Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

• the present invention relates to a gene therapeutic agent using truncated soluble cDNA of VEGF receptor protein (VEGFR) and adeno-associated virus(AW) system, and more particularly, relates to a gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer, comprising a rAAV vector containing truncated soluble cDNA of VEGFR, and a rAAV vector containing the said vector and VEGF-A anti-sense cDNA.
• VEGFR VEGF receptor protein
• AW adeno-associated virus
• the radiotherapy is a method of treating cancer by external radiation or by irradiating cancer cells with X-rays or ⁇ -rays from radioactive substances administered in vivo.
• the drug therapy is a method of administering an anticancer agent orally or by injection to destroy or suppress the DNA or related enzymes required for the proliferation of cancer cells.
• the advantages of the drug therapy are that it allows a drug to be delivered to cancer occurred in any site of the body and can treat metastasized cancer.
• the drug therapy is used as a standard therapy for the treatment of metastatic cancer.
• the drug therapy plays an important role in increasing life span by alleviating symptoms.
• chemical therapeutic agents used in this chemical therapy have problems, such as side effects and anticancer drug resistance.
• biotherapeutic agents are rapidly being developed.
• the biotherapeutic agents are used for the basic purpose of restoring or increasing the natural immune function of the body to weaken the activity of cancer cells, thus preventing the progression of cancer. If the immune system of the body exhibits its own function, the death of cancer cells can be effectively induced, but if not, cancer cells will be easily proliferated or our body gets easily attacked by other germs.
• the biotherapeutic agents are sometimes used in combination with other therapies, such as surgical therapy, radiotherapy and chemotherapy.
• biotherapeutic agents receiving attention in the bioscience field may include anti-sense anticancer agents and angiogenesis inhibitors.
• the anti-sense anticancer agents are strategies of using DNA fragments capable of complementally binding to cancer cell-specific mRNAs, to inhibit the processing of mRNAs or the expression of proteins, thus inducing the death of cancer cells.
• As a result of the human genome project about 30,000 gene sequences were interpreted and about 100,000 mRNA sequences could be identified. With this, as a large amount of information for cancer cell-associated mRNA candidates are established, genes associated with signaling pathways and genes associated with apoptosis and cell proliferation are screened and now in clinical trials.
• angiogenesis supplying oxygen and nutrients required therefor.
• angiogenesis-associated factors e.g., VEGF, bFGF, IL-8, PDGF, PD-EGF, etc.
• angiogenesis is a necessary process for the growth of tumors.
• Angiogenesis inhibitors are used to interfere with angiogenesis caused by tumors so as to suppress the growth of tumors, thus treat cancer.
• Direct angiogenesis inhibitors interfere with angiogenesis by inhibiting the proliferation or migration of vascular endothelial cells or by inhibiting reactions to angiogenesis factors.
• the direct angiogenesis inhibitors have an advantage in that they cause less acquired drug resistance.
• Indirect angiogenesis inhibitors suppress angiogenesis by inhibiting the expression of proteins in tumors activating angiogenesis or by blocking the binding between tumor proteins and vascular endothelial cell surface receptors.
• the gene therapy which is a method of treating diseases by gene transfer and expression, is used to correct the genetic defect of a certain disordered gene, unlike the drug therapy.
• the ultimate purpose of the gene therapy is to obtain useful therapeutic effects by genetically modifying a living cell.
• the gene therapy has various advantages, such as the accurate transfer of a genetic factor into a disease site, the complete decomposition of the genetic factor in vivo, the absence of toxicity and immune antigenicity, and the long-term stable expression of the genetic factor and thus is being spotlighted as the best therapy for the treatment of diseases.
• the main research field for gene therapy can be summarized in three fields of introducing a gene showing a therapeutic effect on a certain disease, increasing the resistant function of a normal cell so as to show resistance to an anticancer agent and the like, or substituting for a modified or deleted gene in patients with various genetic diseases.
• the gene therapies are broadly classified into two categories, i.e., in vivo and in vitro therapies.
