WO2006044322A2 - Micrornas - Google Patents
Micrornas Download PDFInfo
- Publication number
- WO2006044322A2 WO2006044322A2 PCT/US2005/036373 US2005036373W WO2006044322A2 WO 2006044322 A2 WO2006044322 A2 WO 2006044322A2 US 2005036373 W US2005036373 W US 2005036373W WO 2006044322 A2 WO2006044322 A2 WO 2006044322A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mirna
- nucleic acid
- plant
- target sequence
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the field of the present invention relates generally to plant molecular biology and plant biotechnology. More specifically it relates to constructs and methods to suppress the expression of targeted genes or to down regulate targeted genes.
- RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al. (1998) Nature 391 :806-811). The corresponding process in plants is commonly referred to as post- transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi.
- PTGS post- transcriptional gene silencing
- the process of post-transcriptional gene silencing is thought to be an evolutionarily- conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire (1999) Trends Genet. 15:358-363).
- Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA of viral genomic RNA.
- dsRNAs double-stranded RNAs
- the presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized.
- a new class of small RNA molecules is involved in regulating gene expression in a number of eukaryotic organisms ranging from animals to plants.
- miRNAs are 20-22 nucleotide-long molecules that specifically base-pair to target messenger-RNAs to repress their translation or to induce their degradation.
- miRNAs are 20-22 nucleotide-long molecules that specifically base-pair to target messenger-RNAs to repress their translation or to induce their degradation.
- Recent reports have identified numerous miRNAs from vertebrates, Caenorhabditis elegans, Drosophila and Arabidopsis thaliana (Bartel (2004) Cell 116:281-297; He and Hannon (2004) Nature Reviews Genetics 5:522-531).
- Viruses such as Turnip Mosaic Virus (TuMV) and Turnip Yellow Mosaic Virus (TYMV) cause considerable crop loss world-wide and have serious economic impact on agriculture (Morch et al.
- PTGS post-transcriptional gene silencing
- the present invention provides a method of down regulating a target sequence in a cell and a nucleic acid construct for use in this method, as well as a polynucleotide for use in the nucleic acid construct.
- the method comprises introducing into the cell a nucleic acid construct capable of producing miRNA and expressing the nucleic acid construct for a time sufficient to produce the miRNA, wherein the miRNA inhibits expression of the target sequence.
- the nucleic acid construct comprises a polynucleotide encoding a modified miRNA precursor capable of forming a double-stranded RNA or a hairpin, wherein the modified miRNA precursor comprises a modified miRNA and a sequence complementary to the modified miRNA, wherein the modified miRNA is a miRNA modified to be (i) fully complementary to the target sequence or (ii) fully complementary to the target sequence except for GU base pairing.
- the pre-miRNA forms a hairpin which in some cases the double-stranded region may be very short, e.g., not exceeding 21-25 bp in length.
- the nucleic acid construct may further comprise a promoter operably linked to the polynucleotide.
- the cell may be a plant cell, either monocot or dicot, including, but not limited to, corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
- the promoter may be a pathogen-inducible promoter or other inducible promoters. The binding of the modified miRNA to the target RNA leads to cleavage of the target RNA.
- the target sequence of a target RNA may be a coding sequence, an intron or a splice site.
- the present invention provides an isolated polynucleotide encoding a modified plant miRNA precursor, the modified precursor is capable of forming a double-stranded RNA or a hairpin and comprises a modified miRNA and a sequence complementary to the modified miRNA, wherein the modified miRNA is a miRNA modified to be (i) fully complementary to the target sequence or (ii) fully complementary to the target sequence except for GU base pairing.
- Expression of the polynucleotide produces a miRNA precursor which is processed in a host cell to provide a mature miRNA which inhibits expression of the target sequence.
- the polynucleotide may be a nucleic acid construct or may be the modified plant miRNA precursor.
- the nucleic acid construct may further comprise a promoter operably linked to the polynucleotide.
- the promoter may be a pathogen-inducible promoter or other inducible promoter.
- the binding of the modified miRNA to the target RNA leads to cleavage of the target RNA.
- the target sequence of a target RNA may be a coding sequence, a non-coding sequence or a splice site.
- the present invention provides a nucleic acid construct for suppressing a multiple number of target sequences.
- the nucleic acid construct comprises at least two and up to 45 or more polynucleotides, each of which encodes a miRNA precursor capable of forming a double-stranded RNA or a hairpin.
- each miRNA is substantially complementary to a target or is modified to be complementary to a target as described herein.
- each of the polynucleotides encoding precursor miRNAs in the construct is individually placed under control of a single promoter.
- the multiple polynucleotides encoding precursor miRNAs are operably linked together such that they can be placed under the control of a single promoter.
- the promoter may be operably linked to the construct of multiple miRNAs or the construct of multiple miRNAs may be inserted into a host genome such that it is operably linked to a single promoter.
- the promoter may be a pathogen- inducible promoter or other inducible promoter.
- the multiple polynucleotides are linked one to another so as to form a single transcript when expressed.
- Expression of the polynucleotides in the nucleic acid construct produces multiple miRNA precursors which are processed in a host cell to provide multiple mature miRNAs, each of which inhibits expression of a target sequence.
- the binding of each of the mature miRNA to each of the target RNA leads to cleavage of each of the target RNA.
- the target sequence of a target RNA may be a coding sequence, a non-coding sequence or a splice site.
- the present invention provides a method of down regulating a multiple number of target sequences in a cell.
- the method comprises introducing into the cell a nucleic acid construct capable of producing multiple miRNAs and expressing the nucleic acid construct for a time sufficient to produce the multiple miRNAs, wherein each of the miRNAs inhibits expression of a target sequence.
- the nucleic acid construct comprises at least two and up to 45 or more polynucleotides, each of which encodes a miRNA precursor capable of forming a double-stranded RNA or a hairpin.
- Each miRNA is substantially complementary to a target or is modified to be complementary to a target as described herein.
- each of the polynucleotides encoding precursor miRNAs in the construct is individually placed under control of a single promoter.
- the multiple polynucleotides encoding precursor miRNAs are linked together such that they can be under the control of a single promoter as described herein. In some embodiments, the multiple polynucleotides are linked one to another so as to form a single transcript when expressed. In some embodiments, the construct may be a hetero-polymeric pre-miRNA or a homo-polymeric pre-miRNA. Expression of the polynucleotides in the nucleic acid construct produces multiple miRNA precursors which are processed in a host cell to provide multiple mature miRNAs, each of which inhibits expression of a target sequence.
- the binding of each of the mature miRNA to each of the target RNA leads to cleavage of each of the target RNA.
- the target sequence of a target RNA may be a coding sequence, a non-coding sequence or a splice site.
- the present invention provides a cell comprising the isolated polynucleotide or nucleic acid construct of the present invention.
- the isolated polynucleotide or nucleic acid construct of the present invention may be inserted into an intron of a gene or a transgene of the cell.
- the cell may be a plant cell, either a monocot or a dicot, including, but not limited to, corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
- the present invention provides a transgenic plant comprising the isolated polynucleotide or nucleic acid construct.
- the isolated polynucleotide or nucleic acid construct of the present invention may be inserted into an intron of a gene or a transgene of the transgenic plant.
- the transgenic plant may be either a monocot or a dicot, including, but not limited to, corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
- the present invention provides a method of inhibiting expression of a target sequence in a cell comprising: (a) introducing into the cell a nucleic acid construct comprising a modified plant miRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide encodes an RNA sequence substantially identical to the target sequence, and the second oligonucleotide encodes a miRNA substantially complementary to the target sequence, whereby the precursor encodes a miRNA; and (b) expressing the nucleic acid construct for a time sufficient to produce the miRNA, wherein the miRNA inhibits expression of the target sequence.
- the present invention provides an isolated polynucleotide comprising a modified plant miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide encodes an RNA sequence substantially identical to a target sequence, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein expression of the polynucleotide produces the miRNA which inhibits expression of the target sequence.
- the present invention also relates to a cell comprising this isolated polynucleotide.
- the cell may be a plant cell, either monocot or dicot, including, but not limited to, corn, wheat, rice, barley, oats, sorghum, millet, sunflower, saffiower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
- the present invention provides for a method of inhibiting expression of a target sequence in a cell, such as any of those herein described that further comprises producing a transformed plant, wherein the plant comprises the nucleic acid construct which encodes the miRNA.
- the present invention also relates to a plant produced by such methods.
- the plant may a monocot or a dicot, including, but not limited to, corn, wheat, rice, barley, oats, sorghum, millet, sunflower, saffiower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
- Figure 1 shows the predicted hairpin structure formed by the sequence surrounding miR172a-2.
- the mature microRNA is indicated by a grey box.
- FIG. 2 shows the miR172a-2 overexpression phenotype.
- a Wild type (Columbia ecotype) plant, 3.5 weeks old.
- b EAT-D plant, 3.5 weeks old.
- c Wild type flower, d, EAT-D flower. Note absence of second whorl organs (petals).
- Arrow indicates sepal with ovules along the margins and stigmatic papillae at the tip.
- e Cauline leaf margin from a 35S-EAT plant.
- Arrows indicate bundles of stigmatic papillae projecting from the margin, f, Solitary gynoecium (arrow) emerging from the axil of a cauline leaf of a 35 S-EAT plant.
- FIG. 3 shows the EAT gene contains a miRNA that is complementary to APETALA2 (AP2).
- AP2 APETALA2
- a Location of the EAT gene on chromosome 5. The T-DNA insertion and orientation of the 35S enhancers is indicated. The 21-nt sequence corresponding to miR172a-2 is shown below the EAT gene (SEQ ID NO:86).
- b Putative 21-nt miR172a-2/AP2 RNA duplex is shown below the gene structure of AP2. The GU wobble in the duplex is underlined, c, Alignment of AP2 21-nt region (black bar) and surrounding sequence with three other Arabidopsis AP2 family members, and with two maize AP2 genes (IDSl and GLl 5).
- d Alignment of miR172a-2 miRNA (black bar) and surrounding sequence with miR172-like sequences from Arabidopsis, tomato, soybean, potato and rice.
- Figure 4 shows the miR172a-2 miRNA expression, a, Northern blot of total RNA from wild type (lanes 3 and 7) and EAT-D (lanes 4 and 8). Blots were probed with sense (lanes 1-4) or antisense (lanes 5-8) oligo to miR172a-2 miRNA. 100 pg of sense oligo (lanes 2 and 6) and antisense oligo (lanes 1 and 5) were loaded as hybridization controls. Nucleotide size markers are indicated on the left, b, Sl nuclease mapping of miR172a-2 miRNA. A 5 '-end- labeled probe undigested (lane 1) or digested after hybridization to total RNA from wild-type (lane 2), EAT-D (lane 3), or tRNA (lane 4).
- Figure 5 shows the developmental expression pattern of miR172 family members, a, RT-PCR of total RNA from wild type seedlings harvested at 2, 5, 12, and 21 days after germination (lanes 1-4, respectively), or from mature leaves (lane 5) and floral buds (lane 6). Primers for PCR are indicated on the left, b, Northern analysis of mirR172 expression in the indicated mutants, relative to wild type (Col). Blot was probed with an oligo to miR172a-2; however, all miR172 members should cross hybridize.
- Figure 6 shows the expression analysis of putative EAT target genes, a, Northern blot analysis of polyA+ RNA isolated from wild type (Col) or EAT-D floral buds.
- Probes for hybridization are indicated on the right, b, Western blot of proteins from wild type or EAT-D floral buds, probed with AP2 antibody.
- RbcL large subunit of ribulose 1,5-bisphosphate carboxylase as loading control.
- Figure 7 shows the identification of LAT-D. a, Location of the T-DNA insert in LAT-D, in between At2g28550 and At2g28560. The 4X 35S enhancers are approximately 5 kb from At2g28550.
- b RT-PCR analysis of At2g28550 expression in wild type versus LAT-D plants.
- Figure 8 shows that EAT-D is epistatic to LAT-D. Genetic cross between EAT-D and LAT-D plants, with the resultant Fl plants shown, along with their flowering time (measured as rosette leaf number).
- Figure 9 shows the loss-of-function At2g28550 (2-28550) and At5g60120 (6-60120) mutants. Location of T-DNA in each line is indicated, along with intron/exon structure.
- Figure 10 shows the potential function of the miR172 miRNA family, a, Temporal expression of miR172a-2 and its relatives may cause temporal downregulation of AP2 targets (e.g. At2g28550 and At5g60120), which may trigger flowering once the target proteins drop below a critical threshold (dotted line), b, Dicer cleavage at various positions may generate at least four distinct miRNAs from the miR172 family (indicated as a single hairpin with a miRNA consensus sequence).
- FIGS 1 IA-11C show an artificial microRNA (miRNA) designed to cleave the phytoene desaturase (PDS) mRNAs of Nicotiana benthamiana.
- Fig. 1 IA shows the structure of the pre-miR159a sequence construct under the control of the CaMV 35S promoter (35S) and NOS terminator (Tnos). The orientation and position of the mature miRNA is indicated by an arrow.
- HB shows that point mutations in miR159a (SEQ ID NO: 141) (indicated by arrows) turn it into m ⁇ R-PDS 159 * (SEQ ID NO: 142) to become fully complementary to a region in N. benthamiana PDS mR ⁇ A.
- Fig. 11C shows that Northern blot analysis of Agrobacterium infiltrated N. benthamiana leaves shows expression of miR-PDS 159a , miR-PDS l59a * and miR159 in samples infiltrated with an empty vector (vector) or the artificial miR ⁇ A (miR-PDS 159a ) 1, 2, 3 days post infiltration (d.p.i).
- FIGS 12A-12B show that miR-PDS m * (SEQ ID NO: 142) causes PDS mRNA (SEQ ID NO: 143) cleavage.
- Fig. 12 A shows Northern blot analysis of PDS mRNA from samples infiltrated with empty vector or miR-PDS l59a after 1 or 2 days post infiltration (d.p.i.) (upper panel). The bottom panel shows the EtBr-stained agarose gel from the same samples.
- Fig. 12B shows the site of cleavage of the miRNA. 5'RACE analysis was conducted on samples infiltrated with m ⁇ R-PDS i59a constructs and the 5'-end sequence of 5 out of 6 clones indicated the site of cleavage of the miRNA as indicated by an arrow.
- FIGS 13A-13E show that the expression of miR-PDS 169s results in cleavage of the PDS mRNA.
- Fig. 13A shows the point mutations (underlined nucleotides) in miR169g that it tarn it into miR-PDSa ms (SEQ ID NO: 145) or miR-PDSb mg (SEQ ID NO: 146) to become fully complementary to two different regions in N. benthamiana PDS mR ⁇ A.
- Fig. 13B shows Northern blot analysis of two different miR169g expression constructs.
- RNA was extracted from non-infiltrated leaves (C) or from leaves infiltrated with Agrobacterium containing the pre-miR169g sequence in the context of a 0.3kb (0.3kb) or 2.0kb (2.0kb) fragment, or from control Arabidopsis leaves (+).
- the arrow indicates the position of the miR169 signal.
- Fig. 13C shows Northern blot showing the expression of miR-PDS& mg (a) and miR-PDSb l69s (b) in infiltrated leaves containing the 0.3kb construct but not in control using the empty plasmid (vector).
- Fig. 13D shows the sites of cleavage of the miRNA.
- Fig. 13E shows a Northern blot analysis to detect PDS mRJSfA levels in plants infiltrated with Agrob ⁇ cterium strains carrying the empty vector (C) or constructs expressing miR-PDSa. 169 * (a) or miR-PDSb ms (b).
- Figures 14A-14C show the microRNA-directed cleavage of Nicoti ⁇ n ⁇ henth ⁇ mi ⁇ n ⁇ rbcS mRNAs.
- Fig. 14A shows that point mutations in miR159a (SEQ ID NO:141) ⁇ indicated by arrows) turn it into miR-rbcS m *-A (SEQ ID NO: 149) to become complementary to a region common to all N. benth ⁇ mi ⁇ n ⁇ rbcS mRNAs (shown as rbcS mRNA; SEQ ID NO: 150).
- miRNA:mRNA base-pairs are indicated by vertical lines and G:U wobble base-paixs by colons.
- FIG. 14B shows that Northern blot analysis of Agrob ⁇ cterium infiltrated N. benth ⁇ rni ⁇ n ⁇ leaves shows expression of miR-rbcS l59 *-A in samples infiltrated with an empty vector (C) or the artificial miRNA (A) 2 days post infiltration (d.p.i).
- Fig. 14C shows that RT-PCR analysis was used to detect rbcS mRNA abundance for all six genes in the same samples shown in B. Amplification of EFl ⁇ mRNA served as a loading control.
- Figures 15A-15B show the schematic representation of the genes and relevant sequences used in the work shown in Figures 11-14. Fig.
- FIG. 15A shows the PDJS gene from Lycopersicum esculetum that was used as reference sequence since the complete PDS gene from N. benth ⁇ mi ⁇ n ⁇ is not known (segments missing are shown as a dashed line). Large grey arrows indicate positions targeted by the rn.iR.-PDS constructs described in the text. Small arrowheads indicate primers used for 5'RACE analysis. Known N benth ⁇ mi ⁇ n ⁇ PDS fragments are indicated along with the origin of the sequences.
- Fig. 15B shows the different reported sequences that were used to assemble the rbcS gene sequence schematized here.
- FIG. 16A shows sequences of miR-PDS ]59a (SEQ ID ⁇ O: 142) and miR-rbcS l59& - A (SEQ ID NO: 149) as compared to miR159a (SEQ ID NO: 141). The base-changes in each case are underlined while unmodified positions are marked with an asterisk.
- Fig. 16A shows sequences of miR-PDS ]59a (SEQ ID ⁇ O: 142) and miR-rbcS l59& - A (SEQ ID NO: 149) as compared to miR159a (SEQ ID NO: 141). The base-changes in each case are underlined while unmodified positions are marked with an asterisk.
- Fig. 16A shows sequences of miR-PDS ]59a (SEQ ID ⁇ O: 142) and miR-rbcS l59& - A (SEQ ID NO: 149) as compared to miR159a (SEQ ID NO: 141).
- 16B shows sequences of miR-PDSa m& (SEQ ID NO: 145) and miR-PDSb mg (SEQ ID NO: 146) as compared to miR169g (SEQ ID NO: 144).
- the base-changes in each case are underlined while unmodified positions are marked with an asterisk.
- Figure 17 shows development of Arabidopsis root hairs in wildtype, mutant and transgenic plants.
- Panel A Wild type root shows many root hair structures.
- Panel B Very few root hair in cpc mutant.
- Panel C 35S::CPC plants show more root hairs.
- Panel D More root hair in gl2 mutant. This figure is taken from Wada et al. ((2002) Development 129:5409-5419).
- Figure 18 shows Arabidopsis root hair development in transgenic plants.
- Panel b XVE::pre-miRCPCl 159a with inducer (estradiol).
- Panel c XVE: :pre-miRl 59a without inducer (estradiol).
- Panel d XVEr.pre- miR159a with inducer (estradiol).
- Figure 19 shows Arabidopsis root hair development in transgenic plants.
