WO2007088537A2 - Methods and kits for early detection of cancer or predisposition thereto - Google Patents
Methods and kits for early detection of cancer or predisposition thereto Download PDFInfo
- Publication number
- WO2007088537A2 WO2007088537A2 PCT/IL2007/000122 IL2007000122W WO2007088537A2 WO 2007088537 A2 WO2007088537 A2 WO 2007088537A2 IL 2007000122 W IL2007000122 W IL 2007000122W WO 2007088537 A2 WO2007088537 A2 WO 2007088537A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- determining
- circulating
- nucleic acid
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
- G01N33/57585—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds identifiable in body fluids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- the present invention relates to methods and kits for non-invasive, early detection of cancer and predisposition thereto using CD24, and more particularly, to methods and kits for diagnosing cancer or pre-malignant lesions by determining the expression level of soluble, shedded and/or blebbed CD24 in a biological sample.
- Colorectal cancer is a major health concern in the Western world as it is the third most common cancer in both men and women in the United States and Israel. This form of cancer develops through a stepwise process that involves a variety of genetic and epigenetic changes that are acquired over several years and eventually culminate in the transformation of normal epithelium into neoplasm.
- the disease has a long latency period, the currently available markers for disease detection are limited to invasive tests such as colon or gastric endoscopy, which often detect the disease while it has already been spread.
- GI tract gastrointestinal tract
- CRC colorectal cancer
- FOBT fecal occult blood testing
- proteins e.g., fecal calprotectin, lactoferrin, lysozyme, albumin, alpha- 1 -antitrypsin, carcinoembryonic antigen (CEA), decay-accelerating factor (DAF), minichrosomal maintenance protein (MCM2)] or mRNA (e.g., fecal COX-2) (Kanaoka S., et al, 2004) which can be detected in stool samples, and proteins such as nicotinamide N-methyltransferase (NNMT) (Roessler M, et al., 2005) or proteasome activator complex subunit 3 (PSME3) (Roessler M., et al., 2006), which can be detected in serum samples.
- NMT nicotinamide N-methyltransferase
- PSME3 proteasome activator complex subunit 3
- CD24 also known as heat-stable antigen (HSA) in mice, is a heavily glycosilated phosphatidylinositol-anchored mucin-like cell-surface protein. Physiologically, the CD24 protein is expressed mainly on hematopoietic subpopulations of B lymphocytes, various epithelial cells, muscle and neural cells. It plays a crucial role in cell selection and maturation during hematopoiesis and is expressed during the embryonic period, on developing neural and pancreatic cells. In addition, CD24 is a potential ligand for P-selectin which functions as an adhesion molecule that enhances platelets aggregation.
- HSA heat-stable antigen
- CD24 The cellular function of CD24 is still unknown, but recent reports have strengthened its involvement in the initiation of intracellular signal transduction.
- Schabath et al. (Schabath H, et al., 2006) have associated the expression of CD24 with downregulation in the CXCR-4 chemokine receptor.
- CD24 is overexpressed in various malignant tissues including B-cell lymphomas, gliomas, small-cell and non-small cell lung, hepatocellular, renal cell, nasopharyngeal, bladder, uterine, epithelial ovarian, breast, prostate and pancreatic carcinomas (reviewed by Kristiansen et al., 2004).
- a method of diagnosing cancer or a pre-malignant lesion comprising determining a presence and/or a level of a circulating CD24 of a subject in need thereof, wherein the presence and/or the level of the circulating CD24 above a predetermined threshold is indicative of the cancer or the pre-malignant lesion.
- a kit for diagnosing cancer or a pre-malignant lesion comprising a packaging material and at least one reagent for determining presence and/or level of circulating CD24 of a subject.
- a method of monitoring efficacy of cancer therapy comprising determining a level of a circulating CD24 in a biological sample of the subject following the cancer therapy, wherein a decrease from a predetermined threshold in the level of the circulating CD24 following the cancer therapy is indicative of reduction of cancerous cells, thereby monitoring efficacy of the cancer therapy.
- a method of determining if a subject is predisposed to gastrointestinal cancer the method comprising determining a presence or absence, in a homozygous or heterozygous form, of at least one cancer - associated genotype in the CD24 nucleic acid sequence of the subject, thereby determining if the subject is predisposed to the gastrointestinal cancer.
- kits for determining if a subject is predisposed to gastrointestinal cancer comprising a packaging material and at least one reagent for determining a presence or absence, in a homozygous or heterozygous form, of at least one cancer - associated genotype in the CD24 nucleic acid sequence of the subject.
- kits for monitoring efficacy of cancer therapy comprising packaging material and at least one reagent for determining a presence and/or a level of circulating CD24 of a subject.
- said pre-malignant region is an adenoma.
- determining is effected in vivo.
- the CD24 comprises shedded CD24. According to still further features in the described preferred embodiments the
- CD24 comprises blebbed CD24.
- the CD24 comprises soluble CD24.
- the pre-malignant lesion is associated with a solid tumor.
- the cancer is a solid tumor.
- the cancer is a gastrointestinal tract cancer.
- the pre-malignant lesion is associated with a gastrointestinal tract cancer.
- the gastrointestinal tract cancer is colorectal cancer.
- the pre-malignant lesion is associated with a cancer selected from the group consisting of lymphomas, gliomas, small-cell and non-small cell lung, hepatocellular, renal cell, nasopharyngeal, bladder, uterine, epithelial ovarian, breast, prostate and pancreatic carcinomas.
- the circulating CD24 is associated with a biological sample selected from the group consisting of a stool sample, a serum sample, a blood sample, a urine sample and a saliva sample.
- determining is effected at the protein level.
- the at least one reagent comprises a CD24 specific antibody.
- the at least one reagent comprises an oligonucleotide capable of specifically hybridizing to a CD24 nucleic acid sequence.
- the at least one cancer - associated genotype in the CD24 nucleic acid sequence is a thymidine nucleotide containing allele at position 280 of the polynucleotide set forth by SEQ ID NOrI.
- the method further comprising determining a presence or an absence, in a homozygous or heterozygous form, of at least one cancer - associated genotype in an APC nucleic acid sequence of the subject.
- the kit further comprising at least one reagent for determining a determining a presence or an absence, in a homozygous or heterozygous form, of at least one cancer - associated genotype in an APC nucleic acid sequence of the subject.
- the at least one cancer - associated genotype in the APC nucleic acid sequence is an adenosine nucleotide containing allele at position 3977 of the polynucleotide set forth by SEQ ID NO:7.
- the at least one cancer - associated genotype in the APC nucleic acid sequence is an cytosine nucleotide containing allele at position 4006 of the polynucleotide set forth by SEQ ID NO:7.
- the at least one cancer - associated genotype in the APC nucleic acid sequence is an adenosine nucleotide containing allele at position 3977 and a cytosine nucleotide containing allele at position 4006 of the polynucleotide set forth by SEQ ID NO:7
- the cancer therapy comprises radiation therapy. According to still further features in the described preferred embodiments the cancer therapy comprises chemotherapy.
- the cancer therapy comprises antibody therapy.
- kit further comprising instructions for use in monitoring efficacy of caner therapy.
- kit further comprising instructions for use in monitoring efficacy of cancer therapy.
- kit further comprising instructions for use in determining if a subject is predisposed to gastrointestinal cancer.
- kit further comprising instructions for use in diagnosing cancer or a pre-malignant lesion in a subject.
- the present invention successfully addresses the shortcomings of the presently known configurations by providing methods and kits for diagnosing a pre-malignant lesion in a biological sample.
- method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the biotechnological arts.
- FIG. 1 is CD24 — immunoprecipition (IP) analysis of CRC cell lines. Extracts of the HCTl 16 (which do not express CD24) or HT29 (which express CD24) CRC cell lines were subjected to CD24-IP followed by Western blot analysis using the SWAl 1 CD24 antibody.
- IP immunoprecipition
- Lane 1 Total lysate of HCTl 16 CRC cells (without IP); lane 2: total lysate of HT29 CRC cells (without IP); lanes 3-8 - elution products of HCTl 16 cells (lanes 3-5) or HT29 cells (lanes 6-8) using anti-mouse conjugated Sepharose beads (Sigma): in the absence of IP antibody (first binder) (lanes 3 and 6), or following IP using the ML5 Ab (lanes 4 and 7) or the SWAl 1 Ab (lanes 5 and 8). Note the efficient IP using the SWAI l Ab to CD24 (lane 8), demonstrating that SWAl 1 is a suitable IP antibody, yielding low background. .
- FIGs. 2a-c are CD24 Western blot analyses of stool samples obtained from CRC patients before and after the surgical removal of the tumor, or before and after chemotherapy treatment.
- Protein extracts (equal amounts) from stool samples of 12 patients (designated P-I, P-2, P-3...P-12) diagnosed with colorectal tumors [adenomas or adenocarcinomas (CRC)] were subjected to Western blot analysis using the SWAl 1 Ab.
- Figure 2a - lanes 1-9 Lane 1 — HT29 cells (positive control); lanes 2-3 - P-I; lanes 4-5 - P-2; lanes 6-7 - P-3; lanes 8-9 - P-4; Figure 2b - lanes 10-18: lane 10 - HT29 cells; lanes 11-12 - P-5; lanes 13-14 - P-6; lanes 15-16 - P-7; lanes 17-18 - P-8; Figure 2c - lanes 19-27: lane 19 - HT29 cells; lanes 20-21 - P- 9; lanes 22-23 - P-10; lanes 24-25 - P-Il; lanes 26-27 - P- 12.
- Lanes 2, 4, 6, 8, 11, 15, 17, 20, 22, 24 and 26 - samples were taken before the surgical removal of the tumor, lanes 3, 5, 7, 9, 12, 13, 14, 16, 18, 21, 23, 25 and 27 - samples were taken after the surgical removal of the tumor. Note the significant decrease in CD24 levels following the surgical removal of tumors in at least 9 of 11 of the patients (e.g., compare the intensity of the protein band in lane 3 to that of lane 2), demonstrating that the presence of CD24 in the stool originates at least in part from the tumor.
- the CD24-protein species include proteins of various sizes such as from about 20 to about 60 kDa (e.g., lanes 4, 17, 20 and 24), in stool samples taken after the surgical removal of the polyps or tumors the CD24-protein species include proteins of high molecular weight such as from about 37 to about 50 kDa (e.g., lanes 11, 18, 21).
- FIG. 3 depicts an immunoprecipitation analysis of CD24 in serum samples.
- Serum samples taken from patients having active CRC (lane 3) or non-active (lane 2) CRC were immunoprecipitated with a complex formed by pre-incubation of anti- mouse conjugated Sepharose beads (Sigma, Israel) with the SWAI l anti-CD24 monoclonal antibody.
- the immunoprecipitated complexes were subjected to Western blot analysis using the SWAIl anti-CD24 monoclonal antibody.
- Lane 1 - HT29 cells over-expressing CD24; lane 2 - serum from a patient having non-active CRC; lane 3 serum from a patient having active CRC. Note the -40 kDa protein band in lane 3 and the absence of such protein band in lane 2, demonstrating the presence of CD24 in serum of subjects with active CRC and the disappearance of CD24 in subjects with non-active CRC.
- FIG. 4 is an RFLP-analysis of the Val57Ala polymorphism in the CD24 protein (SEQ ID NO:2) (C/T at position 280 of SEQ ID NO: 1).
- Genomic DNA was subjected to PCR amplification using the forward (SEQ ID NO:3) and reverse (SEQ ID NO:4) primers and the resultant 520 bp PCR products were either digested using the BstXl restriction enzyme ("D" for digested, lanes 1, 3, and 5) or remained non-digested ("N” for non-digested, lanes 2, 4 and 6) and electrophoressed on a 1 % agarose gel .
- D for digested, lanes 1, 3, and 5
- N non-digested
- Lanes 1 and 2 - DNA of the colo357 pancreatic cancer cell line which expresses high levels of CD24
- lanes 3 and 4 - DNA of the Panel pancreatic cancer cell line which expresses moderate levels of CD24
- lanes 5 and 6 - DNA of the HT29 colon cancer cell line which expresses high levels of CD24
- lane 7 - 100 bp molecular weight marker
- Panel cells which express moderate levels of CD24 exhibit the C/C genotype at position 280 of SEQ ID NO:1 (which corresponds to the Ala polymorph at position 57 of SEQ ID NO:2) as is evidenced by the presence of only the undigested PCR product of 520 bp
- the colo357 or HT29 cells which express high levels of CD24 exhibit the C/T or the TT genotypes at position 280 of SEQ ID NO:1 (corresponding to the Ala/Val or Val/Val polymorphs at position 57), respectively, as is evidenced by the presence of both digested and undigested PCR products in lane 1 (Colo357) and only the digested PCR products in lane 5 (HT29).
