WO2007145365A1 - Therapeutic agent for cancer and method for screening for the same - Google Patents

Abstract

Disclosed is a method for screening for a therapeutic agent for cancer, comprising the steps of adding a candidate substance to a test system in the presence of a cancer gene product Rda9 and a cancer suppressor gene product p53 and selecting a biologically active substance capable of controlling the binding between Rda9 and p53. Also disclosed is a therapeutic agent for cancer, which an control the binding between Rda9 and p53.

Description

 Cancer therapeutics and screening methods thereof

 The present invention relates to a cancer therapeutic agent. Specifically, the present invention relates to a composition for cancer treatment that controls the function of the oncogene Rad9 and thereby enhances the activity of the tumor suppressor gene p53.

To do.

 Fine

 The invention also relates to a method of screening for such cancer therapeutic agents. Background art

 A cell cycle checkpoint is a signaling pathway that maintains the proper order of cell cycle events. After DNA is damaged or replication is inhibited, cellular responses occur by activation of evolutionarily conserved signaling pathways. This pathway slows cell cycle progression and induces repair of damaged DNA. These signal transduction pathways include protein sensors that recognize abnormal DNA structures and activate kinases, thereby inducing a phosphorylation cascade that ultimately leads to cell cycle arrest and DNA It leads to restoration (Non-Patent Document 1). If this cell cycle monitoring mechanism is not successful, the genome becomes unstable and eventually cancer is formed in mammals (Non-patent Document 2).

 The ヒ Rad9 (hRad9) protein is a ヒ homolog of Schizosaccharomyces pombe Rad9 and is a member of the checkpoint ポ rad gene (radl ;, rad3 +, rad9 +, radl7 +, i: ad26 + and husl +). These rad genes are necessary for S phase (DNA repair) and G2 phase (DNA damage) checkpoints (Non-patent Document 3).

Rad9 was initially identified as a factor that controls the sensitivity of yeast to radiation. When DNA is damaged, Rad9 also forms a trimer with the checkpoint proteins Radl and Husl, surrounds the DNA damage site, and transmits damage repair signals to downstream factors. At that time, phosphorylation at 9 or more phosphorylation sites at the C-terminal of Rad9 is considered to be important for signal transduction (Non-patent Document 4). Rad9 is also The DNA polymerase beta activation, while involved in damage repair, anti-apoptotic proteins BEL- 2 or Bel - xL and suppression binds to induce apoptosis (Non-Patent Documents 5 and 6) _t check Poin DOO and the DNA damage This refers to the mechanism from recognition to cell cycle regulation. From the checkpoint, Rad9 is suggested to exist and function at the branch point of the opposite pathway of damage repair and apoptosis. However, there are many unknown parts that have not been elucidated, especially in humans.

 As data on Rad9 cancer, the Rad9 gene is located in the long arm 13 region of chromosome 11. Although at least four oncogenes are thought to exist in this region, only two oncogenes have been identified so far. Also, clinically, gene amplification in this region is often observed in head and neck cancer, esophageal cancer, and breast cancer, and there is evidence that survival rate is reduced by gene amplification (Non-patent Document 7). However, although the oncogene is overexpressed by gene amplification and leads to a decrease in survival rate, the details of the relationship between gene amplification and carcinogenesis or cancer cell growth are unknown. There is currently no evidence that Rad9 is clinically involved in survival.

 The p53 gene is an unprecedented important tumor suppressor gene that shows some mutation in more than 60% of human cancers. When DNA is damaged, p53 protein increases or activates after recognizing damage, and is involved in induction of apoptosis, cell cycle suppression, cell division suppression, DNA replication, damage repair, etc. through transcription of various genes, genome (Non-Patent Document 8). Therefore, it may be possible to suppress cancer growth and metastasis by controlling p53 function.

 Among the transcriptional targets of p53, an important known function is the P21 gene. When p53 binds to the p53 binding site in the P21 promoter, expression of P21 is induced, and Cycl inE and cdk2 are suppressed, and the cell cycle is suppressed and time is allowed to repair damage (Non-patent literature). 9, 10 and 11). p53 is a negative regulator of cell cycle progression, and controls the transition from the G1 phase to the S phase of the cell cycle (Non-patent Document 12). On the other hand, hRad9 specifically binds to the p53 consensus DNA-binding sequence of the P21 promoter and regulates P21 at the transcription level (Non-patent Document 13).

Furthermore, Patent Document 1 discloses a screening method for bioactive agents using the binding between Rad9 and cell cycle protein PP5. Furthermore, Patent Document 2 describes that the activation of ATM, ATR, or a protein regulated by ATM or ATR is mediated by the binding of AIM3. Proteins regulated by ATM or ATR include many substances such as p53 and RAD9. · Although hRad9 is suggested to be involved in cell cycle control, its function and mechanism are unclear in fact, and the involvement of Rad9 in the above-mentioned p53 pathway is also unknown. .

 Patent Document 1 US Patent Application No. 200302211546A1

 Patent Document 2 US Patent Application No. 20060046250A1 Non-patent Document 1 G. K. Dasika et al., Oncogene 18: 7883-7899, 1999

 Non-Patent Document 2 C. Lengauer et al., Nature 396: 643-649, 1998

 Non-patent document 3 E. Stewart et al., Curr. Opin. Cell Biol. 8: 781-787, 1996 Non-patent document 4 RP St Onge et al., J. Biol. Chem. 278: 26620-26628, 2003 Non-patent document 5 MN Toueill e et al., Nucleic Acids Res. 32: 3316-3324, 2004 Non-Patent Document 6 K. Komatsu et al., Nat. Cell Biol. 2: 1-6, 2000

 Non-Patent Document 7 H. Tsuda et al., Cancer Res. 49: 3104-8, 1989

 Non-Patent Document 8 A. J. Levine, Cel 88: 323-331, 1997

 Non-Patent Document 9 W. S. El-Deiry et al., Cel 75: 817-825, 1993

 Non-Patent Document 1 0 J. Harper et al., Cell 75: 805-816, 1993

 Non-patent literature 1 1 A. Noda et al., Exp. Cel l Res. 211: 90-98, 1994 Non-patent literature 1 2 M. B. Kastan et al., Cel l 71: 587-597, 1992

 Non-patent literature: L 3 Y. Yin et al., Proc. Natl. Acad. Sci. USA 15: 8864-8869, 2004 Disclosure of the Invention

 The object of the present invention is to clarify the biological interaction between Rad9 and p53 and to use it for cancer therapy.

The present inventors have unexpectedly found that the function of Rad9 is manifested through a certain type of protein binding activity, and that its specific protein binding target is p53, and the binding between Rad9 and p53 Control is related to checkpoint control via transcription of P21 As a result, the present invention was completed. The following results were obtained from this series of studies.

 (1) Inhibition of Rad9 by using RNA competition (RNAi) or a competitive reaction with mutant Rad9 increased P21 mRNA expression.

 (2) Due to luciferase activity, introduction of Rad9 suppressed P21 promoter activity.

(3) by immunoprecipitation, Rad9 is directly bonded with _P 53.

 (4) Rad9 bound to the p53 binding site in the promoter region of the P21 gene, and the binding increased by UV irradiation.

 (5) From the formation of Rad9 focus after UV irradiation, phosphorylation of Rad9 C-terminal was important for Rad9 reaction to DNA damage.

 From the above results, the path from activation of Rad9 after DNA damage to the induction of apoptosis of the cell via the p53 pathway, which has been unknown in detail, has been shown. It became clear that it was involved in the decision of whether to go to cell death.

 In summary, the present invention has the following features.

 In the first aspect, the present invention provides an organism capable of controlling the binding between Rda9 and p53 by adding a drug candidate in the presence of the oncogene product Rad9 and the tumor suppressor gene product p53 in the test system. A method is provided for screening cancer therapeutics, comprising selecting active agents.

 According to an embodiment of the present invention, the drug candidate is selected from the group consisting of a small molecule, a nucleic acid, a peptide, a protein, a saccharide, and a lipid.

 According to another embodiment of the invention, the system comprises cells from eukaryotic and prokaryotic organisms.

 According to another embodiment of the invention, the control is either suppression or enhancement. According to another embodiment of the present invention, the drug candidate is an antibody that neutralizes the binding region of Rad9 and p53.

According to another embodiment of the present invention, the drug candidate is a Rad9 protein fragment having 5 or more amino acid residues derived from a binding region of Rad9 and p53, or a variant thereof. According to another embodiment of the present invention, the drug candidate is an antisense nucleic acid, RNAi nucleic acid, or vector DNA containing the nucleic acid thereof that suppresses the transcription and expression of the Rad9 gene.

 In the second aspect, the present invention also controls the biological function of the Rad9 protein or the expression of the Rad9 gene, thereby enhancing or suppressing the binding between Rad9 and p53, thereby suppressing or enhancing the activity of p53. There is provided a pharmaceutical composition for treating cancer comprising a bioactive agent capable of interacting with the Rad9 gene, a transcription product or a translation product thereof.

 As used herein, the term “interacts with the Rad9 gene, its transcript or translation product” refers to the Rad9 protein or gene that directly interacts with the intracellular Rad9 gene, its transcript or translation product. It is meant to control the biological function and expression of the protein positively or negatively. Therefore, the active ingredients of the pharmaceutical composition of the present invention include those exemplified below. For example, the AIM3 protein described in US Patent Application No. 20060046250A1, its variants, and the nucleic acid encoding them are Not included. According to an embodiment of the present invention, the drug is an antibody against Rad9 or an antibody fragment.

 According to another embodiment of the present invention, the agent is an antisense nucleic acid that suppresses transcription and expression of the Rad9 gene or a solid DNA containing the nucleic acid.

 According to another embodiment of the present invention, the agent is an RNAi nucleic acid that suppresses the transcription and expression of the Rad9 gene or a vector DNA containing the nucleic acid.

 According to another embodiment of the present invention, the drug is a Rad9 protein fragment having 5 or more amino acid residues derived from the binding region of Rad9 and p53, or a variant thereof. According to another embodiment of the invention, the drug is encapsulated in ribosomes. The terms according to the present invention include the following definitions.

 As used herein, “Rad9” refers to a Rad9 protein derived from a mammal, preferably human, or a nucleic acid encoding it (ie, genomic DNA, mRNA, cDNA, etc.).

The Rad9 gene is one of the oncogenes, and when Rad9 is damaged,

It is a protein that directs repair of DNA damage, or induces cell apoptosis (programmed cell death) when it is repressively combined with anti-apoptotic proteins It is protein to do.

 As used herein, “p53” is a tumor suppressor gene. When DNA is damaged, the p53 protein increases or activates, induces apoptosis through transcription of various genes, and suppresses the cell cycle. It is involved in cell division inhibition, DNA replication, damage repair, etc., and has the biological function of bringing about the stability of the genome. Therefore, it is possible to suppress cancer growth and metastasis by controlling the function of p53 become. p53 regulates the induction of P21 gene expression. Specifically, when p53 binds to the p53 binding site in the P21 promoter region, transcription of P21 is initiated and P21 expression is induced. p21 is a cyclin-dependent kinase inhibitor that leads to cell cycle suppression. The present invention is based on the new finding that the Rad9 protein binds to the p53 protein and regulates the function of p53, and through such binding control, biological functions involving p53, such as DNA replication or DNA Control of damage repair, apoptosis, suppression of cell division, etc., or control of p53-dependent P21 gene expression, leading to cell cycle suppression, repair of DNA damage, and stabilization of the genome.