- Figure 20 shows Arabidopsis root hair development in transgenic plants.
- Panel b 35S::pre-miRCPCl 159a .
- Figures 21A-21E represent a diagram for a process for designing a polymeric pre- miRNA.
- Fig. 2 IA The products of amplification of three different pre-miRNAs (pre-miR A, pre-miR B and pre-miR C) in which Avrll, Spel and Xhol sites have been added by amplification.
- Fig. 2 IB Pre-miR A is digested with Spel and Xhol and pre-miR B is digested with Avrll and Xhol.
- Fig. 21 C The digested pre-miR A and pre-miR B are ligated to form a dimeric pre-miRNA.
- Fig. 1 IA The products of amplification of three different pre-miRNAs (pre-miR A, pre-miR B and pre-miR C) in which Avrll, Spel and Xhol sites have been added by amplification.
- Fig. 2 IB Pre
- Pre-miR A-B is digested with Spel and Xhol and pre-miR C is digested with Avrll and Xhol.
- Fig. 2 IE The digested pre-miR A-B and pre-miR C are ligated to form a trimeric pre-miRNA.
- Figure 22 is a diagram of a dimeric construct containing pre-miRPDSl' 69g and pre- miRCPC3 159 ⁇ .
- Figures 23A and 23B show that mature miRPDSl' 69s (Fig. 23A) and miRCPC3 159 ⁇ (Fig. 23B) was successfully produced from the dimeric construct.
- Lane 1 is 35S::pre- miRPDSl 169g
- lane 2 is 35S::CPC3 l59a
- lane 3 is 35S::pre-miRPDSl 169g -CPC3 159 *.
- Figure 24 shows the structure of the miR159 ⁇ precursor (SEQ ID NO:161).
- Figure 25 shows Northern blot analysis of miR-HC-Pro 159 ⁇ were performed with three different treatments: (1) Agrob ⁇ cte ⁇ l cells with 35S: :pre-miR-HC-Pro l59 ⁇ ', (2) Agrob ⁇ cteri ⁇ l cells with 35S::HC-Pro, and (3) Agrob ⁇ cteri ⁇ l cells with 35S: :pre-miR-HC-Pro' 59 ⁇ and 35S::HC-Pro.
- Figure 26 shows shows Northern blot analysis of miR-P69, 4 different treatments were performed : (1) Agrobacterial cells carrying 35S:: pre-miR-P69 5 a , (2) Agrobacterial cells XVE::pre-miR-P69 159a , (3) Agrobacterial cells carrying 35S::P69, and (4) Agrobacterial cells carrying 35S::pre-miR-P69 I59a and 35S::P-69.
- Figure 27 shows Northern blot analysis of mature artificial miRNA levels for randomly picked T 2 35S: :pre-miRHC-Pro' 59a transgenic lines (plants). The T 2 plants are known to be transgenic because they were first selected on Kan-containing medium to remove WT.
- FIG. 28 shows Northern blot analysis of mature artificial miRNA levels for randomly picked T 2 35S: :pre-miR-P69 159a transgenic lines (plants).
- FIG. 29 shows that T 2 transgenic plants expressing miR-HC-Pro l59a artificial miRNA are resistant to TuMV infection. Photographs were taken 2 weeks (14 days after infection) after inoculation. T 2 transgenic plants expressing miR-HC-Pro a (line #11; Fig. 33B) developed normal influorescences whereas WT plants and T 2 transgenic plants expressing n ⁇ iR-P69 159a (line #1; Fig 33B) showed viral infection symptoms. The bar represents 3 cm. [0044] Figure 30 shows symptoms of influorescences caused by TuMV infection.
- T 2 transgenic miR-P69 159a plants (line #1) and col-0 plants showed shorter internodes between flowers in influoresences, whereas T 2 miR-HC-Pro 159a transgenic plant (line #11) displayed normal influoresences development. The bar represents 1 cm.
- Bottom panel Close-up views of influoresences on TuMV-infected Arabidopsis plants.
- T 2 transgenic miR-P69 I59a plants (line #1) and col-0 plants showed senescence and pollination defects whereas T 2 transgenic miR-HC-Pro 159a plants (line #11) showed normal flower and silique development. For mock-infection, plants were inoculated with buffer only. The bar represents 0.2 cm.
- Figure 31 shows symptoms of siliques caused by TuMV infection.
- T 2 transgenic miR-P69 159a plants line #1
- WT col-0
- siliques were small and mal-developed.
- T 2 transgenic miR-HC-Pro 159a plants line #11
- Buffer-inoculated plants were used as controls.
- the bar represents 0.5 cm.
- Figure 32 shows Western blot analysis of TuMV coat protein (CP) levels in leaves of different transgenic and WT plants.
- Figure 33 shows (A) Western blot analysis of representative plants of 35S:: miR-HC- Pro 159a , 35S:: miR-P69 I59a , and WT (Col-o) and (B) Northern blot analysis of miRNAs produced by the transgenic plants.
- Figure 34 shows ELISA detection of TuMV in different transgenic and non- transgenic Arabidopsis.
- Figure 35 shows Northern blot analysis o ⁇ p ⁇ Q-miR-P69 159a , p ⁇ e-miR-HC-Pro 159a and ⁇ p ⁇ e-miR-P69 I59a -HC-Pro !59a demonstrating that homo-dimeric miRNA precursor, p ⁇ e-miR- P69 I59a -HC-Pro 159a , can produce mature miR-P69 I59a and miR-HC-Pro l59a .
- Figure 36 shows constructs in which miR-HC-Pro 159a is placed in either intron 1 or intron 2 of the CPC gene.
- Figure 37 shows Northern blot analysis of the constructs of Figure 36 and demonstrates that intron 1 and intron 2 of the CPC transcript can be used to produce artificial miRNAs.
- Figure 38 shows constructs in which pre-miR-HC-Pro 159a is placed in either intron 1 or intron 2 and pre-miR-P69 159a is placed in either intron 2 or intron 1 of the CPC gene.
- Figure 39 shows Northern blot analysis of the constructs of Figure 38 and demonstrates that it is possible to use CPC introns to produce two different artificial miRNAs simultaneously in one transcript.
- the invention provides methods and compositions useful for suppressing targeted sequences.
- the compositions can be employed in any type of plant cell, and in other cells which comprise the appropriate processing components ⁇ e.g., RNA interference components), including invertebrate and vertebrate animal cells.
- RNA interference components e.g., RNA interference components
- the compositions and methods are based on an endogenous miRNA silencing process discovered in Arabidopsis, a similar strategy can be used to extend the number of compositions and the organisms in which the methods are used.
- compositions and methods described herein can be used in individual cells, cells or tissue in culture, or in vivo in organisms, or in organs or other portions of organisms.
- the compositions selectively suppress the target sequence by encoding a miRNA having substantial complementarity to a region of the target sequence.
- the miKNA is provided in a nucleic acid construct which, when transcribed into RNA, is predicted to form a hairpin structure which is processed by the cell to generate the miRNA, which then suppresses expression of the target sequence.
- a nucleic acid construct is provided to encode the miRNA for any specific target sequence. Any miRNA can be inserted into the construct, such that the encoded miRNA selectively targets and suppresses the target sequence.
- a method for suppressing a target sequence is provided. The method employs the constructs above, in which a miRNA is designed to a region of the target sequence, and inserted into the construct. Upon introduction into a cell, the miRNA produced suppresses expression of the targeted sequence.
- the target sequence can be an endogenous plant sequence, or a heterologous transgene in the plant.
- the target gene may also be a gene from a plant pathogen, such as a pathogenic virus, nematode, insect, or mold or fungus.
- a plant, cell, and seed comprising the construct and/or the miRNA is provided.
- the cell will be a cell from a plant, but other eukaryotic cells are also contemplated, including but not limited to yeast, insect, nematode, or animal cells.
- Plant cells include cells from monocots and dicots.
- the invention also provides plants and seeds comprising the construct and/or the miRNA. Viruses and prokaryotic cells comprising the construct are also provided.
- nucleic acid construct refers to an isolated polynucleotide which is introduced into a host cell.
- This construct may comprise any combination of deoxyribonucleotides, ribonucleotides, and/or modified nucleotides.
- the construct may be transcribed to form an RNA, wherein the RNA may be capable of forming a double-stranded RNA and/or hairpin structure.
- This construct may be expressed in the cell, or isolated or synthetically produced.
- the construct may further comprise a promoter, or other sequences which facilitate manipulation or expression of the construct.
- suppression or “silencing” or “inhibition” are used interchangeably to denote the down-regulation of the expression of the product of a target sequence relative to its normal expression level in a wild type organism. Suppression includes expression that is decreased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% relative to the wild type expression level.
- encodes or “encoding” refers to a DNA sequence which can be processed to generate an RNA and/or polypeptide.
- expression refers to the generation of an KNA transcript from an introduced construct, an endogenous DNA sequence, or a stably incorporated heterologous DNA sequence.
- the term may also refer to a polypeptide produced from an mRNA generated from any of the above DNA precursors.
- heterologous in reference to a nucleic acid is a nucleic acid tliat originates from a foreign species, or is synthetically designed, or, if from the same species , is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
- a heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.
- host cell is meant a cell which contains an introduced nucleic acid construct and supports the replication and/or expression of the construct. Host cells may be prokaryotic cells such as E.
- the host cells are monocotyledonous or dicotyledonous plant cells.
- An example of a monocotyledonous host cell is a maize host cell.
- the term "introduced" means providing a nucleic acid or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing.
- isolated refers to material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free from components which normally accompany or interact with the material as found in its naturally occurring environment or (2) if the material is in its natural environment, the material has been altered by deliberate human intervention to a composition and/or placed at a locus in the cell other than the locus native to the material.
- miRNA refers to an oligoribonucleic acid, which suppresses expression of a polynucleotide comprising the target sequence transcript or down regulates a target RNA.
- a “miRNA precursor” refers to a larger polynucleotide which is processed to produce a mature miRNA, and includes a DNA which encodes an RNA precursor, and an RNA transcript comprising the miRNA.
- a “mature miRNA” refers to the miRNA generated from the processing of a miRNA precursor.
- a “miRNA template” is an oligonucleotide region, or regions, in a nucleic acid construct which encodes the miRNA.
- the "backside” region of a miRNA is a portion of a polynucleotide construct which is substantially complementary to the miRNA template and is predicted to base pair with the miRNA template.
- the miRNA template and backside may form a double-stranded polynucleotide, including a hairpin structure.
- the mature miRNA and its complements may contain mismatches and form bulges and thus do not need to be fully complementary.
- Target sequence is used to mean the nucleic acid sequence that is selected for suppression of expression, and is not limited to polynucleotides encoding polypeptides.
- the target sequence comprises a sequence that is substantially or completely complementary to the miRNA.
- the target sequence can be RNA or DNA, and may also refer to a polynucleotide comprising the target sequence.
- nucleic acid means a polynucleotide and includes single or double- stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides.
- nucleic acid library is meant a collection of isolated DNA or RNA molecules which comprise and substantially represent the entire transcribed fraction of a genome of a specified organism or of a tissue from that organism. Construction of exemplary nucleic acid libraries, such as genomic and cDNA libraries, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol.
- operably linked includes reference to a functional linkage of at least two sequences. Operably linked includes linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
- plant includes plants and plant parts including but not limited to plant cells, plant tissue such as leaves, stems, roots, flowers, and seeds.
- polypeptide means proteins, protein fragments, modified proteins, amino acid sequences and synthetic amino acid sequences.
- the polypeptide can be glycosylated or not.
- promoter includes reference to a region of DNA that is involved in recognition and binding of an RNA polymerase and other proteins to initiate transcription.
- selectively hybridizes includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
- sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
- stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a probe will selectively hybridize to its target sequence. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
- a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
- stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 0 C for long probes (e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60 0 C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
- T m 81.5 0 C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 1O 0 C.
- stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- transgenic includes reference to a plant or a cell which comprises a heterologous polynucleotide.
- the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations.
- Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
- transgenic does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
- vector includes reference to a nucleic acid used in introduction of a polynucleotide of the invention into a host cell. Expression vectors permit transcription of a nucleic acid inserted therein.
- Polynucleotide sequences may have substantial identity, substantial homology, or substantial complementarity to the selected region of the target gene.
- substantially identity and “substantial homology” indicate sequences that have sequence identity or homology to each other.
- sequences that are substantially identical or substantially homologous will have about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity wherein the percent sequence identity is based on the entire sequence and is determined by GAP alignment ixsing default parameters (GCG, GAP version 10, Accelrys, San Diego, CA).
- GAP uses the algorithm of Needleman and Wunsch ((1970) J MoI Biol 48:443-453) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of sequence gaps. Sequences which have 100% identity are identical. "Substantial complementarity” refers to sequences that are complementary to each other, and are able to base pair with each other. In describing complementary sequences, if all the nucleotides in the first sequence will base pair to the second sequence, these sequences are fully complementary.
- nxiR172a-2 (Park et al. (2002) CurrBiol 12:1484-1495), causes early flowering and defects in floral organ identity when overexpressed.
- the predicted target of miR172a-2 is a small subfamily of APETALA2-like "transcription factors (Okamuro et al. (1997) Proc Natl Acad Sci USA 94:7076-7081). Overexpre ssion of miR172a-2 downregulates at least one member of this family.
- overexpre ssion of one of the AP2-like target genes, At2g28550 causes late flowering.
- This result in conjunction with loss- of-function analyses of At2g28550 and another target gene, At5g60120, imdicates that at least some of the AP2-like genes targeted by miR172a-2 normally function as floral repressors.
- the EAT-D line overexpressing miR172-a2 has a wild-type response to photoperiod.
- the genomic region encoding the miRNA was also identified (SEQ ID NO:1) and used to produce a cassette into which other miRNAs to target sequences can be inserted (SEQ ID NO: 3 ), and to produce an expression vector (SEQ ID NO:44) useful for cloning the cassettes and expxessing the miRNA.
- the expression vector comprises the 1.4kb region encoding the miRNA. Expression of this region is processed in the cell to produce the miRNA which suppresses exp ⁇ ession of the target gene. Alternatively, the miRNA may be synthetically produced and introduced to the cell directly.
- a method for the suppression of a target sequence comprising introducing into a cell a nucleic acid construct encoding a miRNA substantially complementary to the target.
- the miRTSfA comprises about 10-200 nucleotides, about 10-15, 15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides.
- the nucleic acid construct encodes the miRNA.
- the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
- nucleotides 39-59 and 107-127 of SEQ ID NO:3 are replaced by the backside of the miRNA template and the miRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1. In further embodiments, this new sequence replaces the equivalent region of SEQ ID NO:44.
- the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding regions with sequences designed to produce a miRNA directed to the target sequence.
- the miRNA precursor template is a miR172a miRNA precursor.
- the miR172a precursor is from a dicot or a monocot.
- the miR172a precursor is from Ar ⁇ hidopsis th ⁇ li ⁇ n ⁇ , tomato, soybean, rice, or corn.
- the miRNA precursor is SEQ ID NO: 1, SEQ ID NO:3, or SEQ ID NO:44.
- a method of inhibiting expression of a target sequence in a cell comprising:
- nucleic acid construct comprising a promoter operably linked to a polynucleotide, wherein the polynucleotide comprises in the following order: (i) at least about 20 and up to 38 contiguous nucleotides in the region of nucleotides 1-38 of SEQ ID NO: 3,
- the second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and the second oligonucleotide is substantially complementary to the target sequence, and
- the method comprises selecting a target sequence of a gene, and designing a nucleic acid construct comprising polynucleotide encoding a miRNA substantially complementary to the target sequence.
- the target sequence is selected from any region of the gene.
- the target sequence is selected from an untranslated region.
- the target sequence is selected from a coding region of the gene.
- the target sequence is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon.
- the target sequence and/or the miRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like genes in Arabidopsis thaliana.
- nucleotides 39-59 and 107-127 of SEQ ID NO:3 are replaced by the backside of the miRNA template (first oligonucleotide) and the miRNA template (second oligonucleotide) respectively.
- this new sequence replaces the equivalent region of SEQ ID NO: 1.
- this new sequence replaces the equivalent region of SEQ ID NO:44.
- the miRNA template i.e.
- the polynucleotide encoding the miRNA), and thereby the miRNA may comprise some mismatches relative to the target sequence.
- the miRNA template has > 1 nucleotide mismatch as compared to the target sequence, for example, the miRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the target sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the target sequence.
- the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the target sequence.
- the miRNA template (i.e. the polynucleotide encoding the miRNA) and thereby the miRNA, may comprise some mismatches relative to the miRNA backside.
- the miRNA template has > 1 nucleotide mismatch as compared to the miRNA backside, for example, the miRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the miRNA backside. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the miRNA backside.
- the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the miRNA backside.
- the target sequence is selected from a plant pathogen. Plants or cells comprising a miRNA directed to the target sequence of the pathogen are expected to have decreased sensitivity and/or increased resistance to the pathogen.
- the miRNA is encoded by a nucleic acid construct further comprising an operably linked promoter.
- the promoter is a pathogen-inducible promoter.
- the method comprises replacing the miRNA encoding sequence in the polynucleotide of SEQ ID NO:3 with a sequence encoding a miRNA substantially complementary to the target region of the target gene.
- a method comprising a method of inhibiting expression of a target sequence in a cell comprising:
- nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant miRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and (b) expressing the nucleic acid construct for a time sufficient to produce the miRNA, wherein the miRNA inhibits expression of the target sequence.
- a method comprising a method of inhibiting expression of a target sequence in a cell comprising:
- nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant miR172 miRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and
- the modified plant miR172 miRNA precursor is a modified Arabidopsis miR172 miRNA precursor, or a modified corn miR172 miRNA precursor or the like.
- nucleic acid construct for suppressing a target sequence.
- the nucleic acid construct encodes a miRNA substantially complementary to the target.
- the nucleic acid construct further comprises a promoter operably linked to the polynucleotide encoding the miRNA.
- the nucleic acid construct lacking a promoter is designed and introduced in such a way that it becomes operably linked to a promoter upon integration in the host genome.
- the nucleic acid construct is integrated using recombination, including site-specific recombination. See, for example, PCT International published application No. WO 99/25821, herein incorporated by reference.
- the nucleic acid construct is an RNA. In some embodiments, the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites. In some embodiments the nucleic acid construct comprises at least one recombination site in order to facilitate integration, modification, or cloning of the construct. In some embodiments the nucleic acid construct comprises two site- specific recombination sites flanking the miRNA precursor. In some embodiments the site- specific recombination sites include FRT sites, lox sites, or art sites, including attB, attL, attP or attR sites. See, for example, PCT International published application No. WO 99/25821, and U.S. Patents 5,888,732, 6,143,557, 6,171,861, 6,270,969, and 6,277,608, herein incorporated by reference.
- the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to the target sequence.
- the miRNA precursor template is a miR172a miRNA precursor.
- the miR172a precursor is from a dicot or a monocot.
- the miR172a precursor is from Arabidopsis thaliana, tomato, soybean, rice, or corn.
- the miRNA precursor is SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:44.
