WO2007080194A2 - Use of tpp ii inhibitors in combination with gamma-irradiation for the treatment of cancer - Google Patents
Use of tpp ii inhibitors in combination with gamma-irradiation for the treatment of cancer Download PDFInfo
- Publication number
- WO2007080194A2 WO2007080194A2 PCT/EP2007/050363 EP2007050363W WO2007080194A2 WO 2007080194 A2 WO2007080194 A2 WO 2007080194A2 EP 2007050363 W EP2007050363 W EP 2007050363W WO 2007080194 A2 WO2007080194 A2 WO 2007080194A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- alkyl
- gamma
- phenyl
- unbranched
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/06—Tripeptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
- A61N2005/1092—Details
- A61N2005/1098—Enhancing the effect of the particle by an injected agent or implanted device
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61N—ELECTROTHERAPY; MAGNETOTHERAPY; RADIATION THERAPY; ULTRASOUND THERAPY
- A61N5/00—Radiation therapy
- A61N5/10—X-ray therapy; Gamma-ray therapy; Particle-irradiation therapy
Definitions
- the present invention relates to the use of compounds in combination with gamma- irradiation for the treatment of cancer.
- apoptosis resistance is the phenomenon that is usually responsible for irradiation therapy-resistance, i.e. the cancer cells fail to die when encountering gamma-irradiation.
- Tumours in cancer patients often respond to treatment initially, only to subsequently acquire resistance to therapy.
- Therapy-resistance of tumour cells is a very common cause for failure of the therapy and death of the patient.
- TPP Il tripeptidyl-peptidase II
- TPP Il tripeptidyl-peptidase II
- TPP Il is built from a unique 138 kDa sub-unit expressed in multi-cellular organisms from Drosophila to Homo Sapiens. Data from Drosophila suggests that the TPP Il complex consists of repeated sub-units forming two twisted strands with a native structure of about 6 MDa.
- TPP Il is the only known cytosolic subtilisin-like serine peptidase.
- Bacterial subtilisins are thoroughly studied enzymes, with numerous reports on crystal structure and enzymatic function (Gupta, R., Beg, Q. K., and Lorenz, P., 2002, "Bacterial alkaline proteases: molecular approaches and industrial applications", Appl Microbiol Biotechnol. 59:15-32).
- the present invention provides a compound for use in enhancing the efficacy of gamma-irradiation cancer therapy or increasing the in vivo gamma- irradiation susceptibility of tumour cells, wherein said compound is a TPP Il inhibitor.
- cancer therapy covers the treatment of a cancerous condition, as well as preventative therapy and the treatment of a pre-cancerous condition.
- tumor cells includes cancerous or pre-cancerous cells. Such cells may have cancerous or pre-cancerous defects. Thus the cells may have acquired one or several alterations characteristic of malignant progression.
- the invention not only allows gamma-irradiation-resistant tumours to be treated, but is also advantageous even with tumours that can be treated with gamma-irradiation, in allowing lower doses of gamma-irradiation to be used
- the present invention provides a compound for use in enhancing the efficacy of gamma-irradiation cancer therapy or increasing the in vivo gamma-irradiation susceptibility of tumour cells, wherein said compound is selected from the following formula ( ⁇ ) or is a pharmaceutically acceptable salt thereof
- a 1 , A 2 and A 3 are amino acid residues having the following definitions according to the standard one-letter abbreviations or names
- a 1 is G, A 1 V, L, I, P, 2-am ⁇ nobuty ⁇ c acid, norvaline or tert-butyl glycine,
- a 2 is G, A, V, L, I, P, F, VV, C, S, K, R, 2-am ⁇ nobutyr ⁇ c acid norvaline, norleucine, tert-butyl alanine, alpha-methyl leucine, 4,5-dehydro-leuc ⁇ ne, allo-isoleucine, alpha- methyl valine, tert-butyl glycine, 2-alIylglyc ⁇ ne, ornithine or alpha, gamma- dianmnobuty ⁇ c acid
- a 3 is G, A, V, L, I, P, F, VV, D, E, Y, 2-am ⁇ nobuty ⁇ c acid, norvaline or tert-butyl glycine,
- R N1 and R N2 are each attached to the N terminus of the peptide, are the same or different, and are each independently
- R N3 and R N4 are the same or different and are hydrogen or any of the following optionally substituted groups: saturated or unsaturated, branched or unbranched C 1 ⁇ 6 alkyl; saturated or unsaturated, branched or unbranched C3- 12 cycloalkyl; benzyl; phenyl; naphthyl; mono- or bicyclic C 1-10 heteroaryl; or non-aromatic C 1 - I0 heterocyclyl;
- R N3 and/or R N4 which may be: hydroxy-; thio-: amino-; carboxylic acid; saturated or unsaturated, branched or unbranched C 1-6 alkyloxy; saturated or unsaturated, branched or unbranched C 3-12 cycloalkyl; N-, O-, or S- acetyl; carboxylic acid saturated or unsaturated, branched or unbranched C 1-6 alkyl ester; carboxylic acid saturated or unsaturated, branched or unbranched C 3-12 cycloalkyl ester phenyl; mono- or bicyclic C 1 ⁇ 10 heteroaryl; non-aromatic C M0 heterocyclyl; or halogen;
- R C1 is attached to the C terminus of the tripeptide, and is:
- R C2 , R C3 and R C4 are the same or different, and are hydrogen or any of the following optionally substituted groups saturated or unsaturated, branched or unbranched C 1 6 alkyl, saturated or unsaturated, branched or unbranched C 3 12 cycloalkyl, benzyl, phenyl, naphthyl, mono- or bicyclic C 1 10 heteroaryl, or non-aromatic C 1 10 heterocyclyl,
- R C2 and/or R C3 and/or R C4 which may be one or more of hydroxy-, thio- amino-, carboxylic acid saturated or unsaturated, branched or unbranched C 1 6 alkyloxy, saturated or unsaturated, branched or unbranched C 3 i2 cycloalkyl
- N-, O-, or S- acetyl carboxylic acid saturated or unsaturated, branched or unbranched C 1 e alky! ester, carboxylic acid saturated or unsaturated, branched or unbranched C 3 12 cycloalkyl ester phenyl, halogen mono- or bicyclic Ci 10 heteroaryl, or non-aromatic C 1 - 0 heterocyclyl
- the invention provides a method of enhancing the efficacy of gamma-irradiation cancer therapy or increasing the in vivo gamma-irradiation susceptibility of tumour cells comprising administering to a patient in need thereof a therapeutically effective amount of a TPPII inhibitor or a compound selected from formula (i) or a pharmaceutically acceptable salt thereof.
- the compound may be administered in combination with gamma-irradiation cancer therapy in order to decrease resistance to said gamma-irradiation cancer therapy.
- the administration of gamma-irradiation, in combination with the compound, is preferably repeated until the tumour is treated, preferably until the tumour disappears.
- the present invention provides the use of a TPPII inhibitor or a compound selected from formula (i) or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for enhancing the efficacy of gamma-irradiation cancer therapy or increasing the in vivo gamma-irradiation susceptibility of tumour cells.
- TPP Il inhibitors are useful in combination with gamma-irradiation in the treatment of cancer.
- the present invention provides a pharmaceutical composition
- a pharmaceutical composition comprising a compound of formula (i) or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable diluent or carrier.
