WO2007145365A1 - Agent thérapeutique destiné au traitement du cancer et procédé destiné à cribler ledit agent - Google Patents

Agent thérapeutique destiné au traitement du cancer et procédé destiné à cribler ledit agent Download PDF

Info

Publication number
WO2007145365A1
WO2007145365A1 PCT/JP2007/062362 JP2007062362W WO2007145365A1 WO 2007145365 A1 WO2007145365 A1 WO 2007145365A1 JP 2007062362 W JP2007062362 W JP 2007062362W WO 2007145365 A1 WO2007145365 A1 WO 2007145365A1
Authority
WO
WIPO (PCT)
Prior art keywords
rad9
binding
cells
antibody
gene
Prior art date
Application number
PCT/JP2007/062362
Other languages
English (en)
Japanese (ja)
Inventor
Kazuhiro Ishikawa
Hideshi Ishii
Keiichi Ichimura
Original Assignee
Jichi Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jichi Medical University filed Critical Jichi Medical University
Priority to JP2008521289A priority Critical patent/JPWO2007145365A1/ja
Publication of WO2007145365A1 publication Critical patent/WO2007145365A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity

Definitions

  • the present invention relates to a cancer therapeutic agent. Specifically, the present invention relates to a composition for cancer treatment that controls the function of the oncogene Rad9 and thereby enhances the activity of the tumor suppressor gene p53.
  • the invention also relates to a method of screening for such cancer therapeutic agents.
  • a cell cycle checkpoint is a signaling pathway that maintains the proper order of cell cycle events. After DNA is damaged or replication is inhibited, cellular responses occur by activation of evolutionarily conserved signaling pathways. This pathway slows cell cycle progression and induces repair of damaged DNA.
  • These signal transduction pathways include protein sensors that recognize abnormal DNA structures and activate kinases, thereby inducing a phosphorylation cascade that ultimately leads to cell cycle arrest and DNA It leads to restoration (Non-Patent Document 1). If this cell cycle monitoring mechanism is not successful, the genome becomes unstable and eventually cancer is formed in mammals (Non-patent Document 2).
  • the ⁇ Rad9 (hRad9) protein is a ⁇ homolog of Schizosaccharomyces pombe Rad9 and is a member of the checkpoint ⁇ rad gene (radl ;, rad3 +, rad9 +, radl7 +, i: ad26 + and husl +). These rad genes are necessary for S phase (DNA repair) and G2 phase (DNA damage) checkpoints (Non-patent Document 3).
  • Rad9 was initially identified as a factor that controls the sensitivity of yeast to radiation. When DNA is damaged, Rad9 also forms a trimer with the checkpoint proteins Radl and Husl, surrounds the DNA damage site, and transmits damage repair signals to downstream factors. At that time, phosphorylation at 9 or more phosphorylation sites at the C-terminal of Rad9 is considered to be important for signal transduction (Non-patent Document 4). Rad9 is also The DNA polymerase beta activation, while involved in damage repair, anti-apoptotic proteins BEL- 2 or Bel - xL and suppression binds to induce apoptosis (Non-Patent Documents 5 and 6) t check Poin DOO and the DNA damage This refers to the mechanism from recognition to cell cycle regulation. From the checkpoint, Rad9 is suggested to exist and function at the branch point of the opposite pathway of damage repair and apoptosis. However, there are many unknown parts that have not been elucidated, especially in humans.
  • the Rad9 gene is located in the long arm 13 region of chromosome 11. Although at least four oncogenes are thought to exist in this region, only two oncogenes have been identified so far. Also, clinically, gene amplification in this region is often observed in head and neck cancer, esophageal cancer, and breast cancer, and there is evidence that survival rate is reduced by gene amplification (Non-patent Document 7). However, although the oncogene is overexpressed by gene amplification and leads to a decrease in survival rate, the details of the relationship between gene amplification and carcinogenesis or cancer cell growth are unknown. There is currently no evidence that Rad9 is clinically involved in survival.
  • the p53 gene is an unprecedented important tumor suppressor gene that shows some mutation in more than 60% of human cancers.
  • p53 protein increases or activates after recognizing damage, and is involved in induction of apoptosis, cell cycle suppression, cell division suppression, DNA replication, damage repair, etc. through transcription of various genes, genome (Non-Patent Document 8). Therefore, it may be possible to suppress cancer growth and metastasis by controlling p53 function.
  • Non-patent literature a negative regulator of cell cycle progression, and controls the transition from the G1 phase to the S phase of the cell cycle.
  • hRad9 specifically binds to the p53 consensus DNA-binding sequence of the P21 promoter and regulates P21 at the transcription level (Non-patent Document 13).
  • Patent Document 1 discloses a screening method for bioactive agents using the binding between Rad9 and cell cycle protein PP5.
  • Patent Document 2 describes that the activation of ATM, ATR, or a protein regulated by ATM or ATR is mediated by the binding of AIM3. Proteins regulated by ATM or ATR include many substances such as p53 and RAD9. ⁇ Although hRad9 is suggested to be involved in cell cycle control, its function and mechanism are unclear in fact, and the involvement of Rad9 in the above-mentioned p53 pathway is also unknown. .
  • Patent Document 1 US Patent Application No. 200302211546A1
  • Patent Document 2 US Patent Application No. 20060046250A1 Non-patent Document 1 G. K. Dasika et al., Oncogene 18: 7883-7899, 1999
  • Non-Patent Document 2 C. Lengauer et al., Nature 396: 643-649, 1998
  • Non-patent document 3 E. Stewart et al., Curr. Opin. Cell Biol. 8: 781-787, 1996
  • Non-patent document 4 RP St Onge et al., J. Biol. Chem. 278: 26620-26628, 2003
  • Non-patent document 5 MN Toueill e et al., Nucleic Acids Res. 32: 3316-3324, 2004
  • Non-Patent Document 6 K. Komatsu et al., Nat. Cell Biol. 2: 1-6, 2000
  • Non-Patent Document 8 A. J. Levine, Cel 88: 323-331, 1997
  • Non-Patent Document 9 W. S. El-Deiry et al., Cel 75: 817-825, 1993
  • Non-Patent Document 1 0 J. Harper et al., Cell 75: 805-816, 1993
  • Non-patent literature L 3 Y. Yin et al., Proc. Natl. Acad. Sci. USA 15: 8864-8869, 2004 Disclosure of the Invention
  • the object of the present invention is to clarify the biological interaction between Rad9 and p53 and to use it for cancer therapy.
  • the present inventors have unexpectedly found that the function of Rad9 is manifested through a certain type of protein binding activity, and that its specific protein binding target is p53, and the binding between Rad9 and p53 Control is related to checkpoint control via transcription of P21 As a result, the present invention was completed. The following results were obtained from this series of studies.
  • RNA competition RNA competition
  • mutant Rad9 increased P21 mRNA expression.
  • Rad9 is directly bonded with P 53.
  • the present invention has the following features.
  • the present invention provides an organism capable of controlling the binding between Rda9 and p53 by adding a drug candidate in the presence of the oncogene product Rad9 and the tumor suppressor gene product p53 in the test system.
  • a method is provided for screening cancer therapeutics, comprising selecting active agents.
  • the drug candidate is selected from the group consisting of a small molecule, a nucleic acid, a peptide, a protein, a saccharide, and a lipid.
  • the system comprises cells from eukaryotic and prokaryotic organisms.
  • control is either suppression or enhancement.
  • drug candidate is an antibody that neutralizes the binding region of Rad9 and p53.
  • the drug candidate is a Rad9 protein fragment having 5 or more amino acid residues derived from a binding region of Rad9 and p53, or a variant thereof.
  • the drug candidate is an antisense nucleic acid, RNAi nucleic acid, or vector DNA containing the nucleic acid thereof that suppresses the transcription and expression of the Rad9 gene.
  • the present invention also controls the biological function of the Rad9 protein or the expression of the Rad9 gene, thereby enhancing or suppressing the binding between Rad9 and p53, thereby suppressing or enhancing the activity of p53.