- the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide i is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
- the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant miR172 miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
- the modified plant miR172 miRNA precursor is a modified Arabidopsis miR172 miRNA precursor, or a modified corn miR172 miRNA precursor, or the like.
- the miRNA comprises about 10-200 nucleotides, about 10-15, 15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides.
- the nucleic acid construct encodes the miRNA.
- the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
- nucleotides 39-59 and/or 107-127 of SEQ ID NO: 3 are replaced by the backside of the miRNA template and the miRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1. In further embodiments, this new sequence replaces the equivalent region of SEQ ID NO:44.
- the target region is selected from any region of the target sequence. In some embodiments, the target region is selected from a untranslated region. In some embodiments, the target region is selected from a coding region of the target sequence.
- the target region is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon.
- the target region and/or the miRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like sequences in Arabidopsis thaliana.
- the nucleic acid construct comprises an isolated polynucleotide comprising in the following order at least 20 and up to 38 contiguous nucleotides in the region from nucleotides 1-38 of SEQ ID NO:3, a first oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, at least about 20 and up to 47 contiguous nucleotides in the region from nucleotides 60-106 of SEQ ID NO:3, a second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and the second oligonucleotide is substantially complementary to the target sequence, and at least about 20 and up to 32 contiguous nucleotides in the region from nucleotides 128-159 of SEQ ID NO:3, wherein the
- cells, plants, and seeds comprising the introduced polynucleotides, and/or produced by the methods of the invention.
- the cells include prokaryotic and eukaryotic cells, including but not limited to bacteria, yeast, fungi, viral, invertebrate, vertebrate, and plant cells.
- Plants, plant cells, and seeds of the invention include gynosperms, monocots and dicots, including but not limited to, for example, rice, wheat, oats, barley, millet, sorghum, soy, sunflower, safflower, canola, alfalfa, cotton, Arabidopsis, and tobacco.
- the cells, plants, and/or seeds comprise a nucleic acid construct comprising a modified plant miRNA precursor, wherein the precursor has " been modified to replace the endogenous miRNA encoding regions with sequences designed to produce a miRNA directed to the target sequence.
- the miRNA precursor template is a miR172a miRNA precursor.
- the miR172a precursor is from a dicot or a monocot.
- the miR172a precursor is from Arabidopsis thaliana, tomato, soybean, rice, or corn.
- the miRNA precursor is SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:44.
- the miRNA precursor is encoded by SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:44.
- the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites. In some embodiments the nucleic acid construct comprises at least one recombination site in order to facilitate modification or cloning of the construct. In some embodiments the nucleic acid construct comprises two site-specific recombination sites flanking the miRNA precursor. In some embodiments the site-specific recombination sites include FRT sites, lox sites, or art sites, including attB, attL, attP or attR sites. See, for example, PCT International published application No. WO 99/25821, and U.S. Patents 5,888,732, 6,143,557, 6,171 ,861, 6,270,969, and 6,277,608, herein incorporated by reference.
- a method for down regulating a target RNA comprising introducing into a cell a nucleic acid construct that encodes a miRNA that is complementary to a region of the target RNA.
- the miRNA is fully complementary to the region of the target RNA.
- the miRNA is complementary and includes the use of G-U base pairing, i.e. the GU wobble, to otherwise be fully complementary.
- the first ten nucleotides of the miRNA are fully complementary to a region of the target RNA and the remaining nucleotides may include mismatches and/or bulges with the target RNA.
- the miRNA comprises about 10-200 nucleotides, about 10-15, 15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides.
- the binding of the miRNA to the complementary sequence in the target RNA results in cleavage of the target RNA.
- the miRNA is a miRNA that has been modified such that the miRNA is fully complementary to the target sequence of the target RNA.
- the miRNA is an endogenous plant miRNA that has been modified such that the miRNA is fully complementary to the target sequence of the target RNA.
- the polynucleotide encoding the miRNA is operably linked to a promoter.
- the nucleic acid construct comprises a promoter operably linked to the miRNA.
- the nucleic acid construct encodes the miRNA. In some embodiments, the nucleic acid construct comprises a promoter operably linked to the miRNA. In some embodiments, the nucleic acid construct encodes a polynucleotide which may form a double-stranded RNA, or hairpin structure comprising the miRNA. In some embodiments, the nucleic acid construct comprises a promoter operably linked to the polynucleotide which may form a double-stranded RNA, or hairpin structure comprising the miRNA. In some embodiments, the nucleic acid construct comprises an endogenous plant miRNA precursor that has been modified such that the miRNA is fully complementary to the target sequence of the target RNA.
- the nucleic acid construct comprises a promoter operably linked to the miRNA precursor.
- the nucleic acid construct comprises about 50 nucleotides to about 3000 nucleotides, about 50-100, 100-150, 150-200, 200-250, 250- 300, 300-350, 350-400, 400-450, 450-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000, 2000-2100, 2100-2200, 2200-2300, 2300-2400, 2400-2500, 2500-2600, 2600-2700, 2700-2800, 2800-2900 or about 2900-3000 nucleotides.
- the nucleic acid construct lacking a promoter is designed and introduced in such a way that it becomes operably linked to a promoter upon integration in the host genome.
- the nucleic acid construct is integrated using recombination, including site-specific recombination.
- the nucleic acid construct is an RNA.
- the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
- the nucleic acid construct comprises at least one recombination site in order to facilitate integration, modification, or cloning of the construct.
- the nucleic acid construct comprises two site-specific recombination sites flanking the miRNA precursor.
- the method comprises a method for down regulating a target RNA in a cell comprising introducing into the cell a nucleic acid construct that encodes a miRNA that is complementary to a region of the target RNA and expressing the nucleic acid construct for a time sufficient to produce miRNA, wherein the miRNA down regulates the target RNA.
- the miRNA is fully complementary to the region of the target RNA.
- the miRNA is complementary and includes the use of G-U base pairing, i.e. the GU wobble, to otherwise be fully complementary.
- the method comprises selecting a target RNA, selecting a miRNA, comparing the sequence of the target RNA (or its DNA) with the sequence of the miRNA, identifying a region of the target RNA (or its DNA) in which the nucleotide sequence is similar to the nucleotide sequence of the miRNA, modifying the nucleotide sequence of the miRNA so that it is complementary to the nucleotide sequence of the identified region of the target RNA and preparing a nucleic acid construct comprising the modified miRNA.
- the miRNA is fully complementary to the identified region of the target RNA.
- the miRNA is complementary and includes the use of G-U base pairing, i.e.
- a nucleic acid construct encodes a polynucleotide which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
- a nucleic acid construct comprises a precursor of the miRNA, i.e., a pre-miRNA that has been modified in accordance with this embodiment.
- the method comprises selecting a target RNA, selecting a nucleotide sequence within the target RNA, selecting a miRNA, modifying the sequence of the miRNA so that it is complementary to the nucleotide sequence of the identified region of the target RNA and preparing a nucleic acid construct comprising the modified miRNA.
- the miRNA is fully complementary to the identified region of the target RNA.
- the miRNA is complementary and includes the use of G-U base pairing, i.e. the GU wobble, to otherwise be fully complementary.
- a nucleic acid construct encodes a polynucleotide which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
- a nucleic acid construct comprises a precursor of the miRNA, i.e., a pre-miRNA that has been modified in accordance with this embodiment.
- the miRNA is a miRNA disclosed in the microRNA registry, now also known as the miRBase Sequence Database (Griffiths-Jones (2004) Nucl Acids Res 32, Database issue:D109-Dl l l; http://microrna.sanger.ac.uk/).
- the miRNA is ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath- MIRl 56g, ath-MIR156h, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, afn- MIR158a, ath-MIR158b, ath-MIR159a, ath-MIR159b, ath-MIR159c, ath-MIR160a, ath- MIRlOOb, ath-MIR160c, ath-MIR161, ath-MIR162a, ath-MIR162b, ath-MIR163, ath-MIR164a, ath-MIR164b, ath-MIR164c, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIRl
- the miRNA is a miRNA disclosed in Genbank (USA), EM-BL (Europe) or DDBJ (Japan).
- the miRNA is selected from one of the following Genbank accession numbers: AJ505003, AJ505002, AJ505001, AJ4968O5, AJ496804, AJ496803, AJ496802, AJ496801, AJ505004, AJ493656, AJ493655, AJ493654, AJ493653, AJ493652, AJ493651, AJ493650, AJ493649, AJ493648, AJ493647, AJ493646, AJ493645, AJ493644, AJ493643, AJ493642, AJ493641, AJ493640, AJ493639, AJ493538, AJ493637, AJ493636, AJ493635, AJ493634, AJ493633, AJ493632,
- the miRNA is selected from one of the sequences disclosed in U.S. published patent application No. 2005/0144669 Al, incorporated herein by reference. [0114] In some embodiments, the above miRNAs, as well as those disclosed herein, ha.ve been modified to be directed to a specific target as described herein. [0115] In some embodiments the target RNA is an RNA of a plant pathogen, such as a plant virus or plant viroid. In some embodiments, the miRNA directed against the plant pathogen RNA is operably linked to a pathogen-inducible promoter. In some embodiments, the target RNA is an mRNA.
- the target sequence in an mRNA may be a non-coding sequence (such as an intron sequence, 5' untranslated region and 3' untranslated regeion), a coding sequence ox a sequence involved in mRNA splicing.
- a non-coding sequence such as an intron sequence, 5' untranslated region and 3' untranslated regeion
- a coding sequence ox a sequence involved in mRNA splicing a sequence involved in mRNA splicing.
- Targeting the miRNA to an intron sequence compromises the maturation of the mRNA.
- Targeting the miRNA to a sequence involved, in mRNA splicing influences the maturation of alternative splice forms providing different protein isoforms.
- the cells, plants, and/or seeds comprise a nucleic acid construct comprising a modified plant miRNA precursor, as described herein.
- the modified plant miRNA precursor in the nucleic acid construct is operably linked to a promoter.
- the promoter may be any well known promoter, including constitutive promoters, inducible promoters, derepressible promoters, and the like, such as described below.
- the cells include prokaryotic and eukaryotic cells, including but not limited to bacteria, yeast, fungi, viral, invertebrate, vertebrate, and plant cells.
- Plants, plant cells, and seeds of the invention include gynosperms, monocots and dicots, including but not limited to, rice, wheat, oats, barley, millet, sorghum, soy, sunflower, safflower, canola, alfalfa, cotton, Arabidopsis, and tobacco.
- a method for down regulating multiple target RNAs comprising introducing into a cell a nucleic acid construct encoding a multiple number of miRNAs.
- One miRNA in the multiple miRNAs is complementary to a region of one of the target RNAs.
- a miRNA is fully complementary to the region of the target RNA.
- a miRNA is complementary and includes the use of G- U base pairing, i.e. the GU wobble, to otherwise be fully complementary.
- the first ten nucleotides of the miRNA are fully complementary to a region of the target RNA and the remaining nucleotides may include mismatches and/or bulges with the target RNA.
- a miRNA comprises about 10-200 nucleotides, about 10-15, 15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25- 30, 30-50, 50-100, 100-150, or about 150-200 nucleotides.
- the binding of a miRNA to its complementary sequence in the target RNA results in cleavage of the target RNA.
- the miRNA is a miRNA that has been modified such that the miRNA is fully complementary to the target sequence of the target RNA.
- the miRNA is an endogenous plant miRNA that has been modified such that the miRNA is fully complementary to the target sequence of the target RNA.
- the miRNA is operably linked to a promoter.
- the multiple miRNAs are linked one to another so as to form a single transcript when expressed.
- the nucleic acid construct comprises a promoter operably linked to the miRNA.
- the nucleic acid construct encodes miRNAs for suppressing a multiple number of target sequences.
- the nucleic acid construct encodes at least two miRNAs.
- each miRNA is substantially complementary to a target or which is modified to be complementary to a target as described herein.
- the nucleic acid construct encodes for 2-30 or more miRNAs, for example 3-40 or more miRNAs, for example 3-45 or more miRNAs, and for further example, multimers of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or more miRNAs.
- the multiple miRNAs are linked one to another so as to form a single transcript when expressed.
- polymeric pre-miRNAs that are artificial miRNA precursors consisting of more than one miRNA precursor units are provided.
- the polymeric pre-miRNAs can either be hetero-polymeric with different miRNA precursors, or homo-polymeric containing several units of the same miRNA precursor.
- the Examples demonstrate that hetero-polymeric pre-miRNAs are able to produce different mature artificial miRNAs.
- pre-miR- PDSl' 69g -CPC3 159a which is a dimer comprising of pre-miR-CPC3 159a and pre-miR-PDSl 169g can produce mature miR-PDSl 1698 and miR-CPC3 159a when expressed in plant cells.
- the Examples also demonstrate that homo-polymeric miRNA precursors are able to produce different mature artificial miRNAs.
- pre-miR-P69 i ' 59a -HC-Pro' ' 59a which is a dimer comprising pre-miR-P69 159a and pre-miR-HC-Pro 159a
- pre-miR-P69 i ' 59a -HC-Pro' ' 59a can produce mature miR-P69 159a and miR-HC-Pro a
- hetero- or homo-polymeric pre-miRNAs are produced that contain any number of monomer units, such as described herein.
- An exemplary method for preparing a nucleic acid construct comprising multiple pre-miRNAs under the control of a single promoter is shown in Examples 21 and 27. Each mature miRNA is properly processed from the nucleic acid construct as demonstrated in Examples 22 and 27.
- the nucleic acid construct comprises multiple polynucleotides, each polynucleotide encoding a separate miRNA precursor, i.e., a separate pre-miRNA.
- the polynucleotides are operably linked one to another such that they may be placed under the control of a single promoter.
- the multiple polynucleotides are linked one to another so as to form a single transcript containing the multiple pre-miRNAs when expressed.
- the single transcript is processed in the host cells to produce multiple mature miRNAs, each capable of downregulating its target gene.
- transcripts of 8-10 kb can be produced in plants.
- a nucleic acid construct comprising multimeric polynucleotides encoding 2-30 or more pre-miRNAs, for example 3-40 or more pre-miRNAs, for example 3-45 or more pre- miRNAs, and for further example, multimers of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or more pre-miRNAs.
- the nucleic acid construct further comprises a promoter operably linked to the polynucleotide encoding the multiple number of miRNAs.
- the nucleic acid construct lacking a promoter is designed and introduced in such a way that it becomes operably linked to a promoter upon integration in the host genome.
- the nucleic acid construct is integrated using recombination, including site- specific recombination. See, for example, PCT International published application No. WO 99/25821, herein incorporated by reference.
- the nucleic acid construct is an RNA.
- the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
- the nucleic acid construct comprises at least one recombination site in order to facilitate integration, modification, or cloning of the construct.
- the nucleic acid construct comprises two site-specific recombination sites flanking the miRNA precursor.
- the site-specific recombination sites include FRT sites, lox sites, or att sites, including attB, attL, attP or attR sites. See, for example, PCT International published application No. WO 99/25821, and U.S. Patents 5,888,732, 6,143,557, 6,171,861, 6,270,969, and 6,277,608, herein incorporated by reference.
- the pre-miRNA is inserted into an intron in a gene or a transgene of a cell or plant. If the gene has multiple introns, a pre-miRNA, which can be the same or different, can be inserted into each intron. In some embodiments the pre-miRNA inserted into an intron is a polymeric pre-miRNA, such as described herein. During RNA splicing, introns are released from primary RNA transcripts and therefore, as illustrated herein, can serve as precursors for miRNAs. Most introns contain a splicing donor site at the 5' end, splicing acceptor site at the 3' end and a branch site within the intron.
- the branch site is important for intron maturation -- without it, an intron can not be excised and released from the primary RNA transcript.
- a branch site is usually located 20-50 nt upstream of the splicing acceptor site, whereas distances between the splice donor site and the branch site are largely variable among different introns.
- the pre-miRNA is inserted into an intron between the splicing donor site and the branch site.
- the target RNA is an RNA of a plant pathogen, such as a plant virus or plant viroid.
- the miRNA directed against the plant pathogen RNA is operably linked to a pathogen-inducible promoter.
- the target RNA is an mRNA.
- the target sequence in an mRNA may be an intron sequence, a coding sequence or a sequence involved in mRNA splicing. Targeting the miRNA to an intron sequence compromises the maturation of the mRNA. Targeting the miRNA to a sequence involved in mRNA splicing influences the maturation of alternative splice forms providing different protein isoforms.
- the target includes genes affecting agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and commercial products.
- cells, plants, and seeds comprising the nucleic acid construct encoding multiple miRNAs of the invention, and/or produced by the methods of the invention.
- the cells, plants, and/or seeds comprise a nucleic acid construct comprising multiple polynucleotides, each encoding a plant miRNA precursor, as described herein.
- the multiple polynucleotides are operably linked to a promoter.
- the promoter may be any well known promoter, including constitutive promoters, inducible promoters, derepressible promoters, and the like, such as described below.
- the polynucleotides encoding the miRNA precursors are linked together.
- the multiple polynucleotides are linked one to another so as to form a single transcript containing the multiple pre-miRNAs when expressed in the cells, plants or seeds.
- the cells include prokaryotic and eukaryotic cells, including but not limited to bacteria., yeast, fungi, viral, invertebrate, vertebrate, and plant cells.
- Plants, plant cells, and seeds of the invention include gynosperms, monocots and dicots, including but not limited to, rice, wheat, oats, barley, millet, sorghum, soy, sunflower, safflower, canola, alfalfa, cotton, Arabidopsis, and tobacco.
- the present invention concerns methods and compositions useful in suppression of a target sequence and/or validation of function.
- the invention also relates to a method for using microRNA (miRNA) mediated RNA interference (RNAi) to silence or suppress a target sequence to evaluate function, or to validate a target sequence for phenotypic effect and/or trait development.
- miRNA microRNA
- RNAi RNA interference
- constructs comprising small nucleic acid molecules, miRNAs, capable of inducing silencing, and methods of using these miRNAs to selectively silence target sequences.
- RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al.
- post- transcriptional gene silencing RNA silencing
- quelling in fungi.
- the process of post-transcriptional gene silencing is thought to be an evolutionarily- conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al. (1999) Trends Genet. 15:358-363).
- Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA of viral genomic RNA.
- dsRNAs double-stranded RNAs
- the presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized.
- the presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Bernstein et al.
- Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir et al. (2001) Genes Dev 15:188-200). Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al. (2001) Science 293:834-838).
- stRNAs small temporal RNAs
- RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al. (2001) Genes Dev 15:188-200).
- RISC RNA-induced silencing complex
- RNA interference can also involve small RNA (e.g., microRNA, or miRNA) mediated gene silencing, presumably through cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see, e.g., Allshire, Science 297: 1818-1819 2002; Volpe et al. (2002) Science 297: 1833-1837; Jenuwein (2002) Science 297:2215-2218; Hall et al. (2002) Science 297:2232-2237).
- miRNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional or post-transcriptional level.
- RNAi has been studied in a variety of systems. Fire et al. ((1998) Nature 391:806- 811) were the first to observe RNAi in C. elegans. Wianny and Goetz ((1999) Nature Cell Biol 2:70) describe RNAi mediated by dsRNA in mouse embryos. Hammond et al. ((2000) Nature 404:293-296) describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al. ((2001) Nature 411 :494-498) describe RNAi induced by introduction of duplexes of synthetic 21 -nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
- Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.
