Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
  • A61P13/12—Drugs for disorders of the urinary system of the kidneys

Definitions

• This invention relates to medical science particularly the prevention and treatment of acute renal failure with soluble thrombomodulin.
• Thrombomodulin is a glycoprotein present on the membrane surface of endothelial cells on many organs, including lung, liver, and kidney.
• Activated protein C is generated by thrombin- mediated cleavage of PC, an event which requires TM as a thrombin cofactor (Esmon, et al., J Biol Chem
• PC protein C
• TM has now been well established to possess roles in inflammation, fibrinolysis, apoptosis, cell adhesion and cellular proliferation (Conway, et al., J Exp Med 196: 565-577, 2002; Huang et al., J Biol CIiem 278: 46750-46759, 2003).
• a soluble thrombomodulin offers a potentially significant approach to the prevention and treatment of ischemic ARF.
• the present invention provides a method of treating a subject having acute renal failure which comprises administering to the subject a pharmaceutically effective amount of soluble thrombomodulin or derivative thereof.
• the present invention provides a method for prevention of acute renal failure in a subject which comprises administering to the subject a pharmaceutically effective amount of soluble thrombomodulin or derivative thereof.
• ARF refers to Acute renal failure due to acute tubular necrosis or acute interstitial nephritis. ARF occurs when there is an acute reduction in glomerular filtration rate associated with the retention of nitrogenous wastes. Acute renal failure alternatively may be referred to as acute renal dysfunction.
• APC refers to Activated protein C or aPC refers to recombinant aPC.
• APC includes and is preferably recombinant human aPC although aPC may also include other species having protein C proteolytic, amidolytic, esterolytic, and biological (anti-coagulant, anti-inflammatory, or pro-fibrinolytic) activities.
• sTM refers to soluble thrombomodulin, which is a soluble, secreted variant of thrombomodulin which lacks the full-length thrombomodulin transmembrane and cytoplasmic domains.
• the primary amino acid structure of thrombomodulin is known in the art, as described in EP 0412841 Al.
• Human TM is synthesized as a 575 amino acid protein including a signal peptide portion reported to be 16, 18, or 21 residues in length. Following the signal peptide portion, human TM comprises the following domains or regions, sequentially from the amino terminus: 1) an amino terminal domain of ⁇ 222-226 amino acids, 2) six EGF ("epidermal growth factor")-like structures of ⁇ 236-240 amino acids, 3) a serine/threonine rich domain (ST domain) of ⁇ 34-37 amino acids and having several possible O-glycosylation sites, 4) a transmembrane region of -23-24 amino acids, and 5) a cytoplasmic domain of ⁇ 36-38 amino acids.
• EGF epidermal growth factor
• sTM also includes a thrombomodulin derivative that further lacks the ST domain. Both forms of sTM possess thrombomodulin activity, as described below.
• sTM is preferably recombinant sTM, and more preferably, human recombinant sTM.
• Pharmaceutically effective amount refers to a therapeutically efficacious amount of a pharmaceutical compound.
• the particular dose of the compound administered according to this invention will, of course, be determined by the attending physician evaluating the particular circumstances surrounding the case, including the compound administered, the particular condition being treated, the patient characteristics and similar considerations.
• Continuous infusion refers to continuing substantially uninterrupted the introduction of a solution or suspension into a vein for a specified period of time.
• Bolus injection refers to the injection of a drug in a defined quantity (called a bolus) over a period of time up to about 120 minutes.
• IRI refers to ischemia reperfusion injury.
• Treating describes the management and care of a patient for the purpose of combating a disease, condition, or disorder whether to eliminate the disease, condition, or disorder, or prophylactically to prevent the onset of the symptoms or complications of the disease, condition, or disorder.
• Thrombomodulin Activity refers to any property of soluble thrombomodulin or its derivatives responsible for protein C interaction, binding to thrombin, interaction with EPCR, having binding to
• HMGBl and showing biological properties of APC cofactor activity, thrombin inhibitory activity and antiinflammatory activity.
• Methods for testing for TM binding and functional activities are well known in the art, i.e., see Parkinson, et al., 1990 J. Biol. Chem. 265: 12602-12610; Grinnell and Berg. 1996. Am. J. Physiol. 270: H603-609; Gerlitz, et al 1993 Biochem. J. 295: 131-140; Abeyama et al., 2005, J. Clin. Invest. 115:1267-1274.