  • a pharmaceutical composition for treating cancer comprising a bioactive agent capable of interacting with the Rad9 gene, a transcription product or a translation product thereof.
  • the term “interacts with the Rad9 gene, its transcript or translation product” refers to the Rad9 protein or gene that directly interacts with the intracellular Rad9 gene, its transcript or translation product. It is meant to control the biological function and expression of the protein positively or negatively. Therefore, the active ingredients of the pharmaceutical composition of the present invention include those exemplified below.
  • the AIM3 protein described in US Patent Application No. 20060046250A1 its variants, and the nucleic acid encoding them are Not included.
  • the drug is an antibody against Rad9 or an antibody fragment.
  • the agent is an antisense nucleic acid that suppresses transcription and expression of the Rad9 gene or a solid DNA containing the nucleic acid.
  • the agent is an RNAi nucleic acid that suppresses the transcription and expression of the Rad9 gene or a vector DNA containing the nucleic acid.
  • the drug is a Rad9 protein fragment having 5 or more amino acid residues derived from the binding region of Rad9 and p53, or a variant thereof.
  • the drug is encapsulated in ribosomes.
  • the terms according to the present invention include the following definitions.
  • Rad9 refers to a Rad9 protein derived from a mammal, preferably human, or a nucleic acid encoding it (ie, genomic DNA, mRNA, cDNA, etc.).
  • the Rad9 gene is one of the oncogenes, and when Rad9 is damaged,
  • p53 is a tumor suppressor gene. When DNA is damaged, the p53 protein increases or activates, induces apoptosis through transcription of various genes, and suppresses the cell cycle. It is involved in cell division inhibition, DNA replication, damage repair, etc., and has the biological function of bringing about the stability of the genome. Therefore, it is possible to suppress cancer growth and metastasis by controlling the function of p53 become.
  • p53 regulates the induction of P21 gene expression. Specifically, when p53 binds to the p53 binding site in the P21 promoter region, transcription of P21 is initiated and P21 expression is induced.
  • p21 is a cyclin-dependent kinase inhibitor that leads to cell cycle suppression.
  • the present invention is based on the new finding that the Rad9 protein binds to the p53 protein and regulates the function of p53, and through such binding control, biological functions involving p53, such as DNA replication or DNA Control of damage repair, apoptosis, suppression of cell division, etc., or control of p53-dependent P21 gene expression, leading to cell cycle suppression, repair of DNA damage, and stabilization of the genome.
  • Figure 1 shows the UV-inducing effect on the expression of the P21 gene expression product. Specifically, changes with time in P21 mRNA and p21 protein after UV irradiation are shown. 293 cells were treated with 20 J / m 2 UV and cells were harvested at various times from 0 to 72 hours as indicated after treatment.
  • Figure 1A shows the results of extracting RNA, performing RT-PCR, and calculating the ratio of P21 mRNA to G3PDH by densitometry.
  • Fig. 1B shows the results of extracting proteins and performing Western plotting using anti-P21 antibodies.
  • FIG. 2A shows the results of Western blotting (WB) performed using cell lysates of 293 cells transfected with wild-type Rad9 plasmid or phosphorylation-deficient Rad9 plasmid.
  • FIG. 2B shows the results of P21 transcription assays with hR a d9 using the P21 promoter luciferase reporter system. Relative activity is illustrated as the ratio of Firefly to Renille. Each column represents 293 cells transfected simultaneously as follows.
  • FIG. 3 shows the results of knockdown experiments hRad9 and P 53 using siRNA.
  • FIG. 3A shows the results of Western blot analysis using the indicated antibodies. The ECL signal is detected by a densitometer, and the intensity ratio is shown in the figure.
  • FIG. 3B shows the results of a hRad9 knockdown experiment using siRNA. hRad9 and P53 were knocked down using siRNA (siRad9 or siP53, respectively) and treated with UV or not. After harvesting the cells, RNA was extracted and P21 mRNA was assayed using RT-PCR. The ratio of P21 mRNA to G3PDH was calculated by densitometry and displayed.
  • FIG. 4 shows the interaction between hRad9 and p53.
  • FIG. 4A shows that 293 cell lysates were used for immunoprecipitation as described in Materials and Methods. Anti-c-kit antibody was used as a negative control for immunoprecipitation.
  • Figure 4B shows wild-type labeled with FLAG
  • FIG. 5 shows that promoter binding by hRad9 increases after UV irradiation.
  • FIG. 5A shows the results of EMSA using nuclear extracts from treated and untreated 293 cells.
  • Lane 1 no nuclear extract, 30 bp oligo with downstream p53 consensus DNA binding sequence; Lane 2, untreated nuclear extract; Lane 3, nuclear extract with cold 30 bp oligo added as competitor; Lane 4, nuclear extract with anti-p53 antibody added; Lane 5, nuclear extract with anti-hRad9 antibody added; Lane 6, nuclear extract 6 hours after UV treatment; Lane 7, anti-p53 antibody added, Nuclear extract 6 hours after UV treatment; Lane 8, nuclear extract 6 hours after UV treatment, with addition of anti-hRad9 antibody.
  • Figures 5B, C, D, and E show the ChIP assembly results for the P21 promoter site. 293 cells were transfected with wild-type Rad9 plasmid or phosphorylation-deficient Rad9 plasmid, and the cells were collected with or without UV treatment.
  • FIG. 5B shows ChIP assembly immunoprecipitated with anti-hRad9 antibody, with DNA amplified with primers for the P21 downstream binding site.
  • Figure 5C shows immunoprecipitation with anti-p53 antibody, where DNA is amplified in a primer against the P21 downstream binding site.
  • FIG. 5D shows immunoprecipitation with anti-hRad9 antibody, and DNA is amplified with primers for the P21 upstream site.
  • Figure 5E shows immunoprecipitation with anti-p53 antibody, with DNA amplified with primers for the P21 upstream site.
  • FIG. 6 shows the role of hRad9 in the DNA damage response.
  • FIG. 6A shows the colonization of ⁇ 2 and Rad9 in the UV-induced nuclear focus.
  • Figure 6B shows the focus formation rate of hRad9 after UV treatment. 293 cells were transfected with wild-type Rad9 plasmid or phosphorylated Rad9 plasmid, and fixed with 4% paraformaldehyde 1 hour after UV treatment. Immunofluorescence staining was performed and the percentage of cells with hRad9 focus formation was analyzed.
  • Figure 6C shows the time course of phosphorylated Chkl and apoptosis. 20J / ra 2
  • FIG. 6D shows the mode of modulation of p53-dependent p21 activation.
  • ⁇ 53 accumulates and binds to the p53 consensus sequence of the P21 promoter associated with hRad9.
  • P21 is fully transcribed by phosphorylated hRad9, and the checkpoint response is activated 1-3 hours after DNA damage.
  • P21 transcription is inhibited by phosphorylation-deficient hRad9, suppressing cell cycle arrest and leading to the induction of apoptosis.
  • C-terminal phosphorylation of Rad9 is presumed to play a role in Chkl activation, which induces G2 / M checkpoint activation 24 hours after DNA damage or apoptosis.
  • Fig. 7 shows mutants (mtl, mt2, mt3, mt4 and mt5) of Rad9 that are Rad9 protein fragments having 5 or more amino acid residues derived from the binding region of Rad9 and p53.
  • FIG. 7A Schematic diagram showing the location of Rad9 in the binding region (Fig. 7A), and each mutant Rad9 expression plasmid (including reporter gene FLAG) introduced into MRC5 cells (mtl) ⁇ Mt5) Western blot showing Rad9 expression (Fig. 7B).
  • PCNA fold represents a Proliferating Cell Nuclear Antigen-like structure
  • mock represents a control that does not contain a wild type or mutant Rad9 expression plasmid.
  • Figure 8 shows changes in p53-Rad9 binding (Figure 8A) and p21 expression ( Figure 8B) when wild-type (WT) Rad9 or mutant (mtl to mt5) Rad9 expression plasmids were introduced into MRC5 cells.
  • “mock” represents a control containing no wild-type or mutant Rad9 expression plasmid
  • IB represents an immunoblotting
  • IP represents immunoprecipitation.
  • FIG. 9 shows the percentage of apoptosis of a cancer cell upon introduction of wild-type Rad9 or a mutant (mtl to m1: 5) Rad9 expression plasmid.
  • Fig. 9A shows the results when SI-1 was used as the head and neck squamous cell carcinoma cell line