- the present invention provides a compound of formula (i) or a pharmaceutically acceptable salt thereof for use as a medicament.
- the invention provides a method for identifying a compound suitable for enhancing the efficacy of gamma-irradiation cancer therapy or increasing the in vivo gamma-irradiation susceptibility of tumour cells comprising contacting TPP Il with a compound to be screened, and identifying whether the compound inhibits the activity of
- the present invention recognizes an essential role for TPPII in cellular responses to gamma-irradiation. We have observed complete in vivo tumor regression in mice injected with TPPII inhibitors, during treatment even with relatively low doses of gamma-irradiation.
- TPPII controls signal transduction by PIKKs, although several points in the mechanism remain to be clarified TPPIl may have a role, direct or indirect, in the recruitment and/or binding of regulatory factors to DNA repair foci, allowing these factors to interact with and become activated by PIKKs
- TPPII is believed to control the interaction between ATM and p53 following gamma-irradiation ATM, ATR and DNA-PKcs have a certain degree of redundancy in stabilization of p53, with multiple N-termmal sites for p53 phosphorylation and with more than one PIKK targeting the same site (Bode, AM Dong, Z Post- translational modification of p53 in tumo ⁇ genesis Nat Rev Cancer 2004,4 793-805)
- TPP Il accepts a relatively broad range of substrates
- All the compounds falling within formula ( ⁇ ) are peptides or peptide analogues
- Compounds of formulae (i) are readily synthesizable by methods known in the art (see for example Ganellin et al J Med Chem 2000 43 664-674) or are readily commercially available (for example from Bachem AG)
- the compound may be selected from formulae ( ⁇ )
- Such tripeptides and derivatives are particularly effective therapeutic agents
- the compound for use in enhancing the efficacy of gamma- irradiation cancer therapy or increasing the in vivo gamma-irradiation susceptibility of tumour cells may be a compound which is known to be a TPP Il inhibitor in vivo
- the compound may be selected from compounds identified in Winter et al , Journal of Molecular Graphics and Modelling 2005, 23, 409-418 as TPP Il inhibitors
- the compounds may be selected from the following formula (n) because these compounds are particularly suited to the TPP Il pharmacophore
- R' is H, CH 3 , CH 2 CH 3 , CH 2 CH 2 CH 3 or CH(CH 3 ) 2
- R" is H, CH 2 CH 3 , CH 2 CH 2 CH 3 , CH(CH 3 ) 2 CH 2 CH 2 CH 2 CH 3 CH 2 CH(CH 3 ) 2 , CH(CH 3 )CH 2 CH 3 or C(CH 3 ) 3 , and
- R'" is H CH 3 OCH 3 F Cl or Br
- the compound may be selected from compounds identified in US 6 335 360 of Schwartz et al as TPP Il inhibitors
- TPP Il inhibitors Such compounds include those of the following formula (in)
- each R 1 may be the same or different, and is selected from the group consisting of halogen, OH; Ci -C 6 alkyl optionally substituted by one or more radicals selected from the group consisting of halogen and OH; (C 1 -C 6 ) alkenyl optionally substituted by one or more radicals selected from the group consisting of halogen and OH; (C1 -C 6 ) alkynyl, optionally substituted by one or more radicals selected from the group consisting of halogen and OH, X(C 1 -C 6 )alkyl, wherein X is S, O or OCO, and the alkyl is optionally substituted by one or more radicals selected from the group consisting of halogen and OH; SO 2 (C 1 -C 6 )alkyl, optionally substituted by at least one halogen, YSO 3 H, YSO 2 (C 1 -C 6 )alkyl, wherein Y is O or NH and the alky
- n is from O to 4.
- R 2 is CH 2 R 4 , wherein R 4 is C 1 -C 6 alkyl substituted by one or more radicals selected from the group consisting of halogen and OH; (CH 2 ) p Z(CH 2 ) q CH 3 , wherein Z is O or S, p is from O to 5 and q is from O to 5, provided that p+q is from O to 5; (C 2 -C 6 ) unsaturated alkyl; or (C 3 -C 6 ) cycloalkyl:
- R 3 is H; (C 1 -C 6 )alkyl optionally substituted by at least one halogen; (CH 2 ) P ZR 5 wherein p is from 1 to 3, Z is O or S and R 5 is H or (C 1 -C 3 )alkyl; benzyl.
- Compounds of formula (iii) are readily synthesizable by known methods (see for example US 6,335,360 of Schwartz et al.).
- the compound be selected from formulae (i) and (ii), more preferably formula (i).
- a 1 is G, A, V, L, I. P, S, T, C, N, G, 2-aminobutyric acid, norvaline, norleucine, tert- butyl alanine, alpha-methyl leucine, 4,5-dehydro-leucine, allo-isoleucine, alpha- methyl valine, tert-butyl glycine or 2-allylglycine,
- a 2 is G, A, V, L, I, P, S, T, C, N, Q, F, Y, W, K, R, histidine, 2-aminobutyric acid, norvaline, norleucine, tert-buty! alanine, alpha-methyl leucine, 4,5-dehydro-leucine, allo-isoleucine, alpha-methyl valine, tert-butyl glycine, 2-allylglycine, ornithine, alpha, gamma-diaminobutyric acid or 4,5-dehydro-lysine, and
- a 3 is G, A, V, L, I, P. S, T, C, N, Q, D, E, F, Y, VV, 2-aminobutyric acid, norvaline, norleucine, tert-butyl alanine, alpha-methyl leucine, 4,5-dehydro-leucine, allo- isoleucine, alpha-methyl valine, tert-butyl glycine or 2-allylglycine,
- amino acids of natural (L) configuration are preferred, particularly at the A 2 position
- R N1 is hydrogen
- R N2 is:
- R N2 (Iinker1)-R N3 , CO-(linke ⁇ i)-R N3 , or CO-O-(linker1 )-R N3 ,
- linker may be absent, i.e. a single bond, or CH 2 CH 2 CH 2 , CH 2 CH 2 CH 2 ,
- R N3 is hydrogen or any of the following unsubstituted groups: saturated or unsaturated, branched or unbranched C- M alky!; benzyl; phenyl; or monocyclic heteroaryl.
- R C1 is:
- R C2 is hydrogen or any of the following unsubstituted groups: saturated or unsaturated, branched or unbranched C 1 .5 alkyl: benzyl; phenyl; or monocyclic C wo heteroaryl.