- RNAs appear to function by base-pairing to complementa ⁇ y RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.
- RNA cleavage it is thought that sequence complementarity between small RNA.S and their RNA targets helps to determine which mechanism, RNA cleavage or translational inhibition, is employed. It is believed that siRNAs, which are perfectly complementary with their targets, work by RNA cleavage. Some miRNAs have perfect or near-perfect complementarity with their targets, and RNA cleavage has been demonstrated for at least a few of these miRNAs. Other miRNAs have several mismatches with their targets, and apparently inhibit their targets at the translational level.
- miRNA 172 microRNA 172 in plants.
- One of the targets of miR172 is APET ALA2 (AP2), and although miR172 shares near-perfect complementarity with AP2 it appears to cause translational inhibition of AP2 rather than RNA cleavage.
- MicroRNAs are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al. (2001) Science 294:853-858, Lagos-Quintana et al. (2002) Curr Biol 12:735-739; Lau et al. (2002) Science 294:858-862; Lee and Ambros (2001) Science 294:862-864; Llave et al. (2002) Plant Cell 14:1605-1619; Mourelatos et al. (2002) Genes Dev 16:720-728; Park et al.
- RNAse Ill-like protein Grishok et al. (2001) Cell 106:23-34; Hutvagner et al. (2001) Science 293:834-838; Ketting et al. (2001) Genes Dev 15:2654-2659).
- Plants also have a Dicer-like enzyme, DCLl (previously named CARPEL FACTORY/SHORT INTEGUMENTS 1/ SUSPENSOR1), and recent evidence indicates that it, like Dicer, is involved in processing the hairpin precursors to generate mature miRNAs (Park et al. (2002) Curr Biol 12: 1484-1495; Reinhart et al. (2002) Genes Dev 16:1616- 1626). Furthermore, it is becoming clear from recent work that at least some miRNA hairpin precursors originate as longer polyadenylated transcripts, and several different miRNAs and associated hairpins can be present in a single transcript (Lagos-Quintana et al.
- DCLl Dicer-like enzyme
- MicroRNAs appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes.
- the target sites are located in the 3' UTRs of the target mRNAs (Lee et al. (1993) Cell 75:843-854; Wightman et al (1993) Cell 75:855-862; Reinhart et al. (2000) Nature 403:901-906; Slack et al. (2000) MoI Cell 5:659-669), and there are several mismatches between the lin-4 and let-7 miRNAs and their target sites.
- Binding of the lin-4 or let-7 miRNA appears to cause downregulation of steady-state levels of the protein encoded by the target mRNA without affecting the transcript itself (Olsen and Ambros (1999) Dev Biol 216:671-680).
- miRNAs can, in some cases, cause specific RNA cleavage of the target transcript within the target site, and this cleavage step appears to require 100% complementarity between the miRNA and the target transcript (Hutvagner and Zamore (2002) Science 297:2056-2060; Llave et al. (2002) Plant Cell 14: 1605-1619), especially within the first ten nucleotides (counting from the 5' end of the miRNA).
- miRNAs can enter at least two pathways of target gene regulation. Protein downregulation when target complementarity is ⁇ 100%, and RNA cleavage when target complementarity is 100%. MicroRNAs entering the RNA cleavage pathway are analogous to the 21-25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants (Hamilton and Baulcombe (1999) Science 286:950-952; Hammond et al, (2000) Nature 404:293-296; Zamore et al., (2000) Cell 31:25-33; Elbashir et al, (2001) Nature 411 :494-498), and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.
- siRNAs short interfering RNAs
- PTGS posttranscriptional gene silencing
- the methods provided can be practiced in any organism in which a method of transformation is available, and for which there is at least some sequence information for the target sequence, or for a region flanking the target sequence of interest. It is also understood that two or more sequences could be targeted by sequential transformation, co-transformation with more than one targeting vector, or the construction of a DNA construct comprising more than one miRNA sequence.
- the methods of the invention may also be implemented by a combinatorial nucleic acid library construction in order to generate a library of miRNAs directed to random target sequences.
- the library of miRNAs could be used for high-throughput screening for gene function validation.
- sequences of interest include, for example, those genes involved in regulation or information, such as zinc fingers, transcription factors, homeotic genes, or cell cycle and cell death modulators, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins.
- Target sequences further include coding regions and non-coding regions such as promoters, enhancers, terminators, introns and the like, which may be modified in order to alter the expression of a gene of interest.
- an intron sequence can be added to the 5' region to increase the amount of mature message that accumulates (see for example Buchman and Berg (1988) MoI Cell Biol 8:4395-4405); and Callis et al. (1987) Genes Dev 1 : 1183-1200).
- the target sequence may be an endogenous sequence, or may be an introduced heterologous sequence, or transgene.
- the methods may be used to alter the regulation or expression of a transgene, or to remove a transgene or other introduced sequence such as an introduced site-specific recombination site.
- the target sequence may also be a sequence from a pathogen, for example, the target sequence may be from a plant pathogen such as a virus, a mold or fungus, an insect, or a nematode.
- a miRNA can be expressed in a plant which, upon infection or infestation, would target the pathogen and confer some degree of resistance to the plant.
- the Examples herein demonstrate the techniques to design artificial miRNAs to confer virus resistance/tolerance to plants.
- two or more artificial miRNA sequences directed against different seqeuences of the virus can be used to prevent the target virus from mutating and thus evading the resistance mechanism.
- sequences of artifical miRNAs can be selected so that they target a critical region of the viral RNA (e.g. active site of a silencing gene suppressor). In this case, mutation of the virus in this selected region may render the encoded protein inactive, thus preventing mutation of the virus as a way to escape the resistance mechanism.
- an artifical miRNA directed towards a conserved sequence of a family of viruses would confer resistance to members of the entire family.
- an artifical miRNA directed towards a sequence conserved amongst members of would confer resistance to members of the different viral families (e.g, see Table 1).
- target sequences include genes affecting agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and commercial products. Genes of interest also include those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting, for example, kernel size, sucrose loading, and the like. The quality of grain is reflected in traits such as levels and types of oils, saturated and unsaturated, quality and quantity of essential amino acids, and levels of cellulose. For example, genes of the phytic acid biosynthetic pathway could be suppressed to generate a high available phosphorous phenotype.
- phytic acid biosynthetic enzymes including inositol polyphosphate kinase-2 polynucleotides, disclosed in WO 02/059324, inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides, disclosed in WO 03/027243, and myo-inositol 1- phosphate synthase and other phytate biosynthetic polynucleotides, disclosed in WO 99/05298, all of which are herein incorporated by reference.
- Genes in the lignification pathway could be suppressed to enhance digestibility or energy availability.
- Genes affecting cell cycle or cell death could be suppressed to affect growth or stress response.
- Genes affecting DNA repair and/or recombination could be suppressed to increase genetic variability. Genes affecting flowering time could be suppressed, as well as genes affecting fertility. Any target sequence could be suppressed in order to evaluate or confirm its role in a particular trait or phenotype, or to dissect a molecular, regulatory, biochemical, or proteomic pathway or network. [0141] A number of promoters can be used, these promoters can be selected based on the desired outcome. It is recognized that different applications will be enhanced by the use of different promoters in plant expression cassettes to modulate the timing, location and/or level of expression of the miRNA.
- Such plant expression cassettes may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
- a promoter regulatory region e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression
- a transcription initiation start site e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression
- a transcription initiation start site e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression
- RNA processing signal e.g., RNA processing signal
- constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or T- promoter derived from T-DNA of Agrobacterium tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Patent No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter, the GRPl -8 promoter and other transcription initiation regions from various plant genes known to those of skill. If low level expression is desired, weak promoter(s) may be used.
- Weak constitutive promoters include, for example, the core promoter of the Rsyn7 promoter (WO 99/43838 and U.S. Patent No. 6,072,050), the core 35S CaMV promoter, and the like.
- Other constitutive promoters include, for example, U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142. See also, U.S. Patent No. 6,177,611, herein incorporated by reference.
- inducible promoters examples include the Adhl promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, the PPDK promoter and the PEP (phophoenol pyruvate) carboxylase promoter which are both inducible by light. Also useful are promoters which are chemically inducible, such as the In2-2 promoter which is safener induced (U.S. Patent No. 5,364,780), the ERE promoter which is estrogen induced, and the Axigl promoter which is auxin induced and tapetum specific but also active in callus (PCT International published application No. WO 02/04699). Other examples of inducible promoters include the GVG and XVE promoters, which are induced by glucocorticoids and estrogen, respectively (U.S. Patent No. 6,452,068).
- promoters under developmental control include promoters that initiate transcription preferentially in certain tissues, such as leaves, roots, fruit, seeds, or flowers.
- An exemplary promoter is the anther specific promoter 5126 (U.S. Patent Nos. 5,689,049 and 5,689,051).
- seed-preferred promoters include, but are not limited to, 27 kD gamma zein promoter and waxy promoter ( Boronat et al. (1986) Plant Sci 47:95-102; Reina et al. (1990) NMC/ Acids Res 18(21):6426; Kloesgen et al. (1986) MoI. Gen. Genet. 203:237-244).
- an inducible promoter particularly from a pathogen-inducible promoter.
- promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-l,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645- 656; and Van Loon (1985) Plant MoI. Virol. 4:111-116. See also PCT International published application No.
- WO 99/43819 herein incorporated by reference.
- promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau et al. (1987) Plant MoI Biol 9:335-342; Matton et al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc Natl Acad Sci USA 83:2427-2430; Somsisch et al (1988) MoI Gen Genet 2:93-98; and Yang (1996) Proc Natl Acad Sci USA 93:14972-14977. See also, Chen et al. (1996) Plant J 10:955-966; Zhang et al.
- a wound-inducible promoter may be used in the constructions of the polynucleotides.
- Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann Rev Phytopath 28:425-449; Duan et al. (1996) Nature Biotech 14:494-498); wunl and wun2, U.S. Patent No. 5,428,148; winl and win2 (Stanford et al. (1989) MoI Gen Genet 215:200-208); systemin (McGurl et al.
- Chemical-regulated promoters can be used to modulate the expression of a gene ixi a plant through the application of an exogenous chemical regulator.
- the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
- Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- Ia promoter, which is activated by salicylic acid.
- promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducit>le promoter in Schena et al. (1991) Proc Natl Acad Sci USA 88:10421-10425 and McNellis et al. (1998) Plant J 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) MoI Gen Genet 227:229-237, and U.S. Patent NTos. 5,814,618 and 5,789,156), herein incorporated by reference.
- Tissue-preferred promoters can be utilized to target enhanced expression of a sequence of interest within a particular plant tissue.
- Tissue-preferred promoters include Yamamoto et al. (1997) Plant J 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol 38(7):792-803; Hansen et al. (1997) MoI Gen Genet 254(3):337-343; Russell et al. (1997) Transgenic Res 6(2): 157-168; Rinehart et al. (1996) Plant Physiol 112(3):1331-1341 ; Van Camp et al. (1996) Plant Physiol 112(2):525-535; Canevascini et al.
- Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant MoI Biol 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10): 1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant MoI Biol 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al.
- MAS mannopine synthase
- the promoters of these genes were linked to a ⁇ -glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tahacum and the legume Lotus corniculatus, and in both instances root-specific promoter activity was preserved.
- Leach and Aoyagi ((1991) Plant Science (Limerick) 79(l):69-76) describe their analysis of the promoters of the highly expressed rolC and rolD root-inducing genes of Agrobacterium rhizogenes. They concluded that enhancer and tissue-preferred DNA determinants are dissociated in those promoters. Teeri et al.
- EMBO J 8(2):343-350 used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2' gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene.
- the TRl' gene, fused to nptll (neomycin phosphotransferase II) showed similar characteristics.
- Additional root- preferred promoters include the VfENOD-GRP3 gene promoter (Kuster et al.
- Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing the DNA construct include microinjection (Crossway et al. (1986) Biotechniques 4:320-334; and U.S. Patent No. 6,300,543), sexual crossing, electroporation (Riggs et al. (1986) Proc Natl Acad Sci USA 83:5602-5606), Agrobacterium-mediated transformation (Townsend et al., U.S. Pat No. 5,563,055; and U.S. Patent No.
- nucleotide constructs may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that useful promoters encompass promoters utilized for transcription by viral RNA polymerases.
- transient expression may be desired.
- standard transient transformation techniques may be used. Such methods include, but are not limited to viral transformation methods, and microinjection of DNA or RNA, as well other methods well known in the art.
- the cells from the plants that have stably incorporated the nucleotide sequence may be grown into plants in accordance with conventional ways.
- Gene targeting can be performed without selection if there is a sensitive method for identifying recombinants, for example if the targeted gene modification can be easily detected by PCR analysis, or if it results in a certain phenotype. However, in most cases, identification of gene targeting events will be facilitated by the use of markers.
- Useful markers include positive and negative selectable markers as well as markers that facilitate screening, such as visual markers.
- Selectable markers include genes carrying resistance to an antibiotic such as spectinomycin (e.g. the aada gene, Svab et al. (1990) Plant MoI Biol 14: 197-205), streptomycin (e.g., aada, or SPT, Svab et al.
- Negative selectable markers include cytosine deaminase (codA) (Stougaard (1993) Plant J. 3:755-761), tms2 (DePicker et al.
- reporter enzymes such as ⁇ -glucuronidase (GUS) (Jefferson (1987) Plant MoI Biol Rep 5:387; U.S. Patent No. 5,599,670; U.S. Patent No. 5,432,081), ⁇ -gakctosidase (lacZ), alkaline phosphatase (AP), glutathione S-transferase (GST) and luciferase (O.S. Patent No. 5,674,713; Ow et al.
- GUS ⁇ -glucuronidase
- lacZ alkaline phosphatase
- AP alkaline phosphatase
- GST glutathione S-transferase
- luciferase O.S. Patent No. 5,674,713; Ow et al.
- markers like anthocyanins such as CRC (Ludwig et al. (1990) Science 247:449-450) R gene family (e.g. Lc, P, S), A, C, R-nj, body and/or eye color genes in Drosophila, coat color genes in mammalian systems, and others known in the art.
- CRC Long et al. (1990) Science 247:449-450
- R gene family e.g. Lc, P, S
- A C, R-nj, body and/or eye color genes in Drosophila, coat color genes in mammalian systems, and others known in the art.
- One or more markers may be used in order to select and screen for gene targeting events.
- One common strategy for gene disruption involves iasing a target modifying polynucleotide in which the target is disrupted by a promoterless selectable marker. Since the selectable marker lacks a promoter, random integration events are unlikely to lead to transcription of the gene.
- Gene targeting events will put the selectable marker under control of the promoter for the target gene. Gene targeting events are identified " by selection for expression of the selectable marker.
- Another common strategy utilizes a positive-negative selection scheme. This scheme utilizes two selectable markers, one that confers resistance (R+) coupled with one that confers a sensitivity (S+), each with a promoter. When this polynucleotide is randomly inserted, the resulting phenotype is R+/S+. When a gene targeting event is generated, the two markers are uncoupled and the resulting phenotype is R-+/S-. Examples of using positive-negative selection are found in Thykj ⁇ er et al. (1997) Plant MoI Biol 35:523-530; and PCT International published application No. WO 01/66717, which are herein incorporated by reference.
- EXAMPLE 1 The example describes the identification of a microRNA [0161] The following experiments are carried out on the Arabidopsis thaliancz CoI-O ecotype. Plants are grown in long days (16 h light, 8 h dark) under cool white light at 22° C. [0162] Arabidopsis plants are transformed by a modified version of the floral dip method, in which Agrobacterium cell suspension is applied to plants by direct watering from above. The T- DNA vector used, pHSbarENDs, contained four copies of the CAMV 35S enhancer adjacent to the right border, an arrangement similar to that described by Weigel et al. ⁇ Plant Physiol. 122:1003-1013, 2000).
- Transformed plants are selected with glufosinate (BAST-A) and screened for flowering time, which resulted in the identification of the early-flowering EA-T-D mutant.
- BAST-A glufosinate
- a single T-DNA cosegregating with early flowering is identified in EAT-D, and TAIL-PCR is performed to amplify sequences adjacent to the left and right borders of the T-DNA.
- TAIL-PCR is performed to amplify sequences adjacent to the left and right borders of the T-DNA.
- Northern blots containing RNA extracted from wild type (Col-0) and EAT-D plants is probed.
- Probes for the genes At5g04270 and At5gO4280 do not detect any difference between wild type and EAvT-D, whereas a probe from the intergenic region identifies an ⁇ 1.4 kb transcript that is expressed, at significantly higher levels in EAT-D than in wild type.
- EAT cDNA 5'- and 3'-RACE-PCR is performed with a GeneRacer kit (Invitrogen) that selects for 5'-capped mRNAs. Reverse transcription is carried out using an oligo-dT primer, and PCR utilized a gene-specific primer (SEQ ID NO:45 5'- CTGTGCTCACGATCTTGTTGTTCTTGATC-3') paired with the 5' kit primer, or a second gene-specific primer (SEQ ID NO:46 5'- GTCGGCGGATCCATGGAAGAAAXJCTCATC-5') paired with the 3' kit primer.
- GeneRacer kit Invitrogen
- EAT-D Error Activation Tagged - Dominant mutant
- the activation-tagged T-DNA insert in EAT-D is mapped to chromosome 5, in between the annotated genes At5g04270 and At5g04280. 5'- and 3'-RACE PCR is then used with primers located within this region to identify a 1.4 kb transcript (SEQ ID NO:1), which is named EAT, that is upregulated in EAT-D.
- the 35S::EAT transformants display the identical early-flowering and ap2-like phenotypes seen for EAT-D (Table 1). Many of the 35S::EAT transformants occasionally display additional defects, including stigmatic papillae on cauline leaf margins and the formation of a complete or partial flower rather than a secondary inflorescence in the axils of cauline leaves. Ectopic expression of the EAT gene in 35S::EAT plants, therefore, affects both flowering time and the specification of floral organ identity.
- the EAT gene produces a 1417-nucleotide noncoding RNA that is predicted to be 5' - capped and polyadenylated, based on the RACE-PCR methodology.
- BLASTN and BLASTX searches of several databases with the EAT cDNA do not reveal extensive nucleotide ojc predicted amino acid sequence identity between EAT and any other gene.
- nt 21 - nucleotide (SEQ ID NO:4) stretch in the middle of the EAT transcript is identified that is identical to miR172a-2, a recently identified miRNA (Park et al. (2002) Curr Biol 12:1484- 1495).
- a mutant form of EAT is generated in which the miR172a-2 sequence is deleted, and a construct consisting of this mutant EAT cDNA, eatdel, is made driven by the 35S promoter-.
- Transgenic plants carrying this 35S::eatdel construct flower with the same number of leaves as wild-type and had normal flowers (Table 1), indicating that the miR172a-2 sequence is necessary to confer both the flowering time and floral organ identity phenotypes seen in EAT- overexpressing lines.