  • Fig. 9B shows the cervical cancer cell line.
  • FIG. 10 shows the percentage of apoptosis of Rad9 siRNA (SEQ ID NO: 18) introduced into head and neck squamous cell carcinoma cell line MMSI-1 or cervical cancer cell line HeLa cells.
  • mock represents a control that does not contain a wild-type or mutant Rad9 expression plasmid.
  • Figure 11 shows changes in p53-Rad9 binding measured by immunoprecipitation when MRC5 cells were administered the anticancer drug etoposide (VP16), camptothecin (CPT), cisplatin (CDDP) or doxorubicin (D0X).
  • VP16 anticancer drug etoposide
  • CPT camptothecin
  • CDDP cisplatin
  • D0X doxorubicin
  • FIG. 12 shows changes in P 53 -Rad9 binding by anti-Rad9 antibodies.
  • GST represents glutathione S transferase
  • + represents the substance shown in the figure included in the experimental system (lanes 1, 2 and 3).
  • the present inventors used 293 cells, a human fetal kidney glomerular cell line, and after irradiation with ultraviolet light (UV), phosphorylation of Serl5, which is an index of p53 activation, and p53 transcription target P21.
  • UV ultraviolet light
  • the time course of mRNA was examined. Phosphorylation of p53 increased 5 minutes after irradiation and showed a high value until 12 hours, while P21 mRNA was found to increase in expression 30 minutes to 3 hours after UV irradiation (Fig. 1).
  • Rad9 was more strongly expressed in the nucleus in the head and neck cancer cell line (Ra SI-1) than in the control 293 cells. Cycl inD1 having a gene in the same region as Rad9 was also strongly expressed. On the other hand, P21 showed only mild expression.
  • Rad9 interacts with p53 and controls P21 competitively and suppressively. After recognizing DNA damage, Rad9 regulates p53 while undergoing phosphorylation modification under normal conditions, and is thought to act on checkpoint activation and damage repair through transcription of P21. It is known that the checkpoint protein Chk_l is activated by phosphorylation of Rad9. On the other hand, in the state where Rad9 is not phosphorylated, that is, in the state where the damage of the cell is large, it is considered that the transcription of P21 is further suppressed, and the cell cycle advances and induces apoptosis. Thus, Rad9 interacts with p53 through phosphorylation modification and has an important function in fateing the life and death of DNA-damaged cells (Figure 6D).
  • Rad9 which has a mutation in the phosphorylation site of Rad9, was introduced into 293 cells to examine induction of apoptosis.
  • the expression of the plasmid was confirmed by Western blotting.
  • the plasmid (Rad9-9A) in which 9 phosphorylation sites were mutated compared to the wild type (FT) it was confirmed that Rad9 with high mobility was strongly expressed.
  • Apoptosis after 24 hours of UV irradiation was approximately doubled (WT 6.5%, Rad9-9A 12.5%), suggesting that the induction of apoptosis is promoted by the control of Rad9.
  • Rad9 and p53 bind regardless of whether or not each protein is phosphorylated. Through this binding, Rad9 suppresses the biological action (or biological activity) of p53. It is adjusted to.
  • Rad9 binds to p53 in a state where Rad9 is not phosphorylated, P21 transcription is suppressed, the cell cycle proceeds, and cellular apoptosis is induced.
  • the checkpoint protein Chkl is activated and the checkpoint is activated, and the binding between Rad9 and p53 is inhibited and suppressed.
  • dissociation increases P21 transcription, leading to cell cycle suppression, and these events lead to repair of DNA damage.
  • the present invention controls the binding of Rad9 and p53 when DNA is damaged, that is, based on the knowledge obtained this time (Rad9 suppresses and controls p53), the cancer gene Rad9 and By inhibiting, suppressing or dissociating the binding of the tumor suppressor gene p53, the activity of the tumor suppressor gene P53 is expected to be exerted strongly, and it can be applied to the development of diagnostic methods and treatment methods for cancer medical treatment.
  • the present invention is used to repair the DNA damage that stabilizes the genome and prevents canceration.
  • the cell is, for example, a cancer cell, apoptosis can be induced by the present invention.
  • the present invention provides a novel screening method for such cancer therapeutic agents, as well as antibodies (examples).
  • anti-Rad9 antibody or anti-p53 antibody that neutralizes the binding region between Rad9 and p53, etc.
  • nucleic acid eg, suppression of Rad9 gene expression (or transcription and translation), anti-sense nucleic acid, RNAi nucleic acid,
  • a Rad9 protein fragment containing the same, a variant thereof, and the like, and the like.
  • the present invention provides a biological system capable of controlling the binding between Rda9 and p53 by adding a drug candidate in the presence of the oncogene product Rad9 and the tumor suppressor gene product p53 in the test system.
  • a method for screening cancer therapeutics comprising selecting an active agent.
  • any test system can be used as long as it is an in vitro test system capable of causing the binding of Rad9 and p53.
  • a test system preparing a Rad9 protein and p53 protein, physiological pH (P H7 ⁇ 7. 5, usually 7.4), in salt-containing buffer, from room temperature to about 37 ° C
  • the system mixes both proteins at temperature.
  • the buffer solution include, but are not limited to, a phosphate buffer solution, a tris monohydrochloride buffer solution, and a phosphate buffered saline solution (PBS).
  • the buffer may contain substances that stabilize proteins, such as glycerol, moss, other proteins that do not affect Rad9-p53 binding, polypeptides or peptides.
  • Rad9 is Rad9 derived from a mammal, preferably human Rad9.
  • the nucleotide and amino acid sequences of human Rad9 are shown in GenBank accession number NM_004584 (see SEQ ID NOs: 1 and 2), and human Rad9 is composed of 392 amino acids.
  • Mammal Rad9 other than human includes, for example, mouse Rad9 ( ⁇ _011237), rat Rad9 (wake-001030042) and the like.
  • Rad9 that can be used in the method of the present invention is preferably human Rad9, but 80% or more, 85% or more, preferably 90% or more, more preferably 95% or more, 97% with the nucleotide or amino acid sequence of human Rad9. or higher, 98% or higher, that having a 99% or more identity, can be coupled with Katsuhi preparative P 53, human Rad9 homologues, also variant or analog derconnection good Rere.
  • Rad9 may be phosphorylated or may not be phosphorylated. Phosphorylation of Rad9 can be achieved by phosphorylating enzymes such as protein kinase CS (K. Yoshida et al., EMBO J. 2003, 22: 143 to 1441), ATR (P. Roos-Mattjus et al., J. Biol. Chem. 2003, 278 24428-24437), cdc2 (RP St. Onge et al., J. Biol. Chem. 2003, 278: 26620-26628).
  • protein kinase CS K. Yoshida et al., EMBO J. 2003, 22: 143 to 1441
  • ATR P. Roos-Mattjus et al., J. Biol. Chem. 2003, 278 24428-2443
  • cdc2 RP St. Onge et al., J. Biol. Chem. 2003, 278:
  • p53 is p53 derived from a mammal, preferably human p53.
  • the nucleotide and amino acid sequence of human p53 is shown in GenBank accession number NM-000546 (see SEQ ID NOs: 3 and 4), and human p53 is composed of 394 amino acids.
  • Examples of p53 of mammals other than human include mouse p53 (NM-0111640) and rat p53 (NM-030989).
  • P53 usable in the method of the present invention is preferably human p53, but 80% or more, 85% or more, preferably 90% or more, more preferably 95% with the nucleotide or amino acid sequence of human p53.
  • a human p53 homologue, mutant or analog having the identity of 97% or more, 98% or more, 99% or more and capable of binding to human Rad9 may be used.
  • Rad9 and p53 proteins can be performed using a known gene recombination technique, for example, as follows.
  • cDNA encoding human Rad9 is described in B. Howard et al. (A human homolog of the Schizosaccharomyces pombe rad9 + checkpoint controlgene) Proc Natl Acad Sci US A. 1996, 93 (24): 13890-13895 Has been.
  • a cDNA library can be prepared from human infant brain (GenBank accession number R18275R18275), and human Rad9 cDNA can be amplified by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • 5raM MgCl 2 5raM MgCl 2 ; IX Taq buffer (BRL); use 100 / l total volume, pre-incubation for 5 minutes at 95 ° C, 1 minute at 94 ° C (denaturation), 30 at 57 ° C Second (annealing), consisting of 35 cycles with 2 minutes (extension) at 72 ° C as one cycle, followed by a final extension at 72 ° C for 10 minutes.