• the in vivo gene therapy comprises introducing a therapeutic gene directly into the body, and the in vitro gene therapy comprises culturing a target cell in vitro, introducing a gene into the cell, and then, introducing the genetically modified cell into the body.
• the in vitro therapy is more frequently used than the in vivo therapy.
• the gene transfer technologies are broadly divided into a viral vector-based transfer method using virus as a carrier, a non-viral delivery method using synthetic phospholipid or synthetic cationic polymer, and a physical method, such as electroporation of introducing a gene by applying temporary electrical stimulation to a cell membrane.
• the viral vector-based transfer method is considered to be preferable for the gene therapy because the transfer of a genetic factor can be efficiently made with a vector with the loss of a portion or whole of replicative ability, which has a gene having a therapeutic gene substituted.
• virus used as the virus carrier or vector include RNA virus vectors (retrovirus vectors, lentivirus vector, etc.), and DNA virus vectors (adenovirus vectors, adeno-associated virus vectors, etc.).
• virus vectors include RNA virus vectors (retrovirus vectors, lentivirus vector, etc.), and DNA virus vectors (adenovirus vectors, adeno-associated virus vectors, etc.).
• its examples include herpes simplex viral vectors, alpha viral vectors, etc. Among them, retrovirus and adenovirus vectors are being particularly actively studied.
• retrovirus acting to integrate into the genome of host cells are that it is harmless to the human body, but can inhibit the function of normal cells upon integration, also it infects various cells, proliferates easily, can receive about 1-7 kb of foreign genes, and is capable of producing replication-deficient virus.
• it has disadvantages in that it is hard to infect cells after mitosis, it is difficult to transfer a gene in vivo, and the somatic cell tissue needs to be always proliferated in vitro.
• retrovirus can be integrated into a proto- oncogene, it has the risk of mutation and can cause cell necrosis.
• adenovirus has various advantages for use as a cloning vector; it has moderate size, can be replicated within a cell nucleus, and is clinically nontoxic.
• Adeno-associated virus can overcome the above-described problems, at the same time, has many advantages for use as a gene therapeutic agent and thus is recently considered to be preferable.
• AAV which is single-strand provirus, requires an assistant virus for replication, and the AAV genome is 4,680 bp in size and can be inserted into a certain site of chromosome 19 of infected cells.
• a trans-gene is inserted into plasmid DNA linked with 145 bp of each of two inverted terminal repeat sequence (ITR) and a signal sequence. This gene is transfected with another plasmid DNA expressing AAV rep and cap genes, and adenovirus is added as an assistant virus.
• ITR inverted terminal repeat sequence
• AAV has advantages in that the range of its host cells to be transferred with a gene is wide, immune side effects due to repeated administration are little, and the gene expression time is long. Furthermore, it is stable even when the AAV genome is integrated into the chromosome of a host cell, and it does not cause the modification or rearrangement of gene expression in host cells.
• AAV vector containing a CFTR gene Since an AAV vector containing a CFTR gene was approved by NIH for the treatment of cystic fibrosis in 1994, it has been used for the clinical treatment of various diseases.
• AAV vectors containing various kinds of anticancer genes were certified for use as tumor vaccines.
• Gene therapies using VEGF can be exemplified by a recombinant deficient adenovirus containing a nucleic acid encoding an angiogenesis factor for the treatment of pulmonary hypertension (Korean patent application No.
• a rAAV-ASh VEGF-A vector containing the anti-sense cDNA of VEGF-A (Korean patent application No. 10- 2004-54043), and a rAAV-AShVEGF-ABC vector containing the anti-sense cDNAs of VEGF-A, VEGF-B and VEGF-C (PCT/KR2005/002435), are effective as gene therapeutic agents for cancer.
• a gene therapeutic agent for cancer comprising a rAAV-AShVEGF-A vector containing the anti-sense cDNA of VEGF-A, a rAAV- TShVEGFR-I vector containing the truncated soluble cDNA of VEGFR-I, and a rAAV-TShVEGFR-2 vector containing the truncated soluble cDNA of VEGFR-2 (Korean patent application No. 10-2005-67661).