 This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2006-164890, which is the basis of the priority of the present application. Brief Description of Drawings

Figure 1 shows the UV-inducing effect on the expression of the P21 gene expression product. Specifically, changes with time in P21 mRNA and p21 protein after UV irradiation are shown. 293 cells were treated with 20 J / m ² UV and cells were harvested at various times from 0 to 72 hours as indicated after treatment. Figure 1A shows the results of extracting RNA, performing RT-PCR, and calculating the ratio of P21 mRNA to G3PDH by densitometry. Fig. 1B shows the results of extracting proteins and performing Western plotting using anti-P21 antibodies.

Figure 2 shows the effect of hRad9 wild type or mutant expression on P21 transactivation. FIG. 2A shows the results of Western blotting (WB) performed using cell lysates of 293 cells transfected with wild-type Rad9 plasmid or phosphorylation-deficient Rad9 plasmid. FIG. 2B shows the results of P21 transcription assays with hR _a d9 using the P21 promoter luciferase reporter system. Relative activity is illustrated as the ratio of Firefly to Renille. Each column represents 293 cells transfected simultaneously as follows. Column 1, pUC19 and pGL3Basic; Column 2, pUC19 and WWP-Luc-P21 promoter; Column 3, hHusl and WWP-Luc-P21 promoter (P21-Luc); Column 4, hRadl and WWP-Luc-P21 promoter; Column 5, wild-type Rad9 and T-Luc-P21 promoter; column 6, Rad9-S272A and WWP-Luc-P21 promoter; column 7, Rad9-8A and WWP-Luc-P21 promoter; column 8, Rad9-9A and WWP-Luc-P21 promoter; Column 9, P53 and P 籠 Luc-P21 promoter; Column 10, wild-type Rad9 and p53 and WWP-Luc-P21 promoter; Column 11, Rad9- S272A and p53 and WWP Luc_P21 promoter; Column 12, Rad9-8A and P53 and WWP-Luc-P21 promoter; Column 13, Rad9-9A and P53 and WWP-Luc-P21 promoter.

Figure 3 shows the results of knockdown experiments hRad9 and _P 53 using siRNA. FIG. 3A shows the results of Western blot analysis using the indicated antibodies. The ECL signal is detected by a densitometer, and the intensity ratio is shown in the figure. FIG. 3B shows the results of a hRad9 knockdown experiment using siRNA. hRad9 and P53 were knocked down using siRNA (siRad9 or siP53, respectively) and treated with UV or not. After harvesting the cells, RNA was extracted and P21 mRNA was assayed using RT-PCR. The ratio of P21 mRNA to G3PDH was calculated by densitometry and displayed.

 Figure 4 shows the interaction between hRad9 and p53. FIG. 4A shows that 293 cell lysates were used for immunoprecipitation as described in Materials and Methods. Anti-c-kit antibody was used as a negative control for immunoprecipitation. Figure 4B shows wild-type labeled with FLAG

Transfected with Rad9 plasmid or phosphorylation-deficient Rad9 plasmid

The results are shown when immunoprecipitation was performed using cell lysates of 293 cells. Immunoprecipitation with anti-FLAG antibody and immunoblotting with anti-p53 antibody are shown. Figure 4C shows the time course of the Rad9 / p53 complex after exposure to UV. 293 cells were treated with 20 J / m ² UV, and the cells were collected at 0 to 72 hours after the treatment. Thereafter, immunoprecipitation was performed using cell lysate of 293 cells. The upper panel shows immunoprecipitation with anti-p53 antibody and immunoplot with anti-hRad9 antibody. Middle panel shows immunization with anti-hRad9 antibody Shown are immobilization by precipitation and anti-p53 antibody. The lower panel shows immunoprecipitation with anti-hRad9 antibody and immunoplot with anti-phosphorylated p53 (ser-15) antibody. FIG. 5 shows that promoter binding by hRad9 increases after UV irradiation. FIG. 5A shows the results of EMSA using nuclear extracts from treated and untreated 293 cells. Lane 1, no nuclear extract, 30 bp oligo with downstream p53 consensus DNA binding sequence; Lane 2, untreated nuclear extract; Lane 3, nuclear extract with cold 30 bp oligo added as competitor; Lane 4, nuclear extract with anti-p53 antibody added; Lane 5, nuclear extract with anti-hRad9 antibody added; Lane 6, nuclear extract 6 hours after UV treatment; Lane 7, anti-p53 antibody added, Nuclear extract 6 hours after UV treatment; Lane 8, nuclear extract 6 hours after UV treatment, with addition of anti-hRad9 antibody. Figures 5B, C, D, and E show the ChIP assembly results for the P21 promoter site. 293 cells were transfected with wild-type Rad9 plasmid or phosphorylation-deficient Rad9 plasmid, and the cells were collected with or without UV treatment. Thereafter, ChIP assembly using anti-hRad9 antibody or anti-p53 antibody was performed. The ratio of immunoprecipitated DNA to input DNA was calculated by densitometry and shown in the graph. Figure 5B shows ChIP assembly immunoprecipitated with anti-hRad9 antibody, with DNA amplified with primers for the P21 downstream binding site. Figure 5C shows immunoprecipitation with anti-p53 antibody, where DNA is amplified in a primer against the P21 downstream binding site. FIG. 5D shows immunoprecipitation with anti-hRad9 antibody, and DNA is amplified with primers for the P21 upstream site. Figure 5E shows immunoprecipitation with anti-p53 antibody, with DNA amplified with primers for the P21 upstream site.

Figure 6 shows the role of hRad9 in the DNA damage response. FIG. 6A shows the colonization of γ2 and Rad9 in the UV-induced nuclear focus. Figure 6B shows the focus formation rate of hRad9 after UV treatment. 293 cells were transfected with wild-type Rad9 plasmid or phosphorylated Rad9 plasmid, and fixed with 4% paraformaldehyde 1 hour after UV treatment. Immunofluorescence staining was performed and the percentage of cells with hRad9 focus formation was analyzed. Figure 6C shows the time course of phosphorylated Chkl and apoptosis. 20J / ra ²

293 cells were treated with UV, and cells were collected at various times from 0 to 72 hours after treatment. Western blotting using anti-phosphorylated Chkl (Ser-317) antibody and anti-Chkl antibody was performed. Densitometric calculation of the ratio of phosphorylated Chkl (Ser-317) to total Chkl Indicated. In parallel, after staining cells with DAPI, apoptosis was counted to show the percentage of cells with apoptosis. Phosphorylated p53 (Ser-15), P21 mRNA (FIG. 1A) and p21 protein (FIG. 1B) are also shown. FIG. 6D shows the mode of modulation of p53-dependent p21 activation. After DNA has been damaged by exogenous gene toxins, non-scheduled replication, etc., the damage becomes sensitive due to ATR / ATM, or the focus of the γ Η2ΑΧ and 9-1-1 complex. ρ53 accumulates and binds to the p53 consensus sequence of the P21 promoter associated with hRad9. P21 is fully transcribed by phosphorylated hRad9, and the checkpoint response is activated 1-3 hours after DNA damage. In contrast, P21 transcription is inhibited by phosphorylation-deficient hRad9, suppressing cell cycle arrest and leading to the induction of apoptosis. C-terminal phosphorylation of Rad9 is presumed to play a role in Chkl activation, which induces G2 / M checkpoint activation 24 hours after DNA damage or apoptosis.

 Fig. 7 shows mutants (mtl, mt2, mt3, mt4 and mt5) of Rad9 that are Rad9 protein fragments having 5 or more amino acid residues derived from the binding region of Rad9 and p53.

(WT) Schematic diagram showing the location of Rad9 in the binding region (Fig. 7A), and each mutant Rad9 expression plasmid (including reporter gene FLAG) introduced into MRC5 cells (mtl) ~ Mt5) Western blot showing Rad9 expression (Fig. 7B). In the figure, PCNA fold represents a Proliferating Cell Nuclear Antigen-like structure, and mock represents a control that does not contain a wild type or mutant Rad9 expression plasmid.

 Figure 8 shows changes in p53-Rad9 binding (Figure 8A) and p21 expression (Figure 8B) when wild-type (WT) Rad9 or mutant (mtl to mt5) Rad9 expression plasmids were introduced into MRC5 cells. The In the figure, “mock” represents a control containing no wild-type or mutant Rad9 expression plasmid, IB represents an immunoblotting, and IP represents immunoprecipitation.

 FIG. 9 shows the percentage of apoptosis of a cancer cell upon introduction of wild-type Rad9 or a mutant (mtl to m1: 5) Rad9 expression plasmid. As cancer cells, Fig. 9A shows the results when SI-1 was used as the head and neck squamous cell carcinoma cell line, and Fig. 9B shows the cervical cancer cell line.

The results when using HeLa cells are shown. In the figure, mock represents a control containing no wild-type or mutant Rad9 expression plasmid. FIG. 10 shows the percentage of apoptosis of Rad9 siRNA (SEQ ID NO: 18) introduced into head and neck squamous cell carcinoma cell line MMSI-1 or cervical cancer cell line HeLa cells. In the figure, mock represents a control that does not contain a wild-type or mutant Rad9 expression plasmid.

 Figure 11 shows changes in p53-Rad9 binding measured by immunoprecipitation when MRC5 cells were administered the anticancer drug etoposide (VP16), camptothecin (CPT), cisplatin (CDDP) or doxorubicin (D0X). . In the figure, “mock” represents a control containing no wild-type or mutant Rad9 expression plasmid, IB represents Imunoguchi, and IP represents immunoprecipitation.

FIG. 12 shows changes in _P 53 -Rad9 binding by anti-Rad9 antibodies. In the figure, GST represents glutathione S transferase, and + represents the substance shown in the figure included in the experimental system (lanes 1, 2 and 3). BEST MODE FOR CARRYING OUT THE INVENTION

 The invention will be further described with reference to the accompanying drawings.

 The present inventors used 293 cells, a human fetal kidney glomerular cell line, and after irradiation with ultraviolet light (UV), phosphorylation of Serl5, which is an index of p53 activation, and p53 transcription target P21. The time course of mRNA was examined. Phosphorylation of p53 increased 5 minutes after irradiation and showed a high value until 12 hours, while P21 mRNA was found to increase in expression 30 minutes to 3 hours after UV irradiation (Fig. 1). These results suggest that checkpoints are activated within 5 to 1 hour after DNA damage.