  • DNA expression using an appropriate vector / host system is available. Insert DNA encoding Rad9 or p53 into the vector, introduce it into an appropriate host cell, and culture and express it in an appropriate medium. If necessary, DNA encoding a signal peptide can be ligated to the 5 ′ end of the encoding DNA.
  • a histidine tag for example, H6-H10 tag
  • GFP green fluorescent protein
  • a luciferase tag or a DNA encoding a fluorescent or luminescent protein is linked to one end of the DNA. Protein purification can be facilitated.
  • Vectors include bacterial vectors, yeast vectors, fungal vectors, insect vectors, plant vectors and animal (eg, mammalian, avian, etc.) vectors.
  • vectors include plasmids such as pUC, pBluescript, and pBR, fuzz, cosmids, virus vectors such as baculovirus vectors, adenovirus vectors, adeno-associated wizole vector, retrovirus vectors, etc.
  • commercially available vectors can be preferably used, including Ti plasmid vector / agglobatate system.
  • Vectors include regulatory sequences (eg, promoters, enhancers, etc., such as SV40 early promoter, cytomegalovirus promoter, P21 gene promoter, force reflower mosaic virus 35S promoter, etc.), selectable markers (eg, neomycin resistance gene, Drug resistance gene such as kanamycin resistance gene, ampicillin resistance gene, nutrient-requiring complementary gene such as LEU2, TRP1, HIS4, ADE2, etc.), liposome binding site or Shine-Dalgarno sequence, replication origin, termination And elements such as a multicloning site and a poly A signal can be selected as appropriate.
  • regulatory sequences eg, promoters, enhancers, etc., such as SV40 early promoter, cytomegalovirus promoter, P21 gene promoter, force reflower mosaic virus 35S promoter, etc.
  • selectable markers eg, neomycin resistance gene, Drug resistance gene such as kanamycin resistance gene, ampicillin resistance gene, nutrient-requiring
  • Host cells include, for example, bacteria such as Escherichia coli, Bacillus subtilis, and Pseudomonas, yeast (eg, Saccharomyces, Pichia, and methanol-assimilating yeast), basidiomycetes, insects Including cells (eg Sf cells), plant cells, mammalian cells (eg 293 cells, CH0, COS, BHK, HeLa, etc.).
  • bacteria such as Escherichia coli, Bacillus subtilis, and Pseudomonas
  • yeast eg, Saccharomyces, Pichia, and methanol-assimilating yeast
  • basidiomycetes eg. Sf cells
  • plant cells eg 293 cells, CH0, COS, BHK, HeLa, etc.
  • Transformation of host cells can be carried out by well-known methods such as calcium chloride method, electroporation method, polyethylene glycolate method, microinjection method, bon-nodement method, protoplast or spheroplast method, lipofuxion method, and virus infection method. Can be done by the method.
  • test systems include eukaryotic cells, for example yeast cells, insect cells, animal cells, preferably mammalian cells, more preferably human-derived normal cell lines or tumor cell lines, as exemplified above.
  • eukaryotic cells for example yeast cells, insect cells, animal cells, preferably mammalian cells, more preferably human-derived normal cell lines or tumor cell lines, as exemplified above.
  • the system to be used is included.
  • prokaryotic cells such as Escherichia coli, Bacillus subtilis, and Pseudomonas bacteria can also be used.
  • DNAs encoding Rad9 and p53 are incorporated into a vector such as those shown above so that the vector can be expressed, And a system that allows co-expression of DNA encoding.
  • Each DNA may be separately incorporated into a different vector, or may be incorporated in such a form that it can be co-expressed in the same vector.
  • the vector can contain the same elements as above.
  • the element preferably contains at least a promoter, an origin of replication, a terminator, a selection marker, a manople cloning site and a ribosome binding site.
  • a test system using cells involves culturing the transformed or transfected cells as described above in a suitable medium.
  • genomic DNA refers to the Rad9 or p53 gene and is composed of exons and introns.
  • the cell to be used is preferably the same type as the cell from which the genomic DNA is derived. That is, it is preferable to use a human cell line for human Rad9 and p53 genomic DNA, and a mouse cell line for mouse Rad9 and p53 genomic DNA.
  • the genomic DNA is placed under the control of a strong promoter derived from a virus such as SV40 or cytomegalovirus, or a radiation, light or chemical-inducible promoter (for example, www.nirs.o.jp/report/nirs_news/200410/hik01p.html; unit. aist. go.jp/rcg/rcg-gb/sg2.html etc.)
  • a system capable of causing transcription is more preferable.
  • Such cells also include human mouse-derived cell lines in which the transcriptional level of P21 changes when DNA damage is caused by irradiation with ultraviolet rays or radiation.
  • Such cells include, for example, human MRC5 cells (human lung fibroblast cell line; ATCC CCL-171), mouse NIH 3T3 cells, and the like.
  • test system that can be used in the present invention may be a lysate (lysate) of the above cells. .
  • the drug candidate is selected from, for example, substances that are expected to interact with the Rad9 gene, its transcription product or translation product, and thereby control the binding between Rda9 and p53. It can be selected from the group consisting of molecules (preferably small organic molecules), nucleic acids, peptides, proteins, sugars, lipids and the like.
  • Examples of drug candidates include antibodies that suppress or inhibit the binding between Rad9 and p53, such as antibodies that neutralize the region involved in the binding.
  • Such an antibody is an antibody against Rad9 or p53 or an antibody fragment thereof, and one that can suppress or inhibit the binding between Rad9 and p53 is selected.
  • the antibody is a monoclonal antibody, a polyclonal antibody, a human antibody, a humanized antibody, a peptide antibody or a fragment thereof (such as Fab, (Fab ') 2 ), or a synthetic antibody (eg, Fv, scFv, etc.).
  • An antibody or antibody fragment can be prepared by a known method.
  • Polyclonal antibodies are a protein or polypeptide or peptide that is emulsified together with an adjuvant such as Freund's adjuvant or non-Freund's adjuvant, an aluminum compound (eg, alura), rabbit, goat, hidge, mouse, rat. Immunize non-human mammals such as pigs, boost about every 2 weeks, check antibody titer in blood, then exhale and obtain antiserum. If necessary, further Kochi ⁇ , ammonium sulfate fractionation, is treated with an ion-exchange column chromatography to obtain a I g G fraction.
  • an adjuvant such as Freund's adjuvant or non-Freund's adjuvant
  • an aluminum compound eg, alura
  • Monoclonal antibodies are used to immunize non-human animals such as mice as described above, and then remove the spleen, spleen cells, or lymph nodes, and fuse lymphocytes with myeloma cells to produce high-pridoma.
  • Human antibodies are known human antibody-producing mammals (eg, thigh mice (Kirin Brewery / Medarex), Xeno mice (Abbienix), human antibody-producing sushi (Kirin Brewery / Hematek), etc.) Can be obtained from antisera.
  • a humanized antibody uses a gene recombination technique to encode a complementary region derived from the variable region of a mouse antibody '["complementarity determining region (CDR) 3 ⁇ 4r and a human variable region. It can be obtained by binding to DNA, integrating it into a vector, and transforming it into a mammalian cell (eg, Kettleborough, C, A. et al. Protein Engng., 4, 773-783, 1991; Maeda, H., Human Antibodies and Hybridoma, 2, 124-134, 1991; Gorman, SD et al. Proc. Natl. Acad. Sci.
  • CDR complementarity determining region
  • a Rad9 protein fragment having 20 or more, 30 or more, 50 or more, 100 or more, 150 or more, or 200 or more amino acid residues, or a variant thereof (FIG. 7A). It is an antagonistic (poly) peptide or active agonistic (poly) peptide capable of antagonizing Rad9 protein, and 1 to 5 mutants in the sequence of the Rad9 protein fragment, 1 to 4 1 to 3 A peptide comprising a mutation consisting of substitution, deletion or addition of 1, 2 or 1 amino acid residues.
  • the mutant contains a sequence having 80% or more, 85% or more, preferably 90% or more, 95% or more, more preferably 97% or more, 98% or more identity with the sequence of the Rad9 protein fragment. It is a peptide.
