WO2005116061A2 - Sequenzen für die synthese antibakteriell wirkender polyketide - Google Patents

Sequenzen für die synthese antibakteriell wirkender polyketide Download PDF

Info

Publication number
WO2005116061A2
WO2005116061A2 PCT/DE2005/000949 DE2005000949W WO2005116061A2 WO 2005116061 A2 WO2005116061 A2 WO 2005116061A2 DE 2005000949 W DE2005000949 W DE 2005000949W WO 2005116061 A2 WO2005116061 A2 WO 2005116061A2
Authority
WO
WIPO (PCT)
Prior art keywords
polyketide
synthase
dna sequences
beta
seq
Prior art date
Application number
PCT/DE2005/000949
Other languages
English (en)
French (fr)
Other versions
WO2005116061A3 (de
Inventor
Rainer Borriss
Chen Xiao-Hua
Alexandra Koumoutsi
Joachim Vater
Original Assignee
Rainer Borriss
Chen Xiao-Hua
Alexandra Koumoutsi
Joachim Vater
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rainer Borriss, Chen Xiao-Hua, Alexandra Koumoutsi, Joachim Vater filed Critical Rainer Borriss
Publication of WO2005116061A2 publication Critical patent/WO2005116061A2/de
Publication of WO2005116061A3 publication Critical patent/WO2005116061A3/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/08—Oxygen as only ring hetero atoms containing a hetero ring of at least seven ring members, e.g. zearalenone, macrolide aglycons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P1/00—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes
    • C12P1/04—Preparation of compounds or compositions, not provided for in groups C12P3/00 - C12P39/00, by using microorganisms or enzymes by using bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus

Definitions

  • the invention relates to DNA sequences which code for polypeptides, which in turn are involved in the enzymatic biosynthesis of polyketide compounds, and to the amino acid sequences of the polypeptides.
  • the invention further relates to the first description of synthetic routes for the production of polyketide antibiotics from Bacillus amyloliquefaciens FZB42.
  • At least one polyketide antibiotic has a specific action against bacteria, preferably Gram-positive bacteria, but has no inhibitory action against eukaryotic organisms.
  • the fields of application of the invention are biology, medicine and pharmacy.
  • Bacillus amyloliquefaciens FZB42 promotes plant growth and suppresses the growth of phytopathic microorganisms in the area of the plant root zone (Idriss et al. 2002. Microbiology 148: 2097-2109).
  • the suppression of the phytopathogenic fungus Fusarium oxysporum is caused by the combined action of the cyclic lipopeptides BacillomycinD and Fengycin.
  • the sequence for the BacillomycinD operon indicates the presence of three modular peptide synthetases BmyA, B and C in FZB42 (Borriss et al. Application German Patent and Trademark Office C12N 15/52 Acc. 10326394.2).
  • the increased occurrence of antibiotic-resistant pathogenic microorganisms has led to an intensive search for new effective antibacterial and antifungal compounds.
  • the search for antiviral compounds is at least as important.
  • Polyketides and non-tribosomal peptides are two large families of natural products that contain numerous clinically important compounds, e.g. antimicrobial compounds (penicillin, bacitracin, erythromycin, oleandomycin, tylosin and vancomycin), immunosuppressants (cyclosporin, FK506 and rapamycin) and antitumor compounds (doxorubicin, bleomycin and epothilones).
  • antimicrobial compounds penicillin, bacitracin, erythromycin, oleandomycin, tylosin and vancomycin
  • immunosuppressants cyclosporin, FK506 and rapamycin
  • antitumor compounds doxorubicin, bleomycin and epothilones
  • Polyketides are a class of secondary metabolites with remarkable diversity in structure and function, which can have antimicrobial, antiviral and antiparasitic properties.
  • the polyketide mupirocin is responsible for the biocontrol function of the gram-negative bacterium Pseudomonas fluorescens (El-Sayed et al. 2004. Chemistry & Biology 1: 419-430).
  • the polyketide Bacillaen which is produced in a previously unknown manner in some Bacillus subtilis strains, is known as an inhibitor of prokaryotic protein synthesis and has a molecular weight of 580 and an empirically determined empirical formula of C35H48O7. In the agar diffusion test, Bacillaen is active against a large number of bacteria, but not against eukaryotic organisms (Patel et al. 1995. Journal of Antibiotics 48, 997-1003).
  • PKSs modular polyketide synthases
  • NRPSs non-tribosomal peptide synthases
  • PKSs are used for the synthesis of aromatic polyketides and for combinatorial biosynthesis.
  • Combinatorial biosynthesis is based on the genetic manipulation of biosynthetic pathways of "classic” antibiotics (e.g. lipopeptides), which are synthesized by polyketide synthases (PKS) or non-tribosomal peptide synthases (NRPSs).
  • classic antibiotics e.g. lipopeptides
  • PKS polyketide synthases
  • NRPSs non-tribosomal peptide synthases
  • Modular PKSs and NRPSs are polyfunctional "megasynthases" that are organized in repetitive units or “modules". Each module is responsible for a discrete step of polyketide or polypeptide chain extension.
  • each module determines the functional domains for the recognition, activation and condensation of a substrate amino acid, including the stereospecificity, it is possible to synthesize new connections by manipulating the domains or modules. Since the structures of polyketides are very complex and rich in stereocenters, this technique allows the manipulation of compounds that are difficult to obtain using conventional chemical methods (E. Rodriguez and R. Daniel. 2001. Combinatorial biosynthesis of antimicrobials and other natural products.Current Opinion in Microbiology 4: 526-534).
  • the object of the present invention was the identification and characterization of gene clusters in the genome of the bacterium Bacillus amyloliquefaciens FZB42, which are responsible for the synthesis of polyketides and the identification of synthetic routes for polyketide antibiotics. Another object of the invention was to identify polyketide antibiotics made by these synthetic routes.
  • the present invention relates to DNA sequences which code for polypeptides, which in turn are involved in the enzymatic biosynthesis of polyketide compounds, and the amino acid sequences of the polypeptides.
  • the invention further relates to the description of synthetic routes for the production of polyketide antibiotics from Bacillus amyloliquefaciens FZB42.
  • At least one polyketide antibiotic has a specific action against bacteria, preferably Gram-positive bacteria, but has no inhibitory action against eukaryotic organisms.
  • the invention also includes DNA sequences selected from: a) DNA sequences according to SEQ ID NO: 1, 2 or 3 or their complementary strands; b) DNA sequences which hybridize under stringent conditions to the sequences mentioned under a) or to fragments thereof; c) all variations and mutations of the DNA sequences defined under a) and b) which result from substitution, insertion or deletion and which give isofunctional expression products, and recombinant expression vectors comprising at least one DNA sequence defined under a) to c).
  • the invention also relates to prokaryotic or eukaryotic cells which have been transformed or transfected with at least one DNA sequence defined under a) to c) or with at least one recombinant expression vector, and to processes for the enzymatic biosynthesis of polyketide compounds with antibacterial activity.
  • the methods are characterized in that cells with at least one DNA sequence defined under a) to c) or with at least one recombinant Expression vector is transformed or transfected, the cells are cultivated in a suitable culture medium and the polyketide compound is isolated from the culture supernatant.
  • the polyketides bacillaen, difficidin and / or oxydifficidin as well as a previously uncharacterized polyketide with antibacterial activity can be produced.