• PAC refers to partial aortic clamp.
• the present invention provides for the treatment and/or prevention of acute renal failure with soluble thrombomodulin.
• Mortality from acute renal failure was previously thought to be related only to the underlying illness, recent studies indicate that renal failure per se is an independent risk factor for mortality (Levy EM et al JAMA 1996;275(19): 1489-94; Chertow GM et al. Am J Med 1998;104(4):343- 8).
• ARF that occurs secondary to another illness has a higher mortality and poorer long term outcome that ARF arising de novo (primary ARF).
• ARF ischemia- reperfusion injury
• Cardiopulmonary bypass provokes a systemic inflammatory response syndrome (SIRS) (Faymonville, et al J Thorac Cardiovasc Surg 1991;102(2):309-17; Frering, et al., J Thorac Cardiovasc Surg 1994;108(4):636-41).
• SIRS systemic inflammatory response syndrome
• a spectrum of injury may be observed that includes one or more of the following clinical manifestations: pulmonary, renal, gut, central nervous system, and myocardial dysfunction; coagulopathy; vasodilation and increased capillary permeability; hemolysis; pyrexia; and increased susceptibility to infection (Paparella, et al., Eur J Cardiothorac Surg 2002;21(2):232-44.).
• CPB CPB
• neutrophils and vascular endothelium are activated (Asimakopoulos, et al., Ann Thorac Surg 1998;66(6):2135-44; Galinanes, et al., Circulation 1996;94(9Suppl):II364-9).
• Platelets also undergo activation, degranulation and adherence to vascular endothelium (Zilla et al., J Thorac Cardiovasc Surg 1989;97(3):379-88). These events lead to elaboration of cytotoxic oxygen-derived free radicals (Haga et al Artif Organs 1993;17(10):837-42), proteases (Faymonville et al., J Thorac Cardiovasc Surg 1991;102(2):309-17), cytokines (Frering et al., J Thorac Cardiovasc Surg 1994;108(4):636-41) and chemokines (Paparella et al., Eur J Cardiothorac Surg 2002;21(2):232-44).
• IRI interleukin- 6
• IL-8 tumor necrosis factor
• TNF tumor necrosis factor-alpha
• the present invention contemplates both the use of sTM or derivatives thereof for the prevention of acute renal failure in patients at high risk, as well as the treatment of acute renal failure resulting from inflammatory or ischemic injury.
• Patients at high risk include those with chronic kidney disease, underlying heart or liver disease, and diabetes who subsequently experience acute tubular necrosis or acute interstitial nephritis.
• Soluble TM and its derivatives are useful for the prevention and treatment of acute tubular necrosis resulting from renal ischemia following major trauma or hemorrhage, cardiac arrest, cardiac bypass, septic shock, burns or any interrupted renal blood flow during surgery.
• soluble TM and derivatives will be useful following chemical injury from nephrotoxic drugs, thromboembolism, malignant hypertension, thrombotic thrombocytopenic purpura (TTP), hemolytic uremic syndrome (HUS), vasculitis, transfusion reaction, chemotherapy agents, toxins and poisons, radio contrast dyes used in imaging, malignant hypertension and disorders resulting from childbirth.
• Soluble TM and derivatives will also be useful for the treatment of acute interstitial nephritis caused by inflammation of interstitial kidney tissue following infection or in immune-related diseases such as lupus, leukemia, lymphoma, and sarcoidosis, and following kidney injury in response to antibiotics and NSAIDs (nonsteroidal anti-inflammatory drugs).
• NSAIDs nonsteroidal anti-inflammatory drugs
• sTM is administered to a subject in need thereof using standard parenteral, peripheral administration techniques, with preferred routes of administration including intravenous and/or subcutaneous injection. More preferably, sTM will be administered either by IV bolus and/or subcutaneous injection using an appropriate dose for exposure ranging from one to twenty four or more hours, including but not limited to 48, 72, 96, or as many as 120 hours.
• the preparation of an acceptable pharmaceutical preparation of the sTM used in the present invention, including its strength, excipients, pH, isotonicity, presentation, dosage form, and the like, is well known to the skilled person.
• compositions for use in the present invention should be appropriate for the selected mode of administration, and pharmaceutically acceptable excipients such as, buffers, surfactants, preservatives, solubilizing agents, isotonicity agents, stabilizing agents and the like are used as appropriate.
• pharmaceutically acceptable excipients such as, buffers, surfactants, preservatives, solubilizing agents, isotonicity agents, stabilizing agents and the like are used as appropriate.
• Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton PA, latest edition, incorporated herein by reference provides a compendium of formulation techniques as are generally known to practitioners.
• Pharmaceutical preparations for use in the present invention should be sterile or at least nearly so, and if necessary preserved or rendered bacteriostatic.
• the sTM will be used in conjunction with standard of care, including but not limited to appropriate antibiotic therapies to treat or prevent infection, diuretics for fluid management, furosemide or mannitol, dopamine, atrial natriuretic peptide (ANP), angiotensin-converting enzyme inhibitors, angiotensin receptor blockers, dialysis, erythropoietin, and treatment of hyperkalemia, acidosis, and potassium imbalance with Kayexalate, calcium, glucose/insulin, and/or diuretics.
• ABP atrial natriuretic peptide
• angiotensin-converting enzyme inhibitors angiotensin receptor blockers
• dialysis erythropoietin
• erythropoietin erythropoietin
• potassium imbalance with Kayexalate calcium, glucose/insulin, and/or diuretics.
• the following examples are intended to illustrate but not to limit the invention. The examples describe experiments conducted in rats, thus the use of
• rat soluble thrombomodulin is produced as follows: Full length rat thrombomodulin is PCR amplified from a Clontech 5'- stretch plus cDNA rat lung library and TA cloned into pCRII-TOPO using the Invitrogen TOPO cloning kit using the following primers: 5' primer for full length rat TM,
• rat soluble TM (sTM) into the mammalian transient expression vector XenoFLIS-PP-Fc, comprising the CMV promoter, preprotrypsin signal peptide, Xenopus leader and BGH poly-A: 5 'primer for rat sTM, 5' - CCCAGGCTTCGACTAGCCAAGCTGCAGCCC - 3'; 3 'primer for rat sTM, 5' - CCGCTCGAGTCAAGAGTGCACTGG CCTGGC - 3'.
• the rat sTM constructs do not include the ST domain as they are truncated 4 amino acids after EGF6.
• the resultant purified protein therefore has no chondroitin sulfate moiety (CS-).
• the rat sTM expression vector is purified and used for a large scale transient expression in HEK293E cells.
• the conditioned media is concentrated and clarified by filtration.
• the conductivity of the concentrated, clarified conditioned medium is adjusted to 10 mS by addition of H2O, prior to loading onto a Fast-flow Q-sepharose column (Amersham Biosciences), which has been equilibrated in buffer (20 mM Tris, pH 7.4, containing 50 mM NaCl, 5 mM EDTA, and 5 mM benzamidine-HCl).
• buffer (20 mM Tris, pH 7.4, containing 50 mM NaCl, 5 mM EDTA, and 5 mM benzamidine-HCl.
• the column is washed with 3 bed- volumes of the same buffer, prior to elution with a 50 mM to 1 M NaCl linear gradient.
• Fractions containing thrombomodulin are pooled, and the pH adjusted to 4.5, prior to dialysis in 20 mM sodium phosphate, pH 4.5, containing 5 mM EDTA and 5 mM benzamidine-HCl.
• the pooled protein is then clarified by centrifugation, and loaded onto an SP-sepharose column (Amersham Biosciences) equilibrated in 20 mM sodium phosphate, pH 4.55).
• Rat thrombomodulin which is present in the column flow-through, is collected, concentrated, and further purified by gel-exclusion chromatography, using a Superdex S200 50/60 column (Amersham Biosciences) in PBS (10 mM sodium phosphate, pH 7.4, containing 150 mM NaCl). Fractions containing purified rat thrombomodulin were pooled, and sterile filtered using a 0.2 ⁇ M filter (Millipore). Protein concentration is determined by A280 > using an extinction coefficient of 1.1 (mg/mL)-l cm ⁇ l. MALDI mass spectrometry and N-terminal sequencing are used to confirm the identity and purity of the rat thrombomodulin. Endotoxin levels of rat sTM prepared in this manner were less than 5 EU/mg purified protein.
• Rats Male Sprague-Dawley 200-25Og rats are purchased from Harlan Laboratories (Indianapolis, IN). Rats are housed under standard laboratory conditions and fed a standard 10% corn oil-based rat chow and tap water ad libitum. The rats are allowed a minimum of 3 days acclimation period prior to starting the experimental protocols. The night before surgery, rats are denied access to food but have access to water. Anesthesia is induced with 5% halothane and maintained with 1-1.5% halothane in oxygen enriched air via a face mask. After shaving the abdomen of the rat, a midline incision is made through the skin and musculature to expose the abdominal cavity.
• the abdominal aorta just below the renal arteries is then isolated through blunt dissection from the inferior vena cava, and an ultrasonic probe (2.0mm diameter, Transit Time Perivascular Flowmeter TS420 (Transonic Systems, Inc, Ithica, NY) placed and secured to quantify the aortic blood flow rate.