In order to investigate the role of Rad9 and phosphorylation in P21 promoter activation, p53 or Rad9 plasmid was introduced into 293 cells, and P21 promoter activity was measured by luciferase assay. As a result, when p53 was expressed, the promoter activity of P21 was markedly increased compared to the control (column 1) (force 3), whereas in the cells that expressed Rad9 alone (column 2). The increase in P21 promoter activity was kept low (Fig. 2). On the other hand, expression of both p53 and Rad9 showed intermediate activity (column 4). From these results, it is considered that Rad9 activates P21 in a form that competes with p53. In addition, when plasmids with mutations in Ser272, one of the nine Rad9 phosphate groups, and p53 were both expressed strongly (column 5), plasmids with mutations in eight other sites than Ser272 and p53 When both are expressed together (Column 6), when plasmids with all nine phosphate groups mutated and p53 are expressed together (Column 7), both wild-type (WT) Rad9 and P53 Compared with strong expression, transcription of P21 was kept low (Fig. 2). These results suggest that Rad9 is related to p53 through phosphorylation and may function. Next, Rad9 or p53 was knocked down using RNA interference (RNAi), and expression of P21 mRNA was examined by RT-PCR. Compared to the control (columns 1 and 4), p21 siRNA introduction suppressed P21 mRNA expression (columns 2 and 5), whereas Rad9 siRNA introduction increased P21 mRNA (column 3). 6) (Figure 3). Therefore, it was suggested that Rad9 acts repressively on P21 transcription.

Furthermore, immunoprecipitation was performed to confirm the presence or absence of direct interaction between p53 and Rad9. As a result, Rad9 and p53 binds directly and though there is no significant change in the study result both binding itself changes over time after ultraviolet irradiation, binding to and p5 ³ phosphorylation 5 minutes to 6 hours at Serl5 of (Fig. 4). Therefore, p53 and Rad9 were already bound at the time when there was no DNA damage, but it was considered that the protein bound by the damage response was phosphorylated and functionally regulated. .

 When immunohistochemical staining was performed with the head and neck cancer cell line (MMSI-1), Rad9 was more strongly expressed in the nucleus in the head and neck cancer cell line (Ra SI-1) than in the control 293 cells. Cycl inD1 having a gene in the same region as Rad9 was also strongly expressed. On the other hand, P21 showed only mild expression. These results also suggest that Rad9 is strongly expressed and checkpoint abnormalities in head and neck cancer.

Based on the above facts, it was considered that Rad9 interacts with p53 and controls P21 competitively and suppressively. After recognizing DNA damage, Rad9 regulates p53 while undergoing phosphorylation modification under normal conditions, and is thought to act on checkpoint activation and damage repair through transcription of P21. It is known that the checkpoint protein Chk_l is activated by phosphorylation of Rad9. On the other hand, in the state where Rad9 is not phosphorylated, that is, in the state where the damage of the cell is large, it is considered that the transcription of P21 is further suppressed, and the cell cycle advances and induces apoptosis. Thus, Rad9 interacts with p53 through phosphorylation modification and has an important function in fateing the life and death of DNA-damaged cells (Figure 6D).

 Furthermore, Rad9, which has a mutation in the phosphorylation site of Rad9, was introduced into 293 cells to examine induction of apoptosis. The expression of the plasmid was confirmed by Western blotting. In the plasmid (Rad9-9A) in which 9 phosphorylation sites were mutated compared to the wild type (FT), it was confirmed that Rad9 with high mobility was strongly expressed. Apoptosis after 24 hours of UV irradiation was approximately doubled (WT 6.5%, Rad9-9A 12.5%), suggesting that the induction of apoptosis is promoted by the control of Rad9.

 In summary, Rad9 and p53 bind regardless of whether or not each protein is phosphorylated. Through this binding, Rad9 suppresses the biological action (or biological activity) of p53. It is adjusted to. When Rad9 binds to p53 in a state where Rad9 is not phosphorylated, P21 transcription is suppressed, the cell cycle proceeds, and cellular apoptosis is induced. On the other hand, when Rad9 is phosphorylated due to cellular DNA damage, the checkpoint protein Chkl is activated and the checkpoint is activated, and the binding between Rad9 and p53 is inhibited and suppressed. Alternatively, dissociation increases P21 transcription, leading to cell cycle suppression, and these events lead to repair of DNA damage. The present invention controls the binding of Rad9 and p53 when DNA is damaged, that is, based on the knowledge obtained this time (Rad9 suppresses and controls p53), the cancer gene Rad9 and By inhibiting, suppressing or dissociating the binding of the tumor suppressor gene p53, the activity of the tumor suppressor gene P53 is expected to be exerted strongly, and it can be applied to the development of diagnostic methods and treatment methods for cancer medical treatment. For example, when normal cells undergo DNA damage under the influence of harmful high-energy rays such as ultraviolet rays and radiation, the present invention is used to repair the DNA damage that stabilizes the genome and prevents canceration. Alternatively, when the cell is, for example, a cancer cell, apoptosis can be induced by the present invention.

Therefore, substances that regulate the binding of Rad9 and p53 are useful as cancer therapeutics, whether they are inhibitory or potent. As will be described below, the present invention provides a novel screening method for such cancer therapeutic agents, as well as antibodies (examples). For example, anti-Rad9 antibody or anti-p53 antibody that neutralizes the binding region between Rad9 and p53, etc., nucleic acid (eg, suppression of Rad9 gene expression (or transcription and translation), anti-sense nucleic acid, RNAi nucleic acid, A vector containing such a nucleic acid-encoding DNA or the like, or a mimetic of the p53 binding region of Rad9 (eg, 5 or more, preferably 8 or more, more preferably 10 or more amino acids derived from the binding region) A Rad9 protein fragment containing the same, a variant thereof, and the like, and the like.

<Screening for cancer drugs>

 In the first aspect, the present invention provides a biological system capable of controlling the binding between Rda9 and p53 by adding a drug candidate in the presence of the oncogene product Rad9 and the tumor suppressor gene product p53 in the test system. A method is provided for screening cancer therapeutics comprising selecting an active agent.

In the present invention, any test system can be used as long as it is an in vitro test system capable of causing the binding of Rad9 and p53. One example of such a test system, preparing a Rad9 protein and p53 protein, physiological pH _(P H7~7. 5, usually 7.4), in salt-containing buffer, from room temperature to about 37 ° C The system mixes both proteins at temperature. Examples of the buffer solution include, but are not limited to, a phosphate buffer solution, a tris monohydrochloride buffer solution, and a phosphate buffered saline solution (PBS). The buffer may contain substances that stabilize proteins, such as glycerol, moss, other proteins that do not affect Rad9-p53 binding, polypeptides or peptides.

Rad9 is Rad9 derived from a mammal, preferably human Rad9. The nucleotide and amino acid sequences of human Rad9 are shown in GenBank accession number NM_004584 (see SEQ ID NOs: 1 and 2), and human Rad9 is composed of 392 amino acids. Mammal Rad9 other than human includes, for example, mouse Rad9 (匪 _011237), rat Rad9 (wake-001030042) and the like. Rad9 that can be used in the method of the present invention is preferably human Rad9, but 80% or more, 85% or more, preferably 90% or more, more preferably 95% or more, 97% with the nucleotide or amino acid sequence of human Rad9. or higher, 98% or higher, that having a 99% or more identity, can be coupled with Katsuhi preparative _P 53, human Rad9 homologues, also variant or analog der connexion good Rere.

Rad9 may be phosphorylated or may not be phosphorylated. Phosphorylation of Rad9 can be achieved by phosphorylating enzymes such as protein kinase CS (K. Yoshida et al., EMBO J. 2003, 22: 143 to 1441), ATR (P. Roos-Mattjus et al., J. Biol. Chem. 2003, 278 24428-24437), cdc2 (RP St. Onge et al., J. Biol. Chem. 2003, 278: 26620-26628).

 p53 is p53 derived from a mammal, preferably human p53. The nucleotide and amino acid sequence of human p53 is shown in GenBank accession number NM-000546 (see SEQ ID NOs: 3 and 4), and human p53 is composed of 394 amino acids. Examples of p53 of mammals other than human include mouse p53 (NM-0111640) and rat p53 (NM-030989). P53 usable in the method of the present invention is preferably human p53, but 80% or more, 85% or more, preferably 90% or more, more preferably 95% with the nucleotide or amino acid sequence of human p53. A human p53 homologue, mutant or analog having the identity of 97% or more, 98% or more, 99% or more and capable of binding to human Rad9 may be used.

 The synthesis of Rad9 and p53 proteins can be performed using a known gene recombination technique, for example, as follows.

Cloning of cDNA encoding human Rad9 is described in B. Howard et al. (A human homolog of the Schizosaccharomyces pombe rad9 + checkpoint controlgene) Proc Natl Acad Sci US A. 1996, 93 (24): 13890-13895 Has been. Specifically, a cDNA library can be prepared from human infant brain (GenBank accession number R18275R18275), and human Rad9 cDNA can be amplified by polymerase chain reaction (PCR). According to Howard et al. (Supra), PCR is performed using 1 μg DNA; l OOpmol primer; 0.2 mM each dNTP (N = A, C, G, T); 2.5 unit Taq polymerase; 1. 5raM MgCl ₂ ; IX Taq buffer (BRL); use 100 / l total volume, pre-incubation for 5 minutes at 95 ° C, 1 minute at 94 ° C (denaturation), 30 at 57 ° C Second (annealing), consisting of 35 cycles with 2 minutes (extension) at 72 ° C as one cycle, followed by a final extension at 72 ° C for 10 minutes.

 Cloning and expression of cDNA encoding human p53 has been described, for example, by E. Harlow et al.

(Molecular cloning and in vitro expression of a cDNA clone for human cellular tumor antigen p53) Mol Cell Biol. 1985, 5 (7): 1601-1610, and G. Matlashewski et al. (Isolation and characterization of a human p53 cDNA clone: express ion of the human p53 gene) EMB0 J. 1984, 20: 3257-3262. Briefly, for example, as described by Harlow et al. (Above), either cloned from a cDNA library derived from A431 cells (human epithelial carcinoma cell line), or the p53 sequence shown in SEQ ID NO: 3. It can be amplified from the above cDNA library by PCR using primers prepared based on the nucleotide sequence. PCR conditions are the same as above.

 For protein synthesis, DNA expression using an appropriate vector / host system is available. Insert DNA encoding Rad9 or p53 into the vector, introduce it into an appropriate host cell, and culture and express it in an appropriate medium. If necessary, DNA encoding a signal peptide can be ligated to the 5 ′ end of the encoding DNA. In addition, a histidine tag (for example, H6-H10 tag), a green fluorescent protein (GFP), a luciferase tag, or a DNA encoding a fluorescent or luminescent protein is linked to one end of the DNA. Protein purification can be facilitated.

 Vectors include bacterial vectors, yeast vectors, fungal vectors, insect vectors, plant vectors and animal (eg, mammalian, avian, etc.) vectors. Examples of vectors include plasmids such as pUC, pBluescript, and pBR, fuzz, cosmids, virus vectors such as baculovirus vectors, adenovirus vectors, adeno-associated wizole vector, retrovirus vectors, etc. In addition, commercially available vectors can be preferably used, including Ti plasmid vector / agglobatate system. Vectors include regulatory sequences (eg, promoters, enhancers, etc., such as SV40 early promoter, cytomegalovirus promoter, P21 gene promoter, force reflower mosaic virus 35S promoter, etc.), selectable markers (eg, neomycin resistance gene, Drug resistance gene such as kanamycin resistance gene, ampicillin resistance gene, nutrient-requiring complementary gene such as LEU2, TRP1, HIS4, ADE2, etc.), liposome binding site or Shine-Dalgarno sequence, replication origin, termination And elements such as a multicloning site and a poly A signal can be selected as appropriate.

