitated nucleic acid sample from each subject was treated with DNase to remove DNA prior to the Reverse Transcriptase step.
- the DNA-free sample was then mixed with random hexanucleotide primers and M- MVL reverse transcriptase to synthesize complementary DNA (cDNA).
- This example demonstrates the efficacy of the composition of the present invention for extracting and stabilizing RNA in anterior nasal samples from children.
- EXAMPLE 22 PROTOCOL FOR OBTAINING SAMPLE FROM THE NASAL AND ORAL CAVITIES OF LIVESTOCK.
- Nasal and oral samples can be collected from livestock, including beef cattle, dairy cows, sheep, goats, hogs, poultry and horses.
- nasal or oral samples can be readily collected from dairy cows (Bovidae Bos taurus) while the cow is standing in stanchions in the milking parlour, or while tied in pens.
- dairy cows Bovidae Bos taurus
- the assistance of a handler may, or may not, be required to restrain/steady the animal's head for nasal sample collection or open the animal's mouth for oral sample collection.
- a variety of implements may be used to collect nasal and oral samples from livestock. For example, im ⁇ lement(s) the same as or similar to those described above in Example 16 may be used.
- Example 23 RNA STABILIZED IN NASAL SAMPLES FROM HOLSTEIN DAIRY COWS (Bovidae bos) USING THE COMPOSITION OF THE PRESENT INVENTION.
- the composition comprised 4% SDS, 50 mM LiCDTA, 250 mM LiCl, adjusted to pH 6.8.
- Anterior nasal samples were collected with one large foam-tipped swab (head length 2.6 cm, head width 1.2 cm, swab length 15.1 cm) per cow. In each case, the cow's head was steadied by a 'handler' while a 'collector' quickly inserted the foam tip of the swab into the cow's nostril, specifically the anterior nose. The foam tip was quickly wiped against the mucous membrane of the anterior nose/nostril and then withdrawn. For the most part, a 'handler' is not needed for the collection of nasal samples from calves. Immediately following collection, scissors were used to cut the foam tip of the swab into a collection device containing the composition (2 mL) of the present invention. The samples were vigorously shaken and stored at room temperature (RT).
- RT room temperature
- the sample/composition mixture absorbed by the foam tip was recovered by low-speed centrifugation as follows. Forceps were used to transfer the foam tip into the barrel of a 5 mL plastic syringe situated inside a 15 mL conical tube, which was subjected to low-speed centrifugation. The sample/composition recovered from foam tips by this process was pooled with the sample/composition in the collection device.
- RNA from nasal samples each aliquot was heated at 50°C for 1 hour in the presence of proteinase K and then 90°C for 15 min, SDS was precipitated with potassium chloride and, after the precipitate was removed by centrifugation, nucleic acids were precipitated from the supernatant with 2 volumes of cold 95 % ethanol. The final nucleic acid pellet was dissolved in ribonuclease-free water.
- RT-PCR Reverse Transcriptase-PCR
- a portion of precipitated nucleic acid sample from each dairy cow was treated with DNase to remove DNA prior to the Reverse Transcriptase step.
- the DNA-free sample was then mixed with random hexanucleotide primers and M-MVL reverse transcriptase to synthesize complementary DNA (cDNA).
- the cDNA was diluted 10- fold and mixed with 18S ribosomal RNA primers (18S-165 forward 5' gtggagcgatttgtctggtt and 18S-165 reverse 5' ggacatctaagggcatcacag), Taq DNA polymerase and Syto9 for quantitative real-time PCR analysis.
- the Ct (Crossing Threshold) values are inversely proportional to the amount of 18S ribosomal RNA in the sample.
- HCT-116 RNA served as a positive control for RT-PCR analysis. Negative controls include reactions in which no M-MVL RT (-RT) or no cDNA/template was added.