- FIG. 5 depicts the purification of CD24 from human serum.
- CD24 in serum samples from patients with active CRC was purified by anion exchange chromatography using a DEAE-cellulose (DE52) minicolumn. Prior to fractionation, the serum was centrifuged at 12,000 x g (30 minutes, 4 °C) in order to remove any remaining debris, and the albumin was depleted from serum using the DAC (Depletion of albumin component) protocol, which was modified from a previously published method [Colantonio DA, et al., 2005, Proteomics, 5(15): 3831-5].
- the serum was diluted in 10 niM Tris-HCl pH 7.4 and loaded on a DE52 minicolumn pre-equilibrated in the same buffer.
- the flow-through (FT) and wash (W) were collected separately and bound protein was eluted with increasing concentrations of NaCl (0.05-0.3 M) in Tris-HCl pH 7.4. Eluted proteins were analyzed by SDS- PAGE and Western blotting using the SWAI l monoclonal antibody.
- Lane 1 - total lysate of HT29 cell lines serves as a positive control for the CD24 molecular weight; lane 2 - a sample of the serum sample following the centrifugation but before albumin depletion; lanes 3-8 - are different elution fractions. Note the presence of a protein with an apparent molecular weight of 35-40 kDa in lanes 6 and 7 that was eluted in fractions containing 0.1-0.2 M NaCl and recognized by the anti-CD24 antibody.
- the present invention relates to methods of early and non-invasive diagnosis of cancer or pre-malignant lesions using circulating CD24.
- the present invention is of high association of genotypes in the CD24 and APC genes with gastrointestinal cancer which can be used for detection predisposition thereto.
- CRC carcinogenesis involves mutations in oncogenes (e.g., k-Ras) and tumor suppressor genes (e.g., p53), changes in methylation patterns and loss of DCC and SMADs.
- oncogenes e.g., k-Ras
- tumor suppressor genes e.g., p53
- changes in methylation patterns and loss of DCC and SMADs methylation patterns
- SMADs methylation patterns
- endoscopy procedures e.g., colonoscopy
- CRC cardiovascular disease
- CD24 is a heavily glycosilated phosphatidylinositol-anchored mucin-like cell- surface protein which is expressed mainly on hematopoietic subpopulations of B lymphocytes, various epithelial cells, muscle and neural cells. It is over-expressed in various malignant tissues including B-cell lymphomas, gliomas, small-cell and non- small cell lung, hepatocellular, renal cell, nasopharyngeal, bladder, uterine, epithelial ovarian, breast, prostate and pancreatic carcinomas (reviewed by Kristiansen et al., 2004).
- CD24 role in platelet aggregation may explain its involvement with cancer metastases and worse prognosis (Sammar, M., et al., 1994; Aigner, S., et al., 1997; Aigner, S., et al., 1998).
- U.S. Pat. Appl. 20040005596 to Li J., et al. discloses methods of diagnosing cancer by determining the level of CD24 in situ in samples obtained from suspected precancerous or cancerous tissues, thus again necessitating invasional procedures for cancer detection.
- CD24 is over-expressed in pre-malignant lesions of the gastrointestinal tract and that shedded, blebbed or secreted CD24 can be detected in biological samples of subjects having pre-malignant and malignant lesions.
- the present inventors have uncovered that the level of the CD24 transcript is upregulated in ras mutant- transformed cell lines (Example 1) and that its level is reversed to normal following treatment of such cells with Celecoxib, a specific COX-2 inhibitor.
- the present inventors have uncovered that the level of expression of CD24 in various CRC cell lines correlates with the genotype of the Val57Ala SNP in CD24, such that cells which express high level of the CD24 protein carry the CD24 v/v genotype (VaI- 57 polymorph) whereas, cells that barely express the protein carry the CD24 a/a genotype (Ala-57 polymorph) (Example 3).
- CD24 is over-expressed in pre-malignant lesions of the GI tract which correlate with early stages of carcinogenesis (Table 1, Example 2).
- the present inventors have shown that soluble, shedded, blebbed or secreted CD24 can be detected in serum ( Figures 3 and 5, Example 4), stool ( Figures 2a-c, Example 4) and urine samples of patients with CRC carcinogenesis or pre-malignant lesions of the colon-rectal and that the level of CD24 in the stool decreases following the removal (e.g., by surgery) of the pre-malignant or malignant lesions ( Figures 2a-c) as well as when the CRC is non- active (e.g., after radiation therapy; Figure 2b and 3, Example 4).
- CD24 is an excellent marker for early diagnosis of cancer, even at the pre-malignant stage and that soluble CD24 (e.g., secreted), blebbed and/or shedded CD24 can be detected in biological samples such as stool, serum and urine and thus be used in cancer diagnosis.
- soluble CD24 e.g., secreted
- blebbed and/or shedded CD24 can be detected in biological samples such as stool, serum and urine and thus be used in cancer diagnosis.
- a method of diagnosing cancer and/or a pre-malignant lesion is effected by determining a presence and/or level of a circulating CD24 of a subject in need thereof, wherein the presence and/or the level of said circulating CD24 above a predetermined threshold is indicative of the cancer and/or the pre-malignant lesion.
- pre-malignant lesion refers to a mass of cells and/or tissue having increased probability of transforming into a malignant tumor.
- CD24 is over- expressed as compared to a non-malignant tissue or cell.
- pre-malignant lesions include, but are not limited to, adenomatous polyps, Barrett's esophagus, IPMN (Intraductal Papillary Mucinus Neoplasia), DCIS (Ductal Carcinoma in situ) in the breast, leukoplakia and erythroplakia.
- the pre-malignant lesion which is diagnosed according to the method of this aspect of the present invention can transform into a malignant solid or non-solid (e.g., hematological malignancies) CD24-associated cancer (or tumor).
- a malignant solid or non-solid e.g., hematological malignancies
- CD24-associated cancer or tumor.
- the pre-malignant lesion which is diagnosed by the method of this aspect of the present invention is an adenomatous polyp of the colon, an adenomatous polyp of the rectum, an adenomatous polyp of the small bowel and Barrett's esophagus.
- Non-limiting examples of CD24-associated cancers which can be diagnosed by the method of this aspect of the present invention include tumors of the gastrointestinal tract (colon cancer, rectum cancer, anal region cancer, colorectal cancer, small and/or large bowel cancer, esophageal cancer, stomach cancer, pancreatic cancer, gastric cancer, small intestine cancer, adenocarcinoma arising in the small intestine, carcinoid tumors arising in the small intestine, lymphoma arising in the small intestine, mesenchymal tumors arising in the small intestine, gastrointestinal stromal tumors), gallbladder carcinoma, Biliary tract tumors, prostate cancer, kidney (renal) cancer (e.g., Wilms' tumor), liver cancer (e.g., hepatoblastoma, hepatocellular carcinoma), hepatobiliary cancer, biliary tree cancer, tumors of the Gallbladder, bladder cancer, embryonal rhabdomyos
- diagnosis refers to classifying a pathology (e.g., a CD24-associated cancer or a pre-malignant lesion) or a symptom, determining a severity of the pathology, monitoring pathology progression, forecasting an outcome of a pathology and/or prospects of recovery.
- a pathology e.g., a CD24-associated cancer or a pre-malignant lesion
- the phrase "subject in need thereof refers to a human subject who is at risk of having cancer [e.g., a genetically predisposed subject, a subject with medical and/or family history of cancer, a subject who has been exposed to carcinogens, occupational hazard, environmental hazard] and/or a subject who exhibits suspicious clinical signs of cancer [e.g., blood in the stool or melena, unexplained pain, sweating, unexplained fever, unexplained loss of weight up to anorexia, changes in bowel habits (constipation and/or diarrhea), tenesmus (sense of incomplete defecation, for rectal cancer specifically), anemia and/or general weakness]. Additionally or alternatively, the subject in need thereof can be a healthy human subject undergoing a routine well-being check up.
- cancer e.g., a genetically predisposed subject, a subject with medical and/or family history of cancer, a subject who has been exposed to carcinogens, occupational hazard, environmental
- CD24 refers to the nucleic acid sequence and/or the amino acid sequence of at least a functional portion of the phosphatidylinositol- anchored mucin-like cell-surface protein (e.g., CD24 protein - SEQ ID NO:2,
- circulating CD24 refers to any CD24 molecule present in a biological sample of the subject which is not in situ anchored CD24.
- in situ anchored CD24 refers to a tissue anchored CD24 amino acid or nucleic acid sequence which is anchored to intact cells at the site where it is produced (in situ) such as cells of pre-malignant lesions (e.g., adenomas) or cancerous tumors as described hereinabove.
- circulating CD24 refers to any CD24 molecule which can be systemically detected.
- the circulating CD24 can be in a soluble or a non-soluble form (membrane anchored through a GPI moiety).
- circulating CD24 examples include but are not limited to secreted CD24 (e.g., CD24 splice variant), shedded CD24 which is devoid of membrane components (e.g., by the action of phospholipases such as PIPLC; e.g., the amino acid sequence 27-80 of SEQ ID NO:2), blebbed CD24 (i.e., CD24 present in cell blebs that are formed by rupture of the plasma membrane from the underlying cytoskeleton followed by inflation of the detached membrane by intracellular fluid) or CD24 which is present on shedded cells (i.e., cells which are detached from the tissue).
- secreted CD24 e.g., CD24 splice variant
- shedded CD24 which is devoid of membrane components (e.g., by the action of phospholipases such as PIPLC; e.g., the amino acid sequence 27-80 of SEQ ID NO:2)
- blebbed CD24 i.e., CD24 present in cell blebs
- the circulating CD24 of the present invention can be present in a biological sample that is remote from the cancerous tissue or cancer-free.
- the biological sample may be stool, serum or urine while the cancer may be a GI cancer such as CRC.
- biological sample refers to any cellular or non- cellular biological samples which may contain a circulating CD24 as described above. Examples include but are not limited to, a blood sample (e.g., serum), a saliva sample, a stool sample, a urine sample, pup smear, cervix sample, a bone marrow sample (specifically containing macrophages), lymph fluid, a skin sample, epithelial cells, various external secretions of the respiratory, intestinal, and genitourinary tracts, tears, milk, a tissue biopsy, a cerebrospinal fluid (CSF) sample, a sperm fluid sample, amniotic fluid, and chorionic villi sample (CVS), a sample of neuronal cells, dendritic cells, organs, and also samples of in vivo cell culture constituents.
- a blood sample e.g., serum
- saliva sample e.g., a saliva sample
- a stool sample e.g., a stool sample, a urine
- the biological sample used by the method of this aspect of the present invention is a blood sample (e.g., serum), a stool sample and/or a urine sample.
- the biological sample can be obtained using methods known in the art such as using a syringe with a needle, a scalpel, fine needle aspiration (FNA), catheter, gastrointestinal endoscopy (e.g., colorectal endoscopy, gastro-endoscopy) and the like.
- the biological sample of the present invention can be obtained by blood sampling, stool collection or urine collection. Determining the level and/or presence of soluble CD24 can be effected ex vivo (on a sample derived from the subject) as well as in vivo (within the subject).
- the phrase "presence and/or level of a circulating CD24" refers to the degree of gene expression and/or gene product activity of the CD24 gene in a biological sample. Accordingly, the presence and/or level of CD24 can be determined at the amino acid level using protein detection methods.
- the presence and/or level of the CD24 amino acid sequence can be determined using a CD24 specific antibody via the formation of an immunocomplex [i.e., a complex formed between the CD24 antigen (a CD24 amino acid sequence) present in the biological sample and the CD24 specific antibody].
- the immunocomplex of the present invention can be formed at a variety of temperatures, salt concentration and pH values which may vary depending on the method and the biological sample used and those of skills in the art are capable of adjusting the conditions suitable for the formation of each immunocomplex.
- antibody as used in this invention includes intact molecules as well as functional fragments thereof, such as Fab, F(ab')2, Fv or single domain molecules such as VH and VL to an epitope of an antigen.
- functional antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen- binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of
- Antibody fragments according to the present invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment.
- Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods.
- antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5 S fragment denoted F(ab')2.
- This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5 S Fab' monovalent fragments.
- a thiol reducing agent optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages
- an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly.
- cleaving antibodies such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.