- R N1 is hydrogen
- R N1 is hydrogen
- R N1 is hydrogen
- R N2 ⁇ s a is benzyloxycarbonyl, benzyl, benzoyl, tert-butyloxycarbonyl, 9- fluorenylmethoxycarbonyl or FA, more preferably benzyloxycarbonyl or FA
- R C1 is OH, 0-C 1 e alkyi, 0-C 1 6 alkyl-phenyl, NH-C 1 6 alkyl, or NH-C 1 6 alkyl-phenyl, more preferably OH
- a 1 is G, A, V, L, I, P 1 2-am ⁇ nobuty ⁇ c acid, norvaline or tert-butyl glycine
- a 2 is G, A, V, L, I, P, F, W, C, S, K, R, 2-am ⁇ nobutyr ⁇ c acid, norvaline, norleucine, tert-butyl alanine, alpha-methyl leucine, 4,5-dehydro-leuc ⁇ ne, allo-isoleucine, alpha-methyl valine, tert-butyl glycine, 2-allylglyc ⁇ ne, ornithine or alpha, gamma-diaminobutyric acid
- a 3 is G A V, L, I, P, F, VV, D, E, Y, 2-am ⁇ nobuty ⁇ c acid, norvaline or tert-butyl glycine
- R N1 is H,
- a 1 is G, A or 2-am ⁇ nobutyr ⁇ c acid,
- a 2 is L I, norleucine, V, norvaline tert-butyl alanine, 4,5-dehydro-!eucine allo-isoleucine 2- allylglycine, P, 2-am ⁇ nobutyr ⁇ c acid, alpha-methyl leucine, alpha-methyl valine or tert-butyl glycine
- a 3 is G A, V, P 2-am ⁇ nobuty ⁇ c acid or norvaline,
- R N1 is H
- R C1 is OH, 0-C 1 6 alkyl, 0-C 1 6 aikyl-pheny!, NH-C 1 6 alkyl, or NH-C 1 6 alkyl-phenyl
- a 1 is G, A or 2-am ⁇ nobutyric acid,
- a 2 is L, I, norleucine, V, norvaline, tert-butyl alanine, 4,5-dehydro-leuc ⁇ ne, allo-isoleucine or
- a 3 is G, A, V, P, 2-am ⁇ nobutyr ⁇ c acid or norvaline, R N1 is H,
- a 1 is G or A
- a 2 is L, I or norleucine
- a 3 is G or A
- R N1 is H
- a first set of specific preferred compounds are those in which
- a 1 is G
- a 2 is L
- a 3 is G
- a V L I P, F W, D, E, Y, 2-am ⁇ nobuty ⁇ c acid, norvaline or tert-butyl glycine, more preferably G
- a V, P, 2-am ⁇ nobutyr ⁇ c acid or norvaline more preferably G or A
- R N1 is hydrogen
- R N2 is benzyloxycarbonyl
- R C1 is OH
- a second set of specific preferred compounds are those in which: A 1 is G,
- a 2 is G, A, V, L, I, P, F 1 W, C, S, 2-aminobutyric acid, norvaline, norleucine, tert-butyl alanine, alpha-methyl leucine, 4.5-dehydro-leucine, allo-isoleucine. alpha-methyl valine.
- tert-butyl glycine or 2-allylglycine more preferably L, I 1 norleucine, V, norvaline, tert-butyl alanine, 4,5-dehydro-leucine, allo-isoleucine, 2-allylglycine, P, 2-aminobutyric acid, alpha- methyl leucine, alpha-methyl valine or tert-butyl glycine, more preferably L, I. norleucine, V, norvaline, tert-butyl alanine, 4,5-dehydro-leucine, allo-isoleucine or 2-allylglycine, more preferably L, I, or norleucine, A 3 is A,
- R N1 is hydrogen
- R N2 is benzyloxycarbonyl
- R C1 is OH.
- a third set of specific preferred compounds are those in which:
- a 1 is G, A, V, L, I, P, 2-aminobutyric acid, norvaline or tert-butyl glycine, more preferably G,
- a or 2-aminobutyric acid more preferably G or A,
- a 2 is L
- a 3 is A, R N1 is hydrogen,
- R N2 is benzyloxycarbonyl
- R C1 is OH.
- sequence A 1 -A 2 -A 3 is GLA, GLF, GVA, GIA, GPA or ALA.
- GLA GLF, GVA, GIA, GPA or ALA.
- R N1 is hydrogen
- R N2 is benzyloxycarbonyl
- R C1 is OH.
- alkyl groups are described as saturated or unsaturated, this encompasses alkyl, alkenyl and alkynyl hydrocarbon moieties.
- Ci- 6 alkyl is preferably Ci -4 alkyl, more preferably methyl, ethyl, n-propyl, isopropyl, or butyl (branched or unbranched). most preferably methyl.
- C 3 12 cycloalkyl is preferably C 5 10 cycloalkyl, more preferably C 5 7 cycloalkyl
- aryl is an aromatic group, preferably phenyl or naphthyl
- hetero as part of a word means containing one or more heteroatom(s) preferably selected from N, O and S
- heteroaryl is preferably py ⁇ dyl, pyrrolyl, quinolinyl furanyl, thienyl, oxadiazolyl, thiadiazoiyl, thiazolyl, oxazolyl, pyrazolyl, triazolyl tetrazolyl, isoxazolyl, isothiazolyl, imidazolyl, py ⁇ midinyl, indolyl, pyrazinyl, indazolyl, pyrimidinyl, thiophenetyl, pyranyl carbazolyl ac ⁇ dinyl quinolinyl, benzimidazolyl, benzthiazolyl, pu ⁇ nyl, cinnolinyl or pte ⁇ dinyl
- non-aromatic heterocyclyl is preferably pyrrolidinyl, piperidyl, piperazinyl, morpholinyl, tetrahydrofuranyl or monosaccharide
- halogen is preferably Cl or F 1 more preferably Cl
- a 1 may preferably be selected from G, A or 2-aminobutyr ⁇ c acid more preferably G or A
- a 2 may preferably be selected from L, I, norleucine, V, norvaline, tert-butyl alanine, 4,5-dehydro-ieucine, allo-isoleucine 2-ally!glyc ⁇ ne, P, K, 2-am ⁇ nobutyric acid, alpha-methyl leucine, alpha-methyl valine or tert-butyl glycine, more preferably L, I, norleucine, V, norvaline, tert-butyl alanine, 4,5-dehydro-leuc ⁇ ne allo-isoleucine, 2- allylgly ⁇ ne, P or K, more preferably L I, norleucine, P or K more preferably L or P
- a 3 may preferably be selected from G A V P, 2-am ⁇ nobuty ⁇ c acid or norvaline more preferably G or A
- R N1 is hydrogen
- R Nz is preferably R N3 ,
- R N3 is hydrogen or any of the following unsubstituted groups: saturated or unsaturated, branched or unbranched C 1-4 alkyl; benzyl; phenyl; or monocyclic heteroaryl.
- R N2 is more preferably hydrogen, benzyloxycarbonyl, benzyl, benzoyl, tert- butyloxycarbonyl, 9-fluorenylmethoxycarbonyl or FA, more preferably hydrogen, benzyloxycarbonyl or FA.
- R C1 is: O-R C2 ,
- (Iinker2) may be absent, i.e. a single bond, C 1 ⁇ alkyl or C 2 _ 4 alkenyl, preferably a single bond or CH 2 .
- CH 2 CH 2 , CH 2 CH 2 CH 2 , CH 2 CH 2 CH 2 CH 2 or CH CH,
- R C2 is hydrogen or any of the following unsubstituted groups: saturated or unsaturated, branched or unbranched Ci -5 alkyl; benzyl; phenyl; or monocyclic d.io heteroaryl.
- R C1 is more preferably OH, 0-C 1-6 alky!, 0-C 1-6 alkyl-phenyl, NH 2 , NH-C 1-6 alkyl, or NH-Cv 6 alkyl-phenyl, more preferably OH, 0-Ci -6 alkyl, NH 2 . or NH-C 1-6 alkyl, more preferably OH or NH 2 .