- the 21-nt miR172a-2 miRNA has the potential to form an RNA duplex with a sequence near the 3' end of the coding region of AP2 (Table 3).
- the GU wobble in the duplex is underlined.
- miR172a-2 miRNA in the Arabidopsis genome on chromosome 2 (miR172a-l, Fig. 2d), and miR172a-2 is highly similar to three other Arabidopsis loci. Like the miR172a-2 miRNA, all four reiterations of the sequence are in intergenic regions, i.e. in between the Arabidopsis genes currently annotated in GenBank. In addition, the sequence is found in ESTs from tomato, potato and soybean, and four copies were found in the genomic sequence of rice.
- EXAMPLE 2 This example describes the construction of expression vectors [0171] To overexpress the EAT gene, primers containing Xhol sites (SEQ ID NO:55 5'- GACTACTCGAGCACCTCTCACTCCCTTTCTCTAAC-3' and SEQ ID NO:56 5'- GACTACTCGAGGTTCTCAAGTTGAGCACTTGAAAAC-3') are designed to amplify the entire EAT gene from CoI-O DNA. The PCR product is digested with Xhol and inserted into a modified pBluescriptSK+ vector (Stratagene, La Jolla, CA) that lacked BamHI and HindIII sites, to generate EATX4 (SEQ ID NO:44).
- a modified pBluescriptSK+ vector Stratagene, La Jolla, CA
- the Xhol-cut EAT gene is inserted into the binary vector pBE851 in between a CAMV 35S promoter and b- phaseolin terminator, and CoI-O was transformed by floral dip.
- two oligonucleotides are synthesized (SEQ ID NO:57 5'-GATCCATGGAAGAAAGCTCAT CTGTCGTTGTTTGTAGGCGCAGCACCATTAAGATTCACATGGAAATTGATAAATAC- 3' and SEQ ID NO:58 5'-CCTAAATTAGGGTTTTGATATGTATATTCAACAATCGACG GCTACAAATACCTAA-3') that completely recreated the BamHI/Hindlll fragment of the EAT cDNA except that it lacked the 21 nt miR172a-2 sequence located within the fragment.
- miR172a-l To test whether another member of the miR172 family, miR172a-l, would confer a phenotype similar to that of miR172a-2, a construct containing the 35S promoter fused to the genomic region surrounding miR172a-l is generated. Plants containing the 35S::miR172a-l construct flower early and display an ap2 phenotype (Table 1), indicating that miR172a-l behaves in an identical manner to miR172a-2 when overexpressed.
- RNA hairpin is the substrate which is subsequently cleaved by a plant Dicer homolog to generate the mature miRNA.
- the location of the miRNA within the hairpin i.e. on the 3' side of the stem, is conserved amongst all the members of the miR172 family, and this may reflect a structural requirement for processing of this particular miRNA family.
- the 21-nt miR172a-2 miRNA therefore, is predicted to be a member of a family of miRNAs that have the capacity to regulate a subset of AP2 genes by forming an RNA duplex with a 21-nt cognate sequence in these genes.
- RNA is isolated from wild type and EAT-D whole plants that had already flowered, using TRIZOL reagent (Sigma). 50 mg of each RNA is subjected to electrophoresis on a 15% TBE-Urea Criterion gel (BioRad), electroblotted onto Hybond-N+ filter paper (Amersham) using a TransBlot-SD apparatus (BioRad). The filter is then hybridized at 37° C overnight in UltraHyb-Oligo buffer (Ambion) with 32P-labeled oligos.
- UltraHyb-Oligo buffer Ambion
- the oligos are 30-mers that corresponded to either the sense or antisense strands of the miR172a-2 miRNA, with 4-5 nt of flanking sequence on each side.
- the filter is washed twice at 37°C, in buffer containing 2X SSC and 0.5% SDS.
- probe is made by end-labeling an oligo (SEQ ID NO:61) (5'-ATGCAGCATCATCAAGATTCTCATATACAT-S') with T4 polynucleotide kinase and 32P. Hybridization and processing of Sl reactions are carried out using standard protocols.
- RNA is isolated from plants at the various stages and tissues indicated in Example 4, using an Rneasy kit (Qiagen).
- RT-PCR is carried out using standard protocols, and utilized oligos specific for sequences adjacent to miR172a-2 (SEQ ID NO:62) (5'-GTCGGCGGATCCATGG AAGAAAGCTCATC-3' and (SEQ ID NO:63) 5'-CAAAGATCGArCCAGACTTCAATCAA TATC-3') or sequences adjacent to miR172a-l (SEQ ID NO:64) (5'-TAATTTCCGGAGCCAC GGTCGTTGTTG-3' and (SEQ ID NO:65) 5'-AATAGTCGTTGATTGCCGATGCAGCATC-S').
- Oligos used to amplify the ACTI l (Actin) transcript were: (SEQ ID NO:66) 5'- ATGGCAGATGGTGAAGACATTCAG-S', and (SEQ ID NO:67) 5'-GAAGCACTTCCTGTG GACTATTGATG-3'.
- RT-PCR analysis of AP2 is performed on RNA from floral buds, and utilized the following oligos: (SEQ ID NO:68) 5'-TTTCCGGGCAGCAGCAACATTGGTAG- 3', and (SEQ ID NO:69) 5'-GTTCGCCTAAGTTAACAAGAGGATTTAGG-S '.
- Oligos used to amplify the ANT transcript are: (SEQ ID NO:70) 5'-GATCAACTTCAATGACTAACTCTG GTTTTC-3', and (SEQ ID N0:71) 5'-GTTATAGAGAGATTCATTCTGTTTCACATG-S'.
- Immunoblot analysis of AP2 is performed on proteins extracted from floral buds. Following electrophoresis on a 10% SDS-PAGE gel, proteins are transferred to a Hybond-P membrane (Amersham) and incubated with an antibody specific for AJP2 protein (aA-20, Santa Cruz Biotechnology). The blot is processed using an ECL-plus kit (Amersham).
- EXAMPLE 4 [0178] The example describes the developmental pattern of EAT rrxiRNA expression.
- RT-PCR is used to specifically detect a fragment of the 1.4 kb EAT full-length precursor transcript containing miR172a-2.
- EAT precursor transcript expression is temporally regulated, with little or no transcript detected two days after germination, and progressively more steady-state transcript accumulation seen as the plant approaches flowering.
- the precursor transcript of miR172a-l shows a similar temporal pattern of expression. Both miR172a-2 and miR172a-l precursor transcripts continue to be expressed after flowering has occurred, and accumulate in both leaves and floral buds.
- EXAMPLE 5 The levels of miR.172 in various flowering time mutants are assessed, in an attempt to position miR.172 within the known flowering time pathways. The levels of miR172 are not altered in any of the mutants tested, and the levels of the EAT transcript are identical in plants grown in long days versus plants grown in short days.
- RNA interference pathway (Llave et ai. (2002) Plant Cell 14:1605-1619; Hutvagner and Zamore (2002) Science 297:2056-2060).
- LAT-D a ⁇ i activation-tagged late-flowering mutant
- Table 1 a ⁇ i activation-tagged late-flowering mutant
- RT-PCR analysis using primers specific for At2g28550 indicates that the transcript corresponding to this gene is indeed expressed at higher levels in the LAT-D mutant relative to wild type.
- a genomic region containing the entire At2g28550 coding region is fused to the 35S promoter, and transgenic plants containing this construct are created.
- Transgenic 35S::At2g28550 plants flower later than wild type plants, and are slightly later than the LAT-D mutant (Table 1). This late flowering phenotype is observed in multiple independent transformants.
- At2g28550 plants containing a T-DNA insertion in the At2g28550 gene are identified.
- a T-DNA mutant for At2g60120 a closely related AP2-like gene that also contains the miR172 target sequence. Plants homozygous for either the At2g28550 insert or the At5g60120 insert are slightly early flowering relative to wild type (Table 1). The two mutants are crossed, and the double mutant is isolated by PCR genotyping. The At2g28550/At5g60120 double mutant is earlier flowering than either individual mutant (Table 1), suggesting that the genes tiave overlapping function.
- the early flowering phenotype of the At2g28550/At5g60120 double mutant is consistent with the idea that the early flowering phenotype of miR172-overexpressing lines is due to downregulation of several AP2-like genes, including At2g28550 and At5g60120.
- the At2g28550/At5g60120 double mutant is not as early as miR172-overexpressing lines (c.f. EAT-OX, Table 1), which suggests that other AP2-like targets of rniR172, for example AP2 itself or At5g67180, also contribute to flowering time control. Because ap2 mutants are not early flowering, any potential negative regulation of flowering by AP2 must be normally masked by genetic redundancy.
- EXAMPLE 9 This example describes a method of target selection and method to design DNA constructs to generate miRNAs using the constructs of SEQ ID NOS: 3 and 44. Any sequence of interest can be selected for silencing by miRNA generated using the following method: [0187] 1. Choose a region from the coding strand in a gene of interest to be the target sequence. Typically, choose a region of about 10 — 50 nucleotides found in a similar location to the region targeted by EAT in AP2-like genes, which are regions about 100 nt upstream of the stop codon. The exact location of the target, however, does not appear to be critical. It is recommended to choose a region that has -50% GC and is of high sequence complexity, i.e.
- the chosen region ends with a T or A, such that the complementary miRNA will start with an A or U. This is to help ensure a lower stability at the 5 ' end of the miRNA in its double-stranded Dicer product form (Schwartz, et al. (2003) Cell 115:199-208).
- the miRNA sequence starts with an A, and many other miRNAs start with a U.
- Oligo 1 will have an unpaired BamHI site at the 5' end, and will end with the nucleotide at position 78 of SEQ ID NO:3.
- Oligo 2 will have the nucleotides of position 79-82 (CCTA) unpaired at the 5' end, and will terminate just before the HindIII site (or positions 151-154 in SEQ ID NO.3).
- Oligo 3 will be essentially complementary to Oligo 1, (nucleotides 5-78 of SEQ ID NO:3), and will terminate with 4 nucleotides complementary to nucleotides 1-4 (CCTA) of Oligo 2.
- Oligo 4 will be essentially complementary to Oligo 2 beginning at the nucleotide of position 5, and will terminate with the HindIII site at the 3' end. [0197] Anneal the oligonucleotides to generate two fragments to be used in a subsequence ligation reaction with the plasmid sequence.
- two synthetic oligonucleotides comprising attB sequences can be synthesized and annealed to create an attB-flanked miRNA precursor that is then integrated into a vector using recombinational cloning (GATEWAY, InVitrogen Corp., Carlsbad, CA).
- GATEWAY InVitrogen Corp., Carlsbad, CA.
- the current example uses the modified pBluescript SK+ plasmid of SEQ ID NO:44, which comprises the 1.4kb EAT sequence of SEQ ID NO:1, digested with BamHI/Hindlll and gel purified away from the small fragment using standard molecular biological techniques.
- the new designed miRNA to the gene of interest has replaced the previous miRNA.
- the BP and LR recombination reactions can be used to insert the modified hairpin into a destination vector comprising the full-length miR172a-2 precursor.
- the plasmid from Step 7, subject to any other preparations or modifications as needed, is used to transform the target organism using techniques appropriate for the target.
- Silencing of the target gene can be assessed using techniques well-known in the art, for example, Northern blot analysis, immunoblot analysis if the target gene of interest encodes a polypeptide, and any phenotypic screens relevant to the target gene, for example flowering time, or floral morphology.
- Described in this example are methods one may use for introduction of a polynucleotide or polypeptide into a plant cell.
- a DNA construct can be introduced into maize cells capable of growth on suitable maize culture medium.
- suitable maize culture medium Such competent cells can be from maize suspension culture, callus culture on solid medium, freshly isolated immature embryos or meristem cells. Immature embryos of the Hi-II genotype can be used as the target cells. Ears are harvested at approximately 10 days post-pollination, and 1.2- 1.5mm immature embryos are isolated from the kernels, and placed scutellum-side down on maize culture medium.
- the immature embryos are bombarded from 18-72 hours after being harvested from the ear.
- plasmid DNA (described above) is precipitated onto 1.8 mm tungsten particles using standard CaC12- spermidine chemistry (see, for example, Klein et al. (1987) Nature 327:70-73).
- the embryos are moved onto N6-based culture medium containing 3 mg/1 of the selective agent bialaphos. Embryos, and later callus, are transferred to fresh selection plates every 2 weeks. The calli developing from the immature embryos are screened for the desired phenotype. After 6-8 weeks, transformed calli are recovered.
- Soybean embryogenic suspension cultures are maintained in 35 ml liquid media SB 196 or SBl 72 in 250 ml Erlenmeyer flasks on a rotary shaker, 150 rpm, 26C with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 30-35 uE/m2s. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of fresh liquid media. Alternatively, cultures are initiated and maintained in 6-well Costar plates.
- SB 172 media is prepared as follows: (per liter), 1 bottle Murashige and Skoog Medium (Ducbefa # M 0240), 1 ml B5 vitamins IOOOX stock, 1 ml 2,4-D stock (Gibco 11215- 019), 60 g sucrose, 2 g MES, 0.667 g L-Asparagine anhydrous (GibcoBRL 11013-026), pH 5.7.
- SB 196 media is prepared as follows: (per liter) 10ml MS FeEDTA, 10ml MS Sulfate, 10ml FN- Lite Halides, 1 OmI FN-Lite P,B,Mo, ImI B5 vitamins IOOOX stock, 1 ml 2,4-D, (Gibco 11215- 019), 2.83g K2NTO3 , 0.463g (NH4)2SO4, 2g MES, Ig Asparagine Anhydrous, Powder (Gibco 11013-026), 1Og Sucrose, pH 5.8. 2,4-D stock concentration 10 mg/ml is prepared as follows: 2,4-D is solubilized in 0.1 N NaOH, filter-sterilized, and stored at -20 0 C.
- B5 vitamins IOOOX stock is prepared as follows: (per 100 ml) - store aliquots at -2O 0 C, 1O g myo-inositol, 100 mg nicotinic acid, 100 mg pyridoxine HCl, 1 g thiamin.
- Soybean embryogenic suspension cultures are transformed with various plasmids by the method of particle gun bombardment (Klein et al. (1987) Nature 327:70).
- tissue for bombardment approximately two flasks of suspension culture tissue that has had approximately 1 to 2 weeks to recover since its most recent subculture is placed in a sterile 60 x 20 mm petri dish containing 1 sterile filter paper in the bottom to help absorb moisture.
- Tissue i.e. suspension clusters approximately 3-5 mm in size
- Residual liquid is removed from the tissue with a pipette, or allowed to evaporate to remove excess moisture prior to bombardment.
- 4 - 6 plates of tissue are bombarded.
- Each plate is made from two flasks.
- 30 mg gold is washed in ethanol, centrifuged and resuspended in 0.5 ml of sterile water.
- a separate micro-centrifuge tube is prepared, starting with 50 ⁇ of the gold particles prepared above.
- 5 ⁇ l of plasmid DNA (at l ⁇ g/ ⁇ l), 50 ⁇ l CaC12, and 20/xl 0.1 M spermidine. This mixture is agitated on a vortex shaker for 3 minutes, and then centrifuged using a microcentrifuge set at 14,000 RPM for 10 seconds.
- the supernatant is decanted and the gold particles with attached, precipitated DNA are washed twice with 400 ⁇ aliquots of ethanol (with a brief centrifugation as above between each washing). The final volume of 100% ethanol per each tube is adjusted to 40 ⁇ l, and this particle/DNA suspension is kept on ice until being used for bombardment. [0214] Immediately before applying the particle/DNA suspension, the tube is briefly dipped into a sonicator bath to disperse the particles, and then 5 ⁇ L of DNA prep is pipetted onto each flying disk and allowed to dry. The flying disk is then placed into the DuPont Biolistics PDS1000/HE.
- the membrane rupture pressure is 1100 psi.
- the chamber is evacuated to a vacuum of 27-28 inches of mercury.
- the tissue is placed approximately 3.5 inches from the retaining/stopping screen (3rd shelf from the bottom). Each plate is bombarded twice, and the tissue clusters are rearranged using a sterile spatula between shots.
- the tissue is re-suspended in liquid culture medium, each plate being divided between 2 flasks with fresh SB 196 or SB 172 media and cultured as described above.
- the medium is replaced with fresh medium containing a selection agent.
- the selection media is refreshed weekly for 4 weeks and once again at 6 weeks. Weekly replacement after 4 weeks may be necessary if cell density and media turbidity is high.
- green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into 6-well microliter plates with liquid medium to generate clonally-propagated, transformed embryogenic suspension cultures.
- Each embryogenic cluster is placed into one well of a Costar 6-well plate with 5mls fresh SB 196 media with selection agent. Cultures are maintained for 2-6 weeks with fresh media changes every 2 weeks. When enough tissue is available, a portion of surviving transformed clones are subcultured to a second 6-well plate as a back-up to protect against contamination.
- transformed embryogenic clusters are removed from liquid SB 196 and placed on solid agar media, SB 166, for 2 weeks. Tissue clumps of 2 - 4 mm size are plated at a tissue density of 10 to 15 clusters per plate. Plates are incubated in diffuse, low light ( ⁇ 10 ⁇ E) at 26 +/- 1°C. After two weeks, clusters are subcultured to SB 103 media for 3 - 4 weeks.
- SB 166 is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/ BRL - Cat# 11117- 017), 1 ml B5 vitamins IOOOX stock, 60 g maltose, 750 mg MgC12 hexahydrate, 5 g activated charcoal, pH 5.7, 2 g gelrite.
- SB 103 media is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/BRL - Cat# 11117-017), 1 ml B5 vitamins IOOOX stock, 60 g maltose, 750 mg MgC12 hexahydrate, pH 5.7, 2 g gelrite.
- individual embryos are desiccated by placing embryos into a 100 X 15 petri dish with a lcm 2 portion of the SB 103 media to create a chamber with enough humidity to promote partial desiccation, but not death.
- Approximately 25 embryos are desiccated per plate. Plates are sealed with several layers of paraf ⁇ lm and again are placed in a lower light condition.
- the duration of the desiccation step is best determined empirically, and depends on size and quantity of embryos placed per plate. For example, small embryos or few embryos/plate require a shorter drying period, while large embryos or many embryos/plate require a longer drying period. It is best to check on the embryos after about 3 days, but proper desiccation will most likely take 5 to 7 days. Embryos will decrease in size during this process.
- Desiccated embryos are planted in SB 71-1 or MSO medium where they are left to germinate under the same culture conditions described for the suspension cultures. When the plantlets have two fully-expanded trifoliate leaves, germinated and rooted embryos are transferred to sterile soil and watered with MS fertilizer. Plants are grown to maturity for seed collection and analysis. Healthy, fertile transgenic plants are grown in the greenhouse.
- SB 71-1 is prepared as follows: 1 bottle Gamborg's B5 salts w/ sucrose (Gibco/BRL - Cat# 21153-036), 10 g sucrose, 750 mg MgC12 hexahydrate, pH 5.7, 2 g gelrite.
- MSO media is prepared as follows: 1 pkg Murashige and Skoog salts (Gibco 11117-066), 1 ml B5 vitamins IOOOX stock, 30 g sucrose, pH 5.8, 2g Gelrite.