- Fv fragments comprise an association of VH and VL chains. This association may be noncovalent, as described in Inbar et al. [Proc. Nat'l Acad. Sci. USA 69:2659- 62 (1972O]. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise VH and VL chains connected by a peptide linker. These single- chain antigen binding proteins (scFv) are prepared by constructing a structural gene comprising DNA sequences encoding the VH and VL domains connected by an oligonucleotide.
- scFv single- chain antigen binding proteins
- the structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli.
- a host cell such as E. coli.
- the recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
- Methods for producing scFvs are described, for example, by Whitlow and Filpula, Methods 2: 97-105 (1991); Bird et al., Science 242:423-426 (1988); Pack et al., Bio/Technology 11:1271-77 (1993); and U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety.
- CDR peptides (“minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106-10 (1991)].
- Antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. MoL Biol., 227:381 (1991); Marks et al., J. MoI. Biol., 222:581 (1991)].
- the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol, 147(l):86-95 (1991)].
- human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
- detection of immuiiocomplex formation is indicative of a diagnosis of the cancer or the pre- malignant lesion.
- Various methods can be used to detect the formation of the CD24 immunocomplex of the present invention and those of skills in the art are capable of determining which method is suitable for each immunocomplex and/or the type of cells used for diagnosis.
- the CD24 antibody used in the immunocomplex of the present- invention can be labeled using methods known in the art. It will be appreciated that the labeled antibodies can be either primary antibodies (i.e., which bind to the specific antigen, e.g., a CD24-specific antigen) or secondary antibodies (e.g., labeled goat anti rabbit antibodies, labeled mouse anti human antibody) which bind to the primary antibodies.
- primary antibodies i.e., which bind to the specific antigen, e.g., a CD24-specific antigen
- secondary antibodies e.g., labeled goat anti rabbit antibodies, labeled mouse anti human antibody
- the antibody can be directly conjugated to a label or can be conjugated to an enzyme.
- Antibodies of the present invention can be fluorescently labeled (using a fluorescent dye conjugated to an antibody), radiolabeled (using radiolabeled e.g., I, antibodies), or conjugated to an enzyme (e.g., horseradish peroxidase or alkaline phosphatase) and used along with a chromogenic substrate to produce a colorimetric reaction.
- the chromogenic substrates utilized by the enzyme-conjugated antibodies of the present invention include, but are not limited to, AEC, Fast red, ELF-97 substrate [2-(5 '-chloro-2-phosphoryloxyphenyl)-6-chloro-4(3 H)-quinazolinone] , p- nitrophenyl phosphate (PNPP), phenolphthalein diphosphate, and ELF 39-phosphate,
- Detection of the CD24 immunocomplex in a biological sample such as serum, stool or urine which may contain circulating CD24 can be performed using fluorescence activated cell sorting (FACS), enzyme linked immunosorbent assay
- the proteins are extracted from a cell sample and are subjected to electrophoresis (e.g., SDS-PAGE) and blotting to a membrane (e.g., nylon or PVDF).
- electrophoresis e.g., SDS-PAGE
- a membrane e.g., nylon or PVDF
- Detection may be by autoradiography, colorimetric reaction or cheniiluminescence. This method allows both quantitation of an amount of substrate and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.
- detection of the antigen can be performed by immunoprecipitation (IP), essentially as described in the Examples section which follows.
- IP immunoprecipitation
- the CD24 antibody may directly interact with a sample (e.g., cell lysate) including CD24 and the formed complex can be further detected using a secondary antibody conjugated to beads (e.g., if the CD24 antibody is a mouse monoclonal antibody, the secondary antibody may be an anti- mouse antibody conjugated to e.g., Sepharose beads).
- the beads can be then precipitated by centrifugation, following which the precipitated proteins (e.g., CD24 and anti CD24 antibodies) can be detached from the beads (e.g., using denaturation at 95 °C) and further subjected to Western blot analysis using the CD24 specific antibodies.
- the anti-CD24 antibody and the beads-conjugated secondary antibody may be added to the biological sample containing the antigen (CD24) to thereby form an immunocomplex.
- CD24 is a highly glycosilated protein, it can be also precipitated using a substrate capable of binding glycosilated polypeptides such Concavalin A (GE Healthcare Bio-Sciences, Uppsala, Sweden) which may be also conjugated to beads, followed by Western blot analysis with anti-CD24 antibodies.
- Concavalin A GE Healthcare Bio-Sciences, Uppsala, Sweden
- CD24 specific antibodies are linked to fluorophores and detection is performed by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.
- the presence and/or level of CD24 can be also determined using ELISA.
- a sample containing CD24 antigen is fixed to a surface such as a well of a microtiter plate.
- An antigen specific antibody (a CD24 antibody) coupled to an enzyme is applied and allowed to bind to the antigen. Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody.
- Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of substrate present in the sample is proportional to the amount of color produced.
- a substrate standard is generally employed to improve quantitative accuracy.
- the presence and/or level of CD24 can be also determined using radioimmunoassay (RIA).
- RIA radioimmunoassay
- this method involves precipitation of the desired antigen (CD24) with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labeled with I 125 ) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of antigen.
- a labeled antigen and an unlabelled antibody binding protein are employed.
- a sample containing an unknown amount of antigen is added in varying amounts.
- the decrease in precipitated counts from the labeled antigen is proportional to the amount of antigen in the added sample.
- the presence and/or level of CD24 can be also determined using molecular weight-based approach. Since the immunocomplex exhibits a higher molecular weight than its components, methods capable of detecting such a change in the molecular weight can be also employed. For example, the immunocomplex can be detected by a gel retardation assay. Briefly, a non-denaturing acrylamide gel is loaded with samples. A shift in the size (molecular weight) of the protein product as compared with its components is indicative of the presence of an immunocomplex. Such a shift to a higher molecular weight can be viewed using a non-specific protein staining such as silver stain or Commassie blue stain.
- a non-specific protein staining such as silver stain or Commassie blue stain.
- shedded cells or fragments thereof may also include mRNA molecules
- detection of the circulating CD24 in the biological sample may be also performed using mRNA detection methods which are capable of detecting CD24 over expression.
- detection of circulating CD24 can also be effected at the DNA level in the biological sample.
- RNA or DNA detection methods can be performed using an isolated polynucleotide (e.g., a polynucleotide probe, an oligonucleotide probe/primer) capable of hybridizing to a CD24 nucleic acid sequence such as the CD24 transcript set forth by SEQ ID NO:1 or a portion thereof.
- Such a polynucleotide can be at any size, such as a short polynucleotide (e.g., of 15-200 bases), an intermediate polynucleotide of 100-2000 bases and a long polynucleotide of more than 2000 bases.
- the isolated polynucleotide probe used by the present invention can be any directly or indirectly labeled RNA molecule [e.g., RNA oligonucleotide (e.g., of 17-
- RNA molecules 50 bases
- DNA molecule e.g., oligonucleotide, e.g., 15-50 bases, cDNA molecule, genomic molecule
- an analogue thereof e.g., peptide nucleic acid (PNA)
- PNA peptide nucleic acid
- Oligonucleotides designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art such as enzymatic synthesis or solid phase synthesis.
- Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example, "Molecular Cloning: A laboratory Manual” Sambrook et al, (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed.
- the isolated polynucleotide used by the present invention can be labeled either directly or indirectly using a tag or label molecule.
- labels can be, for example, fluorescent molecules (e.g., fluorescein or Texas Red), radioactive molecule (e.g., 32 P- ⁇ -ATP or 32 P- ⁇ -ATP) and chromogenic substrates [e.g., Fast Red, BCIP/INT, available from (ABCAM, Cambridge, MA)].
- Direct labeling can be achieved by covalently conjugating a label molecule to the polynucleotide (e.g., using solid-phase synthesis) or by incorporation via polymerization (e.g., using an in vitro transcription reaction or random-primed labeling).
- Indirect labeling can be achieved by covalently conjugating or incorporating to the polynucleotide a non-labeled tag molecule (e.g., Digoxigenin or biotin) and subsequently subjecting the polynucleotide to a labeled molecule -(e.g., anti-Digoxigenin antibody or streptavidin) capable of specifically recognizing the non-labeled tag.
- a non-labeled tag molecule e.g., Digoxigenin or biotin
- a labeled molecule -(e.g., anti-Digoxigenin antibody or streptavidin) capable of specifically recognizing the non-labeled tag.
- RNA detection methods such as Northern blot analysis, reverse-transcribed PCR (RT-PCR) [e.g., a semi-quantitative RT-PCR, quantitative RT-PCR using e.g., the Light CyclerTM (Roche)], RNA in situ hybridization (RNA-ISH), in situ RT-PCR stain [e.g., as described in Nuovo GJ, et al. 1993, Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cDNA. Am J Surg Pathol. 17: 683-90, and Herinoth P, et al.
- RT-PCR reverse-transcribed PCR
- RNA-ISH RNA in situ hybridization
- PCR in situ RT-PCR stain
- DNA detection methods which can be used along with the present invention include, but are not limited to, Southern blot analysis, PCR, quantitative PCR and restriction fragment length polymorphism (RFLP).
- predetermined threshold refers to a known level of circulating CD24 in a sample. Such a level can be experimentally determined by comparing normal samples (e.g., samples obtained from healthy subjects) to samples derived from subjects known to have carcinogenesis such as CRC (see for example, Table 1 and Example 2 of the Examples section which follows). Alternatively, such a level can be obtained from the scientific literature.
- the presence and/or the level of the CD24 in the biological sample above a predetermined threshold is indicative of the cancer or the pre-malignant lesion.
- the presence of the cancer or the pre-malignant lesion can be further validated using additional assays.
- additional assays such as colon endoscopy followed by histological evaluations (including CD24 immunostaining) may be performed on the identified adenomas (in case adenomas are present).
- teachings of the present invention provide, for the first time, a highly reliable (over 80 % accuracy), non-invasive method of diagnosing pre-malignant or malignant lesions of the gastrointenstinal tract using biological samples such as serum, urine and stool.
- a method of monitoring efficacy of cancer therapy is effected by determining a level of a circulating CD24 in a biological sample of the subject following the cancer therapy, wherein a decrease from a predetermined threshold in the level of the circulating CD24 following the cancer therapy is indicative of reduction of cancerous cells, thereby monitoring efficacy of the cancer therapy.
- the cancer therapy which efficacy is monitored according to the method of this aspect of the present invention can be radiation therapy, chemotherapy (e.g., CHOP, Cisplatin, carboplatin, oxaliplatin, azathioprine, mercaptopurine, vinca alkaloids, etoposide, teniposide, paclitaxel, docetaxel, irinotecan, topotecanamsacrine, etoposide, etoposide phosphate, teniposide and dactinomycin), antibody therapy [e.g., trastuzumab (Herceptin) and rituximab (Rituxan)] or a combination of any of the above.
- chemotherapy e.g., CHOP, Cisplatin, carboplatin, oxaliplatin, azathioprine, mercaptopurine
- vinca alkaloids etoposide, teniposide, paclitaxel, docetaxe
- a decrease from a pre-determined threshold in the level of circulating CD24 is indicative of the cancer therapy being efficient.
- the cancer therapy is not efficient in eliminating (e.g., killing, depleting) the cancerous cells from the treated subject and additional and/or alternative therapies (e.g., treatment regimens) may be used.
- the pre-determined threshold can be determined in a subset of subj ects with known outcome of therapy.
- the decrease from the pre-determined threshold is of at least 10 times, more preferably, 15 times, preferably, 20 times, preferably, 50 times or at least 100 times (e.g., at least 1000 times) in the level of circulating CD24 following cancer therapy. While further reducing the present invention to practice, the present inventors have uncovered that polymorphisms in the CD24 gene may be used as markers for predisposition of a subject to gastrointestinal cancer.
- Example 3 of the Examples section which follows, individuals who carry the VaI polymorph at position 57 of the CD24 protein (SEQ ID NO:2) have increased predisposition risk to develop gastrointestinal cancer.
- SEQ ID NO:2 the VaI polymorph at position 57 of the CD24 protein
- I1307K of the APC protein for determining predisposition to gastrointestinal cancer.
- a method of determining if a subject is predisposed to gastrointestinal cancer is effected by determining a presence or absence, in a homozygous or heterozygous form, of at least one cancer - associated genotype in the CD24 nucleic acid sequence of the subject, thereby determining if the subject is predisposed to the gastrointestinal cancer.
- predisposed when used with respect to gastrointestinal cancer refers to a subject who is more susceptible to developing gastrointestinal cancer than non-predisposed subjects.