Host cells include, for example, bacteria such as Escherichia coli, Bacillus subtilis, and Pseudomonas, yeast (eg, Saccharomyces, Pichia, and methanol-assimilating yeast), basidiomycetes, insects Including cells (eg Sf cells), plant cells, mammalian cells (eg 293 cells, CH0, COS, BHK, HeLa, etc.).

 Transformation of host cells can be carried out by well-known methods such as calcium chloride method, electroporation method, polyethylene glycolate method, microinjection method, bon-nodement method, protoplast or spheroplast method, lipofuxion method, and virus infection method. Can be done by the method.

 Other test systems include eukaryotic cells, for example yeast cells, insect cells, animal cells, preferably mammalian cells, more preferably human-derived normal cell lines or tumor cell lines, as exemplified above. The system to be used is included. Alternatively, prokaryotic cells such as Escherichia coli, Bacillus subtilis, and Pseudomonas bacteria can also be used.

 In the case of a test system using eukaryotic or prokaryotic cells, for example, DNAs encoding Rad9 and p53 are incorporated into a vector such as those shown above so that the vector can be expressed, And a system that allows co-expression of DNA encoding. Each DNA may be separately incorporated into a different vector, or may be incorporated in such a form that it can be co-expressed in the same vector. The vector can contain the same elements as above. The element preferably contains at least a promoter, an origin of replication, a terminator, a selection marker, a manople cloning site and a ribosome binding site. A test system using cells involves culturing the transformed or transfected cells as described above in a suitable medium.

Another example of a test system using eukaryotic cells is a system obtained by introduction into the cell genome by homologous recombination using an expression vector containing genomic DNA encoding Rad9 and p53. Here, genomic DNA refers to the Rad9 or p53 gene and is composed of exons and introns. In this case, the cell to be used is preferably the same type as the cell from which the genomic DNA is derived. That is, it is preferable to use a human cell line for human Rad9 and p53 genomic DNA, and a mouse cell line for mouse Rad9 and p53 genomic DNA. The genomic DNA is placed under the control of a strong promoter derived from a virus such as SV40 or cytomegalovirus, or a radiation, light or chemical-inducible promoter (for example, www.nirs.o.jp/report/nirs_news/200410/hik01p.html; unit. aist. go.jp/rcg/rcg-gb/sg2.html etc.) A system capable of causing transcription is more preferable. Such cells also include human mouse-derived cell lines in which the transcriptional level of P21 changes when DNA damage is caused by irradiation with ultraviolet rays or radiation. Such cells include, for example, human MRC5 cells (human lung fibroblast cell line; ATCC CCL-171), mouse NIH 3T3 cells, and the like.

 The test system that can be used in the present invention may be a lysate (lysate) of the above cells. .

 For example, J. Sarabrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley. & Sons Inc, 2003, etc., and can be used in the present invention. In the method of the present invention, in the above test system, Rad9 and p53 are simultaneously expressed in the presence of a drug candidate, and the inhibition or enhancement of binding between these proteins is measured.

 The drug candidate is selected from, for example, substances that are expected to interact with the Rad9 gene, its transcription product or translation product, and thereby control the binding between Rda9 and p53. It can be selected from the group consisting of molecules (preferably small organic molecules), nucleic acids, peptides, proteins, sugars, lipids and the like.

Examples of drug candidates include antibodies that suppress or inhibit the binding between Rad9 and p53, such as antibodies that neutralize the region involved in the binding. Such an antibody is an antibody against Rad9 or p53 or an antibody fragment thereof, and one that can suppress or inhibit the binding between Rad9 and p53 is selected. The antibody is a monoclonal antibody, a polyclonal antibody, a human antibody, a humanized antibody, a peptide antibody or a fragment thereof (such as Fab, (Fab ') ₂ ), or a synthetic antibody (eg, Fv, scFv, etc.). . An antibody or antibody fragment can be prepared by a known method.

Polyclonal antibodies are a protein or polypeptide or peptide that is emulsified together with an adjuvant such as Freund's adjuvant or non-Freund's adjuvant, an aluminum compound (eg, alura), rabbit, goat, hidge, mouse, rat. Immunize non-human mammals such as pigs, boost about every 2 weeks, check antibody titer in blood, then exhale and obtain antiserum. If necessary, further Kochi淸, ammonium sulfate fractionation, is treated with an ion-exchange column chromatography to obtain a I _g G fraction.

 Monoclonal antibodies are used to immunize non-human animals such as mice as described above, and then remove the spleen, spleen cells, or lymph nodes, and fuse lymphocytes with myeloma cells to produce high-pridoma. . Select antibody-producing hybridomas in HAT medium and transplant into the abdominal cavity of non-human animals, or subject the hybridomas to appropriate animal cell cultures, culture the hybridomas, and obtain monoclonal antibodies from ascites or culture fluid Collect and measure antibody titer or affinity (binding constant or dissociation constant).

 Human antibodies are known human antibody-producing mammals (eg, thigh mice (Kirin Brewery / Medarex), Xeno mice (Abbienix), human antibody-producing sushi (Kirin Brewery / Hematek), etc.) Can be obtained from antisera.

A humanized antibody uses a gene recombination technique to encode a complementary region derived from the variable region of a mouse antibody '["complementarity determining region (CDR) ¾r and a human variable region. It can be obtained by binding to DNA, integrating it into a vector, and transforming it into a mammalian cell (eg, Kettleborough, C, A. et al. Protein Engng., 4, 773-783, 1991; Maeda, H., Human Antibodies and Hybridoma, 2, 124-134, 1991; Gorman, SD et al. Proc. Natl. Acad. Sci. USA, 88, 4181-4185, 1991; Tempest, PR, Bio / Technology, 9, 266-271, 1991; Natal. Acad. Sci. USA, 88, 2869-2873, 1991; Cater, P. et al. Proc. Natl. Acad. Sci. USA, 89, 4285-4289, 1992; Co, MS et al. J Immunol., 148, 1149-1154, 1992; and Sato, K., et al. Cancer Res., 53, 851-856, 1993, etc.) Another example of a drug candidate is in the binding region of Rad9 and p53. Originated 5 or more, 8 or more, 10 or more or 15 or more For example, a Rad9 protein fragment having 20 or more, 30 or more, 50 or more, 100 or more, 150 or more, or 200 or more amino acid residues, or a variant thereof (FIG. 7A). It is an antagonistic (poly) peptide or active agonistic (poly) peptide capable of antagonizing Rad9 protein, and 1 to 5 mutants in the sequence of the Rad9 protein fragment, 1 to 4 1 to 3 A peptide comprising a mutation consisting of substitution, deletion or addition of 1, 2 or 1 amino acid residues. Alternatively, the mutant contains a sequence having 80% or more, 85% or more, preferably 90% or more, 95% or more, more preferably 97% or more, 98% or more identity with the sequence of the Rad9 protein fragment. It is a peptide. For example, the substitution is preferably a conservative amino acid substitution between amino acids with similar structural, hydrophobic or electrical properties. Conservative amino acid substitutions include, for example, acidic amino acids (glutamic acid, aspartic acid), basic amino acids (lysine, arginine, histidine), aromatic amino acids (phenylalanine, tryptophan, tyrosine), nonpolar hydrophobicity Substitution between amino acids (glycine, alanine, oral isine, isoleucine, methionine, proline) or polar uncharged amino acids (serine, threonine, cysteine, asparagine, glutamine) is included.

 Yet another example of a drug candidate is an antisense nucleic acid, RNAi nucleic acid, or vector DNA containing the nucleic acid that suppresses transcription and expression of the Rad9 gene.

 Antisense nucleic acid is RNA or DNA complementary to the Rad9 mRNA sequence or a fragment thereof. The Rad9 mRNA sequence is an RNA sequence corresponding to, for example, the nucleotide sequence encoded by SEQ ID NO: 2, or the nucleotide sequence of the coding region shown in SEQ ID NO: 1. The fragment size is 15 bases or more to less than the full length, preferably 25 bases to 100 bases.

 RNAi (RNA interference) A nucleic acid is a small RNA that suppresses the expression of the Rad9 gene, and includes, for example, siRNA (small interfering RNA) and miRNA (micro RNA). These RNAi nucleic acids are 18-25 bases in size and consist of double-stranded RNA. siRNA consists of a partial sequence of mRNA corresponding to the Rad9 gene and its complementary sequence, while miRNA is

It consists of a partial sequence corresponding to the intergenic region of the Rad9 gene (non-coding region such as intron region) and its complementary sequence. The precursor miRNA can include a stem loop sequence (eg, a sequence derived from a natural miRNA) between the sense strand and the antisense strand. These nucleic acids have the activity of cleaving the target RNA or suppressing translation of the target RNA. Various sequences based on the Rad9 gene sequence or intergenic sequence, e.g., D.M.

Dykxhoorn et al., Nature Rev. Mol. Cell Biol., 77: 7174—7181, 2003 'described a target site selection method (eg, a sequence with about 50% GC content, 50% from the start codon). ˜100 bases downstream sequence etc.) and can be synthesized using a DNA / RNA synthesizer. Alternatively, a single nucleic acid library obtained by randomly cleaving the Rad9 gene sequence with a nuclease and then synthesizing cDNA and further synthesizing RNA may be used. The siRNA or miRNA may be in the form of an expression vector containing the DNA encoding it. Such vectors are commercially available from Takara Bio, Cosmo Bio, Evrogen, Invitrogen, etc., and drug candidates can be prepared by incorporating DNA encoding Rad9 siRNA or miRNA into this vector. (For example, pSINsi, pBAsi, pU6-siRNA, pHl-siRNA, p2FP-RNA, etc.). Such betaters may include elements such as CMV (cytomegarovirus) / E promoter or SV40 early promoter, kanamycin resistance gene / neomycin resistance gene, poly A signal, stop codon, origin of replication.

 For RNAi, experimental medicine “Science of Ai” Vol. 22, No. 4, 2004, Yodosha; Protein Nucleic Acid Enzyme vol. 46, No. 10: 138 to 1386, 2001, Sankyo Publishing; Contemporary Chemistry, 2006 April, 56-60, Tokyo Chemical Doujin (Tokyo, Japan).

 Still other drug candidates include small molecules. Such small molecules include substances known or not known as drugs. Substances known as drugs include commercially available or non-marketed anticancer drugs such as alkylating drugs (eg cyclophosphamide, menolephalan, isophosphamide, cyclophosphamide, bus / refuan etc.), antimetabolites (eg Methotrexate, fluorouracil, tegafur, cytarabine, hydroxycarbamide, etc., antibiotics (eg, doxorubicin, daunorubicin, mitomycin, bleomycin, idanolevicin, etc.), plant-type alburoids (eg, vincristine, vindesine, paclitaxel) Etc.), platinum preparations (eg cisbratin, carbobratin, nedaplatin, etc.). In the method of the present invention, for example, when various different primary cancer cells or tumor cell lines are used as cells, it is possible to estimate which anticancer agent is effective for which type of cancer, or non-cancer. Even when cells are used, drugs with anticancer effects can be selected using the decrease in Rad9-p53 binding as an index (Fig. 11).