• the present inventors have made extensive efforts to develop a more effective therapeutic agent for cancer and thus constructed a rAAV-TSh VEGFR-I and a rAAV-TShVEGFR-2, which are constructed to insert the truncated soluble cDNA of VEGFR into a rAAV vector with a high anticancer effect, as a result, found that a gene therapeutic agent comprising the above rAAV vector containing rAAV- hVEFGR-1, rAAV-hVEFGR-2 and the anti-sense cDNA of VEGF-A, shows excellent tumor inhibitory effects in vivo, thereby completing the present invention.
• rAAV vector containing the truncated soluble cDNA of VEGFR-I and a rAAV vector containing the truncated soluble cDNA of VEGFR-2.
• a gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer comprising a rAAV vector containing the truncated soluble cDNA of VEGFR-I, a rAAV vector containing the truncated soluble cDNA of VEGFR-2 and a rAAV vector containing the VEGF-A anti-sense cDNA.
• FIG. 1 shows a standard curve for particle titration of a rAAV- AShVEGF-A vector.
• FIG. 2 shows a standard curve for particle titration of a rAAV- AShVEGF- A-IRES- EGFP vector.
• FIG. 3 shows a standard curve for particle titration of a rAA V-TShVEGFR-I -GFP vector.
• FIG. 4 shows a standard curve for particle titration of a rAA V-TSh VEGFR-2-GFP vector.
• FIG. 5 shows a standard curve for particle titration of a rAA V-IRES-EGFP vector.
• FIG. 6 shows a standard curve for particle titration of a rAA V-EGFP vector.
• FIG. 7 is a confocal microscopic photograph showing the measured transduction efficiency of a rAAV- AShVEGF-A vector.
• FIG. 8 is a confocal microscopic photograph showing the measured transduction efficiency of a rAAV-TShVEGFR- 1 vector.
• FIG. 9 is a confocal microscopic photograph showing the measured transduction efficiency of a rAAV-TShVEGFR-2 vector.
• FIG. 10 is a confocal microscopic photograph showing the measured transduction efficiency of a rAA V-IRES-GFP vector.
• FIG. 11 shows the effect of VEGF quantity decrease of a rAAV- AShVEGF-A vector in each cancer cell line.
• FIG. 12 shows the change in tumor volume in tumor model nude mice injected with the rAAV vectors according to the present invention. DETAILED DESCRIPTION OF THE INVENTION, AND PREFERRED EMBODIMENTS THEREOF
• the present invention comprises following steps: (a) transfecting a pAAV vector containing VEGFR-I truncated soluble cDNA of SEQ ID NO: 4, AAV red-cap plasmid DNA and an adeno-virus helper plasmid into an animal cell line; (b) culturing the transfected animal cell line; and (c) isolating and purifying recombinant rAAV particles after disrupting the cultured cell line, and the present invention provides a rAAV vector containing VEGFR-I truncated soluble cDNA of SEQ ID NO: 4.
• the present invention comprises following steps: (a) transfecting a pAAV vector containing VEGFR-2 truncated soluble cDNA of SEQ ID NO: 9, AAV redcap plasmid DNA and an adeno-virus helper plasmid into an animal cell line; (b) culturing the transfected animal cell line; and (c) isolating and purifying recombinant rAAV particles after disrupting the cultured cell line, and the present invention provides a rAAV vector containing VEGFR-2 truncated soluble cDNA of SEQ ID NO: 9.
• the present invention also provides a gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer, comprising the rAAV vector containing the truncated soluble cDNA of VEGFR-I, the rAAV vector containing the truncated soluble cDNA of VEGFR-2 and the rAAV vector containing VEGF-A anti-sense cDNA of SEQ ID NO: 1.
• a gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer comprising the rAAV vector containing the truncated soluble cDNA of VEGFR-I, the rAAV vector containing the truncated soluble cDNA of VEGFR-2 and the rAAV vector containing VEGF-A anti-sense cDNA of SEQ ID NO: 1.