- This example describes the design and synthesis of miRNA targets and hairpins directed to various gene targets found in maize, soy, and/or Arabidopsis, using the method described in Example 9. [0224] A. Targeting Arabidopsis AGAMOUS, At4gl 8960
- the miRNA sequence of SEQ ID NO:4 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 12-15, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:44.
- Arabidopsis thaliana CoI-O is transformed and grown as described in Example 1.
- Two miRNA targets from AP3 are selected and oligonucleotides designed.
- the miRNA sequence of SEQ ID NO:5 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 16-19, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:44.
- the miRNA sequence of SEQ ID NO:6 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:44.
- Arabidopsis thaliana CoI-O is transformed and grown as described in Example 1. After transformation with a vector comprising the miRNA of SEQ ID NfO: 5, the transformants have novel leaf and floral phenotypes, but do not exhibit any mutant AP3 phenotype. Gel electrophoresis and Northern analysis of RNA isolated from 2 week old rosette leaf tissue from the transformants demonstrates that the highest accumulation of the processed miRNA ( ⁇ 21 nt) corresponds to the "backside" strand of the precursor, which evidently silences a different target sequence to produce the novel leaf and floral phenotypes.
- a new target sequence is selected, with the correct asymmetry in order for the miRNA target strand to be selected during incorporation into RISC (Schwartz et al. (2003) Cell 115:199-208).
- the miRNA sequence of SEQ ID NO:6 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:44. Greater than 90% of the transformants show silencing for the AP3 gene, as demonstrated by floral phenotype and electrophoretic analysis. An approximately 21 nt miRNA (antiAP3b) is detected at high levels in the transgenic plants, and not in wild type control plants. RT-PCR analysis confirmed that the amount of AP3 transcript is reduced in the transformants, as compared to wild type control plants.
- the miRNA sequence of SEQ ID NO:7 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 24-27, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:44.
- the miRNA sequence of SEQ ID NO: 8 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 28-31 , and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:44.
- D. Targeting Maize Phytic Acid biosynthetic enzymes Three maize phytic acid biosynthetic enzyme gene targets are selected and miRNA and oligonucleotides designed. Inositol polyphosphate kinase-2 polynucleotides are disclosed in PCT International published application No. WO 02/059324, herein incorporated by reference. Inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides are disclosed in PCT International published application No. WO 03/027243, herein incorporated by reference. Myo-inositol 1- phosphate synthase polynucleotides are disclosed in PCT International published application No. WO 99/05298, herein incorporated by reference.
- IPPK2 Inositol polyphosphate kinase-2
- the miRNA sequence of SEQ ID NO: 9 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 32-35, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:44.
- Inositol 1,3,4-trisphosphate 5/6-kinase-5 Inositol 1,3,4-trisphosphate 5/6-kinase-5 (ITPK5)
- the miRNA sequence of SEQ ID NO: 10 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 36-39, and ligating them into the BamHI/Hindlll backfcone fragment of SEQ ID NO:44.
- the miRNA sequence of SEQ ID NO: 11 is selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 40-43, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO:
- EAT miR172a-2
- SEQ ID NO:1 used for Arabidopsis transformation
- This construct has a miRNA template sequence which encodes the miRNA of SEQ ID NO:48.
- the construct is created using a PCR amplification of miR172a-2 precursor sequence from Arabidopsis , restriction digestion, and ligation as described in Example 2.
- Soybean tissue is transformed and grown essentially as described in Example 10. After transformation, 42% of the transformants exhibit a mutant phexiotype, characterized by the conversion of sepals to leaves. Plants exhibiting the strongest phenotypes are sterile, and produce no seed.
- the miRNA sequence of SEQ ID NO: 72 is selected and designed.
- the sequence is put into the attB hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 73-74, and performing the BP recombination reaction (GATEWAY) to generate the attL intermediate.
- This intermediate is used in the LR reaction to recombine with the destination vector, generally described in Example 12, comprising the EAT full-length precursor containing attR sites, and negative selection markers in place of the hairpin.
- the product of this reaction comprises the miR172a-2 precursor hairpin cassette flanked by attR sites (i.e., the hairpin replaces the marker cassette).
- the miRNA sequence of SEQ ID NO:75 is selected and designed based on the sequence of NM_112047 (At3gl2120).
- the sequence is put into the attB hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 76-77, and performing the BP recombination reaction (GATEWAY) to generate the attL intermediate.
- This intermediate is used in the LR reaction to recombine with the destination vector, generally described in Example 12, comprising the EAT full-length precursor containing attR sites, and negative selection markers in place of the hairpin.
- the product of this reaction comprises the FAD2 miRNA precursor hairpin cassette flanked by attR sites (i.e., the hairpin replaces the marker cassette).
- the effect of the anti-FAD2 miRNA can be determined by fatty acid analysis to determine the change in the fatty acid profile, for example, see Wu et al. (1997) Plant Physiol. 113:347-356, herein incorporated by reference.
- the miRNA sequence of SEQ ID NO:78 is selected and designed based on the sequence of NM_202816 (At4gl4210).
- the sequence is put into the attB hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 79-80, and performing the BP recombination reaction (GATEWAY) to generate the attL intermediate.
- This intermediate is used in the LR reaction to recombine with the destination vector, generally described in Example 12, comprising the EAT full-length precursor containing attR sites, and negative selection markers in place of the hairpin.
- the product of this reaction comprises the PDS miRNA precursor hairpin cassette flanked by attR sites (i.e., the hairpin replaces the marker cassette).
- Transgenic plants containing the antiPDS construct are photobleached upon germination in greater than about 90% of the lines, indicating silencing of PDS.
- This example describes the construction of expression vectors using recombinational cloning technology.
- Example 2 The vector described in Example 2 (SEQ ID NO:44) is modified to incorporate art recombination sites to facilitate recombinational cloning using GATEWAY technology (InVitrogen, Carlsbad, CA).
- the BamHI/Hindlll segment is replaced with a sequence comprising in the following order: attRl - CAM - ccdB - attR2.
- BP + LR Upon recombination (BP + LR) with oligos containing attB sites flanking the miRNA hairpin precursor construct, the selectable markers are replaced by the miRNA hairpin precursor.
- GSS Genome Survey Sequence
- NCBI National Center for Biotechnology Information
- Oligonucleotides are designed in order amplify miR172a or miR172b from a B73 genomic corn library, these primers also add restriction enzyme recognition sites in order to facilitate cloning (BamHI or EcoRV). Alternatively, PCR primers designed to create att sites for recombinational cloning could be used. After PCR amplification, the products are isolated, purified, and confirmed by sequence analysis. Once confirmed, these sequences are inserted into a construct comprising the corn ubiquitin (UBI) promoter. This construct can be used for further transformation vector construction, for example, with the addition of att sites, the GATEWAY system can be used.
- UBI corn ubiquitin
- PCR primers are used to amplify a sequence comprising the hairpin precursor of corn miRl 72a Forward primer (SEQ ID NO:87): 5' GGATCCTCTGCACTAGTGGGGTTATT 3 ' Reverse primer (SEQ ID NO:88): 5' GATATCTGC AACAGTTTACAGGCGTT 3' [0261] The following PCR primers are used to amplify a sequence comprising the hairpin precursor of corn miRl 72b
- This example describes the design and synthesis of miRNA targets and hairpins directed to various gene targets found in maize, for use with the corn miRl 72b miRNA precursor.
- the corn miRl 72b hairpin precursor will be tested by overexpression in corn.
- the precursor sequence comprising the miRNA template is shown in SEQ ID NO:91.
- the miRNA is shown in SEQ ID NO: 92, and the backside of the miRNA duplex is shown in SEQ ID NO:93.
- a double-stranded DNA molecule comprising the miRNA precursor and restriction enzyme overhangs, for BamHI and Kpnl, is created by annealing the oligonucleotides of SEQ ID NOS: 97 and 98.
- oligonucleotide comprising the the miRNA template is shown in SEQ ID NO:94.
- the miRNA directed to PDS is shown in SEQ ID NO: 92, and the backside of the miRNA duplex is shown in SEQ ID NO: 93.
- a double-stranded DNA molecule comprising the miRNA precursor and restriction enzyme overhangs, for BamHI and Kpnl, is created by annealing the oligonucleotides of SEQ ID NOS: 99 and 100.
- the oligonucleotides of this example can be inserted into vectors for transformation of corn using standard cloning techniques, including restriction digestion and ligation, and/or recombinational cloning such as GATEWAY.
- a fragment of 276 base pairs containing the entire sequence of Arabidopsis miR159a was cloned by PCR amplification using primers CACC-miR159a-prec: 5' CACCACAGTTTGCTTATGTCGGATCC 3' (SEQ ID NO: 101) and miR159a-Xma: 5' TGACCCGGGATGTAGAGCTCCCTTCAATCC 3' (SEQ ID NO: 102).
- the miR159a-Xma contains 18 of 21 nucleotides of the mature miR159a (bold) and an introduced Xmal site (italic).
- the PCR fragment was cloned in the pENTR/SD/D-TOPO vector (Invitrogen) according to manufacturers directions to obtain pENTR-miRl 59a-prec.
- the Gateway recombination system was used to transfer the pre-miRl 59a sequence to the plant binary vector pK2GW7, which contains two copies of the 35S promoter and a NOS terminator to generate pK2-pre-miRl 59a.
- Mutagenesis of pre-miR159a was performed by PCR with the following oligonucleotides.
- 5'-miR-PDS ma 5' ATA GA rC7TGATCTGACGATGGAAGAAGAGATC CTAAC
- T TTTCAAA 3' (SEQ ID NO: 103; This oligonucleotide contains a natural BgI II site (italic) and the miR-PDS 159a * sequence (bold)).
- 3'-miR-PZ ⁇ S 159a 5' TGACCCGGGATGAAGAGATCCCATATTTCCAAA 3' SEQ ID NO: 103;
- This oligonucleotide contains point mutations in the miR159a sequence (bold) to increase its complementarity to the PDS mRNA sequence, based on available N. benth ⁇ mi ⁇ n ⁇
- the miR-PDS mg was cloned as follows. An Arabidopsis genomic fragment of 222 base pairs containing the miR169g sequence (see below) was amplified using primers miR169g-
- TpENTK-pre-?niR-PDSa I69g was made by using the following oligonucleotides:
- miR169 PDSa 5' GAGAATGAGGTTGAGTTTAGTCTGACTTGGCCAGTTTTTTTA
- miR169 PDSa* ⁇ 5' CTGATTCTGGTGTTGGCCAAGTCAGACTAAACTCTGTTTCC
- TTCTC 3' (SEQ ID NO: 108).
- ⁇ p ⁇ NTR-pre-miR-PDSb 169g was prod"uced by using the oligonucleotides:
- miR169 PDSb 5' GAGAATGAGGTTGATCTCTTTCCAGTCTTCAGGGTTTTTTTA
- miR169 PDSb* 5' GATTCTGGTGTCCTGAAGACTGGAAAGAGATCTGTTTCCTT
- CTCTTC 3' (SEQ ID NO: 110).
- the two mutagenized miR-PDS !69g precursors above were then transferred into plant binary vectors pBADC and pB2GW7 to generate pBA-pre-miR-PDSa 169g , pB2-pre-miR-
- Precursors for artificial miRNAs that target N. benthamiana rbcS transcripts were produced using similar procedures as those described for pENTR- miR-PDS' 59a using the following primers and cloned into pK2GW7:
- MrbcSA-S 5' TCTGACGATGGAAGTTCCTCGCCCGACATTCGAAAATGAGTT
- MrbcSA-R 5' AAACCCGGGATGTTCCTCGCCCGGAATTCGAAAGAGAGTAA
- miR-PDS l59a mature template 5 ' TTTGGA a a t A t GGGAt CTCT 1 3 ' (SEQ ID NO: 115)
- miR169g precursor template sequence 0.3 kb (222bp) AATGATGATTACGATGATGAGAGTCTCTAGTTGTATCAGAGGGTCTTGCATGGAAG AATAGAGAATGAGGTT(M GCCAA GGA TGA CTTGCCGGGTTTTTACC AATGAATCT AATTAACTGATTCTGGTGTCCGGCAAGTTGACCTTGG-CTCTGTTTCCTTCTCTTCTT TTGGATGTCAGACTCCAAGATATCTATCATCATGAATCGTGATCAAACTTTG (SEQ ID NO: 116) (Sequence of the pre-miR169g fragment (0.3kb) cloned. Sequences of miR169g (italic) and
- miRl 69g mature template 5' GAGCCAAGGATGACTTGCCGG 3' (SEQ ID NO: 117)
- miR-PDSa 169g mature template 5 ' GAG 111 AG t c TGACTTG gC c a 3 ' (SEQ ID NO: 118)
- miR169g mature template 5' GAGCCAAGGATGACTTGCCGG 3'
- Nicotiana benthamiana PDS sequences [0299] Nicotiana benthamiana PDS sequences:
- 5'end probe sequence (corresponding to Le-PDS pos.1-268, see Fig. 15A): ATGCCTCAAATTGGACTTGTTTCTGCTGTTAACTTGAGAGTCCAAGGTAGTTCAGCT TATCTTTGGAGCTCGAGGTCGTCTTCTTTGGGAACTGAAAGTCGAGATGGTTGCTTG CAAAGGAATTCGTTATGTTTTGCTGGTAGCGAATCAATGGGTCATAAGTTAAAGATT CGTACTCCCCATGCCACGACCAGAAGATTGGTTAAGGACTTGGGGCCTTTAAAGGT CGTATGCATTGATTATCCAAGACCAGCTGGACAATACAG (SEQ ID NO: 122) [0301] Partial+5'RACE fragment. Assembled sequence from partial Nicotiana benthamiana PDS sequence (Genbank AJ571700) and 5'RACE experiments (corresponding to LQ-PDS pos. 858-1514, see Fig. 15A).
- Nicoti ⁇ n ⁇ benth ⁇ mi ⁇ n ⁇ rbcS sequences (Bolded nucleotides in all six rbcS gene sequences correspond to the sequence targeted by miR-rbcS l59 ⁇ -A): [0303] rbcSl (Genbank accessions: CN748904: 56-633bp, CN748069: 419-end)
- rbcS5 (Genbank accession: CN744712 : 16-713 b) TAAATAATTAATTGCAACAATGGCTTCCTCTGTGATTTCCTCAGCTGCTGCCGTTGC CACCGGCGCTAATGCTGCTCAAGCCAGCATGGTTGCACCCTTCACTGGCCTCAAATC TGCTTCCTCCTTCCCTGTTACCAGAAAACAAAACCTTGACATTACATCCATTGCTAG CAATGGTGGAAGAGTCCAATGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGT ACGAGACACTCTCATACCTTCCTGATTTGAGCCAGGAGCAATTGCTTAGTGAAGTTG AGTATCTTTTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCGTGG ATTTGTCTACCGTGAACATCACAGCTCACCAGGATACTACGATGGCAGATACTGGA CCATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCCACTCAGGTGTTGGCTGAGG TCGAGGAGGCAAAGA
- Hybridization was carried out using the ULTRAHyb-Oligo solution according to the manufacturer's directions (Ambion, TX), and signals were detected by autoradiography. In each case, the probe contained the exact antisense sequence of the expected miRNA to be detected.
- Northern blot hybridizations to detect PDS mRNA abundance were performed according to standard procedures. The 5' end probe corresponded to a fragment of N. benthamiana PDS gene reported before (Guo et al. (2003) Plant J 34:383-392) equivalent to the tomato PDS gene sequence positions 1-268 (Genbank X59948, see above). The 3 'end probe corresponded to a fragment obtained by 5'RACE and equivalent to the tomato PDS gene sequence positions 1192-1514.
- PCR fragments obtained from 5'RACE experiments were cloned in the pCR4 vector (Invitrogen) and analyzed by D ⁇ A sequencing of individual clones.
- first strand cD ⁇ A was normalized by PCR using primers for EF l ⁇ ( ⁇ ishihama et al. (2002) Cell 109:87-99). To amplify D ⁇ A fragments o ⁇ rbcS cD ⁇ As, the following primers were used.
- ⁇ Brbcs5:l/2-F 5' TTCCTCAGTTCTTTCCTCAGCAGCAGTTG 3' (SEQ ID NO:133)
- rbcS3-F 5' CTCAGTTATGTCCTCAGCAGCTGC 3' (SEQ ID NO:134)
- rbcS4/6-F 5' TCCTCAGTTATGTCCTCAGCTGCC 3' (SEQ ID NO: 135)
- NBrbcS5-F 5' TGTGATTTCCTCAGCTGCTGCC 3' (SEQ ID NO: 136)
- NBrbcsl rev2 5' AACTCAGTAGCCGTCAGGCTTGG 3' (SEQ ID NO:137)
- NBrbcs2 rev2 5' AATATGAAACTTAGTAGCCTTCTGGCTTGT 3' (SEQ ID NO: 138)
- NBrbcs3/4/5 revl 5' GTTTCTCCGGGGAACACATACGA 3' (SEQ ID NO: 139)
- This example describes the design of an artificial microRNA to cleave the phytoene desaturase (PDS) mRNAs of Nicotiana benthamiana.
- PDS phytoene desaturase
- miRNA interaction with the target mRNA can result in inhibition of translation rather than mRNA cleavage as shown for miR172 of Arabidopsis (Aukerman and Sakai (2003) Plant Cell 15:2730-2741; Chen (2004) Science 303:2022-2025).
- miRNA interaction with the target mRNA can result in inhibition of translation rather than mRNA cleavage as shown for miR172 of Arabidopsis (Aukerman and Sakai (2003) Plant Cell 15:2730-2741; Chen (2004) Science 303:2022-2025).
- the Arabidopsis miR159 has been shown to target a set of MYB transcription factors. Base-pairing of miR159 to its target mRNAs is almost perfect and results in cleavage of the RNA molecule (Achard et al.
- MIRl 59a MIRl 59b, MIRl 59c
- the natural promoter and precise precursor sequence of miR159 are not known, nor is it known whether microRNA genes are transcribed by DNA polymerase II or III.
- precursor sequence a DNA fragment of 276 bp that contains the Arabidopsis miR159a.
- This precursor sequence which is called pre-miR159a was placed downstream of a 35S promoter and flanked at the 3' end by a polyA addition sequence of the nopaline synthase gene (Fig. HA).
- N. benthamiana phytoene desaturase (PDS) gene was used as a target to see whether we can design an artificial microRNA to cleave its mRNA and thereby compromise its expression.
- PDS N. benthamiana phytoene desaturase
- PCR techniques were used to introduce point mutations in both miR159a and the miR159a* sequence (the RNA sequence located in the opposite arm to the miRNA within the precursor sequence) in the context of the Arabidopsis pre-miR159a.
- the resulting precursor was placed under the control of the strong cauliflower mosaic virus (CaMV) 35S promoter and expressed in N. benthamiana by infiltration of Agrobacterium tnmefaciens containing the appropriate constructs.
- CaMV cauliflower mosaic virus
- benthamiana was first analyzed to confirm that the mutations introduced in its sequence did not affect its processing and maturation of miR-PDS 159a .