- homozygous or heterozygous refer to two identical or two different alleles, respectively, of a certain polymorphism.
- polymorphism refers to the occurrence of two or more genetically determined variant forms (alleles) of a particular nucleic acid at a frequency where the rarer (or rarest) form could not be maintained by recurrent mutation alone.
- a single nucleotide polymorphism results from a single base difference between related alleles at the same genetic locus.
- a non-limiting example of a polymorphism is the presence of a cytosine or thymidine nucleotide at position 280 of CD24 coding sequence (SEQ ID NO:1; GenBank Accession No.
- genotype determination test is suitable for the identification of thymidine nucleotide - containing allele at position 280 of SEQ ID NO:1, and the subject on which the test is performed is homozygote for the cytosine nucleotide - containing allele at position 280 of SEQ ID NO:1, then the result of the test will be "absence of genotype".
- the at least one cancer - associated genotype in the CD24 nucleic acid sequence is a thymidine nucleotide containing allele at position 280 of the polynucleotide set forth by SEQ ID NO:1.
- Example 3 of the Examples section which follows the present inventors have uncovered that individuals carrying both the thymidine nucleotide containing allele at position 280 of the polynucleotide set forth by SEQ ID NO: 1
- the method of determining if a subject is predisposed to gastrointestinal cancer further comprising determining a presence or an absence, in a homozygous or heterozygous form, of at least one cancer - associated genotype in an APC nucleic acid sequence of the subject.
- the at least one cancer - associated genotype in the APC nucleic acid sequence is an adenosine nucleotide containing allele at position 3977 of the polynucleotide set forth by SEQ ID NO:7 (which encodes the lysine-1307 polymorph of the APC polypeptide set forth by SEQ ID NO:8).
- the at least one cancer - associated genotype in the APC nucleic acid sequence is an cytosine nucleotide containing allele at position 4006 of the polynucleotide set forth by SEQ ID NO: 7 (which encodes the Glutamine-1317 of the polypeptide set forth by SEQ ID NO:8).
- the at least one cancer - associated genotype in the APC nucleic acid sequence is an adenosine nucleotide containing allele at position 3977 and a cytosine nucleotide containing allele at position 4006 of the polynucleotide set forth by SEQ ID NO:7.
- the predisposition to gastrointestinal cancer can be quantified by generating and using genotype relative risk (GRR) values.
- GRR genotype relative risk
- the GRR is the increased chance of an individual with a particular genotype to develop the disease.
- the GRR of the risk genotype G with respect to the protective genotype Go, is the ratio between the risk of an individual carrying genotype G to develop the disease, and the risk of an individual carrying genotype G 0 to develop the disease (e.g., CRC).
- the GRR used herein is represented in terms of an appropriate odds ratio (OR) of G versus Go in cases and controls.
- OR odds ratio
- computation of GRR of haplotypes is based on a multiplicative model in which the GRR of an homozygote individual is the square of the GRR of an heterozygote individual. For further details see Risch and Merikangas, 1996 [The future of genetic studies of complex human diseases. Science 273: 1516- 1517].
- the GRR can reflect the increased predisposition risk of an individual with a specific cancer - associated genotype in the CD24 nucleic acid sequence and/or the APC nucleic acid sequence to develop gastrointestinal cancer.
- the present invention provides a method of predicting predisposition of a subject to gastrointestinal cancer by detecting specific genotypes in the CD24 and APC genes and/or proteins. It will be appreciated that such genotypes can be detected on the DNA level, as well as on the protein level using antibodies capable of detecting specific protein polymorphs.
- a DNA or a protein sample can be obtained from any source of cells or cell content of the subject, including, but not limited to, peripheral blood cells (obtained using a syringe, e.g., white blood cells), skin cells (obtained from a skin biopsy), mouth epithelial cells (obtained from a mouth wash), cerebrospinal fluid, urine, lymph fluids, various external secretions of the respiratory, intestinal, and genitourinary tracts, tears, saliva, and milk, as well as malignant tissues, amniotic fluid, and chorionic villi, tissue sections (e.g., frozen sections or paraffin-embedded sections) and the like.
- peripheral blood cells obtained using a syringe, e.g., white blood cells
- skin cells obtained from a skin biopsy
- mouth epithelial cells obtained from a mouth wash
- cerebrospinal fluid cerebrospinal fluid
- urine obtained from lymph fluids
- lymph fluids various external secretions of the respiratory, intestinal,
- DNA is preferably extracted using methods which are well known in the art, involving tissue mincing, cell lysis, protein extraction, and DNA precipitation using 2 to 3 volumes of 100 % ethanol, rinsing in 70 % ethanol, pelleting, drying, and resuspension in water or any other suitable buffer (e.g., Tris-EDTA).
- DNA can be obtained by adding a protein digestion enzyme (e.g., proteinase K), followed by denaturation (e.g., boiling at 95 °C for 5-10 minutes).
- DNA can be isolated from tissue sections (e.g., archive paraffin embedded sections) as described previously (Arber N, Shapira I, et al., 2000, Activation of c-K-ras mutations in human gastrointestinal tumors. Gastroenterology, 118: 1045-50).
- the DNA sample is obtained from a peripheral blood sample.
- Methods of extracting DNA from blood samples are well known in the art.
- the DNA sample is preferably characterized for the presence or absence of at least one or more of the cancer - associated genotype in the CD24 and/or APC nucleic acid sequence of the present invention.
- the SNPs of the present invention can be identified using a variety of approaches suitable for identifying sequence alterations.
- One option is to detennine the entire gene sequence of a PCR reaction product.
- a given segment of nucleic acid may be characterized on several other levels.
- the size of the molecule can be determined by electrophoresis by comparison to a known standard run on the same gel.
- a more detailed picture of the molecule may be achieved by cleavage with combinations of restriction enzymes prior to electrophoresis, to allow construction of an ordered map.
- the presence of specific sequences within the fragment can be detected by hybridization of a labeled probe, or the precise nucleotide sequence can be determined by partial chemical degradation or by primer extension in the presence of chain-terminating nucleotide analogs.
- the DNA sample is preferably amplified prior to determining sequence alterations, since many genotyping methods require amplification of the DNA region carrying the sequence alteration of interest.
- oligonucleotide refers to a single stranded or double stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or niimetics thereof.
- This term includes oligonucleotides composed of naturally- occurring bases, sugars and covalent internucleoside linkages (e.g., backbone) as well as oligonucleotides having non-naturally-occurring portions which function similarly to respective naturally-occurring portions.
- Oligonucleotides designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art such as enzymatic synthesis or solid phase synthesis.
- Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example, "Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed.
- the oligonucleotide of the present invention is of at least 17, at least 18, at least 19, at least 20, at least 22, at least 25, at least 30 or at least 40, bases specifically hybridizable with sequence alterations described hereinabove.
- the oligonucleotides of the present invention may comprise heterocylic nucleosides consisting of purines and the pyrimidines bases, bonded in a 3 1 to 5' phosphodiester linkage.
- oligonucleotides are those modified in either backbone, internucleoside linkages or bases, as is known in the art.
- RPLP Restriction fragment length polymorphism
- Sequencing analysis The isolated DNA is subjected to automated dideoxy terminator sequencing reactions using a dye-terminator (unlabeled primers and labeled dideoxy nucleotides) or a dye-primer (labeled primers and unlabeled dideoxy nucleotides) cycle sequencing protocol.
- a dye-terminator reaction a PCR reaction is performed using unlabeled PCR primers, followed by a sequencing reaction in the presence of one of the primers, deoxynucleotides, and the labeled dideoxy nucleotide mix.
- PCR reaction For the dye-primer reaction, a PCR reaction is performed using PCR primers conjugated to universal or reverse primers (one in each direction), followed by a sequencing reaction in the presence of four separate mixes (corresponding to the A, G, C, and T nucleotides), each containing a labeled primer specific to the universal or reverse sequence, and the corresponding unlabeled dideoxy nucleotides.
- Microsequencing analysis can be effected by conducting microsequencing reactions on specific regions of the CD24 or APC genes which may be obtained by amplification reaction (PCR), as mentioned hereinabove. Genomic or cDNA amplification products are then subjected to automated microsequencing reactions using ddNTPs (using specific fluorescence for each ddNTP) and an appropriate oligonucleotide microsequencing primer which can hybridize just upstream of the alteration site of interest. Once specifically extended at the 3' end by a DNA polymerase using a complementary fluorescent dideoxynucleotide analogue (e.g., via thermal cycling), the primer is precipitated to remove the unincorporated fluorescent ddNTPs.
- ddNTPs using specific fluorescence for each ddNTP
- an appropriate oligonucleotide microsequencing primer which can hybridize just upstream of the alteration site of interest.
- reaction products into which fluorescent ddNTPs have been incorporated are then analyzed by electrophoresis on sequencing machines (e.g., ABI 377) to determine the identity of the incorporated base, thereby identifying the sequence alteration in the CD24 or APC genes of the present invention.
- sequencing machines e.g., ABI 377
- the extended primer may also be analyzed by MALDI-TOF Mass Spectrometry.
- the base at the alteration site is identified by the mass added onto the microsequencing primer.
- Solid-phase microsequencing reactions employ oligonucleotide microsequencing primers or PCR- amplified products of the DNA fragment of interest, which are immobilized. Immobilization can be carried out, for example, via an interaction between biotinylated DNA and streptavidin-coated microtitration wells or avidin-coated polystyrene particles.
- incorporated ddNTPs can be either radiolabeled (Syvanen, A. C. (1994). Detection of point mutations in human genes by the solid-phase minisequencing method. Clin Chim Acta 226, 225-236) or linked to fluorescein (Livak, K. J. and Hainer, J. W. (1994). A microtiter plate assay for determining apolipoprotein E genotype and discovery of a rare allele. Hum Mutat 5(4), 379-385). The detection of radiolabeled ddNTPs can be achieved through scintillation- based techniques.
- fluorescein-linked ddNTPs The detection of fluorescein-linked ddNTPs is based on the binding of antifluorescein antibody conjugated with alkaline phosphatase, followed by incubation with a chromogenic substrate (such asp-nitrophenyl phosphate).
- a chromogenic substrate such asp-nitrophenyl phosphate
- reporter-detection conjugates include ddNTP linked to dinitrophenyl (DNP) and anti-DNP alkaline phosphatase conjugate (see Harju, L. et al. (1993). Colorimetric solid-phase minisequencing assay for the detection of alpha- 1 -antitrypsin Z mutation. Clin Chem 39(2), 2282-2287) and biotinylated ddNTP and horseradish peroxidase-conjugated streptavidin with o-phenylenediamine as a substrate (see WO 92/15712).
- a diagnostic kit based on fluorescein-linked ddNTP with antifluorescein antibody conjugated with alkaline phosphatase is commercially available from GamidaGen Ltd (PRONTO).
- the Oligonucleotide Ligation Assay uses two oligonucleotides that are designed to be capable of hybridizing to abutting sequences of a single strand of a target molecule.
- One of the oligonucleotides is biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize to the target such that their termini abut, and create a ligation substrate that can be captured and detected.
- OLA is capable of detecting single nucleotide polymorphisms and may be advantageously combined with PCR, as described by: Nickerson, J. A. et al. (1990). Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay. Proc Natl Acad Sci U.S.A. 87, 8923-8927. In this method, PCR is used to achieve the exponential amplification of target DNA, which is then detected using OLA.
- Other amplification methods which are particularly suited for the detection of single nucleotide polymorphisms include LCR (ligase chain reaction) and Gap LCR (GLCR). LCR uses two pairs of probes to exponentially amplify a specific target.
- each pair of oligonucleotides are selected to permit the pair to hybridize to abutting sequences of the same strand of the target. Such hybridization forms a substrate for a template-dependant ligase.
- LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a biallelic marker site. In one embodiment, either oligonucleotide will be designed to include the biallelic marker site.
- the reaction conditions are selected such that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the biallelic marker on the oligonucleotide.
- the oligonucleotides will not include the biallelic marker, such that when they hybridize to the target molecule, a "gap" is created, as described in WO 90/01069. This gap is then "filled” with complementary dNTPs (as mediated by DNA polymerase), or by an additional pair of oligonucleotides.
- each single strand has a complement capable of serving as a target during the next amplification cycle, and exponential allele-specific amplification of the desired sequence is obtained.
- Ligase/Polymerase-mediated Genetic Bit AnalysisTM This is another method for determining the identity of a nucleotide at a preselected site in a nucleic acid molecule (WO 95/21271). This method involves the incorporation of a nucleoside triphosphate, which is complementary to the nucleotide present at the preselected site, onto the terminus of a primer molecule, and their subsequent ligation to a second oligonucleotide. The reaction is monitored by detecting a specific label attached to the reaction's solid phase or by detection in solution.