Selection of a bioactive agent can be performed by detecting or quantifying the binding of Rad9 and p53 or the binding level thereof. For example, sampling from a test system over time However, in the case of cells, after cell lysis, the binding level can be detected and quantified by techniques such as (non-denaturing polyacrylamide gel) electrophoresis and Western blotting. For detection, anti-Rad9 antibody and anti-p53 antibody can be used. These antibodies are available from Alexis Sento, BD Biosciences, Cel Signaling Technology ±, and the like. Alternatively, when the test system includes cells, a candidate drug can be selected by measuring the transcription level of P21 after causing DNA damage by irradiation with ultraviolet rays or the like. This method is based on the finding that P21 activation is p53-dependent (WS El—Deiry et al., Cell 75: 817-825, 1993). Agents that inhibit the binding between Rad9 and p53 increase p53-dependent P21 activation, leading to repair of DNA damage. In contrast, agents that enhance this binding suppress P21 activation and induce apoptosis in the non-phosphorylated state of Rad9. In this case, if the test cell is, for example, a tumor cell, apoptosis occurs. Therefore, it is possible to evaluate the drug by counting the number of living cells.

<Pharmaceutical composition>

 The present invention also controls the biological function of the Rad9 protein or the expression of the Rad9 gene, thereby enhancing or suppressing the binding between Rad9 and p53, thereby suppressing or enhancing the activity of p53, and the Rad9 gene, its Provided is a pharmaceutical composition for treating cancer comprising a bioactive agent that interacts with a transcript or translation product.

 Examples of drugs as active ingredients include: (l) an antibody or antibody fragment against Rad9, (2) an antisense nucleic acid that suppresses transcription and expression of the Rad9 gene, or a vector DNA containing the nucleic acid, and (3) a Rad9 gene. An RNAi nucleic acid that suppresses transcription and expression, or a vector DNA containing the nucleic acid, and (4) a Rad9 protein fragment having 5 or more amino acid residues derived from the binding region of Rad9 and p53 or a variant thereof.

 Examples and preparation of the drugs (1) to (4) above are as described above.

 An example of a drug is a human antibody or a humanized antibody against Rad9. Such antibodies are

It is preferably an antibody that recognizes an epitope in the binding region between Rad9 and p53,

From antibodies against Rad9, it can be easily obtained by selecting an antibody that suppresses binding using the above test system.

Another example of a drug is 5 or more, preferably 8 or more, derived from the binding region of Rad9 and p53. Above, 10 or more or 15 or more, for example 20 or more, 30 or more, 50 or more, 100 or more, 150 or more,

Rad9 protein fragment having 200 or more amino acid residues, or a variant thereof. Such a fragment is a peptide or polypeptide capable of binding to p53 competitively with Rad9 for binding to p53. Rad9 was cut with a suitable protease to produce a random peptide or Poribe peptide and subjected to the test system, a suppressing antagonistic binding between Rad9 and _P 53 (poly) peptide, or Rad ⁹ As such, agonistic (poly) peptides with similar activity can be selected. Examples of the Rad9 protein fragment are the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 41 (mutant (mtl) Rad9) and the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 42 (mutant (mt2) Rad9 ), Polypeptide encoded by the nucleotide sequence of SEQ ID NO: 43 (mutant (mt3) Rad9), polypeptide encoded by the nucleotide sequence of SEQ ID NO: 44 (mutant (mt4) Rad9), nucleotide sequence of SEQ ID NO: 45 Including the polypeptide encoded by (mutant (mt5) Rad9). Furthermore, the mutant is a mutation comprising substitution, deletion or addition of 1 to 5, 1 to 4, 1 to 3, 1 to 2 or 1 amino acid residue in the sequence of the Rad9 protein fragment. It is a peptide containing. Alternatively, variants, the Rad ⁹ protein fragment sequences throat 80% or more, 85% or more, preferably 90% or more, 95% or more, more preferable properly 97% or more, sequences having 98% or more identity It is a peptide containing. Examples of substitutions include the conservative substitutions described above.

 Still another example of the drug is an antisense nucleic acid that suppresses transcription and expression of Rad9 gene or a vector DNA containing the nucleic acid, or an RNAi nucleic acid that suppresses transcription and expression of Rad9 gene or a vector DNA containing the nucleic acid. It is. As described above, these RNAi nucleic acids are about 18 to about 25 bases in size, and include siRNA and miRNA consisting of double-stranded RNA. siRNA consists of a partial sequence of mRNA corresponding to the Rad9 gene and its complementary sequence, while miRNA consists of a partial sequence corresponding to the intergenic region of the Rad9 gene and its complementary sequence, and has a hairpin structure. These nucleic acids have the activity of cleaving the target RNA or suppressing translation of the target RNA. Based on the sequence of the Rad9 gene or the intergenic sequence (for example, the nucleotide sequences shown in SEQ ID NOs: 41 to 45), various sequences can be obtained, for example, D. M. Dykxhoorn et al., Nature Rev. Mol. Cell Biol., 77: 7174-7718,

2003 I describes. Una target site selection methods (e.g., sequence of about ⁵ 0% GC content, And can be synthesized using a DNA / RNA synthesizer.

 Examples of siRNA include, but are not limited to, oligoribonucleotides corresponding to the following sequences.

 5, -GCCATCACTTTCTGCCTCAAGGAAT-3 '(SEQ ID NO: 13)

 5 '-CCATCACTTTCTGCCTCAAGGAATT-3 (SEQ ID NO: 14)

 5 '-GAGCTTTGCAGAGTCAGCAAACTTG-3 (SEQ ID NO: 15)

 5 '-GCAGAGTCAGCAAACTTGAATCTTA-3 (SEQ ID NO: 16)

 5, -CAGAGTCAGCAAACTTGAATCTTAG-3 (SEQ ID NO: 17)

 5, -CAGCAAACTTGAATCTTAGCATTCA-3 (SEQ ID NO: 18)

 5,-CCACTTTGTCTTGGCCACACTCTCA-3 (SEQ ID NO: 19)

 5 '-TGACTCTTACATGATCGCCATGGAA-3 (SEQ ID NO: 20)

 5 '-GACTCTTACATGATCGCCATGGAAA-3 (SEQ ID NO: 21)

 5 '-CATGATCGCCATGGAAACCACTATA-3 (SEQ ID NO: 22)

 5 '-GCCTATGCCTGCTTTCTCT-3' (SEQ ID NO: 23)

 5 '-CCTATGCCTGCTTTCTCTT-3, (SEQ ID NO: 24)

 5 '-GCCATCACTTTCTGCCTCA-3' (SEQ ID NO: 25)

 5, -CCATCACTTTCTGCCTCAA-3 '(SEQ ID NO: 26)

 5 '-GCTTTGCAGAGTCAGCAAA-3' (SEQ ID NO: 27)

 5 '-GCCAATGACGACATTGACT-3' (SEQ ID NO: 28)

 5 '-GGAAACCACTATAGGCAAT-3' (SEQ ID NO: 29)

 5 '-GCCCTCCATTTCCCTTTCA-3' (SEQ ID NO: 30)

 5 '-CCAAGAAGTTCCGCTCACT-3' (SEQ ID NO: 31)

 5 '-GGAAGACAGTGAGGGTGAA-3' (SEQ ID NO: 32)

 The siRNA used in the present invention may be single-stranded or double-stranded.

 -Strand, in the case of double strand, consists of sense strand and antisense strand. These strands overhang at their 3 'ends to ensure stability, for example

Dinucleotides consisting of TT can be included.

The amount of the drug in the pharmaceutical composition of the present invention is not particularly limited, but is 1 g to 20 mg / kg. It is weight.

 The dosage form may be either a liquid form or a solid form. Solid forms include lyophilized forms and may be dissolved in a buffer solution such as sterile water, physiological saline, phosphate buffered physiological saline, Ringer's solution, etc. immediately before use. Alternatively, the drug may be encapsulated in ribosomes. As liposomes, positively charged ribosomes (eg, positively charged cholesterol) can be preferably used in order to facilitate transfer of drugs into cells (Nakanishi Mamoru et al., Protein Nucleic Acid Enzyme Vol. 44, No. 11, 1590- 1596, 1999, Kyoritsu Shuppan (Tokyo, Japan); TS Zimmermann et al., Nature Vol. 441, 111-114, 2006).

 The method of administration includes oral or parenteral administration, preferably parenteral administration, such as intravenous administration, intramuscular administration, intraperitoneal administration, subcutaneous administration, topical administration and the like. Local administration includes direct injection into the affected area.

 In addition to the active ingredient, the pharmaceutical composition can include carriers (eg, diluents and excipients), and additives. Additives include such agents as are commonly used in the pharmaceutical industry such as stabilizers, preservatives, surfactants, buffers, binders and the like. Diluents include, for example, sterilized water, physiological saline, buffer solutions such as phosphate buffered saline, Ringer's solution, and the like.

 Examples of cancer include malignant tumors and metastatic cancers, but are not limited to the following. For example, lung cancer, gastric cancer, esophageal cancer, liver cancer, kidney cancer, oral cancer, brain tumor, bladder cancer, kidney cancer, colon cancer Head and neck cancer, breast cancer, ovarian cancer, cervical cancer, skin cancer, bone cancer, tongue cancer and so on.

 Hereinafter, the present invention will be described more specifically with reference to examples. However, the scope of the present invention is not limited to these examples. Example

Materials and methods>

Cell culture

Cell line 293 derived from human embryonic kidney was cultured in DMEM containing 10% FBS. For UV irradiation, 60% -70% confluent monolayer cells were washed with PBS and irradiated with UVC released by a germicidal lamp (GL-15; NIPPO Electronic). Control cells, irradiated cells Like, but without exposure to UVC exposure sources. Cells were examined at specified times after exposure to UV. For immunofluorescence staining, 293 cells grown on cover slips were fixed with 4% paraformaldehyde for 15 min, washed 2 x 10 min with PBS, and 0.5% Triton X-100 on ice. Permeated for 5 minutes. Samples were blocked for 30 minutes at room temperature in PBS containing 15% FCS. Samples were incubated with anti-γ H2AX and anti-Rad9 antibodies for 16 hours, washed in PBS for 3 × 5 minutes, and incubated with anti-mouse Alexa Fluor488 secondary antibody and anti-rabbit Cy3 secondary antibody (Molecular Probes) at room temperature. 1. Incubated for 5 hours. The cells were washed 3 × 5 minutes in PBS and stained with 4,6-diamidino-2-phenoldiindole (DAPI) (Vector Laboratories). The sample was fixed using DAK0 Fluorescent Mounting Medium (MK0). Fluorescence images were taken using an Olympus BX60 microscope equipped with an Olympus DP70 digital camera and DPmanager software. For quantitative analysis, the focus was visually counted during image processing at a magnification of 100x objective. In a single experiment, cells were counted up to at least 100 cells. For apoptotic assembly, 293 cells were exposed to 20 J / m ² of UV. After fixation with 4% formaldehyde and staining with DAPI, mitotic cells were visualized and counted using a fluorescence microscope. Cells with distinct aggregated chromatin and / or fragmented nuclei were determined to be apoptotic cells.

Antibodies and plasmids

 Mouse anti-Rad9 antibody (Al exis), anti-Chkl antibody, anti-phosphorylated Chkl antibody (Ser-317) and anti-p53 antibody (BD Biosciences), anti-phosphate H2AX antibody (Upstate Biotechnology), and anti-phosphorylated p53 (Ser-15) antibody (Cell Signaling Technology) was used.