- This example demonstrates the efficacy of the composition of the present invention for extracting and stabilizing RNA in samples collected from the anterior nasal cavity of dairy cows (as shown in Table X). Importantly, this example demonstrates that the nasal cavity is a novel and abundant source of messenger RNA in cattle.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Saccharide Compounds (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/444,447 US20100099149A1 (en) | 2006-10-06 | 2007-10-05 | Stabilizing compositions and methods for extraction of ribonucleic acid |
| AU2007304776A AU2007304776A1 (en) | 2006-10-06 | 2007-10-05 | Stabilizing compositions and methods for extraction of ribonucleic acid |
| JP2009530744A JP2010505396A (ja) | 2006-10-06 | 2007-10-05 | リボ核酸を抽出するための安定化組成物および方法 |
| EP07855412A EP2066686A4 (en) | 2006-10-06 | 2007-10-05 | STABILIZING COMPOSITIONS AND METHODS FOR EXTRACTING A RIBONUCLEIC ACID |
| CA2664696A CA2664696C (en) | 2006-10-06 | 2007-10-05 | Stabilizing compositions and methods for extraction of ribonucleic acid |
| NZ576003A NZ576003A (en) | 2006-10-06 | 2007-10-05 | Stabilizing compositions and methods for extraction of ribonucleic acid |
| IL197916A IL197916A (en) | 2006-10-06 | 2009-04-05 | Stabilizing preparations and methods for extracting ribonucleic acid |
| US15/160,712 US10000795B2 (en) | 2006-10-06 | 2016-05-20 | Stabilizing compositions and methods for extraction of ribonucleic acid |
| US15/980,682 US10767215B2 (en) | 2006-10-06 | 2018-05-15 | Stabilizing compositions and methods for extraction of ribonucleic acid |
| US17/014,688 US20210198717A1 (en) | 2006-10-06 | 2020-09-08 | Stabilizing compositions and methods for extraction of ribonucleic acid |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US82856306P | 2006-10-06 | 2006-10-06 | |
| US60/828,563 | 2006-10-06 | ||
| US86698506P | 2006-11-22 | 2006-11-22 | |
| US60/866,985 | 2006-11-22 | ||
| US94977807P | 2007-07-13 | 2007-07-13 | |
| US60/949,778 | 2007-07-13 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/444,447 A-371-Of-International US20100099149A1 (en) | 2006-10-06 | 2007-10-05 | Stabilizing compositions and methods for extraction of ribonucleic acid |
| US15/160,712 Division US10000795B2 (en) | 2006-10-06 | 2016-05-20 | Stabilizing compositions and methods for extraction of ribonucleic acid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2008040126A1 true WO2008040126A1 (en) | 2008-04-10 |
Family
ID=39268089
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2007/001785 Ceased WO2008040126A1 (en) | 2006-10-06 | 2007-10-05 | Stabilizing compositions and methods for extraction of ribonucleic acid |
Country Status (9)
| Country | Link |
|---|---|
| US (4) | US20100099149A1 (https=) |
| EP (1) | EP2066686A4 (https=) |
| JP (2) | JP2010505396A (https=) |
| AU (1) | AU2007304776A1 (https=) |
| CA (1) | CA2664696C (https=) |
| IL (1) | IL197916A (https=) |
| NZ (1) | NZ576003A (https=) |
| SG (1) | SG179454A1 (https=) |
| WO (1) | WO2008040126A1 (https=) |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008145705A1 (de) * | 2007-05-31 | 2008-12-04 | Qiagen Gmbh | Butendisäure oder deren derivate zur behandlung einer biologischen probe |
| WO2009142743A1 (en) * | 2008-05-20 | 2009-11-26 | Cantimer, Inc. | Methods, systems and devices for analyzing a surfactant-treated biological fluid sample |
| WO2010083844A1 (en) | 2009-01-26 | 2010-07-29 | Quantibact A/S | Methods and uses for rna extract and storage |
| CN103097531A (zh) * | 2011-06-29 | 2013-05-08 | 达纳福股份有限公司 | 生物样本的预处理方法、rna的检测方法及预处理试剂盒 |
| EP2598661A4 (en) * | 2010-07-26 | 2013-12-04 | Biomatrica Inc | COMPOSITIONS FOR STABILIZING DNA, RNA AND PROTEINS IN STORAGE AND OTHER BIODEGRADES DURING TRANSPORT AND STORAGE IN AMBIENT TEMPERATURES |