- Hybridization assay methods which allow the detection of single-base alterations rely on the use of an oligonucleotide which can be 10, 15, 20, or 30 to 100 nucleotides long, preferably from 10 to 50, more preferably from 40 to 50 nucleotides in length.
- the oligonucleotide includes a central nucleotide complementary to a polymorphic site of the CD24 or APC genes, and flanking nucleotide sequences spanning on each side of the central nucleotide that are substantially complementary to the nucleotide sequences of the CD24 or APC genes spanning on each side of the polymorphic site.
- Sequence alteration can be detected by hybridization of the oligonucleotide of the present invention to the template sequence under stringent hybridization reactions.
- hybridization of short nucleic acids can be effected by any of the following hybridization protocols, depending on the desired stringency: (i) hybridization solution of 6 x SSC and 1 % SDS or 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 % SDS, 100 ⁇ g/ml denatured salmon sperm DNA, and 0.1 % nonfat dried milk, hybridization temperature of 1-1.5°C below the T m , final wash solution of 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), and 0.5 % SDS at 1-1.5°C below the T m ; (ii) hybridization solution of 6
- hybridization duplexes are separated from unhybridized nucleic acids and the labels bound to the duplexes are then detected.
- labels refer to radioactive, fluorescent, biological, or enzymatic tags or labels of standard use in the art.
- a label can be conjugated to either the oligonucleotide probes or the nucleic acids derived from the biological sample (target).
- oligonucleotides of the present invention can be labeled subsequent to synthesis, by incorporating biotinylated dNTPs or rNTP, or by some similar means (e.g., photo-cross-linking a psoralen derivative of biotin to RNAs), followed by addition of labeled streptavidin (e.g., phycoerythrin- conjugated streptavidin) or the equivalent.
- labeled streptavidin e.g., phycoerythrin- conjugated streptavidin
- oligonucleotide probes when fluorescently-labeled oligonucleotide probes are used, fluorescein, lissamine, phycoerythrin, rhodamine (Perkin Elmer Cetus), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham), and/or others (see, e.g., Kricka, J. D. (1992), "Nonisotopic DNA Probe Techniques," Academic Press, San Diego) can be attached to the oligonucleotides.
- Traditional hybridization assays include PCR 5 RT-PCR, RNase protection, in- situ hybridization, primer extension, Southern blot, Northern Blot, and dot blot analysis.
- wash steps may be employed to wash away excess target DNA or probe as well as unbound conjugate.
- standard heterogeneous assay formats are suitable for detecting the hybrids using the labels present on the oligonucleotide primers and probes.
- the TaqMan® assay takes advantage of the 5' nuclease activity of
- Taq DNA polymerase to digest a DNA probe annealed specifically to the accumulating amplification product.
- TaqMan probes are labeled with a donor-acceptor dye pair that interact via fluorescence energy transfer. Cl cleavage of the TaqMan probe by the advancing polymerase during amplification dissociates the donor dye from the quenching acceptor dye, greatly increasing the donor fluorescence. All reagents necessary to detect two allelic variants can be assembled at the beginning of the reaction and the results are monitored in real time (see Livak, K. J. and Hainer, J.
- Molecular beacons are hairpin-shaped oligonucleotide probes that report the presence of specific nucleic acids in homogeneous solutions. When they bind to their targets they undergo a conformational reorganization that restores the fluorescence of an internally quenched fluorophore (Tyagi, S. et al. (1998). Multicolor molecular beacons for allele discrimination. Nat Biotechnol 16(1), 49-53).
- samples may be hybridized to an irrelevant probe and treated with RNase A prior to hybridization, to assess false hybridization.
- U.S. Pat. No. 5,451,503 provides several examples of oligonucleotide configurations which can be utilized to detect SNPs in template DNA or RNA. Hybridization to oligonucleotide arrays - The chip/array technology has already been applied with success in numerous cases. For example, the screening of mutations has been undertaken in the BRCAl gene, in S. cerevisiae mutant strains, and in the protease gene of HIV-I virus (see: Hacia, JG et al. (1996). Detection of heterozygous mutations in BRCAl using high density oligonucleotide arrays and two- colour fluorescence analysis. Nat Genet 14(4), 441-447; Shoemaker, D. D.
- the nucleic acid sample that includes the candidate region to be analyzed is isolated, amplified, and labeled with a reporter group.
- This reporter group can be a fluorescent group such as phycoerythrin.
- the labeled nucleic acid is then incubated with the probes immobilized on the chip using a f ⁇ uidics station.
- Manz et al. describe the fabrication of fluidics devices and particularly microcapillary devices, in silicon and glass substrates (Manz, A. et al. (1993). Planar chip technology for miniaturization of separation systems. Adv in Chromatogr 33, 1-66).
- the chip is inserted into a scanner and patterns of hybridization are detected.
- the hybridization data is collected from a signal emitted from the reporter groups already incorporated into the nucleic acid, which is now bound to the probes attached to the chip.
- Probes that perfectly match a sequence of the nucleic acid sample generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe immobilized on the chip is known, the identity of the nucleic acid hybridized to a given probe can be determined.
- sets of four oligonucleotide probes are generally designed that span each position of a portion of the candidate region found in the nucleic acid sample, differing only in the identity of the polymorphic base.
- the relative intensity of hybridization to each series of probes at a particular location allows the identification of the base corresponding to the polymorphic base of the probe.
- Integrated systems - Another technique which may be used to analyze sequence alterations includes multicomponent integrated systems, which miniaturize and compartmentalize processes such as PCR and capillary electrophoresis reactions in a single functional device.
- multicomponent integrated systems which miniaturize and compartmentalize processes such as PCR and capillary electrophoresis reactions in a single functional device.
- An example of such a technique is disclosed in U.S. Pat. No. 5,589,136, which describes the integration of PCR amplification and capillary electrophoresis in chips.
- Integrated systems are preferably employed along with microfluidic systems. These systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements of the samples are controlled by electric, electro-osmotic, or hydrostatic forces applied across different areas of the microchip, to create functional microscopic valves and pumps with no moving parts. Varying the voltage controls the liquid flow at intersections between the micro-machined channels and changes the liquid flow rate for pumping across different sections of the microchip.
- a microfluidic system may integrate nucleic acid amplification, microsequencing, capillary electrophoresis, and a detection method such as laser-induced fluorescence detection.
- the DNA sample is amplified, preferably by PCR.
- the amplification product is then subjected to automated microsequencing reactions using ddNTPs (with specific fluorescence for each ddNTP) and the appropriate oligonucleotide microsequencing primers, which hybridize just upstream of the targeted polymorphic base.
- ddNTPs with specific fluorescence for each ddNTP
- oligonucleotide microsequencing primers which hybridize just upstream of the targeted polymorphic base.
- This microchip can be used to process 96 to 384 samples in parallel. It can use the typical four-color laser-induced fluorescence detection of ddNTPs. It will be appreciated that when utilized along with automated equipment, the above-described detection methods can be both rapidly and easily used to screen multiple samples for the CD24 or APC alterations of the present invention.
- Allele-specific oligonucleotides (ASOs) -
- ASO allele-specific oligonucleotide
- ASO is designed to hybridize in proximity to the polymorphic nucleotide, such that a primer extension or ligation event can be used as the indicator of a match or a mismatch.
- Hybridization with radioactively labeled ASOs has also been applied to the detection of specific SNPs (Connor, B. J. et al. (1983), Proc Natl Acad Sci USA, 80, 278-282). The method is based on the differences in the melting temperatures of short DNA fragments differing by a single nucleotide. Stringent hybridization and washing conditions can differentiate between mutant and wild-type alleles.
- DGGE/TGGE Denaturing/Temperature Gradient Gel Electrophoresis
- the fragments to be analyzed are "clamped” at one end by a long stretch of G-C base pairs (30-80) to allow complete denaturation of the sequence of interest without complete dissociation of the strands.
- the attachment of a GC “clamp” to the DNA fragments increases the fraction of mutations that can be recognized by DGGE (Abrams, E. S. et al. (1990). Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresis and a GC clamp. Genomics 7, 463-475). Attaching a GC clamp to one primer is critical to ensure that the amplified sequence has a low dissociation temperature (Sheffield, V. C. et al. (1989).
- RNA:RNA duplexes Smith, F. I. et al. (1988). Novel method of detecting single base substitutions in RNA molecules by differential melting behavior in solution. Genomics 3(3), 217-223).
- DGGE Denaturant Gel Electrophoresis
- TGGE Electrophoresis
- TGGE uses a thermal gradient rather than a chemical denaturant gradient (Scholz, R. B. et al. (1993). Rapid screening for Tp53 mutations by temperature gradient gel electrophoresis: a comparison with SSCP analysis. Hum MoI Genet 2(12), 2155-2158).
- TGGE requires the use of specialized equipment that can generate a temperature gradient perpendicularly oriented relative to the electrical field. TGGE can detect mutations in relatively small fragments of DNA; therefore, scanning large gene segments requires the use of multiple PCR products prior to running the gel.
- SSCP Single-Strand Conformation Polymorphism
- SSCP Single-Strand Conformation Polymorphism
- PCR-SSCP A simple and sensitive method for detection of mutations in the genomic DNA. PCR Meth Appl 1, 34-38), and is based on the observation that single-strand nucleic acids can take on characteristic conformations under non-denaturing conditions, and these conformations influence electrophoretic mobility. The complementary strands assume sufficiently different structures that one strand may be resolved from the other.
- the SSCP process involves denaturing a DNA segment (e.g., a PCR product) that is labeled on both strands, followed by slow electrophoretic separation in a non- denaturing polyacrylamide gel to allow intra-molecular interactions to form without disturbance during the run.
- a DNA segment e.g., a PCR product
- This technique is extremely sensitive to variations in gel composition and temperature.
- a serious limitation of this method is the relative difficulty encountered in comparing data generated in different laboratories, under apparently similar conditions.
- Dideoxy fingerprinting (ddF) - Dideoxy fingerprinting (ddF) is another technique developed to scan genes for the presence of mutations (Liu, Q. and Sommer, S. S. (1994). Parameters affecting the sensitivities of dideoxy fingerprinting and SSCP. PCR Methods Appl 4, 97-108).
- the ddF technique combines components of Sanger dideoxy sequencing with SSCP. First, a dideoxy sequencing reaction is performed using one dideoxy terminator. Next, the reaction products are electrophoresed on non- denaturing polyacrylamide gels to detect alterations in mobility of the termination segments, as in SSCP analysis.
- ddF is an improvement over SSCP in terms of increased sensitivity
- ddF requires the use of expensive dideoxynucleotides and the technique is still limited to the analysis of fragments of the size suitable for SSCP (i.e., fragments of 200-300 bases) for optimal detection of mutations.
- PyrosequencingTM analysis This technique (Pyrosequencing, Inc., Westborough, Massachusetts, USA) is based on the hybridization of a sequencing primer to a single-stranded, PCR-amplified DNA template in the presence of DNA polymerase, ATP sulfurylase, luciferase, and apyrase enzymes and the adenosine 5'- phosphosulfate (APS) and luciferin substrates.
- dNTP deoxynucleotide triphosphates
- the DNA polymerase catalyzes the incorporation of the deoxynucleotide triphosphate into the DNA strand, if it is complementary to the base in the template strand.
- Each incorporation event is accompanied by release of pyrophosphate (PPi) in a quantity equimolar to the amount of incorporated nucleotide.
- PPi pyrophosphate
- the ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5'- phosphosulfate.
- the ATP drives the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP.
- the light produced in the luciferase-catalyzed reaction is detected by a charge-coupled device (CCD) camera and seen as a peak in a pyrogramTM. The strength of each light signal is proportional to the number of nucleotides incorporated.
- CCD charge-coupled device
- AcycloprimeTM analysis is based on fluorescent polarization (FP) detection. Following PCR amplification of the sequence containing the SNP of interest, excess primer and dNTPs are removed through incubation with shrimp alkaline phosphatase (SAP) and exonuclease I. Once the enzymes are heat-inactivated, the Acycloprime-FP process uses a thermostable polymerase to add one of two fluorescent terminators to a primer that ends immediately upstream of the SNP site. The terminator(s) added are identified by their increased FP and represent the allele(s) present in the original DNA sample.