• VEGF-A NCBI accession # NM_003376 for human
• pAAV-FIX cis plamid DNA US 6,093,292
• the anti-sense cDNA of VEGF-A isoform was substituted for factor IX cDNA gene contained in pAAV-FIX cis plamid DNA to construct trans-gene constructs of pAAV-ASh VEGF-A.
• trans-gene constructs of pAAV-AShVEGF-A-IRES-EGFP in which anti-sense cDNA of VEGF- A isoform is connected to IRES-EGFP, was constructed.
• VEGFR-I truncated soluble cDNAs of VEGFR-I (FIt-I; NCBI accession # NM002019 for human) and VEGFR-2 (Kdr/Flk-1; NCBI accession # AF063658 for human), which are receptors acting with three isoforms of VEGF, were inserted or replaced in the same manner as described above, thus preparing trans-gene constructs of pAAV-TShVEGFR-1 and pAAV-TShVEGFR-2.
• GFP was tagged to a VEGF receptor protein cDNA to prepare two trans-gene constructs of pAAV- TShVEGFR-I-GFP and pAAV-TShVEGFR-2-GFP, and analyzed thoroughly with the sequencing method to confirm the above 6 plasmids.
• the trans-genes were always inserted into plasmid DNA linked to each of 145 bp of two inverted terminal repeat (ITR) sequences, a CMV (human cytomegalovirus) immediate early promoter and an SV40 early mRNA polyadenylation signal sequence.
• ITR inverted terminal repeat
• p A AV- AShVEGF- A cDNA was synthesized by the extraction of RNA from HUVEC (Cambrex Bio Science Walkersville, Inc., USA) cells, and 429bp of human VEGF-A isoform antisense cDNA (SEQ ID NO: 1) was amplified by RT-PCR using the following AShVEGF-A primer. The amplified fragment was digested with restriction enzymes Kpnl and Xhol and ligated with pAAV-FIX cis plasmid DNA digested with the same restriction enzymes, thus constructing pAAV- AShVEGF-A.
• AShVEGF-A F2 (SEQ ID NO: 2): GGGGTA CCGTCTTGCTCTATCTTTC
• Kpnl AShVEGF-ARl (SEQ ID NO: 3): CCCTCGA GGGCCTCCGAAACCATGAACT
• the pEGFP-Nl plasmid DNA (Clontech, USA) was digested with restriction enzymes Kpnl and NM so as to prepare linearized insert, and the pAAV-FIX cis plasmid D ⁇ A was digested with restriction enzymes Kpnl and Notl to ligate with the insert, thus constructing pAAV-EGFP.
• the ⁇ IRES2-EGFP plasmid D ⁇ A (Clontech, USA) was digested with restriction enzyme NAeI, blunt-ended with Klenow fragment, and then digested with restriction enzyme Notl so as to prepare linearized insert, followed by digesting pAAV-EGFP plasmid D ⁇ A with restriction enzyme Kpnl, forming blunt-end with T4 D ⁇ A polymerase, and then ligating with the linearized vector digested with restriction enzyme Notl, thus constructing pAAV-IRES-EGFP.
• the pAAV-IRES-EGFP plasmid was digested with restriction enzyme BamHl, and pAAV-ASh VEGF-A plasmid D ⁇ A constructed above was digested with restriction enzyme BamHl to ligate the two D ⁇ A fragments, thus constructing pAAV- AShVEGF-A-IRES-EGFP.
• TShVEGFR-I Fl and TShVEGFR-I R3 primers The amplified fragment was digested with restriction enzymes Kpnl and Xhol, and ligated with pAAV-FIX cis plasmid DNA digested with the same restriction enzymes, thus constructing pAAV- TShVEGFR-I.