 We have identified the wild-type Rad9 plasmid and the following unlabeled Rad9 mutants as previously described: 1) Rad9-S272A (previously identified DNA damage-induced phosphorylation site) 2) Rad9-9A (Ser-272, converted to Ser-272 Ala)

All phosphorylation sites including Ser—277, Ser—328, Ser-336, Ser—341, Ser—355, Ser—375, Ser-380 and Ser—387 have been converted to Ala residues), and 3) Rad-8A

(Retained Ser-272 but all remaining phosphorylation sites were all converted to Ala residues) (P. Roos-Mattjus et al., (2003) J. Biol. Chem. 278, 24428). -24437) ₀

The hRad9 expression vector labeled with FLAG was prepared by the following method. Labeled with FLAG To prepare hRad9 expression vectors, wild-type or phosphorylation-deficient Rad9 plasmids were amplified by PCR using the Advantage Clentaq system (Clontech). At that time, 5 '—AAA AGC GGC CGC GCA TGA AGT GCC TGG TCA CGG G— 3' (酉 S column No. 33) The oligonucleotide No. 34) was used as a primer. The amplified PCR product was electrophoresed on a 1% agarose gel, the gel was cut out and purified with a gel purification kit (Qiagen). The purified sample was cleaved with restriction enzymes Notl and Xbal, and then bound to the cloning site of pcDNA3.1-FLAG vector to prepare an hRad9 expression vector labeled with FLAG.

 The WWP-Luc-P21 promoter vector (specialized by Dr. V. Vogelstein; W. S. E1-Deiry et al., (1993) Cell 75: 817-825) was used for the luciferase assembly. Husl and Radl expression plasmids (S. L. Xiang et al. (2001) Biochem. Biophys. Res. Commun. 287, 932-940) were used for the luciferase assembly. The pcDNA-p53 expression plasmid was a kind gift from Dr. J. Yokota (Y. B. Park et al., (2002) Cancer Genet. Cytogenet. 133, 105-111).

 Expression vector construction method of Rad9 protein fragment derived from the binding region of Rad9 and p53

 Wild type Rad9 plasmid was amplified by PCR using Advantage Clentaq system (Clontech). The following oligonucleotides (1) and (A) and (B) and (2), (C) and (D), (C) and (E), and (1) and (E) were used as primers. Using.

 (1) 5 '-AAAAGCGGCCGCGCATGAAGTGCCTGGTCACGGG-3, (SEQ ID NO: 35)

 (2) 5 '-TTTTCTAGATCAGCCTTCACCCTCACTGTC-3, (SEQ ID NO: 36)

 (A) 5 '-TCCTCTCTAGAGCACATCTCAGTCACCTAGGC-3, (SEQ ID NO: 37)

 (B) 5 '-CAGCACGCGGCCGCCCATGGTGACTGAGATGTGAC-3' (SEQ ID NO: 38)

 (C) 5 '-AGGACCTGCGGCCGCGTAAGATCCTGATGAAGTC-3, (SEQ ID NO: 39)

 (D) 5,-TCCATTCTAGACATCTAAGAGTCAATGTCGTCATTGG-3 '(SEQ ID NO: 46)

 (E) 5 '-GAGTCTCTAGATGACTATGTGGCCAAGACAAAGTGG-3' (SEQ ID NO: 40)

The amplified PCR product was electrophoresed on a 1% agarose gel, the gel was cut out and purified with a gel purification kit (Qiagen). The purified sample was cleaved with restriction enzymes Notl and Xbal, and then bound to the cloning site of the pcDNA3.1-FLAG vector to prepare a Rad9 protein fragment expression vector. The amplified PCR product (DNA encoding Rad9 protein deletion mutant) is encoded by the following DNA sequence.

PCR product from primers (1) and (A) (SEQ ID NO: 41; Mutant (mtl) Rad9):

 C

PCR product from primers (B) and (2) (SEQ ID NO: 42; Mutant (mt2) Rad9):

 CGGAAGACAGTGAGGGTGAAGGCTGA.

PCR product from primers (C) and (D) (SEQ ID NO: 43; Mutant (mt3) Rad9): CTCACAGCACACCCCACCCGGACGACTTTGCCAATGACGACATTGACTCTTA

PCR product from primers (C) and (E) (SEQ ID NO: 44; Mutant (mt4) Rad9):

PCR product from primers (1) and (E) (SEQ ID NO: 45; Mutant (mt5) Rad9):

 A

 Transfection

 293 cells for plasmid tolerance, manufacturer's instructions

Transfected with LipofectAMINE2000 according to (Invitrogen). Double-stranded siRNA against human Rad9 and human p53 was purchased from Santa Cruz Biotechnology for siRNA introduction. 293 cells were transfected with siRNA constructs using TransIT-TK0 transfection reagent (Mirus) twice at 24 hour intervals. Cell samples were collected after the second introduction as indicated.

RT-PCR

 293 cells were treated with UV. RNA was extracted using IS0GEN protocol (Nippon Gene). Rinse cells in 1 ml IS0GEN, incubate for 5 minutes at room temperature,

0.2 ml of black mouth form was added. The suspension was stirred for 15 seconds, stored for 2 minutes, and separated into two phases by centrifugation. The upper aqueous phase was then mixed with 0.5 ml isopropyl alcohol and incubated at room temperature for 10 minutes. 70% of pelleted RNA by centrifugation

(v / v) Washed once with ethanol. The RNA was resuspended in water treated with jetyl pyrocarbonate and the concentration was measured at 320 nm. For RT, 5 μg RNA / 1 / L oligo dT,

Combined with 10 μm each of Ι μΙ dNTPs and 6 // L of jetyl pyrocarbonate treated water. Incubate this mixture at 65 ° C for 5 min, 2 IL 10 X reverse transcriptase first strand buffer, 4 μί 25 mM MgCl ₂ , 2 μL 0.1 M dithiothreitol, Net treated water, 1 / L RNase and 0.2 μί Superscript II

It was with RT. The RT mixture was incubated at 48 ° C for 50 minutes and then at 70 ° C for 15 minutes. The obtained cDNA was amplified by PCR. Oligonucleotide was used to amplify the P21 is 3 ³ amplified product of 5bp 5, - ACCCTCTCATGCTCCAGGT- 3 '(upper stream; SEQ ID NO: 5)及Pi 5, -CCTTGTTCCGCTGCTAATCA-3'(downstream; SEQ ID NO: 6 (E. Zapata et al., (2005) FEBS J. 272, 1343-1353). In order to amplify G3PDH, oligonucleotide 5, -ACCACAGTCCATGCCATCAC-3 '(upstream; SEQ ID NO: 7) and

5′-TCCACCACCCTGTTGGCTGTA-3 ′ (downstream; SEQ ID NO: 8) was used for the 451 bp amplification product (A. Tanaka et al. (2001) J. Autoimmun. 17, 89-98). The PCR conditions for P21 are:

⁹ 4 ° C 1 min initial denaturation, thereafter, ⁹ 4 ° C8 seconds, including the 53 ° C30 Byo及Pi 72 ° C 1 min. After 37 cycles, PCR products were usually detectable by electrophoresis. About G3PDH

PCR conditions included initial denaturation at 94 ° C for 1 minute followed by 94 ° C for 10 seconds, 60 ° C for 15 seconds and 72 ° C for 1 minute. After 28 cycles, PCR products were usually detectable by electrophoresis. The intensity of the band corresponding to each DNA was determined by densitometry analysis (Quantity 0ne, BIO-RAD). Quantified.

Protein research

For western blotting, 293 cells were extracted using lysis buffer (20 mM Tris-HC1, l% Triton X100, 10% glycerol and 0 ImM PMSF). The clear extract is boiled in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), separated by SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and im standardized. Noblotting was performed and the signal was detected with an enhanced chemiluminescence system (ECL, Amarsham Biosciences). The intensity of the band corresponding to each protein was quantified by densitometry analysis (Quantity One, BIO-RAD). For immunoprecipitation, 293 cells were collected using IP-lysis buffer ( ²⁵ mM Tris-HC1, 0.2% NP40, 250 mM NaCl and ImM EDTA) and pre-cleared using protein G-Sepharose beads. A 500 // g sample of cell lysate after incubation was incubated with 3 g of specific antibody. The antigen-antibody complex was immobilized on protein G-Sepharose beads and the beads were washed 5 times in lysis buffer. Bound proteins were eluted by boiling and subjected to SDS-PAGE and immunoprotting.

Promoter research

 Transfected cells were cultured in complete growth medium for 24 hours for the noluciferase promoter assay, harvested for luciferase assembly, and performed according to available protocols (Proniega). Luciferase activity is

Measured on a Fluoroskan Ascent FL (Termo Labsystems Oy) luminometer. Complementary oligos containing p53 / Rad9 binding sites were commercially synthesized for electrophoretic migration shift assembly (EMSA) (Invitrogen). End these probes with [γ- ^ P] ATP

Labeled with T4 polynucleotide kinase. 293 cell nucleoprotein extract (10 g), 2 x 10 ⁵ cpm probe, 30raM Tris-HCl (pH7.4), 0.6 mM EDTA 30 mM KCl

10 mM DTT, 12% glyceride and 0.1 μg of nonspecific competitor poly (dl-dC) (Amarsham

Incubation was carried out in a binding buffer containing (Biosciences). The binding reaction mixture was collected on ice and incubated for 30 minutes at room temperature. The DNA-protein complex was separated on a 5% non-denaturing polyacrylamide gel and the gel was dried in vacuo and used for autography. For super-shift experiments, the antibody was added at 4 ° C, 20 Preincubated with nuclear extract for minutes. For competitive binding reactions, 200 ng of cold probe was added during incubation. For chromatin immunoprecipitation (ChIP) assay, approximately 1 X 10 ^S cells are resuspended in PBS, fixed with 1% formaldehyde for 10 min at 37 ° C, and 200 μl SDS-lysis buffer [50 mM Tris -Resuspended in HC1 (pH 8.1), 10 mM EDTA, and 1% SDS] and sonicated 3 times with a 10 second pulse on ice to break chromatin to 200-: L, 000 bp average length did. Centrifuge the sonicated cell suspension in 13, OOOrpra for 10 minutes, add 20 μL of each supernatant to 4 ° C for 4 hours after addition of 1 μL of 5 mol / L NaCl, and use this as input did. The remainder of the supernatant was diluted with 300 / L of chromatin immunoprecipitation dilution buffer (l67mM NaCl, 16.7mM Tris-containing either 1 / ig Rad9 (Upstate Biotechnology) or 几 p53 (BD Transion ion Laboratories). HC1 (pH 8.1), 1.2 mM EDTA, 0.01% SDS, and 1. l% Triton X-100]. After incubation at 4 ° C for 16 hours, the mixture was shaken with 15 L protein A agarose beads for 1 hour in the presence of g / ml salmon sperm DNA. Immunoprecipitates were washed with four different buffer, and eluted with 0. 1M NaHCO ₃ and 1% SDS. The eluate was heat treated, digested with proteinase K, extracted with phenol / chloroform, ethanol precipitated, and finally resuspended in 20 L TE (pH 8). For PCR, 2 x L of the final suspension was used, and primers corresponding to various regions of the ^human P21 ^wail promoter were used. The downstream P2 raf ¹ promoter primers are 5'-GAGGTCAGCTGCGTTAGAGG-3, (SEQ ID NO: 9) and 5, -TGCAGAGGATGGATTGTTCA-3 '(SEQ ID NO: 10) (G. Koutsodontis and D. Kardassis, (2004) Oncogene 23, 9190-9200), and the upstream P21 ^{wafl promoter primer} is 5, -CCTATGCTGCCTGCTTCCCAGGAA-3 '(sequence number 11) and 5'-TAGCCACCAGCCTCTTCTATGCCAG-3, (sequence number 12) (G. Koutsodontis and D. Kardassis, (2004)).