- SAP shrimp alkaline phosphatase
- the Acycloprime process uses AcycloPolTM, a novel mutant thermostable polymerase from the domain Archaea, and a pair of AcycloTerminatorsTM labeled with RIlO and TAMRA, representing the possible alleles for the SNP of interest.
- AcycloTerminator non-nucleotide analogues are biologically active with a variety of DNA polymerases. Similarly to 2',3'-dideoxynucleotide-5'-triphosphates, the acyclic analogues function as chain terminators.
- the analogue is incorporated by the DNA polymerase in a base- specific manner onto the 3 '-end of the DNA chain; since there is no 3'-hydroxyl, the polymerase is unable to function in further chain elongation. It has been found that AcycloPol has a higher affinity and specificity for derivatized AcycloTerminators than various Taq mutants have for derivatized 2',3'-dideoxynucleotide te ⁇ ninators.
- Reverse dot-blot - This technique uses labeled sequence-specific oligonucleotide probes and unlabeled nucleic acid samples. Activated primary amine- conjugated oligonucleotides are covalently attached to carboxylated nylon membranes. After hybridization and washing, the labeled probe or a labeled fragment of the probe can be released using oligomer restriction, i.e., the digestion of the duplex hybrid with a restriction enzyme.
- Circular spots or lines are visualized colorimetrically after incubation with streptavidin horseradish peroxidase, followed by development using tetramethylbenzidine and hydrogen peroxide, or alternatively via chemiluminescence after incubation with avidin alkaline phosphatase conjugate and a luminous substrate susceptible to enzyme activation, such as CSPD, followed by exposure to x-ray film.
- DASH dynamic allele-specific hybridization
- MADGE microplate array diagonal gel electrophoresis
- Biotechniques 19, 830-835 the TaqMan® system (Holland, P. M. et al. (1991).
- sequence alterations e.g., the VaI/ Ala at position 57 of the CD24 polypeptide set forth in SEQ ID NO:2, the Ile/Lys at position 1307 of the APC polypeptide set forth in SEQ ID NO: 8 and/or the Glu/Gln at position 1317 of the APC polypeptide set forth in SEQ ID NO: 8 can also be determined at the protein level.
- proteins are extracted from a sample of any source of cells or cell content of the subject (as described hereinabove) and the presence of the specific polymorphs of the CD24 and APC proteins is detected. While chromatography and electrophoretic methods are preferably used to detect large variations in CD24 molecular weight, such as detection of a truncated CD24 or APC protein generated by the CD24 or APC sequence alterations, immunodetection assays such as ELISA and Western blot analysis, immunohistochemistry, and the like, which may be effected using antibodies specific to CD24 or APC sequence alterations, are preferably used to detect point mutations and subtle changes in molecular weight.
- the present invention also envisages the use of serum immunoglobulins, polyclonal antibodies or fragments thereof (i.e., immunoreactive derivatives thereof), monoclonal antibodies or fragments thereof having at least a portion of an antigen- binding region, including the fragments described hereinbelow, chimeric or humanized antibodies, and complementarity-determining regions (CDR) for detection of sequence alterations in the protein level (e.g., the VaI/ Ala polymorphisms at position 57 of the CD24 polypeptide set forth by SEQ ID NO:2; and/or the Ile/Lys at position 1307 of the APC polypeptide set forth in SEQ ID NO:8; and/or the Gki/Gln at position 1317 of the APC polypeptide set forth in SEQ ID NO:8).
- sequence alterations in the protein level e.g., the VaI/ Ala polymorphisms at position 57 of the CD24 polypeptide set forth by SEQ ID NO:2; and/or the Ile/
- the reagents described hereinabove for detection of immunocomplex formation e.g., for determining CD24 presence and/or level in a biological sample
- hybridization when oligonucleotides are used e.g., for determining the of a specific CD24 (e.g., the thymidine nucleotide at position 280 of SEQ ID No:l) or APC (e.g., the adenosine nucleotide at position 3977 of SEQ ID NO:7 and/or the cytosine nucleotide at position 4006 of SEQ ID NO:7) genotype of a subject]
- a diagnostic kit/article of manufacture preferably along with appropriate instructions for use and labels indicating FDA approval for use in diagnosing cancer or a pre- malignant lesion, for monitoring efficacy of cancer therapy and/or for determining the predisposition of a subject to gastrointestinal cancer.
- kit can include, for example, at least one container including at least one of the above described diagnostic agents (e.g., a CD24 specific antibody, a CD24 oligonucleotide capable of hybridizing a specific CD24 polymorph) and an imaging reagent packed in another container (e.g., enzymes, secondary antibodies, buffers, chromogenic substrates, fluorogenic material).
- diagnostic agents e.g., a CD24 specific antibody, a CD24 oligonucleotide capable of hybridizing a specific CD24 polymorph
- an imaging reagent packed in another container e.g., enzymes, secondary antibodies, buffers, chromogenic substrates, fluorogenic material.
- the kit may also include appropriate buffers and preservatives for improving the shelf-life of the kit.
- the term "about” refers to ⁇ 10 %.
- microarrays Differential gene expression analysis, using microarrays, provides a comprehensive profile of the relative mRNA levels, thus providing new insight into the various biologic pathways involved in disease pathogenesis, progression, and response to therapy. This technique emerges as a valuable potential tool for classifying histologically similar tumors into molecularly specific subtypes, which may predict clinical outcome in individual patients. Microarray technology has been applied successfully in the study of many malignancies, including CRC (12-16).
- the present inventors have transfected normal enterocytes with a variety of oncogens and evaluated the gene expression pattern of the transformed cells before and after the exposure to Celecoxib (Pfizer, NY, USA), a specific COX-2 inhibitor, using the rat Affymetrix expression array, as follows.
- This cell line-based system is much more coherent and useful when one wishes to apply the new technique of expression micro-array, because it consists only of normal and malignant cells and is devoid of inflammatory, necrotic and stromal cells that might obstruct and mask the true effect of the malignant transformation.
- CD24 is upregulated in intestinal cells transformed with Ras mutants and its expression level is reversed following treatment with Celecoxib -
- RNA extracted from intestinal cell lines transformed with various oncogenes was subjected to analysis using the rat expression arrays [Affymetrix rat (RG-U34) Genechip ® ].
- differential gene expression was analyzed to compare IEC- 18 and Rl cells [Sutter T, Miyake M, Kahn SM, Venkatraj VS, Sobrino A, Warburton D, Holt PR, Weinstein IB. Increased expression of cyclin Dl and the Rb tumor suppressor gene in c-K-ras transformed rat enterocytes.
- CD24 is the gene encoding for CD24 (GenBank Accession No. NM_013230; SEQ ID NO:!).
- EXAMPLE 2 CD24 IS OVEREXPRESSEDATEARLYEVENTS OF CRC CARCINOGENESIS
- Immunohistochemical analysis was performed with an avidin-biotin complex immunoperoxidase technique (Umansky M., Rattan J., et al., Oncogene 2001; 20: 7987-7991).
- Four-micrometer tissue sections were mounted on poly-L-lysine-coated slides. After deparaffinization in Americlear (Baxter, McGaw Parl, IL) and absolute ethanol, sections were hydrated through a series of graded alcohol, distilled water, and phosphate-buffered saline (PBS) at pH 7.4. Slides were then immersed in 10 mM citrate buffer (pH 6) and microwaved at 750 W for a total of 10 minutes.
- PBS phosphate-buffered saline
- CD24 is over-expressed in various adenomas and carcinomas of the colon, rectum and entire GI tract -
- Table 1 hereinbelow, the immunohistochemical analysis validated the array results related to the over- expression of this gene (CD24) in respect to the cellular protein milieu, as well as the projection of the results obtained from the rat model onto human CRC tissues.
- CD24 expression was determined in 398 samples spanning the entire GI tract (benign and malignant), 66 of them were CRC samples.
- membrane staining was positive in only 9 out of 54 (16.6 %) normal appearing mucosa, adjacent to CRC samples. Positive membrane staining was not related to the gender or age of the patient, neither to the size or degree of dysplasia in adenomatous polyps (data not shown). In addition, positive membrane staining was seen in 77.9 % of the pre-malignant adenomas of the entire GI tract and in 71.2 % of the carcinomas of the entire GI tract (Table 1).
- Table 1 398 normal and tumor specimens obtained from normal adjacent mucosa and tumors of the entire GI tract (esophagus, stomach, pancreas, small and large bowel) were stained for CD24 using monoclonal anti-CD24 antibodies (Ab-2, clone 24C02; Neomarkers, Fremont, CA) and the staining of the membrane was recorded according to an intensity score on a scale of 0, 1, 2, and 3 of increasing intensity. Shown are the frequencies of positive membrane staining (of an intensity score higher than "1") in normal tissue, adenomas (pre-malignant lesions) and carcinomas of the entire GI tract (including the colon and rectum) as well as in the colon and rectum as a separate group.
- CD24 was expressed to the same extent in adenomas (the pre- malignant stage of a carcinoma) as well as in all stages of CRC or the entire GI tract carcinomas indicates that expression of CD24 is an early event in the multi-step process of CRC carcinogenesis.
- adenomatous polyp suggests the use of CD24 as an early marker carcinogenic processes of the entire GI tract.
- the APC gene [protein - GenBank Accession No. NP 000029.2 (SEQ ID NO:8), mRNA - GenBank Accession No. NM_000038.3 (SEQ ID NO:7)] encodes a tumor suppressor protein, and is widely mutated as a first event in the carcinogenesis process of the colon and rectum. Laken et al (Laken SJ, Petersen GM, Gruber SB, Oddoux, Vogelstein B. Familial colorectal cancer in Ashkenazim due to a hypermutable tract in APC.
- E1317Q polymorphism in the APC protein does not have a known functional or phenotypic effect but it causes a mismatch repair activity and is related to higher risk for colorectal neoplasia.
- Genomic DNA was extracted from peripheral blood lymphocytes. About 200 ng DNA were taken for real-time PCR reaction (for the APC SNPs) or RFLP analysis (for the CD24 SNP), as follows.
- the DNA encoding the Val-57 polymorph is digested by BstXL to about 320 and 200 bp and the DNA encoding the Ala-57 polymorph is undigested by BstXI and thus is of 520 bp.
- the I1307K polymorphism is a substitution of isoleucine (I) (common allele) with lysine (K) (rare allele) at position 1307 of GenBank Accession No. NP_000029.2; SEQ ID NO:8; which results from the T ⁇ A substitution at nucleotide 3977 of NM_000038.3; SEQ ID NO:7.
- genomic DNA was PCR amplified using the following primers: Forward 5' - GATTCTGCTAAT ACCCTGC AAAT AGC A-3' (SEQ ID NO:5) and reverse 5 1 - CCCTGC AGTCTGCTGGATTTGG-3' (SEQ ID NO:6) primers.
- a sensor primer is designed according to the wild-type allele and downstream to it an anchor primer. Light reaction changes according to the temperature in which the sensor binds to the DNA and meets the anchor; the temperature is elevated with time and the time of reaction is measured.
- the anchor primer was: LC-Red640-
- TTTGCAGGGTATTAGCAGAATCTGCTTCCTGTG— ph SEQ ID NO:9
- sensor primer was: CCAATCTTTTCTTTTTTTTCT— FL (SEQ ID NO:10).
- the E1317Q polymorphism is a substitution of Glutamic acid (E) (common allele) with Glutamine (Q) (rare allele) at position 1317 of GenBank Accession No. NP_000029.2; SEQ ID NO:8; which results from the G ⁇ C substitution at nucleotide 4006 of NM_000038.3; SEQ ID NO:7.
- genomic DNA was PCR amplified using the following primers: Forward 5 1 - GATTCTGCTAAT ACCCTGC AA ATAGC A-3' (SEQ ID NO:5) and reverse 5' - CCCTGC AGTCTGCTGGATTTGG-3 ' (SEQ ID NO:6) primers and detection of the specific polymorphic nucleotide (G/C at position 4006 of SQ ID NO:7) was by real time PCR using the anchor primer: TGCTGTGACACTGCTGGAACTTCGC - FL (SEQ ID NO: 11) and sensor primer: ph-LC-Red705-CACAGGATCTTGAGCTGACCTAG (SEQ ID NO: 12).
- CD 24 expression is depended on the CD24 genotype at position 57 (Ala/Val 57) - Using the CD24 RFLP test the present inventors have found that HT29 cells, that express high level of the CD24 protein, exhibit the CD24 v/v (VaWaI at position 57 of the CD24 protein) genotype whereas, Panel cells and HCTl 16 cells that barely express the protein carry the CD24 a/a (Ala/Ala at position 57 of the CD24 protein) genotype. These results suggest that over-expression of the CD24 protein is associated with the Val-57 polymorph of CD24 protein. Still the majority of CD24 bearing CRC will not have the a/a genotype.