| EP2598660A4 (en) * | 2010-07-26 | 2013-12-04 | Biomatrica Inc | COMPOSITIONS FOR STABILIZING DNA, RNA AND PROTEINS IN BLOOD AND OTHER BIODEGRADS DURING TRANSPORT AND STORAGE IN AMBIENT TEMPERATURES |
| US8900856B2 (en) | 2004-04-08 | 2014-12-02 | Biomatrica, Inc. | Integration of sample storage and sample management for life science |
| WO2015031994A1 (en) * | 2013-09-03 | 2015-03-12 | Dna Genotek Inc. | Method and composition for nucleic acid storage from blood fractions |
| US9079181B2 (en) | 2008-08-21 | 2015-07-14 | Dna Genotek Inc. | Sample receiving device |
| US9725703B2 (en) | 2012-12-20 | 2017-08-08 | Biomatrica, Inc. | Formulations and methods for stabilizing PCR reagents |
| CN108350457A (zh) * | 2015-10-30 | 2018-07-31 | 株式会社博纳克 | 稳定地含有抑制TGF-β1基因的表达的单链核酸分子的组合物 |
| US10064404B2 (en) | 2014-06-10 | 2018-09-04 | Biomatrica, Inc. | Stabilization of thrombocytes at ambient temperatures |
| US10568317B2 (en) | 2015-12-08 | 2020-02-25 | Biomatrica, Inc. | Reduction of erythrocyte sedimentation rate |
| US10793922B2 (en) | 2014-10-20 | 2020-10-06 | Envirologix Inc. | Compositions and methods for detecting an RNA virus |
| US11002646B2 (en) | 2011-06-19 | 2021-05-11 | DNA Genotek, Inc. | Devices, solutions and methods for sample collection |
| US20220010299A1 (en) * | 2020-07-13 | 2022-01-13 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and Methods to Enhance RNA Stability and Translation and Uses Thereof |
| US11505836B2 (en) | 2014-04-22 | 2022-11-22 | Envirologix Inc. | Compositions and methods for enhancing and/or predicting DNA amplification |
| US11753616B2 (en) | 2014-05-27 | 2023-09-12 | DNA Genotek, Inc. | Composition and method for stabilizing and maintaining the viability of hardy microorganisms |
| US11866773B2 (en) | 2012-04-09 | 2024-01-09 | Envirologix Inc. | Isolated oligonucleotides containing modified nucleotides |
| US12043866B2 (en) | 2010-08-13 | 2024-07-23 | Envirologix Inc. | Compositions and methods for quantifying a nucleic acid sequence in a sample |
Families Citing this family (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7482116B2 (en) | 2002-06-07 | 2009-01-27 | Dna Genotek Inc. | Compositions and methods for obtaining nucleic acids from sputum |
| US8221381B2 (en) | 2005-12-09 | 2012-07-17 | Dna Genotek Inc. | Container system for releasably storing a substance |
| AU2007304776A1 (en) | 2006-10-06 | 2008-04-10 | Dna Genotek Inc. | Stabilizing compositions and methods for extraction of ribonucleic acid |
| US8975026B2 (en) | 2007-01-16 | 2015-03-10 | Somalogic, Inc. | Method for generating aptamers with improved off-rates |
| US8703416B2 (en) * | 2008-07-17 | 2014-04-22 | Somalogic, Inc. | Method for purification and identification of sperm cells |
| EP3789500A1 (en) | 2011-08-12 | 2021-03-10 | QIAGEN GmbH | Method for isolating nucleic acids |
| JP5904153B2 (ja) * | 2013-03-29 | 2016-04-13 | ソニー株式会社 | 核酸増幅反応用試料の調製方法、核酸増幅方法、固相状核酸増幅反応用試薬及びマイクロチップ |
| WO2015017701A1 (en) | 2013-08-01 | 2015-02-05 | Ancestry.Com Dna, Llc | Sample collection device |
| KR102392407B1 (ko) * | 2014-03-07 | 2022-04-29 | 디엔에이 제노텍 인코퍼레이티드 | 생물학적 샘플에서 핵산을 안정화하기 위한 조성물 및 방법 |
| JP6435139B2 (ja) * | 2014-09-02 | 2018-12-05 | 国立大学法人 鹿児島大学 | 染色体キメラの検出方法 |
| US9896682B2 (en) | 2015-03-06 | 2018-02-20 | Bio-Rad Laboratories, Inc. | Stabilized RNA solutions |
| ES2818569T3 (es) | 2015-09-09 | 2021-04-13 | Drawbridge Health Inc | Métodos para la recopilación, estabilización y conservación de muestras |
| US10905113B2 (en) | 2015-11-12 | 2021-02-02 | Regents Of The University Of Minnesota | Compositions and method for storing liquid biospecimens |
| JP6733951B2 (ja) * | 2016-05-09 | 2020-08-05 | 日本メナード化粧品株式会社 | 核酸保存用組成物及び核酸保存方法 |
| EP3464589A4 (en) | 2016-05-31 | 2020-02-26 | DNA Genotek Inc. | A composition, system and method for removal of detergents from aqueous solutions |