  • the substitution is preferably a conservative amino acid substitution between amino acids with similar structural, hydrophobic or electrical properties.
  • Conservative amino acid substitutions include, for example, acidic amino acids (glutamic acid, aspartic acid), basic amino acids (lysine, arginine, histidine), aromatic amino acids (phenylalanine, tryptophan, tyrosine), nonpolar hydrophobicity Substitution between amino acids (glycine, alanine, oral isine, isoleucine, methionine, proline) or polar uncharged amino acids (serine, threonine, cysteine, asparagine, glutamine) is included.
  • a drug candidate is an antisense nucleic acid, RNAi nucleic acid, or vector DNA containing the nucleic acid that suppresses transcription and expression of the Rad9 gene.
  • Antisense nucleic acid is RNA or DNA complementary to the Rad9 mRNA sequence or a fragment thereof.
  • the Rad9 mRNA sequence is an RNA sequence corresponding to, for example, the nucleotide sequence encoded by SEQ ID NO: 2, or the nucleotide sequence of the coding region shown in SEQ ID NO: 1.
  • the fragment size is 15 bases or more to less than the full length, preferably 25 bases to 100 bases.
  • RNAi RNA interference
  • a nucleic acid is a small RNA that suppresses the expression of the Rad9 gene, and includes, for example, siRNA (small interfering RNA) and miRNA (micro RNA). These RNAi nucleic acids are 18-25 bases in size and consist of double-stranded RNA.
  • siRNA consists of a partial sequence of mRNA corresponding to the Rad9 gene and its complementary sequence, while miRNA is
  • the precursor miRNA can include a stem loop sequence (eg, a sequence derived from a natural miRNA) between the sense strand and the antisense strand.
  • stem loop sequence eg, a sequence derived from a natural miRNA
  • These nucleic acids have the activity of cleaving the target RNA or suppressing translation of the target RNA.
  • sequences based on the Rad9 gene sequence or intergenic sequence e.g., D.M.
  • a target site selection method eg, a sequence with about 50% GC content, 50% from the start codon. ⁇ 100 bases downstream sequence etc.
  • a single nucleic acid library obtained by randomly cleaving the Rad9 gene sequence with a nuclease and then synthesizing cDNA and further synthesizing RNA may be used.
  • the siRNA or miRNA may be in the form of an expression vector containing the DNA encoding it.
  • Such vectors are commercially available from Takara Bio, Cosmo Bio, Evrogen, Invitrogen, etc., and drug candidates can be prepared by incorporating DNA encoding Rad9 siRNA or miRNA into this vector.
  • pSINsi, pBAsi, pU6-siRNA, pHl-siRNA, p2FP-RNA, etc. Such betaters may include elements such as CMV (cytomegarovirus) / E promoter or SV40 early promoter, kanamycin resistance gene / neomycin resistance gene, poly A signal, stop codon, origin of replication.
  • drugs include commercially available or non-marketed anticancer drugs such as alkylating drugs (eg cyclophosphamide, menolephalan, isophosphamide, cyclophosphamide, bus / refuan etc.), antimetabolites (eg Methotrexate, fluorouracil, tegafur, cytarabine, hydroxycarbamide, etc., antibiotics (eg, doxorubicin, daunorubicin, mitomycin, bleomycin, idanolevicin, etc.), plant-type alburoids (eg, vincristine, vindesine, paclitaxel) Etc.), platinum preparations (eg cisbratin, carbobratin, nedaplatin, etc.).
  • alkylating drugs eg cyclophosphamide, menolephalan, isophosphamide, cyclophosphamide, bus / refuan etc.
  • Selection of a bioactive agent can be performed by detecting or quantifying the binding of Rad9 and p53 or the binding level thereof. For example, sampling from a test system over time However, in the case of cells, after cell lysis, the binding level can be detected and quantified by techniques such as (non-denaturing polyacrylamide gel) electrophoresis and Western blotting. For detection, anti-Rad9 antibody and anti-p53 antibody can be used. These antibodies are available from Alexis Sento, BD Biosciences, Cel Signaling Technology ⁇ , and the like. Alternatively, when the test system includes cells, a candidate drug can be selected by measuring the transcription level of P21 after causing DNA damage by irradiation with ultraviolet rays or the like.
  • the present invention also controls the biological function of the Rad9 protein or the expression of the Rad9 gene, thereby enhancing or suppressing the binding between Rad9 and p53, thereby suppressing or enhancing the activity of p53, and the Rad9 gene, its Provided is a pharmaceutical composition for treating cancer comprising a bioactive agent that interacts with a transcript or translation product.
  • drugs as active ingredients include: (l) an antibody or antibody fragment against Rad9, (2) an antisense nucleic acid that suppresses transcription and expression of the Rad9 gene, or a vector DNA containing the nucleic acid, and (3) a Rad9 gene.
  • An example of a drug is a human antibody or a humanized antibody against Rad9. Such antibodies are
  • Another example of a drug is 5 or more, preferably 8 or more, derived from the binding region of Rad9 and p53. Above, 10 or more or 15 or more, for example 20 or more, 30 or more, 50 or more, 100 or more, 150 or more,
  • Rad9 protein fragment having 200 or more amino acid residues, or a variant thereof.
  • a fragment is a peptide or polypeptide capable of binding to p53 competitively with Rad9 for binding to p53.
  • Rad9 was cut with a suitable protease to produce a random peptide or Poribe peptide and subjected to the test system, a suppressing antagonistic binding between Rad9 and P 53 (poly) peptide, or Rad 9
  • agonistic (poly) peptides with similar activity can be selected.
  • Rad9 protein fragment examples include the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 41 (mutant (mtl) Rad9) and the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 42 (mutant (mt2) Rad9 ), Polypeptide encoded by the nucleotide sequence of SEQ ID NO: 43 (mutant (mt3) Rad9), polypeptide encoded by the nucleotide sequence of SEQ ID NO: 44 (mutant (mt4) Rad9), nucleotide sequence of SEQ ID NO: 45 Including the polypeptide encoded by (mutant (mt5) Rad9).
  • the mutant is a mutation comprising substitution, deletion or addition of 1 to 5, 1 to 4, 1 to 3, 1 to 2 or 1 amino acid residue in the sequence of the Rad9 protein fragment. It is a peptide containing.
  • Still another example of the drug is an antisense nucleic acid that suppresses transcription and expression of Rad9 gene or a vector DNA containing the nucleic acid, or an RNAi nucleic acid that suppresses transcription and expression of Rad9 gene or a vector DNA containing the nucleic acid.
  • these RNAi nucleic acids are about 18 to about 25 bases in size, and include siRNA and miRNA consisting of double-stranded RNA.
  • siRNA consists of a partial sequence of mRNA corresponding to the Rad9 gene and its complementary sequence
  • miRNA consists of a partial sequence corresponding to the intergenic region of the Rad9 gene and its complementary sequence, and has a hairpin structure.
  • nucleic acids have the activity of cleaving the target RNA or suppressing translation of the target RNA.
  • sequence of the Rad9 gene or the intergenic sequence for example, the nucleotide sequences shown in SEQ ID NOs: 41 to 45
  • various sequences can be obtained, for example, D. M. Dykxhoorn et al., Nature Rev. Mol. Cell Biol., 77: 7174-7718,
  • Una target site selection methods e.g., sequence of about 5 0% GC content, And can be synthesized using a DNA / RNA synthesizer.
  • siRNA examples include, but are not limited to, oligoribonucleotides corresponding to the following sequences.
  • the siRNA used in the present invention may be single-stranded or double-stranded.
  • -Strand in the case of double strand, consists of sense strand and antisense strand. These strands overhang at their 3 'ends to ensure stability, for example
  • the amount of the drug in the pharmaceutical composition of the present invention is not particularly limited, but is 1 g to 20 mg / kg. It is weight.
  • the dosage form may be either a liquid form or a solid form.
  • Solid forms include lyophilized forms and may be dissolved in a buffer solution such as sterile water, physiological saline, phosphate buffered physiological saline, Ringer's solution, etc. immediately before use.
  • the drug may be encapsulated in ribosomes.
  • positively charged ribosomes eg, positively charged cholesterol