- Figure 4 depicts an example of the genotype analysis performed using restriction fragment length polymorphism (RFLP) of the Ala57Val polymorphism of the CD24 gene using the BsfXI restriction enzyme.
- RFLP restriction fragment length polymorphism
- Val-57 polymorph is associated with increased risk to CRC carcinogenesis -
- Combined genotypes in CD24 and APC genes are highly associated with increased risk to colorectal neoplasia or cancer -
- 375 subjects with AJ V genotype (at position 57) of the CD24 protein were tested for the presence of the E1317Q polymorphism in the APC protein.
- 7 out of 375 subjects were positive for the El 317Q polymorphism (i.e., exhibited one allele of the 1317Q polymorph in the APC protein).
- CD24 was significantly over- expressed in pre-malignant tumors of the GI tract, such as colorectal adenomatous polyps and adenomatous polyps of the entire GI tract.
- results suggest that CD24 expression may precede the conversion of the pre-malignant adenoma to a malignant adenocarcinoma.
- CD24 is expressed on the cell surface and conjugated via a GPI anchor, the present inventors have hypothesized that CD24 which is shedded or found in membrane residues from cell blebbing or death may be detected in various biological samples derived from subjects having pre-malignant tumors, and its detection may serve as an early marker of GI tract carcinogenesis.
- IP Immunoprecipitation
- A6531 (20 ⁇ l) were incubated for 1 hour with ⁇ 2-5 ⁇ g of the monoclonal anti-CD24 antibody (SWAl 1), and aliquots of the beads-antibody complex (20 ⁇ l) were then mixed with the lysed serum samples and incubated over-night in a cold-room while rotating.
- SWAl 1 monoclonal anti-CD24 antibody
- the resulting beads-immuno complexes which included the CD24 protein of the serum samples were collected (by short centrifugation) and washed 6 times with Hepes-saline buffer (20 mM HEPES, 150 mM NaCl, 0.1 % Triton and 10 % Glycerol), and then the CD24-immunoprecipitates were eluted by 4 X protein sample buffer (200 mM Tris-HCl pH 6.8, 40 % glycerol, 8 % SDS, 0.2 % Bromophenol blue, 100 mM DTT) at 90-95 °C (5 minutes) followed by short centrifugation to separate the beads from the CD24 protein and the anti-CD24 antibody.
- Hepes-saline buffer 20 mM HEPES, 150 mM NaCl, 0.1 % Triton and 10 % Glycerol
- the eluates were then subjected to Western blot analysis using the SWAl 1 anti-CD24 antibody.
- serum samples were incubated with lysis buffer or PBS (as described hereinabove) and immuiioprecipitation was performed with beads conjugated to Concavalin A, which binds to glycosilated proteins.
- the beads- immunocomplexes were then separated from the sample (by short centrifugation), followed by elution at 90-95 °C.
- the eluants (containing the CD24 protein) were then subjected to SDS-PAGE followed by Western blot analysis with the SWAl 1 CD24 antibody.
- Western blot analysis was performed on cell lysates prepared using the following lysis buffer: 20 mM Tris-HCl, pH 7.4, 2 niM EDTA, 1 % NP40, 0.1 % SDS, or in the presence of PBS using the SWIl antibody similarly to the Western blot performed following IP analysis. Briefly, the amount of protein in the cell extracts is determined (e.g., using the Bradford assay) and 16 ⁇ g of total protein is loaded in each well.
- CD24 IP analysis in serum samples In order to determine if the over- expression of CD24 in GI tumors (pre-malignant and malignant) is associated with the presence of CD24 in the serum, samples of serum from patients whose tumor biopsies were formerly positively stained by CD24 IHC were subjected to IP analysis using CD24 monoclonal antibodies or conconavalin A conjugated beads (conconavalin A binds glycosilated proteins). Briefly, serum samples (0.5 ml) were incubated over- night with precipitating beads which were prepared by pre-incubation of anti-mouse conjugated Sepharose beads (Sigma, Israel) with the SWAl 1 anti-CD24 monoclonal antibody.
- CD24 was also purified from serum sample of a patient with active CRC by anion exchange chromatography using a DEAE-cellulose (DE52) minicolumn and albumin depletion, followed by Western blot analysis with the SWAl 1 monoclonal anti CD24 antibody (Figure 5).
- CD24 Western blot analysis in stool and urine samples Over 90 samples of stool and urine from CRC patients and healthy subjects, attendees at the Integrated Cancer Prevention Center (Sorasky Medical Center, Tel Aviv, Israel) were collected and stored at - 80 0 C. All subjects signed informed consent under the approval of the hospital IRB and the ministry of health, and matching endoscopic reports were recorded. In order to analyze CD24 presence in stool samples, a small amount (0.3- 0.5 ml) was snapped from the frozen sample and homogenized in 1 ml protein lysis buffer with protease inhibitors. Lysates were collected from the supernatant phase following centrifugation of the homogenate (20 minutes, 14,000 rpm). In 21/26 subjects who underwent colonoscopic examination and diagnosed with benign or malignant tumors CD24 was found in the stool (data not shown).
- stool samples were collected from 11 patients before and after surgical/endoscopical removal of the tumor. Differences in the CD24 expression levels were visible among the paired samples ( Figures 2a-c; and data not shown from a repeated experiment), demonstrating that the presence of CD24 in the stool originates at least in part from the tumors.
- the level of CD24 in the stool decreases following radiation therapy -
- the level of CD24 was detected in CRC patients following the surgical removal of the tumor but before or after radiation therapy.
- Figure 2b shows that a significant decrease in the level of CD24 was noted after radiation therapy as compared to before treatment.
- CD24 is expressed on the membrane of a distinctively high percentage of cells of pre-malignant and malignant tumors of the GI tract, including adenomas of the colon/rectum and of the rest of the alimentary tract (small intestine and upper GI tract).
- adenomas of the colon/rectum and of the rest of the alimentary tract small intestine and upper GI tract.
- the present inventors suggest CD24 as a novel highly reliable biomarker for cancer cells.
- CD24 in biological samples such as serum , stool and urine in subjects having pre-malignant or malignant lesions of the GI tract demonstrate, for the first time, that soluble, shedded or blebbed CD24 (circulating CD24) can be used in the diagnosis of pre-malignant and malignant lesions.
- CD24 is a short peptide, that is set on the outer side of the cells and has no transmembrane domain but only an anchor to GPI, it is likely to believe that a portion of the protein, which as is shown in-vitro, is produced excessively when is expressed, is constantly secreted from the tumor cells and reaches the bloodstream or cleaved by lipases at the extra-cellular matrix. Furthermore, necrotic tumor cells, their fragments or blebbing products of tumor cells, might reach the bloodstream as well and contain in them GPI anchored CD24 protein.
- CD24 which is shedded from cells overexpressing CD24 (e.g., the pre-malignant adenomas cells or the malignant CRC tumor cells) can be detected by IP followed by Western blot analysis in serum samples.
- CD24 can be also traced in phases of bigger non-dissolved materials (vesicles and cell fragments) that are separated from their medium by ultra-centrifugation or sucrose gradient separation.
- CD24 is anchored to the membrane and therefore might be present at the blood stream while is still integrated in membrane fragments or vesicles that are the product of cell blabbing, these large corpuses are concentrated as mentioned due to their high weight and, membranes are dissolved by lysis buffer, and IP is performed as described.
- antibodies to the protein might also be present in the sera of subjects who express high levels of CD24. Their presence might be detectable using ELISA methodology with plates, coated with the purified protein or fixed with cells that express high CD24 levels.
- HT29 cells that express high levels of CD24 are fixed to a 96 wells plate with 5 % formaldehyde.
- Serum is added to the well for 2 hours incubation, after three washes, an anti-Human HRP antibody is added to the wells, washed five times, and a color reaction is performed by adding a substrate to the HRP for five minutes [3,3',5,5'-Tetramethylbenzidine (TMB), Sigma]. Reaction is stopped with sulfuric-acid and the color intensity (that stands for the amount of anti-CD24 antibody in the serum) is measured by an ELISA reader device at 450nm.
- CD24 DNA that might be shed from the tumor cells to the blood-stream can be detected by performing RT PCR from peripheral blood. Mutations and polymorphisms that are searched for can be thus detected, and also by quantitative PCR reactions, amplifications in the CD24 genes that occur within the tumor cells can be seen.
- the methods for detecting CD24 at the serum of subjects can be applied for all tumors which were previously reported to have a tendency to over-express CD24. This includes all the following tumors, as well as their pre-malignant lesions, and other tumors that will be discovered in the future to over-express CD24. Most kinds of lymphomas over-express CD24, it was so far reported in: acute leukemia, Waldeyer's ring lymphomas, common acute lymphoblastic leukemia, non-Hodgkin lymphoma, hairy cell leukemia.
- solid tumors express CD24 such as: clear cell sarcoma, nephroblastoma, renal cell carcinoma, adult mesoblastic nephroma, small-cell and non small-cell lung carcinoma, neuroblastoma, ganalioblastoma, sarcoma, squamous cell carcinoma, gastic and colorectal carcinoma, nasopharyngeal carcinoma, bladder cancer, breast cancer, glioma, ovarian cancer, prostate cancer, neuroendocrine prostate cancer, Merkel cell carcinoma and pancreatic cancer among others.
- CD24 such as: clear cell sarcoma, nephroblastoma, renal cell carcinoma, adult mesoblastic nephroma, small-cell and non small-cell lung carcinoma, neuroblastoma, ganalioblastoma, sarcoma, squamous cell carcinoma, gastic and colorectal carcinoma, nasopharyngeal carcinoma, bladder cancer, breast cancer, glioma,
- Aigner S., Sthoeger, Z. M., Fogel, M., Weber, E., Zarn, J., Ruppert, M., Zeller, Y., Vestweber, D., Stahel, R., Sammar, M., and Altevogt, P. CD24, a mucin- type glycoprotein, is a ligand for P-selectin on human tumor cells. Blood, 1997,89: 3385-3395.