• the upper abdominal aorta is then isolated through blunt dissection and freed from the surrounding structures to expose the aorta between the celiac artery and superior mesenteric artery (SMA).
• the aortic clamp itself is comprised of two 4mm length polyethylene tubing (PE- 100, 0.86mm diameter, Clay Adams Co, Parsippany, NJ) and a 10 inch 3.0 standard silk suture.
• the silk suture thread is first passed under the aorta in the above mentioned region.
• the first piece of tubing is then passed over both the ends of the thread to end up resting on the aorta between the celiac and SMA.
• the silk thread is then looped to leave an unsecured tie.
• the second piece of tubing is then placed in the loop, perpendicular and on top the first.
• the silk thread is then tied and the tension on the two ends of the thread increased until there is a 90% reduction of initial aortic blood flow rate as measured on the ultrasonic probe reader. This initial aortic blood flow rate is recorded prior to the placement of the tubings.
• a 10% baseline blood flow is maintained for a duration of 60 minutes. Rats are maintained on a warming blanket throughout the procedure to maintain body temperature of 37° C.
• Histopathological analysis is performed on a series of rats 24 hours after PAC.
• kidneys Prior to harvesting, kidneys are perfused briefly through the abdominal aorta with warm phosphate buffered saline (PBS) and subsequently preserved by in vivo perfusion with 4% paraformaldehyde (PFA) solution.
• PBS warm phosphate buffered saline
• PFA paraformaldehyde
• Each rat has both kidneys harvested, cut into sagittal slices and immersed in PFA overnight at 4°C. The sections are then embedded in paraffin, and histologic staining with hematoxyline-eosin (H&E) or periodic acid-Schiff(PAS) is done.
• H&E hematoxyline-eosin
• PAS periodic acid-Schiff
• Histological grading for severity of tissue damage as assessed by extent of tubular cell sloughing, loss of proximal tubule brush border, cast formation, tubular dilatation and obstruction is performed by a renal pathologist (C.L.P.) blinded to the study,.
• Tubular necrosis scores as described previously Jablonski, et al., Transplantation 35: 198-204, 1983) for cortical proximal tubule damage and (Kelly, et al., J Clin Invest 97: 1056-1063, 1996) for outer medulla tubular damage are also assessed.
• HMWD high molecular weight dextran
• LMWD low molecular weight dextran
• the HMWD dextran is labeled with fluorescein (Molecular Probes, Eugene, OR) while the LMWD is labeled with Texas Red (Molecular Probes, Eugene, Oregon).
• the left kidney of the anesthetized rat is imaged following exteriorization through a retroperitoneal window via a flank incision. Images are analyzed with Metamorph (Universal Imaging, West Chester, PA) software. Approximately 10-12 images every 3 min are collected for each animal examined. For studies examining leukocytes in the microvasculature, images obtained are analyzed in a 4x4 grid. Leukocytes are identified by their characteristic to uptake the Hoechst nuclear stain. This is correlated with microvasculature and only leukocytes present in the microvasculature itself are counted.
• Leukocytes in the microvasculature are classified into 3 subtypes namely (i) free flowing - rapid appearance and disappearance during real time imaging in a grid for less than or equal to 2 frames, (ii) static or adherent - attached to microvascular endothelium with no movement , and (iii) rolling - appearance along endothelium surface for 3 or more frames in a grid.
• rat sTM serum levels A study is undertaken to develop a dose response curve for rat sTM serum levels and its antithrombotic efficacy.
• Recombinant rat sTM is administered to rats in a ferric chloride model (FeC13) and time to occlusion is studied at various time points.
• the dose required to achieve a maximal antithrombotic effect is 5 mg/kg administered subcutaneously (s.c). This response is maximal at 24 hours and persists through 48 hours post treatment but does not last through 72 hours.
• Simultaneous serum measurements of rat sTM using ELISA reveal that the maximum serum concentration achieved after a 5mg/kg subcutaneously is at 24 hours after administration. In a separate experiment, the intravenous pharmacokinetic data is established.
• sTM intravenously
• i.v. intravenously
• the vehicle for sTM is saline and the volume injected is 0.76ml i.v. per rat and 1.64ml s.c. per rat.