| WO2018170186A1 (en) | 2017-03-15 | 2018-09-20 | Ancestry.Com Dna, Llc | Sample collection device and method |
| NZ764035A (en) | 2017-10-06 | 2020-05-29 | Ancestry Com Dna Llc | Systems, devices, and methods for sample collection |
| US11426734B2 (en) | 2017-11-22 | 2022-08-30 | Ancestry.Com Dna, Llc | Sample collection kit including cap having selectively movable sleeve |
| MX2020005246A (es) | 2017-11-22 | 2020-11-09 | Ancestry Com Dna Llc | Kit de recolección de muestras que incluye tapa con manguito que se puede mover de manera selectiva. |
| LT3752836T (lt) | 2018-02-14 | 2023-02-10 | Salignostics Ltd. | Sudėtinių dalių aptikimo būdai ir aparatas |
| CA3120086A1 (en) * | 2018-11-14 | 2020-05-22 | Spectrum Solutions L.L.C. | Rna preservation solution and methods of manufacture and use |
| US11712692B2 (en) | 2018-11-20 | 2023-08-01 | Spectrum Solutions L.L.C. | Sample collection system including sealing cap and valve |
| AU2020227306A1 (en) | 2019-02-27 | 2021-10-07 | Ancestry.Com Dna, Llc | Graphical user interface displaying relatedness based on shared DNA |
| US11968975B2 (en) | 2019-04-30 | 2024-04-30 | Regents Of The University Of Minnesota | Compositions and methods for storing liquid biospecimens |
| US11701094B2 (en) | 2019-06-20 | 2023-07-18 | Spectrum Solutions L.L.C. | Sample collection system including valve and plug assemblies |
| EP4120907A4 (en) * | 2020-03-16 | 2024-05-08 | Seegene, Inc. | SAMPLING KIT USED IN DETERMINATION OF RESPIRATORY INFECTION |
| KR102370468B1 (ko) * | 2020-03-18 | 2022-03-03 | 재단법인대구경북과학기술원 | 생체 시료 내 잔존하는 음이온 계면 활성제와 이와 결합한 지질 또는 단백질 결합체, 및 마이셀을 제거하는 조성물, 방법 및 이의 용도 |
| EP3996732A4 (en) * | 2020-04-14 | 2022-08-24 | Spectrum Solutions, LLC | ASSAYS AND METHODS FOR DETECTION OF VIRAL NUCLEIC ACIDS |
| US11926877B2 (en) | 2020-06-18 | 2024-03-12 | The Board Of Trustees Of The University Of Illinois | Saliva-based molecular testing for SARS-CoV-2 |
| WO2021044064A1 (de) * | 2020-06-22 | 2021-03-11 | Lead Horizon Gmbh | Vorrichtung zur gewinnung einer rachenspülprobe |
| AT17544U1 (de) * | 2020-06-22 | 2022-07-15 | Lead Horizon Gmbh | Vorrichtung zur gewinnung einer rachenspülprobe |
| US11207057B1 (en) | 2020-08-07 | 2021-12-28 | Cyrano Medical, Inc. | Nasopharyngeal sample collection devices and methods |
| US11724077B2 (en) * | 2021-07-28 | 2023-08-15 | Subhash Dhawan | Therapeutic swabs for treating upper respiratory infections |
| US12332902B2 (en) | 2022-04-20 | 2025-06-17 | Ancestry.Com Dna, Llc | Filtering individual datasets in a database |
| WO2024189656A1 (en) * | 2023-03-16 | 2024-09-19 | Pt. Jawahar Lal Nehru Memorial Medical College | An in-vitro method and a kit for determining the severity of covid-19 outcome |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003104251A2 (en) * | 2002-06-07 | 2003-12-18 | Dna Genotek Inc. | Composition and methods for obtaining nucleic acids from sputum |
| WO2004033470A2 (en) * | 2002-10-04 | 2004-04-22 | Whatman, Inc. | Methods and materials for using chemical compounds as a tool for nucleic acid storage on media of nucleic acid purification systems |
Family Cites Families (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4935340A (en) * | 1985-06-07 | 1990-06-19 | Eli Lilly And Company | Method of isolating antibiotic biosynthetic genes |
| US5756126A (en) * | 1991-05-29 | 1998-05-26 | Flinders Technologies Pty. Ltd. | Dry solid medium for storage and analysis of genetic material |
| US5234809A (en) * | 1989-03-23 | 1993-08-10 | Akzo N.V. | Process for isolating nucleic acid |
| DE4034036C2 (de) * | 1990-10-26 | 1994-03-03 | Diagen Inst Molekularbio | Vorrichtung und Verfahren zur Isolierung von Nukleinsäuren aus Zellsuspensionen |
| AU664050B2 (en) * | 1991-12-18 | 1995-11-02 | Becton Dickinson & Company | Process for lysing mycobacteria |