- Northern blot analysis showed that 2 to 3 days after infiltration miR-PDS' 59a is clearly expressed (Fig. HC), accumulating to levels comparable to endogenous miR159.
- Biogenesis of known miRNAs includes the generation of the almost complementary miRNA* which is short-lived and accumulates to very low levels when compared to those of the actual miRNA. Consistently, the presence of miR-PDS i59z * was detected but its abundance was significantly lower than that of m ⁇ R-PDS ma (Fig. HC, middle panel).
- Nucleotide sequences of the coding region of these rbcS transcripts were over 90% identical to each other, and allowed us to design m ⁇ R-rbsS 159a -A, which targets all members of the gene family.
- the sequence introduced in miR159a was not guided by the minimal number of changes that would target rbsS but reflected the need to target a specific region common to all rbsS mRNAs and thus included several changes. In this way, we have generated one miRNA that targets all six rbcS mRNAs (miR-rbcS I59a -A, Fig. 14A).
- the artificial miRNAs presented here are distributed along three different locations in PDS mRNA (summarized in Fig. 15A), and have been used to target 2 different genes (PDS and rbcS, Fig. 15A and Fig. 15B). This range of use is also reflected in the flexibility of the miRNA sequences, as the artificial miRNAs show that almost every nucleotide position can be changed (Fig. 16). Changes in miR159a to create two artificial miRNAs retained only 8 positions unchanged (Fig. 16A). In the case of miR169g this number was reduced to only three positions (Fig. 16B). Moreover, when the mutations in both miRNAs are analyzed together, only the first two nucleotide positions remain untouched. This suggests that every position along the miRNA sequence can be changed, adding to the advantages of using artificial miRNAs for gene silencing.
- EXAMPLE 20 [0334] This example demonstrates that artificial miRNACPC 159 " inhibits root hair development in Arabidopsis.
- Root epidermal cells differentiate root-hair cells and hairless cells. Only root-hair epidermal cells are able to develop into root hair. In Arabidopsis roots, among a total of 16-22 cell files, 8 symmetrically positioned cell files are root-hair cells and all others are hairless cell files.
- CAPRICE CPC
- GL2 GLABRA!
- GL2 causes most epidermal cells to differentiate into root hairless cells, and consequently, very few cells are able develop root hair. Roots of the gl2 mutant or wild type transgenic plants over-expressing CPC, produce more root hairs compared to wild type roots (Fig. 17; Wada et al. (2002) Development 129:5409-5419).
- CPC is a good candidate for investigations on the utility of artificial miRNAs to silence or suppress gene function because the loss-of-function phenotype of CPC appears at a very early stage during seedling development, does not cause lethality and is easy to observe.
- pre-miRNA159 as a backbone two artificial pre-miRNAs
- pre-miRCPCl l59a and pre- miRCPC3 159a were designed to target different regions of the CPC mRNA.
- Mature miRCPCl l59a and miRCPC3 l59a are complementary to the sequences located in nt 233-253 and nt 310-330, respectively, of the CPC messenger RNA.
- the nucleotide sequences for the precursor and mature miRNAs are as follows. [0337] miRCPCl 159 " precursor template:
- miRCPCl' 59 " mature template: 5' tttcgatactactcacctctt 3' (SEQ ID NO: 152).
- miRCPC3 159a precursor template 5' tttcgatactactcacctctt 3' (SEQ ID NO: 152).
- miRCPC3 159a mature template 5' ctcccacctgacgccaacgag 3' (SEQ ID NO: 154).
- Arabidopsis thaliana plants were transformed by Agrobacteria carrying XVEr.pre- miRCPCl 159 " or 35S::pre-miRCPCl l59a , and many transgenic lines were obtained.
- Ti seeds of XVE::pre-miRCPCl 159a plants were geminated on antibiotic selection medium containing kanamycin and resistant trasngenic seedlings were transferred to MS medium with or without ⁇ - estradiol, an inducer of the XVE system.
- Ti transgenic lines carrying XVE: :pre-miRl 59 were used as a control.
- Pre-miR159 is the backbone used to construct the artificial pre-miRCPCl l59a .
- transgenic lines carrying 35S::pre-miR159 and those carrying 35S::pre-miRP69 l59a .
- the latter was designed using pre-miR159 as a backbone to produce an artificial j>re-miRP69 159a targeting nt 214-234 of the P69 mRNA of turnip yellow mosaic virus (TYMV; Bozarth et al. (1992) Virology 187: 124- 130).
- the nucleotide sequences for the precursor and mature miRNAs are as follows. [0345] miRP69 159a precursor template :
- m ⁇ RP69 159a mature template 5 ' aaagtctcgattgtcttgtgg 3 ' (SEQ ID NO: 156).
- This example describes one embodiment of a process for the designing a polymeric pre-miRNA.
- Step 1 Different pre-miRNAs are amplified by PCR to include an Avrll site in the 5' end and to include an Spel site and an Xhol site in the 3' end Each pre-miRNA is then cloned into a vector, such as pENTR/SD/D-TOPO (Invitrogen) to produce, for example, pENTR/pre- miRA, pENTR/pre-miRB and pENTR/pre-miRC (Fig. 21A).
- pENTR/SD/D-TOPO Invitrogen
- Step 2 The pENTR/pre-miRA is digested with the restriction enzy ⁇ xes Spel and Xhol.
- the restriction enzymes Avrll and Xhol are used to digest the pENTR/pre-miRB vector (Fig. 21B).
- Opened vector pENTR/pre-miRA and DNA fragment of pre-miRB are collected and purified for further steps.
- Step 3 The opened vector pENTR/pre-miRA and DNA fragment of pre-miRB from step 2 are ligated to generate dimeric pre-miRA-B (Fig. 21C). Because of compatible cohesive ends of Avrll and Spel, the pre-miRB fragment can be inserted into the opened pENTR/pre- miRA and both Avrll and Spel sites will disappear after ligation (Fig. 21C).
- Step 4 The pENTR/pre-miRA-B is digested by with the restriction enzymes Spel and Xhol, and pENTR/pre-miRC is digested with the restriction enzymes Avrll and Xhol (Fig. 21D). Opened vector pENTR/pre-miRA-B and DNA fragment of pre-miRC are collected and purified for further steps.
- Step 5 The opened vector pENTR/pre-miRA-B and DNA fragment of pre-miRC from step 4 are ligated to generated triple pre-miRNA-B-C (Fig. 21E).
- pre- miRNAs containing more pre-miRNA units can be prepared.
- pre-miRNA.s as desired can be linked together in this fashion, with the only limitation being the ultimate size of the transcript. It is well known that transcripts of 8-10 kb can be produced in plants .
- a multimeric pre-miRNA molecule containing from 2-30 or more, for example from 3-40 or more, for example from 3-45 and more, and for further example, multirmers of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or more pre-miR3JAs.
- This example demonstrates the successful processing of a dimeric pre- ⁇ IRNA to two mature miRNAs.
- Artificial pre-miRPDSl' 69g and pre-miRCPC3 159a were linked to form dimeric precursor, pre-miRPDS J69g -CPC3 !59a as described in Example 21.
- This dimeric miRNA precursor was cloned into a vector in which 35S promoter drives expression of the pre- miRPDSl l69g -CPC3 l59a (Fig. 22).
- the nucleotide sequences for the precursor and mature miRNAs are as follows.
- miRPDSl' 69g precursor template [0358]
- miRPDSl' 69g mature template 5' gagtttagtctgacttggcca 3 ' (SEQ ID NO: 158).
- miRPDSl l69& .QPC3 159a precursor template 5' gagtttagtctgacttggcca 3 ' (SEQ ID NO: 158).
- 35S::pre-miRPDS I69g -CPC3 I59a indicates that mature miRPDS 169g and CPC3 l59a were successfully produced from the dimeric miRNA precursor (Figs. 23A and 23B).
- treatment 1 is 35S::pre-miRPDSl 169g
- treatment 2 is 35S::miRCPC3 159 ⁇
- treatment 3 is 35S:: pre-miRPDS 169g -CPC3 IS9 ⁇ .
- miRPDSl 169g anti sense DNA oligo as probe both land 3 treatments showed signals that proved the dimeric precursor was able to produce matured miRPDSl 169g .
- the probe is miRCPC3 159 ⁇ anti sense DNA oligo
- signal in treatment 3 confirmed the ability of pre-miRPDS I69g -CPC3 159 ⁇ to generate mature miRCPC3 159 ⁇ .
- HC-Pro and P69 are plant PTGS suppressors encoded by TuMV and TYMV, respectively (Anandalakshmi et al. (1998) Proc Natl Acad Sci USA 95:13079-13084; Chen et al. (2004) Plant Cell 16:1302-1313; Kasschau and Carrington (1998) Cell 95:461-470). Using these two viral suppressor genes as targets, artificial miRNAs were designed with sequence complementarity to their coding sequences.
- At-miR159a is strongly expressed in most Arabidopsis organs and at high levels. Similar high level expression was also found in other plants species such as corn and tobacco.
- the miR159a precursor pre-miR159a
- Pre-miR159a a 184nt stem-loop RNA, produces mature n ⁇ iR159a (5'- uuuggauugaagggagcucua-3'; SEQ ID NO: 160) from the base of its stem near the 3'end.
- This base stem sequence is the miR159a sequence and the complementary strand is called miR159a* sequence (Fig. 24; SEQ I DNO: 161).
- the miR159a sequence was replaced by a sequence 5'-acuugcucacgcacucgacug-3' (SEQ ID NO: 162), which is complementary to the viral sequence encoding HC-P from 2045 to 2065 of the TuMV genome sequence.
- the miR159a* sequence was also altered to maintain the stem structure.
- a 78bp sequence cloned from the genome sequence upstream of pre-miR159 was added to the 5 'end of this artificial miRNA precursor.
- This primary miRNA-like artificial miRNA precursor was called pre-miRHC-P /59 ⁇ . Its DNA sequence follows. [0365] Pre-miRHC-P' 59a
- Pre-miRP69 159a was also constructed.
- Pre- miRP69 159a was predicted to generate mature artificial miRNA P69 ;59fl , 5'-aaagucucgauugucuugugg-3' (SEQ ID NO: 164), to target the P69 gene of TYMV. Its DNA sequence follows.
- a tobacco transient expression system was used to check whether these two artificial miRZNA precursors can produce the desired miRNAs.
- Agrobacterial cells containing plasmids with 35S::pre-miR-HC-Pro I59a , 35::pre-miR-P69 159a , 35S::HC-Pro, 35S::P69, and XVE::pre- ⁇ niR- P69 l59a were used to infiltrate N. benthamiana leaves (Llave et al. (2000) Proc Natl Acad Sci USA 97:13401-13406; Voinnet et al. (2000) Cell 103:157-167).
- DlSfA oligonucleotides with exact complementary sequence to m ⁇ R.-HC-Pro 159a or pre-miR-P6P y5P ⁇ were end-labeled with [ ⁇ - 32 P]-ATP and T4 polynucleotide kinase to generate high specific activity probe.
- Hybridization was carried out using the ULTRA-Hyb Oligo solution according to the manufacturer's directions (Ambion) and signals were detected by autoradiography.
- Leaf disks (a total of 0.01 g) from different systemic leaves of each plant infected with TuMV were taken 14 dpi (days post infection), and assayed by indirect enzyme-linked immunosorbent assay (ELISA) using a polyclonal antiserum to TuMV coat protein (CP) (Chen et al. (2003) Plant Dis 87:901-905) and goat anti-rabbit immunoglobulin G conjugated with alkaline phosphatase. The substrate p-nitrophenyl phosphate was used for color development. Results were recorded by measuring absorbance at 405 nm using Tunable Microplate Reader (VersaMax, Molecular Devices Co., CA).
- Total protein of each sample (15 ⁇ l) was loaded on 12% polyacryamide gels, separated by SDS-polyacrylamide gel electrophoresis, and subsequently transferred onto PVDF membrane (immobilon-P, Millipore, Bedford, MA) using an electro transfer apparatus (BioRad).
- the membranes were incubated with polyclonal rabbit antiserum to TuMV CP as primary antibodies and peroxidase-conjugated secondary antibodies (Amersham Biosciences) before visualization of immunoreactive proteins using ECL kits (Amersham Biosciences). Gels were stained with coomassie-blue R250 and levels of the large subunit of RUBISCO (55 kd) were used as loading controls.
- the large subunit (55kd) of RUBISCO was used as a loading control. Note that no CP was detected in lane 6 (top panel) and lane 4 (middle panel) likely due to failed virus inoculation. These plants had no symptoms.
- the results of the infectivity assay are shown in Table 7.
- Transgenic line Resistant Susceptible Total Resistant rate (%) miR-HC-Pro 1 TM a #U 12 0 12 100 miR-P69 159a # ⁇ 1 11 12 8.3 col-0 1 11 12 8.3
- Experiment 2 The following transgenic lines and WT plants were used.
- 35S::miR- HC-Pro' 59a plants line #10 (12 plants inoculated with TuMV and 4 with buffer;); line #11 (12 plants inoculated with TuMV and 4 with buffer); line #12 (9 plants inoculated with TuMV and 4 with buffer); line #13 (10 plants inoculated with TuMV and 4 with buffer).
- 35S::miR-P69 I59a plants line #1 (8 plants inoculated with TuMV and 4 with buffer); line #2 (7 plants inoculated with TuMV and 4 with buffer); line #3 (9 plants inoculated with TuMV and 4 with buffer); line 7 (5 plants inoculated with TuMV and 4 with buffer).
- Polymeric pre-miRNAs are artificial miRNA precursors consisting of more than one miRNA precursor units. They can either be hetero-polymeric with different miKNA precursors, or homo-polymeric containing several units of the same miRNA precursor. In previous Examples, it has been demonstrated that hetero-polymeric pre-miRNAs are able to produce different mature artificial miRNAs.
- pre-miR-PDSl' 69g -CPC3 159 " which is a dimer comprising of pre-miR-CPC3>' 59a &nd pre-miR-PDSl 169g can produce mature miR-PDSl l69g and n ⁇ R-CPC3 159a when expressed in plant cells.
- the use of homo-polymeric miRNA precursors to produce different mature artificial miRNAs is described.
- Pre-miR-P69 159a and pre-miR-HC-Pro' 59a were generated from the pre-miR159a backbone. They are derived from the same miRNA precursor. They were linked together to form a homo-dimeric pre-miRNA, pre-miR-P69 159a -HC-Pro' 59a .
- the DNA sequence follows. [0391] Pre-miRP69 l59a -HC-P 159a
- sequences in lower case text are At-miR159 backbone.
- sequence in bold text is miR-P69 159a .
- sequence in italic text is miR-HC-Pro 159a .
- sequence in bold italic text is the linker sequence.
- a tobacco transient expression system was used to check whether this homo-dimeric miRNA precursor can produce the desired mature miR-P69 159a and miR-HC-Pro 159a .
- three treatments were performed: (1) Agrobacteria with 35S::pre-miR-P69 l59a , (2) Agrobacteria with 35S::pre-miR-HC-Pro !59a , and (3) Agrobacteria with 35::pre-miR-P69 159a - HC-Pw 159 ".
- RNA splicing During RNA splicing, introns are released from primary RNA transcripts and therefore can potentially serve as precursors for miRNAs. In this example, the insertion of pre- miRNAs into such intronic sequences to produce artificial miRNAs is described.
- introns begin with the sequence 5'-GU-3' and end with the sequence 5'-AG-3'. These sequences are referred to as the splicing donor and splicing acceptor site, respectively.
- the branch site which is located within introns is also important for intron maturation. Without the branch site, an intron can not be excised and released from the primary RNA transcript.
- a branch site is located 20-50 nt upstream of the splicing acceptor site. Distances between the splice donor site and the branch site are largely variable among different introns.
- the Arabidopsis CARPRICE (CPC) gene contains three exons and two introns. Following the consensus sequence of the branch site 5'-CU(A/G)A(C/U)-3', where A is conserved in all transcripts, two branch sites located in 128 tol32 nt (intron 1) and 722 to 726 nt (intron 2) downstream of the start codon are predicted.
- Agrobacterial cells carrying 35S::CPC-A, 35S::CPC-B, 35S: :pre-miR-HC-Pro' 59a , and 35S::pre-miR159a were infiltrated into N. benthamiana leaves for transient expression.
- Northern blot hybridizations using a probe complementary to miR-HC- Pro 159 " showed that in 4 separate experiments leaf samples infiltrated with CPC-A and CPC-B expressed miR-HC-Pro l59a (Fig. 37). This result demonstrates that both intron 1 and intron 2 of the CPC transcript can be used to produce artificial miRNAs.