Example 1> P21 is activated immediately after UV treatment

Of several previous studies in mammalian cells leading to increased expression of p53 downstream genes such as P21, genotoxic stress is child induces stabilization and temporarily accumulated in the wild-type p5 ³ protein Toga示(AJ Levine, (1997) Cell 88, 323-331; WS

El-Dery et al. (1993) Cell 75, 817-825). Using RT-PCR, first of all, P21 mRNA The expression level was examined. After treatment with UV, 293 cells were collected at various times after UV irradiation. Total RNA was extracted and cDNA was synthesized using a reverse transcription reaction. The obtained cDNA was amplified by PCR, and the intensity of the band corresponding to each DNA was quantified by densitometry analysis. Results as shown in Figure 1A were obtained. It was observed that the level of P21 mRNA expression increased substantially 30 minutes after UV irradiation and reached a maximum level at 1 hour. Although mRNA levels were low, they were still detectable until 72 hours after UV exposure. Western blotting was performed using the same protein at each time point, and the time course of p21 protein was examined. As shown in FIG. 1B, the substantial accumulation of _P 21 is, 3 hours of exposure to UV, was observed after 12 hours and 24 hours. From these results, P21 transcription and p21 protein accumulation occurred, and the G1 / S checkpoint was activated after UV irradiation to protect the cells from UV-induced DNA damage. Based on these results, the following experiments were performed between 10 minutes and 6 hours after UV irradiation.

Example 2> Competition between hRad9 and p53 for P21 activation

 Using the P21 promoter luciferase reporter system, functional aspects of p21 regulation by human Rad9 (hereinafter referred to as hRad9) were evaluated. In addition to the wild-type Rad9 plasmid, Rad9 phosphorylation mutants were used, and hRad9 phosphorylation was required for S phase or G2 / M checkpoint activation (P. Roots-Mattjus et al., ( 2003) J. Biol. Chem. 278, 24428-2437), to investigate whether this phosphorylation is required for P21 activation. Western blotting was performed to confirm the expression of wild-type or phosphorylation-deficient Rad9.

Wild-type Rad9 is well detectable with the low-migratory protein fraction (Figure 2A, lane 2), indicating the phosphorylated form of Rad9. Rad9-S272A was also well expressed with a similar low-migratory protein fraction, so this protein probably corresponds to the different phosphorylation state of Rad9 and lacks phosphorylation at the S272 residue. Wax (Figure 2A, lane 3). The results of Rad9-8A and Rad9-9A transfection showed lower phosphorylation compared to wild-type Rad9 (Fig. 2A, lanes 2, 4 and 5). It indicates that the body is overexpressed. Subsequently, the P21 promoter region (WWP-Lu-P21 promoter) fused to luciferase was co-transfected into the 293 cells using a plasmid. When an insert-free expression vector binds to promoter-free pGL3-basic, the background level is low (Figure 2B, column 1). The P21 promoter contains at least two p53-binding consensus sequences in the approximately 2kb upstream region 5 'from the transcription start site (WS EL-Deiry et al., (1995) Cancer Res. 55, 2910-2919) P53 overexpression induced luciferase activity as expected (Figure 2B, column 9). Wild-type Rad9 overexpression also induced luciferase activity, although not as strongly as p53 (Figure 2B, column 5). Co-expression of p53 and wild-type Rad9 induced a high level of luciferase activity (Figure 2B, column 10), which was intermediate to the level observed when each protein was overproduced. Met. Activity transfer characteristics from Rad9 to P21 promoter have been reported (Y. Yin et al., (2004) Proc. Natl. Acad. Sci. USA 15, 8864-8869). It was shown that it does not seem to exert a sufficient transcriptional activity.

 The luciferase activity measured using each phosphorylation-deficient plasmid was comparable to that using wild-type Rad9 (FIG. 2B, columns 5-8). In contrast, when co-expressed with p53, the activity with phosphorylation-deficient Rad9 mutants was lower than when co-expressed with wild-type Rad9 (Figure 2B, columns 10-13). . This showed that hRad9 is involved in p53-dependent P21 activation.

 Furthermore, in contrast to hRad9, hHusl and hRadl show a strong activity like p53, which indicates the role of Husl and Radl in checkpoint activation (MA Burtelow et al., (2001) J. Biol. Chem. 276 , 25903-25909; V. Ρ Bermudez et al., 2003 Proc. Natl. Acad. Sci. USA 18, 1633-1638) and their role in indirect or direct activation of P21 transcription Suggests the possibility of fulfilling.

Example 3> Endogenous hRad9 knockdown increases P21 transcription

To define the role of hRad9 in transcribing P21 in response to ultraviolet (UV) exposure, siRNA 'was used to knock down endogenous hRad9. After confirmation of knockdown of each endogenous p53 or Rad9 protein by Western plot (Figure 3A), the cells were treated with siRNA. And exposed to 20 J / m ² UV to extract total RNA. RT-PCR was used to measure the level of P21 mRNA. As shown in FIG. 3B, transfection of Rad9 s iRNA (Santa Cruz; product No. sc-36364) increased the level of P21 mRNA (column 3), while p53 s iRNA (Santa Cruz; Transfection using product No. cs-29435) showed P21 mRNA levels similar to those of the motta treatment (column 2). After UV treatment, Motta-treated cells showed an increase in P21 mRNA compared to the UV (-) control (column 4), and transfection with p53 siRNA resulted in a clear decrease in P21 mRNA. (Column 5). In contrast to p53 s iRNA knockdown, Rad9 s iRNA knockdown caused an increase in P21 mRNA after UV exposure (column 6). This level is similar to that in the UV (-) experiment, suggesting that Rad9 may be involved in providing a basic platform for UV-induced P21 responses.

 The above results indicate that hRad9 knockdown results in P21 transactivation, and that hRad9 modulates p21 p53-dependent transactivation in response to DNA damage induced by UV irradiation. In addition to the functional linkage with p53-dependent p21 activation through the p53-binding consensus of the P21 promoter, as demonstrated by hRad9-force luciferase assembly. It was suggested to be involved. <Example 4> Binding of p53 and Rad9

 The data obtained from the above experiments showed that hRad9 suppresses the activation of the p53-dependent P21 promoter, and that hRad9 knockdown stimulates the activation of the p53-dependent P21 promoter. Therefore, we investigated how endogenous hRad9 is related to endogenous p53.

Immunoprecipitation was performed to confirm whether hRad9 interacts with p53. Briefly, 293 cells were collected and cell lysates were incubated with anti-Rad9 or anti-p53 antibodies. The antigen-antibody complex was immobilized on protein G sepharose beads, and the bound protein was eluted by boiling and subjected to SDS-PAGE and Western blotting. As shown in FIG. 4A, hRad9 was immunoprecipitated with p53. In order to examine whether phosphorylation of Rad9 affects the binding to p53, 293 cells were transfected with wild-type or phosphorylation-deficient Rad9 plasmid, and immunoprecipitation was performed. As a result, it was found that Rad9 binds to p53, and this bond is not related to the wild type or phosphorylation-deficient mutants (Rad9-S272A, Rad9-8A and Rad9-9A). (Figure 4B). In order to confirm whether the binding between hRad9 and p53 changes temporarily after UV irradiation, the change with time was examined.

 As shown in Figure 4C, phosphorylation of p53 at Ser-15 increased after UV irradiation, but there was little change in interaction with hRad9. In addition, other phosphorylation sites of p53 (Ser-6, Ser-9, Ser-20, Ser-37, Ser-46, Ser-392) were also investigated. Was irrelevant.

 From the above results, the binding of hRad9 and p53 does not affect the phosphorylation of each of hRad9 and p53, but the possibility that amino acid residues on the binding surface of these proteins are involved in phosphorylation events is denied. It was shown that it is not possible.

<Example 5> Phosphorylation of hRad9 affects the DNA binding affinity of p53

 Changes in the affinity of hRad9 / p53 to the p53 consensus binding site of the P21 promoter after UV treatment were examined. As previously reported, hRad9 specifically binds to the p53 consensus DNA binding sequence in the P21 promoter and regulates transcriptional levels of P21 (Y. Yin et al. (2004) Proc. Natl. Acad. Sc. i. USA 15, 8864-8869). In this experiment, EMSA was performed to confirm p53 consensus specific binding of hRad9. In addition, EMSA was performed to evaluate changes in promoter binding after UV treatment.

 For this purpose, an oligo probe containing a p53 binding sequence as previously reported was used (Y. Yin et al., (2004)). The ends of these probes were labeled with [γ-32P] ATP. Nuclear proteins extracted from 293 cells were incubated with oligo probes in a binding buffer. The DNA-protein complex was separated on a polyacrylamide gel and the gel was exposed to film. For supershift experiments, antibodies were preincubated with nuclear extracts. Also, a cold probe was added during the incubation for competitive binding reactions.

As shown in Fig. 5 (b), the results show that the band shift was caused by incubation of the 30 bp oligo containing the downstream ρ53 consensus DNA binding sequence with the nuclear extract from 293 cells (lane 2). This band clearly increased after UV irradiation (lane 6). This band is supplemented with excess cold 30bp oligo as a competitor. This indicates that there is a specific protein-probe interaction (lane 3). The band of P21 promoter disappeared by the addition of anti-Rad9 antibody, indicating that hRad9 binds to the p53 consensus binding site of P21 promoter (lanes 5 and 8). In contrast to the addition of anti-Rad9 antibody, the addition of anti-p53 antibody showed little disappearance or supershift of the above-mentioned panda in this experiment (lanes 4 and 7). These results are due to the specificity of the anti-ρδ3 antibody in this experiment, and are presumed to be in contrast to the supershift observed in previous studies (Y. Yin et al., (2004)). .

 The above results demonstrated that hRad9 binds to the p53 consensus binding site of the P21 promoter and that this binding increases with UV irradiation.

To assess whether the affinity of the hRad ⁹ / p53 complex for the P53 binding site increases after UV irradiation, and whether the phosphorylation of hRad9 affects the affinity for the binding site, ChIP assembly Went. 293 cells were transformed with wild type or phosphorylation deficient Rad9 plasmid and treated with UV radiation or untreated. After treatment, the cells were cross-linked with 1% formaldehyde and sonicated to break up the chromatin to an average length of 200-1 and OOObp. The sonicated cell suspension was added to a chromatin immunoprecipitation dilution buffer containing anti-Rad9 antibody or anti-p53 antibody. After 16 hours incubation, the mixture was shaken with protein A agarose. The immunoprecipitate was eluted and DNA was extracted from the eluate. The above DNA was amplified by PCR using primers corresponding to various regions of the ^human P2 ^afl promoter.