| US5512440A (en) * | 1991-12-18 | 1996-04-30 | Becton Dickinson And Company | Process for lysing Mycobacteria |
| US6551791B1 (en) * | 1995-12-21 | 2003-04-22 | University Of Florida | Rapid diagnostic method for distinguishing allergies and infections and nasal secretion collection unit |
| US5973137A (en) * | 1996-02-13 | 1999-10-26 | Gentra Systems, Inc. | Low pH RNA isolation reagents, method, and kit |
| US5939262A (en) * | 1996-07-03 | 1999-08-17 | Ambion, Inc. | Ribonuclease resistant RNA preparation and utilization |
| US5939259A (en) * | 1997-04-09 | 1999-08-17 | Schleicher & Schuell, Inc. | Methods and devices for collecting and storing clinical samples for genetic analysis |
| US6071745A (en) * | 1997-06-27 | 2000-06-06 | Bio-Rad Laboratories | Method and formulation for lyophilizing cultured human cells to preserve RNA and DNA contained in cells for use in molecular biology experiments |
| US7626017B2 (en) * | 1997-10-31 | 2009-12-01 | Pressure Biosciences, Inc. | Pressure-enhanced extraction and purification |
| US7244828B2 (en) * | 1997-11-07 | 2007-07-17 | Aftab Alam | Agent for protein precipitation, a method of protein precipitation, a method of protein assay using protein precipitation agent, and a kit for protein assay |
| US6204375B1 (en) * | 1998-07-31 | 2001-03-20 | Ambion, Inc. | Methods and reagents for preserving RNA in cell and tissue samples |
| DE19836559A1 (de) * | 1998-08-12 | 2000-03-23 | Antigen Gmbh | Gefäß zur Entnahme von Blut |
| US6777210B1 (en) * | 1998-09-24 | 2004-08-17 | Ambion, Inc. | Method and reagents for inactivating ribonucleases RNase A, RNase I and RNase T1 |
| DE60044977D1 (de) * | 1999-09-24 | 2010-10-28 | Ambion Inc | Cocktail von nukleaseinhibitoren |
| US6409528B1 (en) * | 1999-12-06 | 2002-06-25 | Becton, Dickinson And Company | Device and method for collecting, preparation and stabilizing a sample |
| US7005266B2 (en) * | 2000-02-04 | 2006-02-28 | Qiagen Gmbh | Nucleic acid isolation from stool samples and other inhibitor-rich biological materials |
| US6602718B1 (en) * | 2000-11-08 | 2003-08-05 | Becton, Dickinson And Company | Method and device for collecting and stabilizing a biological sample |
| US7029840B2 (en) * | 2000-11-15 | 2006-04-18 | Becton, Dickinson And Company | Method for preservation of cells and nucleic acid targets |
| US7001724B1 (en) * | 2000-11-28 | 2006-02-21 | Applera Corporation | Compositions, methods, and kits for isolating nucleic acids using surfactants and proteases |
| US20030170694A1 (en) * | 2001-12-21 | 2003-09-11 | Daniel Wall | Stabilized nucleic acids in gene and drug discovery and methods of use |
| DE10219117C1 (de) * | 2002-04-29 | 2003-10-30 | Adnagen Ag | Verfahren zur Stabilisierung von RNS und Verwendungen von Stabilisierungspuffern |
| US8158357B2 (en) | 2005-03-16 | 2012-04-17 | Dna Genotek Inc. | Compositions and method for storage of nucleic acid from bodily fluids |
| WO2006119292A2 (en) * | 2005-04-29 | 2006-11-09 | Henkin, Robert | Methods for detection of biological substances |
| US20070015165A1 (en) * | 2005-07-13 | 2007-01-18 | Sigma-Aldrich Co. | Method for the isolation of RNA from biological sources |
| US8221381B2 (en) | 2005-12-09 | 2012-07-17 | Dna Genotek Inc. | Container system for releasably storing a substance |
| EP1996070A2 (en) | 2006-03-17 | 2008-12-03 | The Regents of the University of California | Collection assembly for obtaining oral samples from an animal |
| AU2007304776A1 (en) * | 2006-10-06 | 2008-04-10 | Dna Genotek Inc. | Stabilizing compositions and methods for extraction of ribonucleic acid |
-
2007
- 2007-10-05 AU AU2007304776A patent/AU2007304776A1/en not_active Abandoned
- 2007-10-05 NZ NZ576003A patent/NZ576003A/en unknown
- 2007-10-05 WO PCT/CA2007/001785 patent/WO2008040126A1/en not_active Ceased