- Compounds of particular interest include those wherein A 2 is P.
- Compounds of particular interest include those wherein R C1 is NH 2 .
- a 3 In general the following amino acids are less preferred for A 3 : F, W, D, E and Y. Similarly, in general A 3 may be selected not to be P and/or E due to compounds containing these exhibiting lower activity.
- R' is CH 2 CH 3 or CH 2 CH 2 CH 3
- R" is CH 2 CH 2 CH 3 or CH(CH 3 ) 2
- R'" is H or Cl.
- a therapeutic compound of formula (i) is Z-GLA-OH, i.e. tripeptide GLA which is derivatized at the N-terminus with a Z group and which is not derivatized at the C- terminus.
- Z denotes benzyloxycarbonyl. This is a compound of formula (i) wherein R N1 is
- R N2 is Z
- a 1 is G
- a 2 is L
- a 3 is A
- R C1 is OH.
- This compound is available commercially from Bachem AG and has been found to inhibit the bacterial homologue of the eukaryotic TPP II.
- Z-GLA-OH is of low cost and works well in vivo to induce rejection of tumours that are resistant to therapy with gamma-irradiation. Novel treatments of therapy resistant cancers are of substantial interest to public health.
- any disclosures of any compounds or groups of compounds herein may optionally be subject to the proviso that the sequence A 1 A 2 A 3 is not GLA 1 or the proviso that the compound is not selected from the group consisting of Z-GLA-OH, Bn-GLA-OH 1 FA-GLA-OH or H-GLA-OH 1 or the proviso that the compound is not Z-GLA-OH
- Z- GLA-OH or other compounds described herein may be administered to improve such treatment in patients with malignant disease, for example increasing the in vivo response to such treatment in solid tumours
- a 1 A 2 A 3 is GPG, such as GPG-NH 2 or Z- GPG-NH 2
- the compounds described herein may be administered in any suitable manner
- the administration may be parenteral, such as intravenous or subcutaneous, oral, transdermal, intranasal, by inhalation, or rectal
- the compounds are administered by injection
- Examples of pharmaceutically acceptable addition salts for use in the pharmaceutical compositions of the present invention include those derived from mineral acids, such as hydrochlorid hydrobromic, phosphoric, metaphospho ⁇ c, nitric and sulphuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids
- mineral acids such as hydrochlorid hydrobromic, phosphoric, metaphospho ⁇ c, nitric and sulphuric acids
- organic acids such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids
- the pharmaceutically acceptable excipients described herein, for example, vehicles, adjuvants, carriers or diluents are well-known to those who are skilled in the art and are readily available to the public
- the pharmaceutically acceptable carrier
- composition may be prepared for any route of administration, e g oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, or intraperitoneal
- routes of administration e g oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, or intraperitoneal
- a parenterally acceptable aqueous solution is employed, which is pyrogen free and has requisite pH, isotonicity and stability
- a parenterally acceptable aqueous solution which is pyrogen free and has requisite pH, isotonicity and stability
- suitable solutions e g Langer Science 249 1527-1533 (1990)
- the dose administered to a mammal, particularly a human, in the context of the present invention should be sufficient to effect a therapeutic response in the mammal over a reasonable time frame
- dosage will depend upon a variety of factors including the age, condition and body weight of the patient, as well as the stage/seventy of the disease
- the dose will also be determined by the route (administration form) timing and frequency of administration
- the dosage can vary for example from about 0 01 mg to about 10 g, preferably from about 0 01 mg to about 1000 mg, more preferably from about 10 mg to about 1000 mg per day of a compound or the corresponding amount of a pharmaceutically acceptable salt thereof
- the compounds may be administered before, during or after gamma-irradiation
- TPP Il TPP Il protein may be purified in a first step, and a TPP ll-preferred fluorogenic substrate may be used in a second step This results in an effective method to measure TPP Il activity
- TPP II 100 x 10 6 cells (such as EL-4 cells) were sedimented and lysed by vortexing in glass beads and homogenisation buffer (50 mM T ⁇ s Base pH 7 5, 250 mM Sucrose, 5 mM MgCI 2 , 1 mM DTT) Cellular lysates were subjected to differential centrifugation, first the cellular homogenate was cent ⁇ fuged at 14,000 rpm for 15 mm, and then the supernatant was transferred to ultra-cent ⁇ fugation tubes Next the sample was ultra-cent ⁇ fugated at 100 000 x g for 1 hour, and the supernatant (denoted as cytosol in most biochemical literature) was subjected to 100 000 x g centrifugation for 5 hours which sedimented high molecular weight cytosolic proteins/protein
- the compounds of use in the present invention may be defined as those which result in partial or preferably complete tumour regression compared to control experiments when used in an in vivo model which comprises the steps of (i) inoculation of tumor cells into mice, (n) gamma-irradiation of said mice and administration of compound to said mice, and (HI) measuring the tumour size at periodic intervals
- the gamma-irradiation step is omitted in the control experiments Further details and examples of tumour growth experiments are described below We found it convenient to inject the compound shortly after application of gamma-irradiation treatment, but the invention should not be understood as limited to this sequence of administration
- the compounds used in the present invention result in partial or preferably complete tumour regression in vivo when applied in combination with gamma-irradiation, for example in a method as described herein
- the compounds used in the present invention are sufficiently serum-stable, i e in v>vo they retain their identity long enough to exert the desired therapeutic effect
- FIG. 1 TPPII in growth arrest regulation by gamma-irradiation exposure.
- A Western blotting analysis using anti-TPPH of cellular lysates from EL-4 cells exposed to 1000 Rad of gamma-irradiation in the presence or absence of 1 micro-M wortmannin, with subsequent exposure to wortmannin in the presence of 25 micro-M NLVS (right lanes)
- B TPPII activity (enzymatic cleavage of AAF-AMC top) and expression (by western blotting with anti-TPPII, bottom) as determined by testing high molecular weight cytosolic protein from EL-4 cells stably transfected with either empty pSUPER vector (denoted EL-4 wt empty bars) or with pSUPER-TPPIIi (anti-TPPII siRNA, denoted EL-4.TPPII 1 , filled bars).
- AAF-CMK is a Serine peptidase inhibitor.
- C Immuno-cytochemical analysis of TPPII in EL-4.wt (top) versus EL-4. TPPII 1 cells (bottom), either left untreated (left panels) or gamma- irradiated (5 Gy) and analyzed after 1 hour. DAPI was used as controls for nuclear 5 staining.
- D DNA synthesis of gamma-irradiated EL-4.wt (open symbols) and EL-4. TPPI I' cells (closed symbols) following exposure to 1000 Rad, as measured by 3 H-Thymidin incorporation (bars indicate +/- standard deviation).
- E Cell cycle analysis of EL-4.wt (top) versus EL-4.
- TPPII' cells (bottom), before or 20 hours after exposure to 10 Gy of gamma- irradiation.
- TPPIl expression is required for stabilization of p53.
- A p53 expression in EL-4.wt control versus EL-4.
- B p21 expression in EL-4.wt
- TPPII controls pathways that respond to PIKK signaling.
- A Western 25 blotting analysis of Akt kinase expression, total Akt and Ser473-phosphorylated (p-Akt), in EL-4.wt control versus EL-4.TPPII' cells (top), or in EL-4.pcDNA3 versus EL-4.pcDNA3- TPPII cells (bottom).