  • the method of administration includes oral or parenteral administration, preferably parenteral administration, such as intravenous administration, intramuscular administration, intraperitoneal administration, subcutaneous administration, topical administration and the like.
  • Local administration includes direct injection into the affected area.
  • the pharmaceutical composition can include carriers (eg, diluents and excipients), and additives.
  • Additives include such agents as are commonly used in the pharmaceutical industry such as stabilizers, preservatives, surfactants, buffers, binders and the like.
  • Diluents include, for example, sterilized water, physiological saline, buffer solutions such as phosphate buffered saline, Ringer's solution, and the like.
  • cancer examples include malignant tumors and metastatic cancers, but are not limited to the following.
  • lung cancer gastric cancer, esophageal cancer, liver cancer, kidney cancer, oral cancer, brain tumor, bladder cancer, kidney cancer, colon cancer Head and neck cancer, breast cancer, ovarian cancer, cervical cancer, skin cancer, bone cancer, tongue cancer and so on.
  • Cell line 293 derived from human embryonic kidney was cultured in DMEM containing 10% FBS.
  • DMEM fetal bovine serum
  • Control cells irradiated cells Like, but without exposure to UVC exposure sources. Cells were examined at specified times after exposure to UV.
  • immunofluorescence staining 293 cells grown on cover slips were fixed with 4% paraformaldehyde for 15 min, washed 2 x 10 min with PBS, and 0.5% Triton X-100 on ice. Permeated for 5 minutes.
  • Samples were blocked for 30 minutes at room temperature in PBS containing 15% FCS. Samples were incubated with anti- ⁇ H2AX and anti-Rad9 antibodies for 16 hours, washed in PBS for 3 ⁇ 5 minutes, and incubated with anti-mouse Alexa Fluor488 secondary antibody and anti-rabbit Cy3 secondary antibody (Molecular Probes) at room temperature. 1. Incubated for 5 hours. The cells were washed 3 ⁇ 5 minutes in PBS and stained with 4,6-diamidino-2-phenoldiindole (DAPI) (Vector Laboratories). The sample was fixed using DAK0 Fluorescent Mounting Medium (MK0).
  • DAPI 4,6-diamidino-2-phenoldiindole
  • Fluorescence images were taken using an Olympus BX60 microscope equipped with an Olympus DP70 digital camera and DPmanager software. For quantitative analysis, the focus was visually counted during image processing at a magnification of 100x objective. In a single experiment, cells were counted up to at least 100 cells. For apoptotic assembly, 293 cells were exposed to 20 J / m 2 of UV. After fixation with 4% formaldehyde and staining with DAPI, mitotic cells were visualized and counted using a fluorescence microscope. Cells with distinct aggregated chromatin and / or fragmented nuclei were determined to be apoptotic cells.
  • Mouse anti-Rad9 antibody (Al exis), anti-Chkl antibody, anti-phosphorylated Chkl antibody (Ser-317) and anti-p53 antibody (BD Biosciences), anti-phosphate H2AX antibody (Upstate Biotechnology), and anti-phosphorylated p53 (Ser-15) antibody (Cell Signaling Technology) was used.
  • Rad9-S272A previously identified DNA damage-induced phosphorylation site
  • Rad9-9A Ser-272, converted to Ser-272 Ala
  • the hRad9 expression vector labeled with FLAG was prepared by the following method. Labeled with FLAG To prepare hRad9 expression vectors, wild-type or phosphorylation-deficient Rad9 plasmids were amplified by PCR using the Advantage Clentaq system (Clontech). At that time, 5 '—AAA AGC GGC CGC GCA TGA AGT GCC TGG TCA CGG G— 3' ( ⁇ S column No. 33) The oligonucleotide No. 34) was used as a primer. The amplified PCR product was electrophoresed on a 1% agarose gel, the gel was cut out and purified with a gel purification kit (Qiagen). The purified sample was cleaved with restriction enzymes Notl and Xbal, and then bound to the cloning site of pcDNA3.1-FLAG vector to prepare an hRad9 expression vector labeled with FLAG.
  • the WWP-Luc-P21 promoter vector (specialized by Dr. V. Vogelstein; W. S. E1-Deiry et al., (1993) Cell 75: 817-825) was used for the luciferase assembly.
  • Husl and Radl expression plasmids (S. L. Xiang et al. (2001) Biochem. Biophys. Res. Commun. 287, 932-940) were used for the luciferase assembly.
  • the pcDNA-p53 expression plasmid was a kind gift from Dr. J. Yokota (Y. B. Park et al., (2002) Cancer Genet. Cytogenet. 133, 105-111).
  • Wild type Rad9 plasmid was amplified by PCR using Advantage Clentaq system (Clontech). The following oligonucleotides (1) and (A) and (B) and (2), (C) and (D), (C) and (E), and (1) and (E) were used as primers. Using.
  • the amplified PCR product was electrophoresed on a 1% agarose gel, the gel was cut out and purified with a gel purification kit (Qiagen). The purified sample was cleaved with restriction enzymes Notl and Xbal, and then bound to the cloning site of the pcDNA3.1-FLAG vector to prepare a Rad9 protein fragment expression vector.
  • the amplified PCR product (DNA encoding Rad9 protein deletion mutant) is encoded by the following DNA sequence.
  • PCR product from primers (C) and (D) (SEQ ID NO: 43; Mutant (mt3) Rad9): CTCACAGCACACCCCACCCGGACGACTTTGCCAATGACGACATTGACTCTTA
  • Double-stranded siRNA against human Rad9 and human p53 was purchased from Santa Cruz Biotechnology for siRNA introduction. 293 cells were transfected with siRNA constructs using TransIT-TK0 transfection reagent (Mirus) twice at 24 hour intervals. Cell samples were collected after the second introduction as indicated.
  • 0.2 ml of black mouth form was added. The suspension was stirred for 15 seconds, stored for 2 minutes, and separated into two phases by centrifugation. The upper aqueous phase was then mixed with 0.5 ml isopropyl alcohol and incubated at room temperature for 10 minutes. 70% of pelleted RNA by centrifugation
  • RNA (v / v) Washed once with ethanol.
  • the RNA was resuspended in water treated with jetyl pyrocarbonate and the concentration was measured at 320 nm.
  • RT 5 ⁇ g RNA / 1 / L oligo dT,
  • Oligonucleotide 5 In order to amplify G3PDH, oligonucleotide 5, -ACCACAGTCCATGCCATCAC-3 '(upstream; SEQ ID NO: 7) and
  • PCR conditions included initial denaturation at 94 ° C for 1 minute followed by 94 ° C for 10 seconds, 60 ° C for 15 seconds and 72 ° C for 1 minute. After 28 cycles, PCR products were usually detectable by electrophoresis. The intensity of the band corresponding to each DNA was determined by densitometry analysis (Quantity 0ne, BIO-RAD). Quantified.
  • IP-lysis buffer 25 mM Tris-HC1, 0.2% NP40, 250 mM NaCl and ImM EDTA
  • a 500 // g sample of cell lysate after incubation was incubated with 3 g of specific antibody.
  • the antigen-antibody complex was immobilized on protein G-Sepharose beads and the beads were washed 5 times in lysis buffer. Bound proteins were eluted by boiling and subjected to SDS-PAGE and immunoprotting.
  • Transfected cells were cultured in complete growth medium for 24 hours for the noluciferase promoter assay, harvested for luciferase assembly, and performed according to available protocols (Proniega). Luciferase activity is
  • Incubation was carried out in a binding buffer containing (Biosciences). The binding reaction mixture was collected on ice and incubated for 30 minutes at room temperature. The DNA-protein complex was separated on a 5% non-denaturing polyacrylamide gel and the gel was dried in vacuo and used for autography. For super-shift experiments, the antibody was added at 4 ° C, 20 Preincubated with nuclear extract for minutes. For competitive binding reactions, 200 ng of cold probe was added during incubation.
  • Chromatation assay approximately 1 X 10 S cells are resuspended in PBS, fixed with 1% formaldehyde for 10 min at 37 ° C, and 200 ⁇ l SDS-lysis buffer [50 mM Tris -Resuspended in HC1 (pH 8.1), 10 mM EDTA, and 1% SDS] and sonicated 3 times with a 10 second pulse on ice to break chromatin to 200-: L, 000 bp average length did.
  • SDS-lysis buffer 50 mM Tris -Resuspended in HC1 (pH 8.1), 10 mM EDTA, and 1% SDS
  • the downstream P2 raf 1 promoter primers are 5'-GAGGTCAGCTGCGTTAGAGG-3, (SEQ ID NO: 9) and 5, -TGCAGAGGATGGATTGTTCA-3 '(SEQ ID NO: 10) (G. Koutsodontis and D. Kardassis, (2004) Oncogene 23, 9190-9200), and the upstream P21 wafl promoter primer is 5, -CCTATGCTGCCTGCTTCCCAGGAA-3 '(sequence number 11) and 5'-TAGCCACCAGCCTCTTCTATGCCAG-3, (sequence number 12) (G. Koutsodontis and D. Kardassis, (2004)).