- 2007-10-05 US US12/444,447 patent/US20100099149A1/en not_active Abandoned
- 2007-10-05 JP JP2009530744A patent/JP2010505396A/ja active Pending
- 2007-10-05 SG SG2012016606A patent/SG179454A1/en unknown
- 2007-10-05 EP EP07855412A patent/EP2066686A4/en not_active Ceased
- 2007-10-05 CA CA2664696A patent/CA2664696C/en active Active
-
2009
- 2009-04-05 IL IL197916A patent/IL197916A/en active IP Right Grant
-
2013
- 2013-11-05 JP JP2013229632A patent/JP2014057590A/ja active Pending
-
2016
- 2016-05-20 US US15/160,712 patent/US10000795B2/en active Active
-
2018
- 2018-05-15 US US15/980,682 patent/US10767215B2/en active Active
-
2020
- 2020-09-08 US US17/014,688 patent/US20210198717A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003104251A2 (en) * | 2002-06-07 | 2003-12-18 | Dna Genotek Inc. | Composition and methods for obtaining nucleic acids from sputum |
| WO2004033470A2 (en) * | 2002-10-04 | 2004-04-22 | Whatman, Inc. | Methods and materials for using chemical compounds as a tool for nucleic acid storage on media of nucleic acid purification systems |
Non-Patent Citations (5)
| Title |
|---|
| BIRNBOIM H.C.: "New method for extraction of ribonucleic acid and polyribosomes from Schizosaccharomyces pombe", JOURNAL OF BACTERIOLOGY, vol. 107, no. 3, September 1971 (1971-09-01), pages 659 - 663, XP008105356 * |
| CROXSON M.C. AND BELLAMY A.R.: "Extraction of rotavirus from human feces by treatment with lithium dodecyl sulfate", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 41, no. 1, January 1981 (1981-01-01), pages 255 - 260, XP008105353 * |
| RAHMAN M. ET AL.: "Chromatography paper strip method for collection, transporation, and storage of rotavirus RNA in stool samples", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 42, no. 4, April 2004 (2004-04-01), pages 1605 - 1608, XP008105354 * |
| See also references of EP2066686A4 * |
| WOLLANTS E. ET AL.: "Evaluation of norovirus sampling method using sodium dodecyl sulfate/EDTA-pretreated chromatography paper strips", JOURNAL OF VIROLOGICAL METHODS, vol. 122, 2004, pages 45 - 48, XP004603072 * |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8900856B2 (en) | 2004-04-08 | 2014-12-02 | Biomatrica, Inc. | Integration of sample storage and sample management for life science |
| US9078426B2 (en) | 2004-04-08 | 2015-07-14 | Biomatrica, Inc. | Integration of sample storage and sample management for life science |
| WO2008145705A1 (de) * | 2007-05-31 | 2008-12-04 | Qiagen Gmbh | Butendisäure oder deren derivate zur behandlung einer biologischen probe |
| WO2009142743A1 (en) * | 2008-05-20 | 2009-11-26 | Cantimer, Inc. | Methods, systems and devices for analyzing a surfactant-treated biological fluid sample |
| US8349610B2 (en) | 2008-05-20 | 2013-01-08 | Cantimer, Inc. | Methods, systems and devices for analyzing a surfactant-treated biological fluid sample |
| US9079181B2 (en) | 2008-08-21 | 2015-07-14 | Dna Genotek Inc. | Sample receiving device |
| WO2010083844A1 (en) | 2009-01-26 | 2010-07-29 | Quantibact A/S | Methods and uses for rna extract and storage |
| US9376709B2 (en) | 2010-07-26 | 2016-06-28 | Biomatrica, Inc. | Compositions for stabilizing DNA and RNA in blood and other biological samples during shipping and storage at ambient temperatures |
| US9845489B2 (en) | 2010-07-26 | 2017-12-19 | Biomatrica, Inc. | Compositions for stabilizing DNA, RNA and proteins in saliva and other biological samples during shipping and storage at ambient temperatures |
| EP2598661A4 (en) * | 2010-07-26 | 2013-12-04 | Biomatrica Inc | COMPOSITIONS FOR STABILIZING DNA, RNA AND PROTEINS IN STORAGE AND OTHER BIODEGRADES DURING TRANSPORT AND STORAGE IN AMBIENT TEMPERATURES |