- B Growth in vitro of EL-4.wt and EL-4.TPPII 1 cells in cell culture medium with either high (5%. left) or low (1 %, right) serum content. Both live (empty circles) and dead (filled circles) cells were counted.
- TPPII is required for in vivo tumor resistance to gamma-irradiation.
- the data represent the mean tumor size
- A Flow cytometric analysis of DBA/2 spleen cells 13 days post-transplantation of stem cells transduced with pMSCV-Bcl-XL-l RES-E-GFP and pMSCV-c-Myc-l RES-E-YFP.
- B In vivo tumor growth of DBA/2-c-myc/Bcl-xL cells in the presence or absence of gamma- irradiation treatment and Z-GLA-OH.
- C-G Flow cytometric detection of vector encoded YFP (c-Myc+) and GFP (Bcl-xL+) from DBA-c-Myc/Bcl-xL cells in tissues derived from tumour-carrying mice from untreated (C-E) versus treated (F, G) mice (gamma-irradiation and Z-GLA-OH), tissues used were from subcutaneous tumor (C), lung (D, F), and spleen (E, G). Gates indicated in top panels correspond to cells analyzed for GFP/YFP- fluorescence in bottom panels.
- H-J Histological sections of livers from mice inoculated with DBA/2-c-Myc/Bcl-xL cells, receiving no treatment (H), gamma-irradiation (! or both gamma-irradiation and Z-GLA-OH (J). Arrows indicate sinusoids filled with tumor cells.
- Tumour size vertical axis, mm 3
- time horizontal axis, days
- Lewis Lung Carcinoma (LLC, A), ALC (B) and YAC- 1 (C) cells were stably transfected with pSUPER- TPPIIi, or with empty pSUPER vector, and were exposed to 5 Gy of gamma-irradiation. Immunocytochemical expression of TPPII and Mre11 was measured, as indicated in figure, and DAPI was used for nuclear control staining.
- EL-4 is a Benzpyrene-induced lymphoma cell line derived from the C57BI/6 mouse strain.
- TPPI I' are EL-4 cells transfected with the pSUPER vector (Brummelkamp, TR, Bernards, R, Agami, R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296:550-3), empty versus containing the siRNA directed against TPPII.
- HeLa cells are human cervical carcinoma cells.
- YAC-1 is a Moloney Leukemia Virus-induced lymphoma cell line derived from the A/Sn mouse strain.
- ALC is a T cell lymphoma induced by radiation leukemia virus D-RadLV, derived from the C57BI/6 mouse strain.
- D-RadLV radiation leukemia virus
- PBS Phosphate Buffered Saline
- NLVS is an inhibitor of the proteasome that preferentially targets the chymotryptic peptidase activity, and efficiently inhibits proteasomal degradation in live cells.
- Butabindide is described in the literature (Rose, C, Vargas, F, Facchinetti, P, Bourgeat, P, Bambal, RB, Bishop, PB, et. al. Characterization and inhibition of a cholecystokinin- inactivating serine peptidase. Nature 1996;380:403-9).
- Z-Gly-Leu-Ala-OH is an inhibitor of Subtilisin (Bacnem, Weil am Rhein, Germany), a bacterial enzyme with an active site that is homologous to that of TPPII.
- Wortmannin is an inhibitor of PIKK (PI3- kinase-related) -family kinases (Sigma, St. Louis, MO). All inhibitors were dissolved in DMSO and stored at -2O 0 C until use.
- the resulting pellet dissolved in 50 mM Tris Base pH 7 5, 30%Glycerol, 5 mM MgCI2, and 1 mM DTT, and 1 micro-g of high molecular weight protein was used as enzyme in peptidase assays or in Western blotting for TPP Il expression
- substrate AAF-AMC Sigma St Louis, MO
- 5 mM MgCI2 and 1 mM DTT Cleavage activity was measured by emission at 460 nm in a LS50B Luminescence Spectrometer (Perkin Elmer, Boston, MA)
- a DNA topoisomerase Il inhibitor commonly used as an apoptosis-inducing agent, to starvation (50% PBS) Cells were
- TPPII siRNA-expressing pSUPER (Brummelkamp, TR, Bernards, R, Agami, R A system for stable expression of short interfering RNAs in mammalian cells Science 2002,296 550-3 ) plasmids were constructed as follows Non- phosphorylated DNA oligomers (Thermo Hybaid, UIm, Germany) were resuspended to a concentration of 3 micro-g/micro-l 1 micro-l of each oligo pair was mixed with 48 micro-l of annealing buffer (100 mM KAc, 30 mM HEPES-KOH pH 7 4 2 mM MgAc) and heated to 95° C for 4 mm, 70° C for 10 mm, then slowly cooled to room temperature 2 micro-l of annealed oligomers were mixed with 100 ng of pSUPER plasmid (digested with BgII!
- Akt by rabbit anti-Akt serum (Cell Signaling Technology, Beverly, MA), Phospho- Akt (Ser 473) by 193H2 rabbit anti-phospho-Akt serum (Cell Signaling Technology, Beverly MA), gamma-H2AX by rabbit ant ⁇ -gamma-H2AX (Cell Signalling Technology, Beverly, MA), Mre11 by polyclonal rabbit anti-human Mre11 (Cell Signalling Technology, Beverly, MA), p21 by SX118 (R & D Systems, Minneapolis, MN), p53 (R & D Systems, Minneapolis, MN), Rae-1 by monoclonal Rat anti-mouse Rae-1 , 199215 (R &D Systems, Minneapolis, MN), XIAP by monoclonal mouse anti-human XIAP, 117320 (R&D Systems, Minneapolis, MN)
- TPPII chicken anti-TPPII serum (Immunsystem, Uppsala, Sweden) Western blotting was
- Tumor Growth Experiments. Tumor cells were washed in PBS and resuspended in a volume of 200 micro-l per inoculate The cells were then inoculated into the right flank at 10 6 per mouse and growth of the tumor was monitored by measurement two times per week The initiation of anti-tumor treatment of the mice was to some extent individualized according to when tumor growth started in each mouse The mice were irradiated with 4 Gy prior to tumor inoculation in order to inhibit anti-tumor immune responses The tumor volume was calculated as the mean volume in mice with tumors growth, according to (a-i x a 2 x a 3 )/2 (the numbers a denote tumor diameter, width and depth) The time of first palpation varied between different mice, although the general pattern of growth was similar in virtually all of the mice In most diagrams a log-scale is used to better visualize the therapeutic effects against small tumors, i e the presence of complete rejections For inhibition of TPPII in vivo we made intraperitoneal injections with 13 8
- c-Myc was amplified from human cDNA (brain) by PCR using the following primers 5'ACGTGAATTCCACCATGCCCCTCAACGTTAGCTTC and
- ATM Ataxia Telangiectasia Mutated
- BRCT BRCA C-terminal repeat
- NLVS - ⁇ -hydroxy-S-iodo-S-nitrophenylacetyl-Leu-Leu-Leu-vinyl sulphone
- Pl Propidium Iodide
- PIKKs Phosphoinos ⁇ tide-3-OH-k ⁇ nase-related kinases
- TPPII T ⁇ peptidyl-peptidase Il
- FA 3-(2-furyl)acryloyl
- YFP Yellow Fluorescent Protein
- GFP Green Fluorescent Protein
- the invention also makes use of several unnatural alpha-ammo acids Abbreviation SIDE CHAIN
- Gamma-irradiation-induced cell cycle arrest depends on TPPII expression.