• TShVEGFR-I Fl (SEQ ID NO: 5):
• the amplified fragment was digested with restriction enzymes Kpnl and Apal, and ligated with pAAV-EGFP plasmid digested with the same restriction enzymes, thus constructing pAAV-TShVEGFR-1-GFP wherein GFP marker protein is tagged to truncated soluble VEGFR-I cDNA.
• TShVEGFR-I Rl (SEQ ID NO: 8):
• pAAV-TShVEGFR-2 cDNA was synthesized from the extraction of RNA from cancer cell line LCSC#1, and 2402b ⁇ of truncated soluble human VEGFR-2 receptor cDNA (SEQ ID NO: 9) was amplified by RT-PCR using the following TShVEGFR-2 Fl and TShVEGFR-2 R2 primers. The amplified fragment was digested with restriction enzymes Kpnl and Xhol, and ligated with pAAV-FIX cis plasmid DNA digested with the same restriction enzymes, thus constructing pAAV-TShVEGFR-2.
• TShVEGFR-2 Fl (SEQ ID NO: 10):
• Cloning of pAAV-TShVEGFR-2-GFP construct cDNA was synthesized by the extraction of RNA from cancer cell line LCSC#1, and 2397b ⁇ of truncated soluble human VEGFR-2 receptor cDNA (SEQ ID NO: 12) was amplified by RT-PCR using the above TShVEGFR-2 Fl and the following TShVEGFR-2 Rl primers.
• the amplified fragment was digested with restriction enzymes Kpnl and Apal, and ligated with pAAV-EGFP plasmid digested with the same restriction enzymes, thus constructing pAAV-TShVEGFR-2-GFP wherein GFP marker protein is tagged to truncated soluble VEGFR-I cDNA.
• TShVEGFR-2 Rl (SEQ ID NO: 13):CC ⁇ 7GGCCCCTGTCTTCAGTTCCCCTCCA
• Example 2 Construction of rAAV vector for use as gene therapeutic agent for inhibition of angiogenesis
• AAV rep- cap plasmid DNA pAAV-RC plasmid; Stratagene Co., USA
• pHelper plasmid adenovirus helper plasmid
• HEK293 human embryonic kidney 293; ATCC CRL- 1573
• the cultured HEK293 cells were collected and disrupted by sonication, and the recombinant AAV (rAAV) particles were subjected to CsCl density gradient centrifugation three times, so as to isolate a pure fraction with a RI (Refractive Index) of 1.37-1.41 g/ml.
• RI Refractive Index
• the titration of the above isolated rAAV particles was performed by quantitative PCR using the following PCR primers constructed for a CMV promoter region:
• CMV Fl (SEQ ID NO: 14): 5'-GGG CGT GGA TAG CGG TTT GAC TC-3'
• CMV Rl (SEQ ID NO: 15): 5'-CGG GGC GGG GTTATTACG ACA TT-3'.
• each of pAAV plasmid DNAs with known concentrations was used as a standard substance, and it was found that the recombinant rAAV produced and isolated as described above generally had a rAAV particle titer of 10 ⁇ 10 viral particles/ml.
• Example 3 Culture of cancer cell line and treatment of rAAV vector as gene therapeutic agent
• rAAV-EGFP rAAV-EGFP
• GFP GFP which is not inserted with VEGF anti-sense
• the cell treated with rAAV vector is cleansed two times with IxPBS and cultured for 72 hours after added with new optimum condition medium.
• Transduction efficiency of cultured cell was confirmed by monitoring GFP protein expression using confocal microscopy.
• Example 2 5 cancer cell lines (T84, LCSC#1, MKN45, MKN74, NUGC3) of Example 3 were treated with rAAV vector expressing GFP to be each kind of rAAV vector having total M.O.I of 10 5 for 24 hours. After 48 hours, GFP protein expression was monitored using confocal microscopy method (excitation 488 nm; emission>500 nm), and measured for transduction efficiency.
• rAAV-AShVEGF-A-IRES-EGFP is expected to independently express GFP protein bicistronically, and because rAAV-TShVEGFR- 1-GFP and rAAV-TShVEGFR-2-GFP vectors express fusion protein tagged with GFP protein, infection efficiency could be measured by monitoring GFP protein expression. Meanwhile, a negative control group cell without treating with rAAV vector and rAAV-IRES-EGFP treated cell as a control group were monitored for GFP protein expression.