- the metastasis-associated gene CD24 is regulated by RaI GTPase and is a mediator of cell proliferation and survival in human cancer. Cancer Res. 2006; 66:1917-22.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Hospice & Palliative Care (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/223,315 US9394569B2 (en) | 2006-01-31 | 2007-01-31 | Methods and kits for early detection of cancer or predisposition thereto |
| JP2008552953A JP5091163B2 (ja) | 2006-01-31 | 2007-01-31 | 癌またはその素因の早期検出のための方法およびキット |
| DK07706065.5T DK1994410T3 (da) | 2006-01-31 | 2007-01-31 | Fremgangsmåder og kits til tidlig påvisning af cancer eller disposition derfor |
| EP07706065A EP1994410B1 (en) | 2006-01-31 | 2007-01-31 | Methods for early detection of cancer |
| DE602007010108T DE602007010108D1 (https=) | 2006-01-31 | 2007-01-31 | |
| PL07706065T PL1994410T3 (pl) | 2006-01-31 | 2007-01-31 | Sposoby wczesnego wykrywania raka |
| SI200730466T SI1994410T1 (sl) | 2006-01-31 | 2007-01-31 | Metode in kompleti za zgodnje odkrivanje raka ali predispozicije zanj |
| AT07706065T ATE486285T1 (de) | 2006-01-31 | 2007-01-31 | Verfahren zur früherkennung von krebs |
| IL193097A IL193097A (en) | 2006-01-31 | 2008-07-28 | Methods for early detection of gastrointestinal tract cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US76337806P | 2006-01-31 | 2006-01-31 | |
| US60/763,378 | 2006-01-31 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007088537A2 true WO2007088537A2 (en) | 2007-08-09 |
| WO2007088537A3 WO2007088537A3 (en) | 2007-10-25 |
Family
ID=38001788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2007/000122 Ceased WO2007088537A2 (en) | 2006-01-31 | 2007-01-31 | Methods and kits for early detection of cancer or predisposition thereto |
Country Status (12)
| Country | Link |
|---|---|
| US (1) | US9394569B2 (https=) |
| EP (1) | EP1994410B1 (https=) |
| JP (1) | JP5091163B2 (https=) |
| AT (1) | ATE486285T1 (https=) |
| DE (1) | DE602007010108D1 (https=) |
| DK (1) | DK1994410T3 (https=) |
| ES (1) | ES2355388T3 (https=) |
| IL (1) | IL193097A (https=) |
| PL (1) | PL1994410T3 (https=) |
| PT (1) | PT1994410E (https=) |
| SI (1) | SI1994410T1 (https=) |
| WO (1) | WO2007088537A2 (https=) |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009074988A1 (en) * | 2007-12-10 | 2009-06-18 | Medical Research Fund Of Tel Aviv Sourasky Medical Center | Methods of diagnosing cancer |
| US7897356B2 (en) | 2008-11-12 | 2011-03-01 | Caris Life Sciences | Methods and systems of using exosomes for determining phenotypes |
| WO2011088226A2 (en) | 2010-01-13 | 2011-07-21 | Caris Life Sciences Luxembourg Holdings | Detection of gastrointestinal disorders |
| WO2011143779A1 (en) | 2010-05-21 | 2011-11-24 | The Governors Of The University Of Alberta | Methods for the assessment of colorectal cancer and colorectal polyps by measurement of metabolites in urine |
| US9128101B2 (en) | 2010-03-01 | 2015-09-08 | Caris Life Sciences Switzerland Holdings Gmbh | Biomarkers for theranostics |
| US9394569B2 (en) | 2006-01-31 | 2016-07-19 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Methods and kits for early detection of cancer or predisposition thereto |
| US9469876B2 (en) | 2010-04-06 | 2016-10-18 | Caris Life Sciences Switzerland Holdings Gmbh | Circulating biomarkers for metastatic prostate cancer |
| WO2018216006A1 (en) | 2017-05-21 | 2018-11-29 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Combination of markers for diagnosing cancer |
| EP3447154A1 (en) * | 2017-08-23 | 2019-02-27 | Instytut Genetyki Sadowej Jolanta Powierska - Czarny | Method for detection of mutations, polymorphisms and specific dna sequences on dna matrices with dna imaging techniques for the use in medical diagnostics and forensic genetics |
| WO2019167047A1 (en) | 2018-02-28 | 2019-09-06 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Methods of diagnosing and treating bladder cancer |
| CN110777213A (zh) * | 2019-11-05 | 2020-02-11 | 武汉科技大学 | 一种潜伏期胃癌诊断试剂盒 |
| WO2020113237A1 (en) | 2018-11-30 | 2020-06-04 | Caris Mpi, Inc. | Next-generation molecular profiling |
| US11840720B2 (en) | 2019-12-23 | 2023-12-12 | Metabolomic Technologies Inc. | Urinary metabolomic biomarkers for detecting colorectal cancer and polyps |
| US11842805B2 (en) | 2019-12-02 | 2023-12-12 | Caris Mpi, Inc. | Pan-cancer platinum response predictor |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2358912B1 (en) * | 2008-10-30 | 2016-10-12 | Caris Life Sciences Switzerland Holdings GmbH | Methods for assessing rna patterns |
| EP3052651B1 (en) | 2013-10-01 | 2019-11-27 | Life Technologies Corporation | Systems and methods for detecting structural variants |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH07500411A (ja) * | 1991-02-05 | 1995-01-12 | ファロク セィディ | 癌胎児性抗原を検出するための簡易検査法 |
| US5741650A (en) * | 1996-01-30 | 1998-04-21 | Exact Laboratories, Inc. | Methods for detecting colon cancer from stool samples |
| US7081516B2 (en) * | 2002-08-26 | 2006-07-25 | Case Western Reserve University | Methods for categorizing patients |
| EP1497642A2 (en) * | 2002-03-19 | 2005-01-19 | Tularik, Inc. | Gene amplification in cancer |
| US20040097448A1 (en) * | 2002-11-19 | 2004-05-20 | Isis Pharmaceuticals Inc. | Modulation of CD24 expression |
| WO2005024603A2 (en) * | 2003-09-10 | 2005-03-17 | The Board Of Regents Of The University Of Texas System | Methods for detecting, diagnosing and treating human renal cell carcinoma |
| CA2549913A1 (en) * | 2003-11-26 | 2005-06-16 | The Ohio State University Research Foundation | Polymorphic cd24 genotypes that are predictive of multiple sclerosis risk and progression |
| CA2453198A1 (en) * | 2004-01-07 | 2005-07-07 | Wei-Ping Min | Quantification and generation of immune suppressive exosomes |
| US7666583B2 (en) * | 2004-02-19 | 2010-02-23 | Yale University | Identification of cancer protein biomarkers using proteomic techniques |
| ATE486285T1 (de) | 2006-01-31 | 2010-11-15 | Medical Res Fund Of Tel Aviv S | Verfahren zur früherkennung von krebs |
-
2007
- 2007-01-31 AT AT07706065T patent/ATE486285T1/de active
- 2007-01-31 SI SI200730466T patent/SI1994410T1/sl unknown
- 2007-01-31 PT PT07706065T patent/PT1994410E/pt unknown
- 2007-01-31 JP JP2008552953A patent/JP5091163B2/ja not_active Expired - Fee Related
- 2007-01-31 WO PCT/IL2007/000122 patent/WO2007088537A2/en not_active Ceased
- 2007-01-31 DK DK07706065.5T patent/DK1994410T3/da active
- 2007-01-31 US US12/223,315 patent/US9394569B2/en not_active Expired - Fee Related
- 2007-01-31 ES ES07706065T patent/ES2355388T3/es active Active
- 2007-01-31 EP EP07706065A patent/EP1994410B1/en not_active Not-in-force
- 2007-01-31 DE DE602007010108T patent/DE602007010108D1/de active Active
- 2007-01-31 PL PL07706065T patent/PL1994410T3/pl unknown
-
2008
- 2008-07-28 IL IL193097A patent/IL193097A/en not_active IP Right Cessation
Cited By (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9394569B2 (en) | 2006-01-31 | 2016-07-19 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Methods and kits for early detection of cancer or predisposition thereto |
| US9034587B2 (en) | 2007-12-10 | 2015-05-19 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Methods of diagnosing cancer |
| WO2009074988A1 (en) * | 2007-12-10 | 2009-06-18 | Medical Research Fund Of Tel Aviv Sourasky Medical Center | Methods of diagnosing cancer |
| US7897356B2 (en) | 2008-11-12 | 2011-03-01 | Caris Life Sciences | Methods and systems of using exosomes for determining phenotypes |
| WO2011088226A2 (en) | 2010-01-13 | 2011-07-21 | Caris Life Sciences Luxembourg Holdings | Detection of gastrointestinal disorders |
| US9128101B2 (en) | 2010-03-01 | 2015-09-08 | Caris Life Sciences Switzerland Holdings Gmbh | Biomarkers for theranostics |
| US9469876B2 (en) | 2010-04-06 | 2016-10-18 | Caris Life Sciences Switzerland Holdings Gmbh | Circulating biomarkers for metastatic prostate cancer |
| US10267800B2 (en) | 2010-05-21 | 2019-04-23 | The Governors Of The University Of Alberta | Methods for the assessment of colorectal cancer and colorectal polyps by measurement of metabolites in urine |
| WO2011143779A1 (en) | 2010-05-21 | 2011-11-24 | The Governors Of The University Of Alberta | Methods for the assessment of colorectal cancer and colorectal polyps by measurement of metabolites in urine |
| EP2572193B1 (en) * | 2010-05-21 | 2017-11-01 | The Governors Of The University Of Alberta | Methods for the assessment of colorectal cancer and colorectal polyps by measurement of metabolites in urine |
| US11385230B2 (en) | 2010-05-21 | 2022-07-12 | The Governors Of The University Of Alberta | Methods for the assessment of colorectal cancer and colorectal polyps by measurement of metabolites in urine |
| EP3652541A4 (en) * | 2017-05-21 | 2021-06-02 | The Medical Research, Infrastructure, And Health Services Fund Of The Tel Aviv Medical Center | COMBINATION OF MARKERS FOR DIAGNOSING CANCER |
| WO2018216006A1 (en) | 2017-05-21 | 2018-11-29 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Combination of markers for diagnosing cancer |
| US11714089B2 (en) | 2017-05-21 | 2023-08-01 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Combination of markers for diagnosing cancer |
| EP3447154A1 (en) * | 2017-08-23 | 2019-02-27 | Instytut Genetyki Sadowej Jolanta Powierska - Czarny | Method for detection of mutations, polymorphisms and specific dna sequences on dna matrices with dna imaging techniques for the use in medical diagnostics and forensic genetics |
| WO2019167047A1 (en) | 2018-02-28 | 2019-09-06 | The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical Center | Methods of diagnosing and treating bladder cancer |
| WO2020113237A1 (en) | 2018-11-30 | 2020-06-04 | Caris Mpi, Inc. | Next-generation molecular profiling |
| US11315673B2 (en) | 2018-11-30 | 2022-04-26 | Caris Mpi, Inc. | Next-generation molecular profiling |
| EP4369356A2 (en) | 2018-11-30 | 2024-05-15 | Caris MPI, Inc. | Next-generation molecular profiling |
| US12165759B2 (en) | 2018-11-30 | 2024-12-10 | Caris Mpi, Inc. | Classifying an entity for FOLFOX treatment |
| CN110777213A (zh) * | 2019-11-05 | 2020-02-11 | 武汉科技大学 | 一种潜伏期胃癌诊断试剂盒 |
| US11842805B2 (en) | 2019-12-02 | 2023-12-12 | Caris Mpi, Inc. | Pan-cancer platinum response predictor |
| US11840720B2 (en) | 2019-12-23 | 2023-12-12 | Metabolomic Technologies Inc. | Urinary metabolomic biomarkers for detecting colorectal cancer and polyps |
Also Published As
| Publication number | Publication date |
|---|---|
| IL193097A0 (en) | 2009-02-11 |
| EP1994410B1 (en) | 2010-10-27 |
| JP5091163B2 (ja) | 2012-12-05 |
| US9394569B2 (en) | 2016-07-19 |
| SI1994410T1 (sl) | 2011-03-31 |
| PL1994410T3 (pl) | 2011-12-30 |
| ES2355388T3 (es) | 2011-03-25 |
| JP2009525041A (ja) | 2009-07-09 |
| DK1994410T3 (da) | 2011-01-31 |
| IL193097A (en) | 2013-03-24 |
| DE602007010108D1 (https=) | 2010-12-09 |
| US20100062450A1 (en) | 2010-03-11 |
| ATE486285T1 (de) | 2010-11-15 |
| WO2007088537A3 (en) | 2007-10-25 |
| EP1994410A2 (en) | 2008-11-26 |
| PT1994410E (pt) | 2011-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9394569B2 (en) | Methods and kits for early detection of cancer or predisposition thereto | |
| AU2016223532B2 (en) | Biomarker panel for the detection of cancer | |
| US11060152B2 (en) | Methods for the surveillance, diagnosis and screening of bladder cancer | |
| DK2456889T3 (en) | Markers of endometrial cancer | |
| CN103834729B (zh) | 肺癌的多基因预后试验 | |
| Gupta et al. | Expanding the spectrum of IDH1 mutations in gliomas | |
| US20110159509A1 (en) | Use of runx3 and mir-532-5p as cancer markers and therapeutic targets | |
| US20120277110A1 (en) | Parp and adjuvant cisplatin-based chemotherapy in non-small-cell lung cancer | |
| JP2022536846A (ja) | 胃癌を診断するための高メチル化遺伝子の検出 | |
| KR101359851B1 (ko) | 간세포암종의 예후 진단용 단일 염기 다형성 | |
| JP7721449B2 (ja) | Fgfrの決定に基づいて試料を分類する方法 | |
| CA2574311A1 (en) | Method of predicting the responsiveness oa a tumor to erbb receptor drugs | |
| Tran et al. | Evaluation of the expression levels of BRAF V600E mRNA in primary tumors of thyroid cancer using an ultrasensitive mutation assay | |
| KR101601943B1 (ko) | 난소암 환자의 항암제 치료 반응성 예측을 위한 마커 uchl1 | |
| AU2007243181A1 (en) | Composition and methods for the detection of Cripto-3 | |
| KR101583673B1 (ko) | 난소암 환자의 항암제 치료 반응성 예측을 위한 마커 dlx5 | |
| US9593380B2 (en) | Compositions and methods for the treatment of prostate carcinoma | |
| KR101601941B1 (ko) | 난소암 환자의 항암제 치료 반응성 예측을 위한 마커 mta3 | |
| KR101601942B1 (ko) | 난소암 환자의 항암제 치료 반응성 예측을 위한 마커 tet1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 193097 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12223315 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008552953 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007706065 Country of ref document: EP |