- PIKKs Activation of PIKKs is required to halt DNA synthesis in response to DNA damage (Bakkenist, CJ, Kastan MB Initiating cellular stress responses Cell 2004,118 9-17)
- the transcription factor p53 initiates cell cycle arrest in response to many types of stress and its expression is controlled by direct phosphorylation by PIKKs
- PIKKs By Western blotting analysis in cellular lysates of gamma-irradiated EL-4 wt cells, we found increased levels of p53, whereas those of EL-4 TPPII' cells showed low levels (Fig 2A)
- treatment with NLVS increased p53 expression of gamma-irradiated EL-4 TPPII' cells, suggesting that p53 was still synthesized but degraded by the proteasome in EL-4 TPPII' cells p21 , a transcriptional target of p53 s was weakly expressed in EL-4 TPPII 1 cells following exposure to gamma-irradiation, compared to EL-4.wt control cells (Fig.
- EL-4.pcDNA- TPPII cells that stably over-express TPPII, showed increased levels of p53 following exposure to gamma-irradiation in comparison to EL-4.pcDNA3 cells (Wang, EW, Kessler, BM, Borodovsky, A, Cravatt, BF, Bogyo, M, Ploegh, HL, et. al. Integration of the ubiquitin- proteasome pathway with a cytosolic oligopeptidase activity. Proc Natl Acad Sci U S A. 2000;97:9990-5.) (Fig. 2C).
- TPPII controls activation of several pathways that depend on PIKK signaling.
- TPPII expression was a requirement for stabilization of p53 we tested also other stress-induced pathways that depend on PIKK signaling (Gasser, S, Orsulic, S, Brown, EJ,
- Akt kinase is important for transduction of cell survival signals, and is over- activated in many tumors
- EL-4 TPPII 1 cells showed an increased rate of proliferation, compared to EL-4 wt, but also an increased accumulation of dead cells (Fig 3C) Further, by lowering serum concentrations to 1% this accumulation was accelerated, compared to EL-4 wt cells, suggesting that cell survival mechanisms
- X-linked inhibitor of apoptosis protein (XIAP) J Biol Chem 2004,279 5405-12), is a member of the IAP family of molecules, endogenous caspase inhibitors commonly over-expressed in tumor cells Up-regulation of TPPII causes increased expression of c-IAP-1 and XIAP molecules in EL-4 pcDNA3-TPPII cells By treatment with etoposide we found that expression of XIAP was substantially higher in EL-
- BRCA C-terminal repeat (BRCT)-domains are often contained within proteins controlling DNA damage signaling pathway, where they control interactions with ATM substrates (Bork, P, Hofmann, K, Bucher, P, Neuwald, AF, Altschul, SF, Koonin, EV.
- ATM substrates Bork, P, Hofmann, K, Bucher, P, Neuwald, AF, Altschul, SF, Koonin, EV.
- TPPII TPPII possesses a BRCT-Iike domain important for DNA damage signaling. 5 Regulatory factors are co-localized at sites of DNA damage, to allow the activation of downstream responses (Al Rashid, ST, Dellaire, G, Cuddihy, A, JaIaIi, F, Vaid, M, Coackley, C, et. al.
- TPPII expression controls gamma-irradiation resistance of EL-4 tumors in vivo.
- PIKKs are possible target molecules for the development of novel cancer therapies (Choudhury, A, Cuddihy, A, Bristow, RG. Radiation and new molecular agents part I: targeting ATM-ATR checkpoints, DNA repair, and the proteasome. Semin Radiat Oncol 2006; 16:51 -8).
- TPPII-rnediated growth regulation was important for in vivo tumor growth.
- mice carrying either tumors of EL-4.wt or EL-4. TPPiI' cells with 2- 4 doses of 4 Gy (400 Rad's) gamma-irradiation. We found that this had minor effects on tumor size after inoculation with 10 6 EL-4.wt cells that continued to grow despite gamma- irradiation (Fig. 5 A, gamma-irradiation indicated with arrow).
- mice carrying tumors of EL-4.TPPII' cells responded to gamma-irradiation treatment with complete regression of established tumors (Fig. 5B). These data resembled those obtained with tumors of EL-4.ATM' or EL-4.TPPII wt /G725E cells, since these also failed to resist gamma- irradiation in vivo (Fig. 5C, D).
- the data support TPPII as a target to increase in vivo gamma-irradiation susceptibility of tumor cells.
- Tri-peptide-based TPPII inhibitors radio-sensitize tumors in vivo.
- TPPII is a Subtilisin-type Serine peptidase, with a catalytic domain that is homologous to bacterial Subtilisins (Tomkinson, B, Wernstedt, C, Hellman, U, Zetterqvist, O. Active site of tripeptidyl peptidase Il from human erythrocytes is of the subtilisin type. Proc Natl Acad Sci U S A. 1987;84:7508-12).
- Z-GLA-OH tri-peptide Subtilisin inhibitor Z-Gly-Leu-Ala- OH
- Table 1 contains in vitro data, in fluoromet ⁇ c units which are arbitrary but relative, for the inhibition of cleavage of AAF-AMC (H-Ala-Ala-7-amido-4-methylcouma ⁇ n) by compounds at several concentrations Some beneficial effect is seen for most of the compounds tested
- TPP II protein was enriched, and then a TPP ll-preferred fluorogenic substrate AAF-AMC was used 10O x 10 6 cells were sedimented and lysed by vortexing in glass beads and homogenisation buffer (50 mM Tris Base pH 7 5, 250 mM Sucrose, 5 mM MgCI 2 , 1 mM DTT) Cellular lysates were subjected to differential cent ⁇ fugation, first the cellular homogenate was centrifuged at 14,000 rpm for 15 mm, and then the supernatant was transferred to ultra-cent ⁇ fugation tubes Next the sample was ultra-centrifugated at 100 000 x g for 1 hour and the supernatant (denoted as cytosol in most biochemical literature) was subjected to 100,000 x g centrifugation for 5 hours, which sedimented high molecular weight cytosolic proteins/protein complexes.
- homogenisation buffer 50 mM Tris Base pH 7 5, 250 mM Sucrose, 5
- the resulting pellet dissolved in 50 mM Tris Base pH 7.5, 30%Glycerol, 5 mM MgCI 2 , and 1 mM DTT, and 1 ug of high molecular weight protein was used as enzyme in peptidase assays.
- TPP Il To test the activity of TPP Il we used the substrate and AAF-AMC (Sigma, St. Louis, MO), at 100 uM concentration in 100 ul of test buffer composed of 50 mM Tri Base pH 7.5, 5 mM MgCI 2 and 1 mM DTT. To stop reactions we used dilution with 900 ul 1% SDS solution. Cleavage activity was measured by emission at 460 nm in a LS50B Luminescence Spectrometer (Perkin Elmer, Boston, MA).
- FA 3-(2-furyl)acryloyl
- PBS phosphate-buffered saline.