| US9999217B2 (en) | 2010-07-26 | 2018-06-19 | Biomatrica, Inc. | Compositions for stabilizing DNA, RNA, and proteins in blood and other biological samples during shipping and storage at ambient temperatures |
| EP2598660A4 (en) * | 2010-07-26 | 2013-12-04 | Biomatrica Inc | COMPOSITIONS FOR STABILIZING DNA, RNA AND PROTEINS IN BLOOD AND OTHER BIODEGRADS DURING TRANSPORT AND STORAGE IN AMBIENT TEMPERATURES |
| US12043866B2 (en) | 2010-08-13 | 2024-07-23 | Envirologix Inc. | Compositions and methods for quantifying a nucleic acid sequence in a sample |
| US11002646B2 (en) | 2011-06-19 | 2021-05-11 | DNA Genotek, Inc. | Devices, solutions and methods for sample collection |
| US11592368B2 (en) | 2011-06-19 | 2023-02-28 | DNA Genotek, Inc. | Method for collecting and preserving a biological sample |
| US11549870B2 (en) | 2011-06-19 | 2023-01-10 | DNA Genotek, Inc. | Cell preserving solution |
| US11536632B2 (en) | 2011-06-19 | 2022-12-27 | DNA Genotek, Inc. | Biological collection system |
| US9518901B2 (en) | 2011-06-29 | 2016-12-13 | Kabushiki Kaisha Dnaform | Pretreatment method of biological sample, detection method of RNA, and pretreatment kit |
| CN103097531B (zh) * | 2011-06-29 | 2016-11-23 | 达纳福股份有限公司 | 生物样本的预处理方法、rna的检测方法及预处理试剂盒 |
| EP2574669A4 (en) * | 2011-06-29 | 2013-09-04 | Dnaform Kk | PROCEDURE FOR PRE-TREATING BIOLOGICAL SAMPLES, METHOD FOR DETECTING RNA AND PRE-TREATMENT KIT |
| CN103097531A (zh) * | 2011-06-29 | 2013-05-08 | 达纳福股份有限公司 | 生物样本的预处理方法、rna的检测方法及预处理试剂盒 |
| US11866773B2 (en) | 2012-04-09 | 2024-01-09 | Envirologix Inc. | Isolated oligonucleotides containing modified nucleotides |
| US9725703B2 (en) | 2012-12-20 | 2017-08-08 | Biomatrica, Inc. | Formulations and methods for stabilizing PCR reagents |
| WO2015031994A1 (en) * | 2013-09-03 | 2015-03-12 | Dna Genotek Inc. | Method and composition for nucleic acid storage from blood fractions |
| US11505836B2 (en) | 2014-04-22 | 2022-11-22 | Envirologix Inc. | Compositions and methods for enhancing and/or predicting DNA amplification |
| US12258637B2 (en) | 2014-04-22 | 2025-03-25 | Envirologix Inc. | Compositions and methods for enhancing and/or predicting DNA amplification |
| US11753616B2 (en) | 2014-05-27 | 2023-09-12 | DNA Genotek, Inc. | Composition and method for stabilizing and maintaining the viability of hardy microorganisms |
| US11672247B2 (en) | 2014-06-10 | 2023-06-13 | Biomatrica, Inc. | Stabilization of thrombocytes at ambient temperatures |
| US10772319B2 (en) | 2014-06-10 | 2020-09-15 | Biomatrica, Inc. | Stabilization of thrombocytes at ambient temperatures |
| US10064404B2 (en) | 2014-06-10 | 2018-09-04 | Biomatrica, Inc. | Stabilization of thrombocytes at ambient temperatures |
| US12121022B2 (en) | 2014-06-10 | 2024-10-22 | Biomatrica, Inc. | Stabilization of thrombocytes at ambient temperatures |
| US10793922B2 (en) | 2014-10-20 | 2020-10-06 | Envirologix Inc. | Compositions and methods for detecting an RNA virus |
| US12392001B2 (en) | 2014-10-20 | 2025-08-19 | Envirologix Inc. | Compositions and methods for detecting an RNA virus |
| EP3369816A4 (en) * | 2015-10-30 | 2019-06-26 | Bonac Corporation | COMPOSITION WITH STABLE INGREDIENT NUCLEIC ACID MOLECULE PRESSING THE EXPRESSION OF THE TGF-BETA1 GENE |
| CN108350457A (zh) * | 2015-10-30 | 2018-07-31 | 株式会社博纳克 | 稳定地含有抑制TGF-β1基因的表达的单链核酸分子的组合物 |
| US10568317B2 (en) | 2015-12-08 | 2020-02-25 | Biomatrica, Inc. | Reduction of erythrocyte sedimentation rate |
| US11116205B2 (en) | 2015-12-08 | 2021-09-14 | Biomatrica, Inc. | Reduction of erythrocyte sedimentation rate |
| US12089588B2 (en) | 2015-12-08 | 2024-09-17 | Biomatrica, Inc. | Reduction of erythrocyte sedimentation rate |
| US20220010299A1 (en) * | 2020-07-13 | 2022-01-13 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and Methods to Enhance RNA Stability and Translation and Uses Thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20180363027A1 (en) | 2018-12-20 |