• the assessment of renal function and acid-base status is performed as follows. Blood samples in all cases are obtained from tail vein or aortic puncture at indicated time points after PAC under halothane. Serum creatinine (SCr) is measured using Creatinine Analyzer 2(Beckman-Coulter, Inc. Brea, CA) and is used to assess kidney function. Arterial blood gases (ABGs) and venous blood gases (VBGs) are obtained from their respective femoral catheters preoperatively at indicated time points and analyzed using blood gas analyzer ABL 77 (Radiometer Medicals, Copenhagen, Denmark).
• ABL 77 Radiometer Medicals, Copenhagen, Denmark
• PAC suprarenal aortic clamp
• Histological assessment and functional live 2-photon imaging at 24h is assessed in another group of rats who receive pretreatment with sTM 5mg/kg s.c. 24h prior to 60 min of ischemic injury using the PAC model and compared with ischemic untreated rats undergoing the same injury.
• Untreated rats subjected to PAC I-R demonstrate significant medullary vascular congestion seen on gross morphology of the harvested kidneys at 24h.
• the gross morphology of the sTM treated rats seen at 24h reveals decreased medullary vascular congestion.
• renal sections obtained from rats treated with sTM (5mg/kg) given 24 hours prior to injury demonstrate marked reduction in ' the severity of these histological features.
• Proximal tubule injury in the cortex is significantly less in the sTM pretreated group as compared to the untreated group.
• tubular damage in the outer medulla is significantly less severe in the sTM pretreated group (Table 2).
• Table 2. - sTM reduces kidney necrosis
• Soluble Thrombomodulin diminishes the increase in microvascular permeability following renal ischemia.
• Intravital 2-photon microscopy is used to examine changes in renal microvasculature permeability to investigate the effect of sTM on the integrity of microvasculature. The defect is shown to be most extensive at 24 hours following ischemia; hence this time point is chosen for imaging.
• saline treated control rats we observe leakage of both LMWD and the HMWD from the renal microvasculature. The extent of leakage of HMWD is less than that of LMWD.
• the extent of LMWD is significantly less than that observed in saline treated control animals. Leakage of HMWD is virtually not seen in any sTM pretreated animals.
• Example 5 Renal Ischemia Soluble thrombomodulin decreases leukocyte adhesion following renal ischemia. Using intravital
• sTM treated animals demonstrate a higher percentage of free flowing leukocytes (88.3%), and a significantly lower percentage of rolling (8.3%) or static leukocytes (3.3%). All these difference between the untreated and sTM treated rats are statistically significant (P ⁇ 0.05).
• sTM treated rats exhibit faster blood flow rates as compared to untreated rats which have turbulent, sluggish flow. In the untreated rats, casts inside tubular lumen (membrane blebs, cellular fragments) obstructed flow, tubular damage, and tubular necrosis is observed more frequently, whereas in the sTM treated group there are noticeably fewer luminal casts, better flow rate in most areas, and less tubular damage.
• sTM is administered 2 hours following reperfusion.
• the dose of sTM administered is lmg/kg i.v. along with a simultaneous dose of 5mg/kg s.c.
• the untreated ischemic rats are given similar volumes of saline through similar routes.
• the rationale to choose this dose and simultaneous i.v. and s.c. administration is based on the half-life of sTM as measured in separate experiments mentioned above, to allow sufficient serum levels for at least 24 hours post injury.
• the therapeutic time of 2 hours post-injury is chosen to mimic a human clinical scenario with a therapeutic realistic time window, when it is practical to employ an agent after a known ischemic insult has occurred.
• the rats are followed for 48h and assessment of renal function, acid-base status, hematocrits, muscle and liver enzymes are made.
• the mean serum creatinine in the sTM treated group is also lower than the untreated group at 48h, approaching statistical significance (P 0.08).
• ischemic untreated rats experience a mortality rate of 45% at 24 hours, while none of the sTM treated rats die in the 2h post treatment protocol.
• Untreated ischemic rats that underwent PAC I-R have significant elevation in LDH, CK, AST and ALT suggesting significant ischemia-reperfusion injury to the muscles of the lower extremity, intestines and liver.
• Administration of sTM lmg/kg i.v. along with simultaneous 5mg/kg s.c. attenuate this rise in enzymes significantly (Table 4). Because these enzymes markers are not specific for any organ and can be released from various sites undergoing ischemia-reperfusion injury, it is suffice to say that sTM attenuates the overall body injury induced by the partial aortic clamp ischemia reperfusion.
• LDH Lactate dehydrogenase
• CK creatine kinase
• AST aspartate transaminase
• ALT alanine transaminase