- the text (Z, FA, H, etc.) at the start of each compound name is the substituent at the N-terminus; H indicates that the N- terminus is free NH 2 .
- the text (OH, NBu, etc.) at the end of each compound name is the substituent at the C-terminus; OH indicates that the C-terminus is free CO 2 H.
- Table 2 contains in vivo data, showing tumor volume in mm 3 , in groups of 4 mice with LLC (Lewis Lung Carcinoma) Mice were sacrificed if the tumor volume exceeded 1000 mm 3 Some mice were administered with the compounds alone, others were additionally administered with irradiation Mice were given the compounds, and in some cases also gamma irradition (400 Rad) at days 7, 10, 14, 18 and 21 In combination with irradiation some compounds showed excellent results.
- the fact that the dipeptide derivative Z-GL- OH performs poorly in vitro as well as in vivo supports the theory that the in vitro results can be extrapolated to in vivo effects.
- 6,0 144,0 600,0 600 mean 6,00 168,00 495,00 800,00
- FA-GLA-OH 4 0 100,0 90,0 48 18,0 irradiated 0,0 90,0 120,0 48 48,0
- 18,0 320,0 864,0 1372 mean 7,00 207,00 672,00 1076,50 1654,00 Table 2 days after tumor inoculation
- Table 3 contains further in vivo data, showing tumor volumne in mm" 5 , in groups of 7-8 mice, according to the EL-4 tumor model described above 1 000 000 EL-4 lymphoma cells were inoculated subcutaneously at day 0 No palpable tumors were observed until day 22 At each treatment (twice weekly) mice with palpable tumors were given 400 Rads irradiation alone, or in combination with 14 micro-l 5OmM solution of Z-GLA-OH Mice with no palpable tumors were not treated i e in mice with rejected tumors, treatment was terminated and the mice were kept under observation Table 3 shows excellent results, namely complete rejection of established tumors, not just arrest of tumor growth, decreased volume, or a delay of tumor growth.
- the compound was inoculated intraperitoneally, whereas tumors were always inoculated subcutaneously.
- 0 ,50 mean 0 ,07
- 0 ,00 mean 0, ,01
- GPG-NH 2 and Z-GPG-NH 2 were tested in the same manner as Z-GLA-OH. These were injected twice weekly at 13.8 mg/kg in tumor bearing mice, and compared to Z-GLA-OH for their ability to mediate sensitization to gamma-irradiation in vivo. We found that both GPG- NH 2 and Z-GPG-NH 2 mediated complete regression of established EL-4 tumors following gamma-irradiation.
- TPPII is rapidly translocated into the nucleus of gamma-irradiated cells.
- the results of further immunocytochemical experiments are shown in Figure 9.
- TPPII does not appear to form foci, which would have instead shown a dotted appearance (Fig. 9, shown for cells with inhibited TPPII expression, LLC, ALC and YAC-1).
- This failure of cells with inhibited TPP Il expression to assemble Mre11 foci upon gamma-irradiation exposure provides further support for the use of TPP Il inhibitors in the present invention.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Psychology (AREA)
- Urology & Nephrology (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Vascular Medicine (AREA)
- Pathology (AREA)
- Radiology & Medical Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2007204314A AU2007204314A1 (en) | 2006-01-13 | 2007-01-15 | Use of TPP II inhibitors in combination with gamma-irradiation for the treatment of cancer |
| JP2008549886A JP2009523156A (ja) | 2006-01-13 | 2007-01-15 | 癌の処置のためのγ線照射と組み合わせた化合物の使用 |
| EP07703879A EP1971357A2 (en) | 2006-01-13 | 2007-01-15 | Use of tpp ii inhibitors in combination with gamma-irradiation for the treatment of cancer |
| CA002636533A CA2636533A1 (en) | 2006-01-13 | 2007-01-15 | Use of tpp ii inhibitors in combination with gamma-irradiation for the treatment of cancer |
| US12/160,787 US20100168038A1 (en) | 2006-01-13 | 2007-01-15 | Use of compounds in combination with gamma-irradiation for the treatment of cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US75908806P | 2006-01-13 | 2006-01-13 | |
| US60/759,088 | 2006-01-13 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007080194A2 true WO2007080194A2 (en) | 2007-07-19 |
| WO2007080194A3 WO2007080194A3 (en) | 2008-02-14 |
Family
ID=36609604
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2007/050363 Ceased WO2007080194A2 (en) | 2006-01-13 | 2007-01-15 | Use of tpp ii inhibitors in combination with gamma-irradiation for the treatment of cancer |
| PCT/EP2007/050364 Ceased WO2007088099A2 (en) | 2006-01-13 | 2007-01-15 | Compounds for the treatment of ischemia and neurodegeneration |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2007/050364 Ceased WO2007088099A2 (en) | 2006-01-13 | 2007-01-15 | Compounds for the treatment of ischemia and neurodegeneration |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US20100168038A1 (https=) |
| EP (2) | EP1971357A2 (https=) |
| JP (2) | JP2009523156A (https=) |
| KR (1) | KR20080085035A (https=) |
| CN (1) | CN101370509A (https=) |
| AU (1) | AU2007204314A1 (https=) |
| CA (1) | CA2636533A1 (https=) |
| WO (2) | WO2007080194A2 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009000297A1 (en) * | 2007-06-25 | 2008-12-31 | Oncoreg Ab | Tpp ii inhibitors for use in combination with chemotherapy for the treatment of cancer |
| WO2011159685A3 (en) * | 2010-06-16 | 2012-04-12 | The Regents Of The University Of Michigan | Inhibition of wdr5 interaction with its binding partners and therapeutic methods |
| US8362068B2 (en) | 2009-12-18 | 2013-01-29 | Idenix Pharmaceuticals, Inc. | 5,5-fused arylene or heteroarylene hepatitis C virus inhibitors |
| WO2015040235A1 (en) | 2013-09-23 | 2015-03-26 | Dr. August Wolff Gmbh & Co. Kg Arzneimittel | Anti-inflammatory tripeptides |
| US12036286B2 (en) | 2021-03-18 | 2024-07-16 | Seagen Inc. | Selective drug release from internalized conjugates of biologically active compounds |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2170364A2 (en) * | 2007-06-25 | 2010-04-07 | Oncoreg AB | Tpp ii inhibitors for use in the treatment of autoimmune and inflammatory diseases and transplant rejection |
| US8779002B2 (en) * | 2007-10-15 | 2014-07-15 | Salk Institute For Biological Studies | Methods for treating a variety of diseases and conditions, and compounds useful therefor |
| AU2011348220B2 (en) * | 2010-12-22 | 2017-09-07 | The Salk Institute For Biological Studies | Cyclic CRF antagonist peptides |
| EP3171941B1 (en) * | 2014-07-24 | 2021-03-24 | Naurex Inc. | N-methyl-d-aspartate receptor modulators and methods of making and using same |