  • hRad9 functional aspects of p21 regulation by human Rad9 (hereinafter referred to as hRad9) were evaluated.
  • Rad9 phosphorylation mutants were used, and hRad9 phosphorylation was required for S phase or G2 / M checkpoint activation (P. Roots-Mattjus et al., ( 2003) J. Biol. Chem. 278, 24428-2437), to investigate whether this phosphorylation is required for P21 activation.
  • Western blotting was performed to confirm the expression of wild-type or phosphorylation-deficient Rad9.
  • Wild-type Rad9 is well detectable with the low-migratory protein fraction ( Figure 2A, lane 2), indicating the phosphorylated form of Rad9. Rad9-S272A was also well expressed with a similar low-migratory protein fraction, so this protein probably corresponds to the different phosphorylation state of Rad9 and lacks phosphorylation at the S272 residue. Wax ( Figure 2A, lane 3). The results of Rad9-8A and Rad9-9A transfection showed lower phosphorylation compared to wild-type Rad9 (Fig. 2A, lanes 2, 4 and 5). It indicates that the body is overexpressed.
  • the P21 promoter region (WWP-Lu-P21 promoter) fused to luciferase was co-transfected into the 293 cells using a plasmid.
  • the background level is low ( Figure 2B, column 1).
  • the P21 promoter contains at least two p53-binding consensus sequences in the approximately 2kb upstream region 5 'from the transcription start site (WS EL-Deiry et al., (1995) Cancer Res. 55, 2910-2919) P53 overexpression induced luciferase activity as expected (Figure 2B, column 9).
  • hHusl and hRadl show a strong activity like p53, which indicates the role of Husl and Radl in checkpoint activation (MA Burtelow et al., (2001) J. Biol. Chem. 276 , 25903-25909; V. ⁇ Bermudez et al., 2003 Proc. Natl. Acad. Sci. USA 18, 1633-1638) and their role in indirect or direct activation of P21 transcription Suggests the possibility of fulfilling.
  • siRNA was used to knock down endogenous hRad9.
  • Figure 3A After confirmation of knockdown of each endogenous p53 or Rad9 protein by Western plot ( Figure 3A), the cells were treated with siRNA. And exposed to 20 J / m 2 UV to extract total RNA. RT-PCR was used to measure the level of P21 mRNA.
  • FIG. 3B transfection of Rad9 s iRNA (Santa Cruz; product No. sc-36364) increased the level of P21 mRNA (column 3), while p53 s iRNA (Santa Cruz; Transfection using product No.
  • Immunoprecipitation was performed to confirm whether hRad9 interacts with p53. Briefly, 293 cells were collected and cell lysates were incubated with anti-Rad9 or anti-p53 antibodies. The antigen-antibody complex was immobilized on protein G sepharose beads, and the bound protein was eluted by boiling and subjected to SDS-PAGE and Western blotting. As shown in FIG. 4A, hRad9 was immunoprecipitated with p53. In order to examine whether phosphorylation of Rad9 affects the binding to p53, 293 cells were transfected with wild-type or phosphorylation-deficient Rad9 plasmid, and immunoprecipitation was performed.
  • hRad9 specifically binds to the p53 consensus DNA binding sequence in the P21 promoter and regulates transcriptional levels of P21 (Y. Yin et al. (2004) Proc. Natl. Acad. Sc. i. USA 15, 8864-8869).
  • EMSA was performed to confirm p53 consensus specific binding of hRad9.
  • EMSA was performed to evaluate changes in promoter binding after UV treatment.
  • oligo probe containing a p53 binding sequence as previously reported was used (Y. Yin et al., (2004)). The ends of these probes were labeled with [ ⁇ -32P] ATP.
  • Nuclear proteins extracted from 293 cells were incubated with oligo probes in a binding buffer. The DNA-protein complex was separated on a polyacrylamide gel and the gel was exposed to film. For supershift experiments, antibodies were preincubated with nuclear extracts. Also, a cold probe was added during the incubation for competitive binding reactions.
  • ChIP assembly Went 293 cells were transformed with wild type or phosphorylation deficient Rad9 plasmid and treated with UV radiation or untreated. After treatment, the cells were cross-linked with 1% formaldehyde and sonicated to break up the chromatin to an average length of 200-1 and OOObp. The sonicated cell suspension was added to a chromatin immunoprecipitation dilution buffer containing anti-Rad9 antibody or anti-p53 antibody.
  • the mixture was shaken with protein A agarose.
  • the immunoprecipitate was eluted and DNA was extracted from the eluate.
  • the above DNA was amplified by PCR using primers corresponding to various regions of the human P2 afl promoter.
  • Example 6>-phosphorylation of hRad9 is required for focus formation after DNA damage.
  • 9-1-1 complex forms the DNA damage focus when DNA damage occurs (VP Bermudez et al. (2003) Proc. Natl. Acad. Sci. USA 18, 1633-1638; ⁇ A. Burtelow et al. (2000) J. Biol. Chem. 275, 26343-26348; I. Hirai and HG Wang, (2002) Biol. Chem. 277, 25722-25727).
  • Immunohistochemistry was performed to examine whether phosphorylation of Rad9 affects the focus formation at the site of DNA damage. 293 cells grown on force bars were fixed in 4% paraformaldehyde.
  • Rad9 protein fragment mutants (mtl, mt2, mt3, mt4 and mt5) Rad9 (SEQ ID NOs: 41 to 45, respectively)
  • Expression plasmid including reporter gene FLAG
  • expression of the mutant (mtl to mt5) Rad9 was introduced into MRC5 cells (ATCC CCL-171) and Western plot. (Figure 7B) was confirmed by using anti-FLAG antibody (SIGMA).
  • Wild-type (WT) and mutant (mt2) Rad9 plasmids were introduced into cultured MRC5 cells (cultured in DMEM containing 10% FBS) and immunoprecipitation (anti-FLAG antibody (SIGMA) and anti-p53 antibody (BD Biosciences) ) was used to examine the binding of p53 and Rad9. After introduction of the mutant (mt2) Rad9, the binding of p53 and endogenous Rad9 (arrow) decreased compared to the control (mock) (Fig. 8A).
  • Head and neck squamous cell carcinoma cell line MMSI-1 (cultured in DMEM containing 10% FBS) in wild type (WT), mutant type (M1: 2)
  • WT wild type
  • M1 mutant type
  • Each of the Rad9 plasmids was introduced, the expression of the plasmid was confirmed by immunofluorescence staining, and apoptosis was examined by staining with DAPI.
  • DAPI staining with DAPI.
  • Rad9 siRNA (SEQ ID NO: 18) was introduced into the head and neck squamous cell carcinoma cell line MMSI-1 and cervical cancer cell line HeLa cells using Lipofectamine 2000 (Invitrogen), and apoptosis was examined by staining with DAPI. As a result, apoptosis was significantly enhanced when Rad9 siRNA was introduced compared to the control (Mota) (2.8% and 7.8% in wake SI-1 and 3.0% and 12.0% in HeLa). (Fig. 10)).
  • Etoposide (VP16), camptothecin (CPT), cisplatin (CDDP), and doxorubicin (D0X) were administered to cultured MRC5 cells, and collected after 4 hours. Of endogenous protein binding). As a result, etoposide, camptothecin, and cisbratin both showed increased binding, whereas doxorubicin decreased both binding (Fig. 11).
  • [35 S] -labeled p53 protein ([35 S] P 53) and Rad9 protein bound with GST tag (GST-Rad9) were reacted in vitro with NETN buffer.
  • [35 S] When expressed the GST protein alone unbound p53 and Rad9 is not an observed binding of two (lane 1), and GST [35 S] p53 - Reaction of Rad9 binding of both was confirmed (lane 2) (Fig. 1 2).
  • it is reacted with [3] ⁇ 3 after reacting the GST-Rad 9 with anti-Rad 9 antibody, the binding of GST-Rad9 with [35 S] p53 were reduced (lane 3).
  • Rad9-p53 binding is decreased by administration of anti-Rad9 antibody, and it is considered that the binding of both can be controlled by neutralizing antibody.
  • the biological function of p53 is controlled through the control of the binding between Rad9 and p53, which makes it possible to suppress cancer growth and metastasis, for example. It also enables screening of bioactive agents as cancer therapeutic agents that control such binding.
  • the present invention through control of the coupling between Rad9 and p53, to control the biological function of P 53, this Yotsute allows for example cancer proliferation and metastasis inhibition. In addition, it becomes possible to screen for bioactive agents as cancer therapeutic agents that control such binding. Drugs that can control the activity of p53, which is associated with more than 60% of cancer types, are useful for cancer treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Urology & Nephrology (AREA)
  • Epidemiology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Dispersion Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