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Veterinary Medicine (AREA)
• Chemical & Material Sciences (AREA)
• Public Health (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• General Chemical & Material Sciences (AREA)
• Gastroenterology & Hepatology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Urology & Nephrology (AREA)
• Marine Sciences & Fisheries (AREA)
• Zoology (AREA)
• Organic Chemistry (AREA)
• Immunology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Epidemiology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Priority Applications (9)

Applications Claiming Priority (2)

Publications (3)

Family

ID=37670944

Family Applications (1)

Country Status (13)

Cited By (2)

Family Cites Families (4)

• 2006
  • 2006-10-12 US US12/088,564 patent/US20080255047A1/en not_active Abandoned
  • 2006-10-12 JP JP2008535706A patent/JP5405829B2/ja not_active Expired - Fee Related
  • 2006-10-12 CA CA2625888A patent/CA2625888C/en not_active Expired - Fee Related
  • 2006-10-12 WO PCT/US2006/040069 patent/WO2007047430A2/en not_active Ceased
  • 2006-10-12 EP EP06825898A patent/EP1948216B1/en not_active Not-in-force
  • 2006-10-12 DK DK06825898.7T patent/DK1948216T3/da active
  • 2006-10-12 DE DE602006021048T patent/DE602006021048D1/de active Active
  • 2006-10-12 ES ES06825898T patent/ES2360610T3/es active Active
  • 2006-10-12 PT PT06825898T patent/PT1948216E/pt unknown
  • 2006-10-12 PL PL06825898T patent/PL1948216T3/pl unknown
  • 2006-10-12 SI SI200631016T patent/SI1948216T1/sl unknown
  • 2006-10-12 AT AT06825898T patent/ATE503489T1/de active
• 2011
  • 2011-05-13 CY CY20111100452T patent/CY1112438T1/el unknown

Also Published As

Similar Documents

Legal Events