 As shown in Fig. 5B and Fig. 5C, the above results indicate that hRad9 and p53 bind to the downstream site in an increasing manner after UV treatment, except that Rad9-9A plasmid with low affinity for the binding site can be transformed. The above binding was observed in all cases except the harvested cells. The binding of Rad9 appeared to be much less than that of p53, which is recognized as a result of the properties of the Rad9 antibody. Similar results were obtained with hRad9 (Fig. 5D) and p53 (Fig. 5E) at the upstream site. These results indicate that phosphorylation of hRad9 plays a role in regulating p53 affinity for the consensus site.

Example 6>-phosphorylation of hRad9 is required for focus formation after DNA damage Previous studies have shown that the 9-1-1 complex forms the DNA damage focus when DNA damage occurs (VP Bermudez et al. (2003) Proc. Natl. Acad. Sci. USA 18, 1633-1638; Μ A. Burtelow et al. (2000) J. Biol. Chem. 275, 26343-26348; I. Hirai and HG Wang, (2002) Biol. Chem. 277, 25722-25727). Immunohistochemistry was performed to examine whether phosphorylation of Rad9 affects the focus formation at the site of DNA damage. 293 cells grown on force bars were fixed in 4% paraformaldehyde. Samples were blocked in FCS, incubated with anti-γ2 antibody or anti-Rad9 antibody, and incubated with anti-mouse Alexa488 secondary antibody and anti-rabbit Cy3 secondary antibody. The cells were then stained with DAPI (Figure 6A). As shown in Figure 6B, the results show that 1 hour after UV exposure, 80% of 293 cells were either motted or transfected with wild-type Rad9 or Rad9-S272A plasmids, respectively. It was shown that the focus was formed at the rate of 86% and 80%. On the other hand, cells transfected with Rad9-8A and Rad9-9A plasmids formed focus at 34% and 32%, respectively. These results indicate that phosphorylation of Rad9 is necessary for focus formation after DNA damage by UV treatment. These data suggested that P21 transcriptional regulation is similar to hRad9 focus formation in experiments using hRad9 phosphorylation-deficient mutants. Although P21 is involved in the G1 / S checkpoint, previous reports indicate that phosphorylation of hRad9 is essential for ChU activation at the HU, IR and S2 G2 checkpoints after treatment. Roos-Mattjus et al., (2003) J. Biol. Chem. 278, 24428-24437), and Chkl, Ser / Thr—Gin-rich two residues (Ser-317 And Ser-345) (JT. Bartek et al., (2004) Nat. Rev. Mol. Cell Biol. 5, 792-804). In this experiment, in order to evaluate the time course of apoptosis induction after UV irradiation, the time course of Chkl phosphorylation with Ser-317 was examined by Western blotting. Induction of apoptosis was evaluated using 293 cells after exposure of the cells to UV and fixation with 4% formaldehyde and fluorescence staining with DAPI. Cells containing clearly aggregated chromatin and / or fragmented nuclei were determined to be apoptotic cells. As shown in Figure 6C, the results indicated that the increase in phosphorylation of Chkl with Ser-317 was evident more than 12 hours after UV irradiation. Subsequent treatment of cells with UV induced apoptosis, and approximately 21% of the cells died from apoptosis 36 hours after UV irradiation, compared to 2% for unirradiated cells. From these results, increases in p53 phosphate, P21 mRNA and p21 protein were observed 1 to 3 hours after DNA damage, and apoptosis was clearly increased 36 hours after UV irradiation. Was immediately after phosphorylation. From this, damaged cells released from the G1 / S checkpoint are viable by the checkpoint from S to G2, and induce induction of apoptosis, Rad9 is only at G1 / S, but at S or G2, This suggests that there is a possibility of exerting a wide range of checkpoint functions.

Preparation of <Example I> Rad9 and expression base Kuta one Rad9 protein fragments derived from binding region of the _P 53

 Rad9 protein fragment mutants (mtl, mt2, mt3, mt4 and mt5) Rad9 (SEQ ID NOs: 41 to 45, respectively) Expression plasmid (including reporter gene FLAG), and expression of the mutant (mtl to mt5) Rad9 was introduced into MRC5 cells (ATCC CCL-171) and Western plot. (Figure 7B) was confirmed by using anti-FLAG antibody (SIGMA).

 <Example 8> Effect of mutant Rad9 on Rad9-p53 binding and p21 expression

 Wild-type (WT) and mutant (mt2) Rad9 plasmids were introduced into cultured MRC5 cells (cultured in DMEM containing 10% FBS) and immunoprecipitation (anti-FLAG antibody (SIGMA) and anti-p53 antibody (BD Biosciences) ) Was used to examine the binding of p53 and Rad9. After introduction of the mutant (mt2) Rad9, the binding of p53 and endogenous Rad9 (arrow) decreased compared to the control (mock) (Fig. 8A).

 Wild type (revised) and mutant (mtl ~ 5) Rad9 plasmids were introduced into cultured MRC5 cells, and expression of the p21 gene was examined by Western plot. As a result, mutant type (mt2)

When Rad9 plasmid was introduced, p21 expression was increased (FIG. 8B).

From the above results, p53 and endogenous Rad9 were introduced by introducing the mutant (mt2) Rad9 plasmid. As the binding of (arrow) decreased, the expression of p21 increased, indicating that tumorigenicity decreased (secondary carcinogenesis decreased).

Example 9> Apoptosis changes upon introduction of Rad9 plasmid into mutant cancer cells Head and neck squamous cell carcinoma cell line MMSI-1 (cultured in DMEM containing 10% FBS) in wild type (WT), mutant type (M1: 2) Each of the Rad9 plasmids was introduced, the expression of the plasmid was confirmed by immunofluorescence staining, and apoptosis was examined by staining with DAPI. As a result, in the case of introducing controls particular mutant in comparison to the _(moc k) _(m t2) Rad9 plasmid, apoptosis was significantly宂進(1. 6% 4.3%) (Figure 9A).

 On the other hand, an experiment similar to the above was performed using a cervical cancer cell line HeLa cells (cultured in DMEM containing 10% FBS). As a result, as with MMSI-1, when the mutant (mt2) Rad9 blastoid was introduced, apoptosis was significantly enhanced (4.0% and 11.6%) (Fig. 9B). From the above results, it was shown that when the mutant (mt2) Rad9 plasmid was introduced into cancer cells, apoptosis was enhanced and it acted as a suppressant on cancer cell growth.

Example 10> Apoptosis changes upon introduction of Rad9 siRNA into cancer cells

 Rad9 siRNA (SEQ ID NO: 18) was introduced into the head and neck squamous cell carcinoma cell line MMSI-1 and cervical cancer cell line HeLa cells using Lipofectamine 2000 (Invitrogen), and apoptosis was examined by staining with DAPI. As a result, apoptosis was significantly enhanced when Rad9 siRNA was introduced compared to the control (Mota) (2.8% and 7.8% in wake SI-1 and 3.0% and 12.0% in HeLa). (Fig. 10)).

 From the above results, it was shown that when Rad9 siRNA was introduced into cancer cells, apoptosis was enhanced and the cancer cells proliferated.

<Example 11> Changes in P53-Raci9 binding by anticancer agents

 Etoposide (VP16), camptothecin (CPT), cisplatin (CDDP), and doxorubicin (D0X) were administered to cultured MRC5 cells, and collected after 4 hours. Of endogenous protein binding). As a result, etoposide, camptothecin, and cisbratin both showed increased binding, whereas doxorubicin decreased both binding (Fig. 11).

Therefore, it is considered that doxorubicin reduces the binding between the two, and a drug effect due to the binding change can be expected. Example 12> Changes in p53-Rad9 binding by anti-Rad9 antibody

^[35 S] -labeled p53 protein ^([35 S] _P 53) and Rad9 protein bound with GST tag (GST-Rad9) were reacted in vitro with NETN buffer. As a result, ^[35 S] When expressed the GST protein alone unbound p53 and Rad9 is not an observed binding of two (lane 1), and GST ^[35 S] p53 - Reaction of Rad9 binding of both was confirmed (lane 2) (Fig. 1 ^2). On the other hand, it is reacted with ^[3] ρδ3 after reacting the GST-Rad ⁹ with anti-Rad ⁹ antibody, the binding of GST-Rad9 with ^[35 S] p53 were reduced (lane 3).

 Therefore, Rad9-p53 binding is decreased by administration of anti-Rad9 antibody, and it is considered that the binding of both can be controlled by neutralizing antibody. Industrial applicability

According to the present invention, the biological function of p53 is controlled through the control of the binding between Rad9 and p53, which makes it possible to suppress cancer growth and metastasis, for example. It also enables screening of bioactive agents as cancer therapeutic agents that control such binding. The present invention, through control of the coupling between Rad9 and p53, to control the biological function of _P 53, this Yotsute allows for example cancer proliferation and metastasis inhibition. In addition, it becomes possible to screen for bioactive agents as cancer therapeutic agents that control such binding. Drugs that can control the activity of p53, which is associated with more than 60% of cancer types, are useful for cancer treatment.

All publications and patent applications cited in this specification are incorporated herein by reference in their entirety.

Claims

The scope of the claims

1. In a test system, including adding a drug candidate in the presence of the oncogene product Rad9 and the tumor suppressor gene product p53, and selecting a bioactive agent that can control the binding between Rda9 and p53. A method for screening cancer drugs.

 2. The method according to claim 1, wherein the drug candidate is selected from the group consisting of a small molecule, a nucleic acid, a peptide, a protein, a saccharide, and a lipid.

 3. The method of claim 1, wherein the system comprises cells from eukaryotic and prokaryotic organisms.

4. The method according to any one of claims 1 to 3, wherein the control is either suppression or enhancement.

 5. The method according to claim 1 or 2, wherein the drug candidate is an antibody that neutralizes a binding region between Rad9 and p53.

 6. The method according to claim 1 or 2, wherein the drug candidate is a Rad9 protein fragment having 5 or more amino acid residues derived from a binding region of Rad9 and p53 or a variant thereof.

 7. The method according to claim 1 or 2, wherein the drug candidate is an antisense nucleic acid that suppresses transcription and expression of the Rad9 gene, an RNAi nucleic acid, or a vector DNA containing the nucleic acid.

 8. Control of biological function of Rad9 protein or expression of Rad9 gene, thereby enhancing or suppressing binding of Rad9 and p53 to suppress or enhance the activity of p53, and Rad9 gene, its A pharmaceutical composition for treating cancer, comprising a bioactive agent that interacts with a transcription product or translation product.

 9. The pharmaceutical composition according to claim 8, wherein the drug is an antibody or antibody fragment against Rad9.

 10. The pharmaceutical composition according to claim 8, wherein the drug is an antisense nucleic acid that suppresses transcription and expression of the Rad9 gene or a vector DNA containing the nucleic acid.

1 1. The pharmaceutical composition according to claim 8, wherein the drug is an RNAi nucleic acid that suppresses transcription and expression of the Rad ⁹ gene or a vector DNA containing the nucleic acid.

1 2. The drug is a residue of 5 or more amino acids derived from the binding region of Rad9 and p53. 9. The pharmaceutical composition according to claim 8, which is a Rad9 protein fragment having a group or a variant thereof.

13. The pharmaceutical composition according to any one of claims 8 to 12, wherein the drug is encapsulated in a ribosome.