• Example 5 Inhibitory effect on angiogenesis of rAAV vector in cancer cell line using ELISA
• 3 kinds of gastric cancer cell lines(NUGC3, MKN74, MKN45), lung cancer cell line(LCSC#l) and large intestine cancer cell line(T84) were treated with rAAV- AShVEGF-A vector to be a total M.O.I of 10 5 for 24 hours. After 72 hours, cell lysates were prepared by disrupting the cell. Two cell groups, a cell group without being treated with rAAV vector and a group treated with rAAV-EGFP vector, were used as a control group.
• lysates containing 10 ⁇ g of total protein were subjected to ELISA (RPN2779, Amersham Biosciences, USA), and the changed amount of VEGF by rAAV-ASh VEGF-A vector treatment was measured three times repeatedly.
• VEGF amount of cell group treated with rAAV-AShVEGF-A vector has decreased more than 55% in large intestine cancer cell line T84 compared to the control group treated with rAAV-EGFP vector, and compared to the control group, VEGF amount has decreased about 45% in lung cancer cell line LCSC#1, whereas almost no change in the amount of VEGF was seen in three gastric cancer cell lines.
• Table 1 Changed amount of VEGF in cancer cell line by rAAV- ASh VEGF-A treatment
• Tumor model was prepared by injecting 5 x 10 6 NCI-H460 human lung cancer cell line(ATCC HTB- 177) into BABL/c nude mice (BABL/c nu/nu mouse, Central Experiment Animal Inc., Japan SLC, Inc.) using hypodermic injection.
• the internal organs liver, spleen, kidney, heart, lung, testicle and epididymis
• the internal organs were fixed with 10% neutral formalin and Bouin Solution(in case of tumor, testicle and epididymis), to make paraffin embedded section and then subjected to immunohistochemical and histochemical analysis.
• immunohistochemical analysis was performed using anti-CD34 antibody, and histochemical analysis was carried out by haematoxylin/eosin dyeing.
• [rAAV-TShVEGFR-1 + rAAV-TShVEGFR-2] and [r AAV-TShVEGFR-I + rAAV-TShVEGFR-2 + rAAV-AShVEGF-A] has decreased compared to negative control group injected with HEPES, especially, it could be seen that the tumor volume of the group injected with [rAAV-TShVEGFR-1 + rAAV-TShVEGFR-2 + rAAV-AShVEGF-A] has decreased remarkably.
• the present invention provides a gene therapeutic rAAV vector containing the truncated soluble cDNA of VEGFR-I or the truncated soluble cDNA of VEGFR-2.
• the present invention also provides a gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer, comprising all of the rAAV vector containing truncated soluble cDNA of VEGFR and the rAAV vector containing truncated soluble cDNA of the above VEGFR and the rAAV vector containing VEGF-A anti-sense cDNA.
• the gene therapeutic agent according to the present invention reduces the growth of tumors by inhibiting the expression and function of VEGF involved in angiogenesis necessary for the proliferation and metastasis of tumors.
• the inventive gene therapeutic agent can be effectively used to treat cancer at a gene level.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Biotechnology (AREA)
• Medicinal Chemistry (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biophysics (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Immunology (AREA)
• Cell Biology (AREA)
• Physics & Mathematics (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Toxicology (AREA)
• Plant Pathology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Microbiology (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=37179891

Family Applications (1)

Country Status (3)

Families Citing this family (3)

• 2005
  • 2005-07-26 KR KR1020050067661A patent/KR100563099B1/ko active IP Right Grant
  • 2005-12-20 WO PCT/KR2005/004384 patent/WO2007013719A1/en active Application Filing
• 2006
  • 2006-01-06 CN CNB2006100000717A patent/CN100487125C/zh not_active Expired - Fee Related

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events