- FIG. 39 shows northern blot results of four independent experiments. Note that all of the four samples show signals corresponding to miR- HC-Pro 159a miRNA and miR-P69 159a , although the signal in sample 1 is weak (Fig. 39, 1 of 35S::CPC-C). This weak signal could be due to a lower transient expression efficiency in this particular sample. A similar situation was encountered in sample 4 of the 35S::CPC-D experiment.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Physiology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BRPI0516874-0A BRPI0516874A (pt) | 2004-10-12 | 2005-10-12 | micrornas |
| MX2007004321A MX2007004321A (es) | 2004-10-12 | 2005-10-12 | Micro acidos ribonucleicos. |
| EP05808412A EP1809748B1 (en) | 2004-10-12 | 2005-10-12 | Micrornas |
| CN2005800425477A CN101076592B (zh) | 2004-10-12 | 2005-10-12 | 微小rna |
| CA2583690A CA2583690C (en) | 2004-10-12 | 2005-10-12 | Microrna constructs for the suppression of the expression of targeted genes or the down regulation of targeted genes and methods therefore |
| AU2005295948A AU2005295948A1 (en) | 2004-10-12 | 2005-10-12 | MicroRNAs |
| JP2007536777A JP2008522585A (ja) | 2004-10-12 | 2005-10-12 | マイクロrna |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| USPCT/US2004/033379 | 2004-10-12 | ||
| USPCT/US2004/033379 | 2004-10-12 | ||
| US67108905P | 2005-04-14 | 2005-04-14 | |
| US60/671,089 | 2005-04-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006044322A2 true WO2006044322A2 (en) | 2006-04-27 |
| WO2006044322A3 WO2006044322A3 (en) | 2007-01-04 |
Family
ID=36203437
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2005/036373 Ceased WO2006044322A2 (en) | 2004-10-12 | 2005-10-12 | Micrornas |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US8975471B2 (enExample) |
| EP (1) | EP1809748B1 (enExample) |
| JP (1) | JP2008522585A (enExample) |
| CN (1) | CN101076592B (enExample) |
| AR (1) | AR050972A1 (enExample) |
| AU (1) | AU2005295948A1 (enExample) |
| BR (1) | BRPI0516874A (enExample) |
| CA (1) | CA2583690C (enExample) |
| MX (1) | MX2007004321A (enExample) |
| WO (1) | WO2006044322A2 (enExample) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008087562A3 (en) * | 2007-01-18 | 2009-03-05 | Plant Bioscience Ltd Pbl | Methods and compositions for modulating the mirna pathway |
| WO2009079548A3 (en) * | 2007-12-18 | 2009-09-17 | E. I. Du Pont De Nemours And Company | Down-regulation of gene expression using artificial micrornas |
| WO2010042575A1 (en) * | 2008-10-08 | 2010-04-15 | Monsanto Technology Llc | Transgenic plants with enhanced agronomic traits |
| EP2121921A4 (en) * | 2006-12-13 | 2010-08-04 | Idiverse Inc | NEW, STRESSTOLERANZ TRANSMITTING GENES AND RNA MOLECULES |
| US8237017B2 (en) | 2006-05-12 | 2012-08-07 | Bayer Cropscience Nv | Stress-related microRNA molecules and uses thereof |
| US8309530B2 (en) | 2009-02-04 | 2012-11-13 | Washington State University | Compositions and methods for modulating ghrelin-mediated conditions |
| WO2013112523A3 (en) * | 2012-01-23 | 2014-03-13 | E. I. Du Pont De Nemours And Company | Down-regulation of gene expression using artificial micrornas for silencing fatty acid biosynthestic genes |
| US9057073B2 (en) | 2007-01-11 | 2015-06-16 | Bayer Cropscience N.V. | Differential expression of subgenome specific alleles in cotton and uses thereof |
| US9121074B2 (en) | 2008-05-26 | 2015-09-01 | Bayer Cropscience N.V. | Gossypium hirsutum plants with increased fiber strength comprising a fiber strength allele spanning the GLUC1.1A gene from Gossypium barbadense |
| US9200293B2 (en) | 2008-03-04 | 2015-12-01 | Washington State University | Compositions and methods for differential regulation of fatty acid unsaturation in membrane lipids and seed oil |
| WO2016038511A1 (en) * | 2014-09-10 | 2016-03-17 | The New Zealand Institute For Plant And Food Research Limited | Methods and materials for producing fruit of altered size |
| US9309512B2 (en) | 2006-08-31 | 2016-04-12 | Monsanto Technology Llc | Phased small RNAs |
| CN115083516A (zh) * | 2022-07-13 | 2022-09-20 | 北京先声医学检验实验室有限公司 | 一种基于靶向RNA测序技术检测基因融合的Panel设计和评估方法 |
Families Citing this family (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080081330A1 (en) * | 2006-09-28 | 2008-04-03 | Helicos Biosciences Corporation | Method and devices for analyzing small RNA molecules |
| US8410334B2 (en) * | 2007-02-20 | 2013-04-02 | Monsanto Technology Llc | Invertebrate microRNAs |
| US20080313773A1 (en) * | 2007-05-14 | 2008-12-18 | The Rockefeller University | Production of artificial micrornas using synthetic microrna precursors |
| EP2530152B1 (en) | 2007-05-31 | 2017-12-27 | University of Iowa Research Foundation | Reduction of off-target RNA interference toxicity |
| WO2009026574A2 (en) * | 2007-08-23 | 2009-02-26 | Keren Pharmaceutical, Inc. | Immunogenic compositions and uses thereof |
| AU2010259295B2 (en) | 2009-06-10 | 2015-05-07 | Temasek Life Sciences Laboratory Limited | Virus induced gene silencing (VIGS) for functional analysis of genes in cotton. |
| CN101710362B (zh) * | 2009-12-10 | 2011-07-20 | 浙江大学 | 一种基于支持向量机的microRNA靶位点预测的方法 |
| US20130117885A1 (en) * | 2010-06-30 | 2013-05-09 | Basf Plant Science Company Gmbh | Novel Microrna Precursor and Methods of Use for Regulation of Target Gene Expression |
| CN101976296B (zh) * | 2010-09-10 | 2012-05-23 | 浙江大学 | 结合基于下一代测序数据的植物microRNA靶位互作网络预测的方法 |
| EP2627768A4 (en) * | 2010-10-15 | 2014-04-02 | Univ Queensland | Small viral rna molecules and uses thereof |
| ES2739804T3 (es) | 2011-02-12 | 2020-02-04 | Univ Iowa Res Found | Compuestos terapéuticos |
| WO2012143805A1 (en) * | 2011-04-21 | 2012-10-26 | Basf Plant Science Company Gmbh | Methods of modifying lignin biosynthesis and improving digestibility |
| WO2013138463A1 (en) | 2012-03-14 | 2013-09-19 | University Of Central Florida Research Foundation, Inc. | Neurofibromatoses therapeutic agents and screening for same |
| CN104797712B (zh) | 2012-04-19 | 2018-06-12 | 淡马锡生命科学研究院有限公司 | 提高棉纤维长度的方法 |
| CN102703500B (zh) * | 2012-05-30 | 2014-03-12 | 清华大学 | 利用植物病毒载体进行miRNA靶标模拟序列构建和表达的方法 |
| US20140030792A1 (en) * | 2012-07-23 | 2014-01-30 | Radhakrishnan Rathnachalam | Therapeutic Anti-Virus VLPS |
| WO2014064704A2 (en) * | 2012-10-28 | 2014-05-01 | A.B. Seeds Ltd. | Transgenic plants with modified sugar content and methods of generating same |
| CN103088061B (zh) * | 2013-01-15 | 2016-08-03 | 中国科学院微生物研究所 | 一种rna及载体在制备预防和/或治疗肝癌产品中的应用 |
| EP3088524A4 (en) | 2013-12-26 | 2017-08-09 | Tokyo Medical University | Artificial mimic mirna for controlling gene expression, and use of same |
| BR112016014986A2 (pt) | 2013-12-27 | 2018-01-23 | Bonac Corporation | mirna tipo correspondência artificial, composição e método para suprimir expressão de um gene alvo, composição farmacêutica, método para tratar uma doença, e, ácido nucleico de fita única |
| AU2015264263B2 (en) | 2014-05-20 | 2021-08-05 | University Of Iowa Research Foundation | Huntington's disease therapeutic compounds |
| CN107405357B (zh) * | 2014-10-14 | 2021-12-31 | 德克萨斯科技大学系统 | 多重shRNAs及其应用 |
| WO2016064347A1 (en) | 2014-10-22 | 2016-04-28 | Temasek Life Sciences Laboratory Limited | Terpene synthases from ylang ylang (cananga odorata var. fruticosa) |
| EP3239297B1 (en) | 2014-12-27 | 2021-03-10 | Bonac Corporation | Naturally occuring mirna for controlling gene expression, and use of same |
| CN104774837B (zh) * | 2015-03-13 | 2018-02-02 | 浙江省医学科学院 | 9种植物微小核糖核苷酸及其应用 |
| JP6602847B2 (ja) | 2015-03-27 | 2019-11-06 | 株式会社ボナック | デリバリー機能と遺伝子発現制御能を有する一本鎖核酸分子 |
| CN106167801B (zh) * | 2016-09-30 | 2018-08-28 | 山东大学 | 大豆威廉姆斯82中NAC膜结合转录因子基因GmNTL1及其应用 |
| WO2019103581A1 (ko) * | 2017-11-27 | 2019-05-31 | (주)프로스테믹스 | 이중 가닥의 올리고뉴클레오티드 및 그 제조 방법 |
| CN111621588A (zh) * | 2020-06-08 | 2020-09-04 | 华中农业大学 | 光亮果皮番茄品种选育的分子标记及其应用 |
| CN112210555B (zh) * | 2020-09-18 | 2022-02-22 | 大连理工大学 | 番茄抗晚疫病基因Sly-miR166b及其克隆方法与应用方法 |
| CN114908089B (zh) * | 2021-02-08 | 2024-03-15 | 上海细胞治疗集团有限公司 | 3’utr的构建方法和应用 |
| CN114606236B (zh) * | 2022-04-21 | 2024-01-05 | 南通大学 | 一种翘芪复方中药汤剂来源的微小核糖核酸及其制备方法和应用 |
| CN117210463B (zh) * | 2023-09-12 | 2024-03-19 | 扬州大学 | 一种与莲藕根状茎淀粉合成相关的miRNA及其应用 |
| CN118516400B (zh) * | 2024-07-24 | 2024-10-29 | 吉林农业大学 | gma-miR169c基因在调控植物脂肪酸合成中的应用 |
| CN120648688B (zh) * | 2025-08-21 | 2025-11-07 | 中国农业科学院烟草研究所(中国烟草总公司青州烟草研究所) | 与植物抗病毒相关的miR159a及其在提高植物对病毒抗性中的应用 |
Family Cites Families (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6506559B1 (en) * | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| DK1068311T3 (da) | 1998-04-08 | 2011-08-08 | Commw Scient Ind Res Org | Fremgangsmåder og midler til opnåelse af modificerede fænotyper |
| JP2003516124A (ja) * | 1999-10-15 | 2003-05-13 | ユニバーシティー オブ マサチューセッツ | 標的とした遺伝的干渉の手段としてのrna干渉経路遺伝子 |
| WO2003070918A2 (en) | 2002-02-20 | 2003-08-28 | Ribozyme Pharmaceuticals, Incorporated | Rna interference by modified short interfering nucleic acid |
| DE60140676D1 (de) * | 2000-03-30 | 2010-01-14 | Massachusetts Inst Technology | Mediatoren von rns-interferenz, die rns-sequenzspezifisch sind |
| EP1412371B1 (en) * | 2001-07-12 | 2016-02-24 | University of Massachusetts | IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING |
| WO2003012052A2 (en) | 2001-07-30 | 2003-02-13 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Specific inhibition of gene expression by small double stranded rnas |
| US7166771B2 (en) * | 2002-06-21 | 2007-01-23 | Monsanto Technology Llc | Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs |
| CA2524569C (en) * | 2002-05-03 | 2013-10-22 | Duke University | A method of regulating gene expression |
| AU2003247951A1 (en) * | 2002-07-10 | 2004-01-23 | Kansas State University Research Foundation | Compositions and methods for controlling parasitic nematodes |
| WO2004009779A2 (en) * | 2002-07-19 | 2004-01-29 | University Of South Carolina | Compositions and methods for the modulation of gene expression in plants |
| WO2004066183A2 (en) | 2003-01-22 | 2004-08-05 | European Molecular Biology Laboratory | Microrna |
| US7750144B2 (en) * | 2003-06-02 | 2010-07-06 | University Of Massachusetts | Methods and compositions for enhancing the efficacy and specificity of RNA silencing |
| CA2527958C (en) * | 2003-06-02 | 2014-04-08 | University Of Massachusetts | Methods and compositions for enhancing the efficacy and specificity of rnai |
| EP1633767B1 (en) * | 2003-06-02 | 2018-11-21 | University of Massachusetts | Methods and compositions for controlling efficacy of rna silencing |
| US20050144669A1 (en) * | 2003-07-01 | 2005-06-30 | Whitehead Institute For Biomedical Research | MicroRNAs in plants |
| US7071380B1 (en) * | 2003-08-29 | 2006-07-04 | Agrigenesis Biosciences Limited | Control of floral induction |
| WO2005035769A2 (en) * | 2003-10-09 | 2005-04-21 | E. I. Du Pont De Nemours And Company | Gene silencing by using micro-rna molecules |
-
2005
- 2005-10-12 US US11/247,587 patent/US8975471B2/en not_active Expired - Fee Related
- 2005-10-12 JP JP2007536777A patent/JP2008522585A/ja not_active Withdrawn
- 2005-10-12 CN CN2005800425477A patent/CN101076592B/zh not_active Expired - Fee Related
- 2005-10-12 EP EP05808412A patent/EP1809748B1/en not_active Expired - Lifetime
- 2005-10-12 WO PCT/US2005/036373 patent/WO2006044322A2/en not_active Ceased
- 2005-10-12 BR BRPI0516874-0A patent/BRPI0516874A/pt not_active IP Right Cessation
- 2005-10-12 MX MX2007004321A patent/MX2007004321A/es active IP Right Grant
- 2005-10-12 CA CA2583690A patent/CA2583690C/en not_active Expired - Fee Related
- 2005-10-12 AU AU2005295948A patent/AU2005295948A1/en not_active Abandoned
- 2005-10-13 AR ARP050104285A patent/AR050972A1/es unknown
-
2015
- 2015-02-20 US US14/627,543 patent/US20150159157A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of EP1809748A4 * |
Cited By (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8237017B2 (en) | 2006-05-12 | 2012-08-07 | Bayer Cropscience Nv | Stress-related microRNA molecules and uses thereof |
| US10301623B2 (en) | 2006-08-31 | 2019-05-28 | Monsanto Technology Llc | Phased small RNAs |
| US9309512B2 (en) | 2006-08-31 | 2016-04-12 | Monsanto Technology Llc | Phased small RNAs |
| EP2059596B1 (en) * | 2006-08-31 | 2017-10-04 | Monsanto Technology, LLC | Phased small rnas |
| EP2121921A4 (en) * | 2006-12-13 | 2010-08-04 | Idiverse Inc | NEW, STRESSTOLERANZ TRANSMITTING GENES AND RNA MOLECULES |
| US9057073B2 (en) | 2007-01-11 | 2015-06-16 | Bayer Cropscience N.V. | Differential expression of subgenome specific alleles in cotton and uses thereof |
| EP2687604A3 (en) * | 2007-01-18 | 2014-04-16 | Plant Bioscience Limited (PBL) | Methods and compositions for modulating the miRNA pathway |
| WO2008087562A3 (en) * | 2007-01-18 | 2009-03-05 | Plant Bioscience Ltd Pbl | Methods and compositions for modulating the mirna pathway |
| EP2666865A3 (en) * | 2007-01-18 | 2014-02-19 | Plant Bioscience Limited (PBL) | Methods and compostions for modulating the miRNA pathway |
| EP2573181A3 (en) * | 2007-12-18 | 2013-06-26 | E. I. du Pont de Nemours and Company | Down-regulation of gene expression using artificial microRNAs |
| EP2573182A3 (en) * | 2007-12-18 | 2013-06-26 | E. I. du Pont de Nemours and Company | Down-regulation of gene expression using artificial microRNAs |
| RU2492239C2 (ru) * | 2007-12-18 | 2013-09-10 | Е.И.Дюпон Де Немур Энд Компани | Понижающая регуляция экспрессии гена с помощью искусственных микрорнк |
| US8536405B2 (en) | 2007-12-18 | 2013-09-17 | E. I. Du Pont De Nemours And Company | Down-regulation of gene expression using artificial MicroRNAs |
| EP2573180A3 (en) * | 2007-12-18 | 2013-06-26 | E. I. du Pont de Nemours and Company | Down-regulation of gene expression using artificial microRNAs |
| US8273951B2 (en) | 2007-12-18 | 2012-09-25 | E. I. Du Pont De Nemours And Company | Down-regulation of gene expression using artificial micrornas |
| US8115055B2 (en) | 2007-12-18 | 2012-02-14 | E.I. Du Pont De Nemours And Company | Down-regulation of gene expression using artificial microRNAs |
| CN103898114A (zh) * | 2007-12-18 | 2014-07-02 | 纳幕尔杜邦公司 | 使用人工微rna下调基因表达 |
| WO2009079548A3 (en) * | 2007-12-18 | 2009-09-17 | E. I. Du Pont De Nemours And Company | Down-regulation of gene expression using artificial micrornas |
| US9200293B2 (en) | 2008-03-04 | 2015-12-01 | Washington State University | Compositions and methods for differential regulation of fatty acid unsaturation in membrane lipids and seed oil |
| US10287600B2 (en) | 2008-03-04 | 2019-05-14 | Washington State University | Compositions and methods for differential regulation of fatty acid unsaturation in membrane lipids and seed oil |
| US9121074B2 (en) | 2008-05-26 | 2015-09-01 | Bayer Cropscience N.V. | Gossypium hirsutum plants with increased fiber strength comprising a fiber strength allele spanning the GLUC1.1A gene from Gossypium barbadense |
| WO2010042575A1 (en) * | 2008-10-08 | 2010-04-15 | Monsanto Technology Llc | Transgenic plants with enhanced agronomic traits |
| US8309530B2 (en) | 2009-02-04 | 2012-11-13 | Washington State University | Compositions and methods for modulating ghrelin-mediated conditions |
| EP2807258B1 (en) * | 2012-01-23 | 2017-04-26 | E. I. du Pont de Nemours and Company | Down-regulation of gene expression using artificial micrornas for silencing fatty acid biosynthestic genes |
| US9598701B2 (en) | 2012-01-23 | 2017-03-21 | E I Du Pont De Nemours And Company | Down-regulation of gene expression using artificial MicroRNAs for silencing fatty acid biosynthetic genes |
| WO2013112523A3 (en) * | 2012-01-23 | 2014-03-13 | E. I. Du Pont De Nemours And Company | Down-regulation of gene expression using artificial micrornas for silencing fatty acid biosynthestic genes |
| CN107075500A (zh) * | 2014-09-10 | 2017-08-18 | 新西兰植物和食品研究院有限公司 | 能改变果实大小的方法和材料 |
| US20180223300A1 (en) * | 2014-09-10 | 2018-08-09 | The New Zealand Institute For Plant And Food Research Limited | Methods and Materials for Producing Fruit of Altered Size |
| WO2016038511A1 (en) * | 2014-09-10 | 2016-03-17 | The New Zealand Institute For Plant And Food Research Limited | Methods and materials for producing fruit of altered size |
| CN115083516A (zh) * | 2022-07-13 | 2022-09-20 | 北京先声医学检验实验室有限公司 | 一种基于靶向RNA测序技术检测基因融合的Panel设计和评估方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1809748B1 (en) | 2012-12-26 |
| EP1809748A2 (en) | 2007-07-25 |
| AU2005295948A1 (en) | 2006-04-27 |
| JP2008522585A (ja) | 2008-07-03 |
| EP1809748A4 (en) | 2009-03-25 |
| MX2007004321A (es) | 2007-06-07 |
| CN101076592B (zh) | 2013-08-21 |
| CA2583690C (en) | 2016-04-05 |
| CA2583690A1 (en) | 2006-04-27 |
| US20060130176A1 (en) | 2006-06-15 |
| BRPI0516874A (pt) | 2008-09-23 |
| CN101076592A (zh) | 2007-11-21 |
| WO2006044322A3 (en) | 2007-01-04 |
| US8975471B2 (en) | 2015-03-10 |
| US20150159157A1 (en) | 2015-06-11 |
| AR050972A1 (es) | 2006-12-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8975471B2 (en) | MicroRNAs | |
| CA2541914C (en) | Gene silencing by using micro-rna molecules | |
| US8273951B2 (en) | Down-regulation of gene expression using artificial micrornas | |
| US8981181B2 (en) | Maize microrna sequences | |
| US20080313773A1 (en) | Production of artificial micrornas using synthetic microrna precursors | |
| US20160017349A1 (en) | Maize microrna sequences and targets thereof for agronomic traits | |
| ZA200703832B (en) | Micrornas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 11247587 Country of ref document: US |
|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2583690 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2007/004321 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007536777 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005295948 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1640/KOLNP/2007 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005808412 Country of ref document: EP Ref document number: 2007/03832 Country of ref document: ZA |
|
| ENP | Entry into the national phase |
Ref document number: 2005295948 Country of ref document: AU Date of ref document: 20051012 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580042547.7 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005808412 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0516874 Country of ref document: BR |