| CN111603560A (zh) * | 2020-06-22 | 2020-09-01 | 泉州台商投资区秋鑫茶业有限公司 | 茶叶γ-氨基丁酸在肿瘤放射治疗上的应用 |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MC2306A1 (fr) * | 1990-08-22 | 1993-09-27 | Syntello Vaccine Dev Kb | Peptides bloquant les infections par le virus de l'immunodeficience humaine et methode de leur utilisation |
| US5627035A (en) * | 1990-08-22 | 1997-05-06 | Syntello Vaccine Development Ab | Peptides that block human immunodeficiency virus and methods of use thereof |
| US6335360B1 (en) * | 1997-12-23 | 2002-01-01 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Tripeptidyl peptidase inhibitors |
| US6258932B1 (en) * | 1999-08-09 | 2001-07-10 | Tripep Ab | Peptides that block viral infectivity and methods of use thereof |
| DE10105039A1 (de) * | 2001-02-05 | 2002-08-08 | Tell Pharm Ag Hergiswil | Tripeptid-Derivate für die Behandlung neurodegenerativer Krankheiten |
| WO2003024995A1 (en) * | 2001-09-19 | 2003-03-27 | Tripep Ab | Molecules that block viral infectivity and methods of use thereof |
| US20040097422A1 (en) * | 2002-06-14 | 2004-05-20 | Karl Munger | Methods of use for tripeptidyl peptidase II inhibitors as anticancer agents |
| EP1716247A1 (en) * | 2004-01-31 | 2006-11-02 | Bayer HealthCare AG | Diagnostics and therapeutics for diseases associated with tripeptidyl-peptidase 2 (tpp2) |
-
2007
- 2007-01-15 CN CNA200780002382XA patent/CN101370509A/zh active Pending
- 2007-01-15 JP JP2008549886A patent/JP2009523156A/ja active Pending
- 2007-01-15 EP EP07703879A patent/EP1971357A2/en not_active Withdrawn
- 2007-01-15 AU AU2007204314A patent/AU2007204314A1/en not_active Abandoned
- 2007-01-15 EP EP07726197A patent/EP2160196A2/en not_active Withdrawn
- 2007-01-15 WO PCT/EP2007/050363 patent/WO2007080194A2/en not_active Ceased
- 2007-01-15 JP JP2008549887A patent/JP2009523157A/ja active Pending
- 2007-01-15 CA CA002636533A patent/CA2636533A1/en not_active Abandoned
- 2007-01-15 US US12/160,787 patent/US20100168038A1/en not_active Abandoned
- 2007-01-15 US US12/160,786 patent/US20090227521A1/en not_active Abandoned
- 2007-01-15 WO PCT/EP2007/050364 patent/WO2007088099A2/en not_active Ceased
- 2007-01-15 KR KR1020087017003A patent/KR20080085035A/ko not_active Withdrawn
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009000297A1 (en) * | 2007-06-25 | 2008-12-31 | Oncoreg Ab | Tpp ii inhibitors for use in combination with chemotherapy for the treatment of cancer |
| US8362068B2 (en) | 2009-12-18 | 2013-01-29 | Idenix Pharmaceuticals, Inc. | 5,5-fused arylene or heteroarylene hepatitis C virus inhibitors |
| US9187496B2 (en) | 2009-12-18 | 2015-11-17 | Idenix Pharmaceuticals Llc | 5,5-fused arylene or heteroarylene hepatitis C virus inhibitors |
| WO2011159685A3 (en) * | 2010-06-16 | 2012-04-12 | The Regents Of The University Of Michigan | Inhibition of wdr5 interaction with its binding partners and therapeutic methods |
| US9233086B2 (en) | 2010-06-16 | 2016-01-12 | The Regents Of The University Of Michigan | Inhibition of WDR5 interaction with its binding partners |
| WO2015040235A1 (en) | 2013-09-23 | 2015-03-26 | Dr. August Wolff Gmbh & Co. Kg Arzneimittel | Anti-inflammatory tripeptides |
| US12036286B2 (en) | 2021-03-18 | 2024-07-16 | Seagen Inc. | Selective drug release from internalized conjugates of biologically active compounds |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2007088099A2 (en) | 2007-08-09 |
| WO2007080194A3 (en) | 2008-02-14 |
| JP2009523156A (ja) | 2009-06-18 |
| KR20080085035A (ko) | 2008-09-22 |
| WO2007088099A3 (en) | 2007-11-08 |
| EP1971357A2 (en) | 2008-09-24 |
| JP2009523157A (ja) | 2009-06-18 |
| US20100168038A1 (en) | 2010-07-01 |
| AU2007204314A1 (en) | 2007-07-19 |
| CA2636533A1 (en) | 2007-07-19 |
| EP2160196A2 (en) | 2010-03-10 |
| US20090227521A1 (en) | 2009-09-10 |
| CN101370509A (zh) | 2009-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100168038A1 (en) | Use of compounds in combination with gamma-irradiation for the treatment of cancer | |
| CN102245632B (zh) | Muc-1胞质结构域肽作为癌症的抑制剂 | |
| JP6553605B2 (ja) | 血管新生抑制活性を有するペプチド、及びそれを含む組成物 | |
| EA007396B1 (ru) | Иммуноконъюгаты для лечения опухолей | |
| CN1816564B (zh) | 能选择性杀伤癌细胞的RasGAP衍生肽 | |
| US20110158956A1 (en) | Treating cancer | |
| WO2012051207A2 (en) | FRAGMENT OF SECRETED HEAT SHOCK PROTEIN-90ALPHA (Hsup90ALPHA) AS VACCINES OR EPITOPE FOR MONOCLONAL ANTIBODY DRUGS OR TARGET FOR SMALL MOLECULE DRUGS AGAINST A RANGE OF SOLID HUMAN TUMORS | |
| Lee et al. | Zfra activates memory Hyal-2+ CD3− CD19− spleen cells to block cancer growth, stemness, and metastasis in vivo | |
| WO2009000297A1 (en) | Tpp ii inhibitors for use in combination with chemotherapy for the treatment of cancer | |
| US20100240591A1 (en) | Tpp ii inhibitors for use in the treatment of autoimmune and inflammatory diseases and transplant rejection | |
| Blishchenko et al. | Antitumor effect of valorphin in vitro and in vivo: combined action with cytostatic drugs | |
| US20250049930A1 (en) | Protac molecules targeting foxp3 and uses thereof | |
| WO2021050510A1 (en) | Engineered peptide and peptide mimetic compositions and methods | |
| EP2670416B1 (en) | A novel high affinity bivalent helically constrained peptide against cancer | |
| WO2012016918A1 (en) | Use of a peptide enhancing the ability of radiation therapy to kill cancer cells | |
| Rew | Cell and molecular mechanisms of pathogenesis and treatment of cancer | |
| JP2023103155A (ja) | がん治療用医薬組成物およびがん治療薬をスクリーニングする方法 | |
| 조영석 | Caspase-3 activated prodrugs for biomarker based targeted chemotherapy in TNBC | |
| WO2003095484A2 (en) | Polypeptides increasing p53 expression | |
| Blishchenko et al. | Research Paper Anti-tumor Effect of Valorphin In Vitro and In Vivo | |
| EP2391378A1 (en) | Use of a fragment of rasgap peptide in the treatment or prevention of metastasis | |
| WO2010043713A2 (en) | Use of cyclin o in a medical setting |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2007703879 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008549886 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2636533 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007204314 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780002382.X Country of ref document: CN Ref document number: 1020087017003 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12160787 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 6222/DELNP/2008 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2007204314 Country of ref document: AU Date of ref document: 20070115 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2007204314 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2007703879 Country of ref document: EP |