| US10000795B2 (en) | 2018-06-19 |
| AU2007304776A1 (en) | 2008-04-10 |
| NZ576003A (en) | 2012-03-30 |
| US20160340713A1 (en) | 2016-11-24 |
| US20100099149A1 (en) | 2010-04-22 |
| US20210198717A1 (en) | 2021-07-01 |
| JP2014057590A (ja) | 2014-04-03 |
| CA2664696A1 (en) | 2008-04-10 |
| CA2664696C (en) | 2018-11-20 |
| IL197916A (en) | 2016-06-30 |
| US10767215B2 (en) | 2020-09-08 |
| EP2066686A4 (en) | 2010-07-14 |
| EP2066686A1 (en) | 2009-06-10 |
| SG179454A1 (en) | 2012-04-27 |
| IL197916A0 (en) | 2009-12-24 |
| JP2010505396A (ja) | 2010-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10767215B2 (en) | Stabilizing compositions and methods for extraction of ribonucleic acid | |
| RU2595421C2 (ru) | Композиции и способы для обнаружения и идентификации последовательностей нуклеиновых кислот в биологических образцах | |
| Gunn-Moore et al. | Detection of feline coronaviruses by culture and reverse transcriptase-polymerase chain reaction of blood samples from healthy cats and cats with clinical feline infectious peritonitis | |
| AU2010239385B2 (en) | Biological specimen collection/transport compositions and methods | |
| CN101175853A (zh) | 用于保存来自体液的核酸的组合物和方法 | |
| Monteiro et al. | Detection of respiratory viruses in shelter dogs maintained under varying environmental conditions | |
| AU2013206564B2 (en) | Stabilizing compositions and methods for extraction of ribonucleic acid | |
| McCabe et al. | Simultaneous detection of DNA and RNA virus species involved in bovine respiratory disease by PCR-free rapid tagmentation-based library preparation and MinION nanopore sequencing | |
| US20230349009A1 (en) | Kit for Collecting Saliva Samples | |
| Velayudhan et al. | Avian pneumovirus and its survival in poultry litter | |
| EP4244236A1 (en) | Pathogen inactivating and nucleic acid stabilization media for microorganism collection and transport | |
| Dawson | Oral fluid as a non-invasive alternative diagnostic medium for disease monitoring in pigs | |
| NL2027844B1 (en) | Kit for collecting saliva samples | |
| Rennhofer et al. | Epidemiological investigations on coronavirus infections in dogs and cats in an animal shelter | |
| Ghanem et al. | DNA extraction from bovine mummified fetuses and detection of factor XI gene deficiency in the mummies | |
| JP7803271B2 (ja) | 改良されたウイルスの検出方法 | |
| KR20240146187A (ko) | 크리스퍼-카스 시스템을 이용한 소 바이러스성 설사증 바이러스 검출방법 | |
| EP3971289A1 (en) | Kit for collecting samples | |
| CA2462920A1 (en) | Method and device for isolating rna samples | |
| Henning et al. | The tropism of foot-and-mouth disease virus in African buffalo (Syncerus caffer) using BaseScope™ in situ hybridisation | |
| WO2022085530A1 (ja) | 外来性核酸を検出する方法に供する試料の調製のための前処理方法 | |
| Body et al. | Corneal impression technique as a tool for early clinical diagnosis of rabies in animals | |
| AU2020359005A1 (en) | Compositions, methods, and kits for selection of donors and recipients for in vitro fertilization | |
| Kennedy | Molecular diagnostics: understanding assays for infectious diseases (Proceedings) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07855412 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2664696 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007855412 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2009530744 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007304776 Country of ref document: AU Ref document number: 576003 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 197916 Country of ref document: IL |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2389/CHENP/2009 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2007304776 Country of ref document: AU Date of ref document: 20071005 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12444447 Country of ref document: US |