La présente invention concerne un procédé de criblage d'un agent thérapeutique destiné à traiter le cancer, le procédé comportant les étapes qui consistent à ajouter une substance candidate à un système de test en présence d'un produit génique cancéreux Rda9 et d'un produit génique anti-cancéreux p53 et à sélectionner une substance biologiquement active susceptible de moduler la liaison entre Rda9 et p53. L'invention concerne également un agent thérapeutique destiné à traiter le cancer qui module la liaison entre Rda9 et p53.
PCT/JP2007/062362 2006-06-14 2007-06-13 Agent thérapeutique destiné au traitement du cancer et procédé destiné à cribler ledit agent WO2007145365A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2008521289A JPWO2007145365A1 (ja) 2006-06-14 2007-06-13 癌治療薬及びそのスクリーニング法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2006164890 2006-06-14
JP2006-164890 2006-06-14

Publications (1)

Publication Number Publication Date
WO2007145365A1 true WO2007145365A1 (fr) 2007-12-21

Family

ID=38831871

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2007/062362 WO2007145365A1 (fr) 2006-06-14 2007-06-13 Agent thérapeutique destiné au traitement du cancer et procédé destiné à cribler ledit agent

Country Status (2)

Country Link
JP (1) JPWO2007145365A1 (fr)
WO (1) WO2007145365A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022047038A1 (fr) 2020-08-28 2022-03-03 Illumina, Inc. Détection et filtrage de groupes sur la base d'appels de base prédits par intelligence artificielle
WO2022212180A1 (fr) 2021-03-31 2022-10-06 Illumina, Inc. Appelant de base à base d'intelligence artificielle avec reconnaissance contextuelle

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ISHIKAWA K. ET AL.: "A role of Rad9 in regulation of p53-dependent p21waf1 activation after exposure to UV light", SEIKAGAKU, 2006, pages A10724 + ABSTR. NO. 3P-A-269, XP003020945 *
ISHIKAWA K. ET AL.: "p53 o Kaisuru P21 Hatsugen Seigyo ni Okeru Rad9 no Yakuwari to Shuyo Zoshoku en o Kan'yo", JAPANESE JOURNAL OF HEAD AND NECK CANCER, vol. 32, no. 2, 15 May 2006 (2006-05-15), pages 159, XP003020943 *
MOCHAN T.A. ET AL.: "53BP1, an activator of ATM in response to DNA damage", DNA REPAIR, vol. 3, no. 8/9, 2004, pages 945 - 952, XP003020944 *
YIN Y. ET AL.: "Human RAD9 checkpoint control/proapoptotic protein can activate transcription of p21", PROC. NATL. ACAD. SCI. USA, vol. 101, no. 24, 2004, pages 8864 - 8869, XP003020946 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022047038A1 (fr) 2020-08-28 2022-03-03 Illumina, Inc. Détection et filtrage de groupes sur la base d'appels de base prédits par intelligence artificielle
WO2022212180A1 (fr) 2021-03-31 2022-10-06 Illumina, Inc. Appelant de base à base d'intelligence artificielle avec reconnaissance contextuelle

Also Published As

Publication number Publication date
JPWO2007145365A1 (ja) 2009-11-12

Similar Documents

Publication Publication Date Title
KR20090040391A (ko) Ｒｅｇ４ 또는 ｋｉａａ０１０１을 과발현하는 암의 예방 및 치료 기술
US20080220455A1 (en) p53-DEPENDENT APOPTOSIS-INDUCING PROTEIN AND METHOD OF SCREENING FOR APOPTOSIS REGULATOR
KR20170138410A (ko) 비-천연 세마포린 3 및 이의 의학적 용도
JP2022130514A (ja) 抗ｒｈｏ ｇｔｐａｓｅコンホーメーションシングルドメイン抗体及びその使用
US20140178899A1 (en) Compositions and methods for diagnosing and treating cancer and neurodegenerative diseases related to beclin-1
JP7125979B2 (ja) 異所性骨化の治療又は予防のための医薬組成物
TW202212360A (zh) 抗ｃｌｄｎ１８．２抗體及其診斷用途
EP1440091A1 (fr) Homologues de recepteur nogo et utilisations
WO2007145365A1 (fr) Agent thérapeutique destiné au traitement du cancer et procédé destiné à cribler ledit agent
Shi et al. A novel single‐chain variable fragment antibody against FGF‐1 inhibits the growth of breast carcinoma cells by blocking the intracrine pathway of FGF‐1
US6171857B1 (en) Leucine zipper protein, KARP-1 and methods of regulating DNA dependent protein kinase activity
JP5354634B2 (ja) ヒトａｂｈ８タンパク質、それをコードする遺伝子、およびこれらの治療的又は診断的用途
JPH11235186A (ja) 神経組織のナトリウムチャンネルをコードする核酸
JPWO2005111213A1 (ja) Ｍｙｃ標的遺伝子ｍｉｍｉｔｉｎ
JP2014511377A (ja) Ｂ型プレキシンのアンタゴニストおよびその使用
CN116635418A (zh) 抗igsf1抗体及其用途
Choi et al. Cloning and characterization of mouse disabled 2 interacting protein 2, a mouse orthologue of human NOSTRIN
WO2004069869A1 (fr) Gene provoquant l'apoptose et son utilisation
CA3070936A1 (fr) Proteine de fusion
RU2783762C2 (ru) Прогнозирование риска развития нежелательной реакции, связанной с введением антитела к ALK2, и способности отвечать на лечение антителом к ALK2
US20090087423A1 (en) Novel protein complex and use thereof
US20060281125A1 (en) ICBP90 polypeptide and its fragments and polynucleotides coding for said polypeptides and applications for diagnosing and treating cancer
TWI291991B (en) Isolated dna encoding a gpbp polypeptide, vectors comprising such dna, isolated gpbp polypeptides, and isolated antibodies that bind to gpbp polypeptides
JP4530631B2 (ja) 新規タンパク質および癌の予防・治療剤
CA2460092C (fr) Procede de diagnostic et de traitement et agents mis en oeuvre par ledit procede

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07745529

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2008521289

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07745529

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)