  • the invention encompasses the use of the DNA sequences defined under a) to c) and the expression vectors according to the invention for combinatorial new synthesis of polyketides which have improved stability and / or activity against phyto-, animal and / or human pathogenic bacteria.
  • amino acid sequences of polypeptides which are involved in the enzymatic biosynthesis of polyketide compounds comprise the sequences with SEQ ID NO: 4 to 42 and the use of the amino acid sequences for combinatorial re-synthesis of polyketides, which have improved stability and / or Effect on phyto-, animal and / or human pathogenic bacteria are also the subject of the invention.
  • type 1 polyketide synthases allows the targeted manipulation of the non-tribosomal protein matrices and thus enables, according to the invention, the rational design of new polyketide antibiotics.
  • Functional hybrid matrices can be produced in vitro and in vivo.
  • Numerous modifying enzymes e.g. reductases, dehydratases, methyl transferases
  • reductases, dehydratases, methyl transferases from one of the three PKS clusters present in FZB42 can also be used for combinatorial biosynthesis of new polyketide agents.
  • Table 1 Inhibition of microorganisms by culture filtrates of FZB42 (24 and 48 h growth). The diameter of the zones of inhibition is given in cm.
  • Bacillaen provides an alternative when used against pathogenic Gram-positive bacteria of the genera Staphylococcus sp. and Streptococcus sp. whose medical treatment is becoming increasingly difficult due to the rapidly spreading multi-resistance to conventional antibiotics.
  • the pks3 polyketide does not inhibit eukaryotic cells and is therefore potentially suitable for use in the human field.
  • KS keto-synthase module
  • Em R erythromycin
  • Cm R chloramphenicol resistance
  • pMX39 Em R
  • pMX39 was digested with SpeI.
  • the resulting 2.9 kb fragment was digested with HindIII and a 1.8 kb emrAM fragment was obtained.
  • emrAM was inserted into the polylinker region of HindUC digested pUC18.
  • the plasmid (pUCemR) was used for the further gene insertion experiments to introduce erythromycin resistance.
  • a 1.8 kb fragment with the CmR marker gene was obtained from SpDI and HindIII digestion from pDG268 and cloned into pUC18.
  • the Cm R gene was flanked by the polylinker region of pUC18.
  • pkslUp 5'-AAAGGAGCGGAGTGCAACATC and pkslDw 5'-TGAGATGATGCCGTCCTCTTC a 3.3 kb fragment was amphfected by PCR and cloned into the vector pGEM-T.
  • ATGATCGCCGCTTCCTCATCAG obtained and cloned into the Vector.pGEMT.
  • a 1.3 kb fragment with the first KS domain from pks2 (KSl, Tab. 3) was cut out by EcoRI and Kpnl and replaced by the 1.3 kb Cm R gene from pUCCmR. After linearization with ScaJ, competent FZB42 cells were transformed and the Cm R pks2 knock out mutant CH7 was obtained. The pks3 gene was destroyed by inserting an Em R cassette from pUCemR.
  • a 2.2 kb pks3 gene fragment was primed with pks3Up 5'- ACATTGACCGCATCCTCAATCTG and pks3Dw 5'-
  • the genetic configuration of the mutants was confirmed by PCR of the chromosomal DNA with the specific primers.
  • Table 5 Strains and plasmids.
  • the plasmids pCH6, pCH7 and pCH8 were used for transformation into FZB42.
  • CH7 Apks2 :: Cmr pCH7 ⁇ FZB42
  • CH8 Apks3 Emr pCH8- FZB42 Plasmids pMX39 Ap R , Emr, Tetr derivative of pDB 101 pDG364 amyE Ap R , Cm R Integrative vector pGEM-T Cloning Vector, Ap R Labor Collection pUC18 Cloning Vector, Ap R Labor Collection pUCemR pUC18 with erm_amp, Ap R pUCemR pUC18 with cat, Amp R , Cm R
  • the elimination of the bacillaen biosynthesis had no drastic influence on the inhibitory effect compared to the indicator strains used in the agar diffusion test.
  • the inhibitory effect of the culture filtrate was slightly reduced, compared to St. aureus - similar to the CH8 pks3 knock out mutant - only detectable at all.
  • the cause could be the increased formation of difficidin and oxydifficidin in both mutants compared to the wild type.
  • no difficidin oxydifficidin was detectable in the culture filtrate of CH7.
  • the antibiotic activity against B.megaterium remained unchanged while there was no inhibitory activity against St. aureus (Fig. 2).
  • Domain shuffling within the three pks gene clusters in FZB 42 makes it possible to synthesize "tailor-made" polyketides which have improved durability and effectiveness compared to the pathogenic target microorganisms. Since all three polyketides have no activity against the eukaryotic model organisms S. cerevisiae and Fusarium oxysporum, the active ingredients can also be used in the medical field.
  • Table 2 The pksl gene cluster of B. amyloliquefaciens FZB42 size / genes / pks orf module domain position G + C aa pkslB hydroxyacylglutathione hydrolase (EC 3.1.2.6) 229aa 4254_pksl 4254 1..690 42.79% pkslC malonyl-CoA- [acyl -carrier-protein] transacylase (EC 2.3.1.39) 293 aa 4255_pksl 4255 Load AT 1009..1878 44.03% pkslD Malonyl-CoA- [acyl-carrier-protein] transacylase (EC 2.3.1.39) 379aa 4256_pksl 4256 Load AT 1850. .2989 47.49% pkslE 746aa
  • KS2 FabB 3-oxoacyl- (acyl-carrier-protein) synthase 3306 ... 3745 Beta-ketoacyl synthase, N-terminal domain 3307 ... 3556 Beta ketoacyl synthase, C -terminal domain 3564 ... 3745 ACP2 PP-binding, Phosphopantetheine attachment site 4418 ... 4484 frame shift
  • KS9 FabB 3-oxoacyl (acyl carrier protein) synthase 2290 ... 2707 Beta-ketoacyl 'synthase, N-terminal domain 2292 ... 2526 Beta-ketoacyl synthase, C-terminal domain 2534 ... 2702 KR adh_short, short chain dehydrogenase 3136 ... 3237 ACP9 PP-binding, Phosphopantetheine attachment site. 3389 ... 3454 pksN ( Putative polyketide synthase pksK 5433 aa 4302_pksl 4302 pfam00668 Condensation domain 35 ... 326
  • KS2 3-oxoacyl- (acyl-carrier-protein) synthase 1556-1985 Beta-ketoacyl synthase, N-terminal domain 1550-1800 Beta-ketoacyl synthase, C-terminal domain 1808..1984 KR2 hydroxyl beta-ketoacyl-ACP reductase 2703-2863 ACP2 PP-binding, Phosphopantetheine attachment site 2954-3018 PP-binding , Phosphopantetheine attachment site 3048-3114 Mi COG3321 Polyketide synthase module 3164 ...
  • KS6 3-oxoacyl (acyl carrier protein ) synthase 2155 2584 beta-ketoacyl synthase, N-terminal domain 2155 ... 2410 beta-ketoacyl synthase, C-terminal domain 2408 2587 ACP6 PP-binding, phosphopantetheine attachment site 2644 2710
  • Table 4 The pks3 gene cluster of B. amyloliquefaciens FZB42
  • Table 7 The pksl gene cluster from Bacillus amyloliquefaciens FZB42
  • Source SEQ-ID-NO: 1, GenBank Accession Number: AJ634060, length: 72612 bp, contains the pksl operon (bp 1..71249)
  • Table 8 The pks2 gene cluster from Bacillus amyloliquefaciens FZB42
  • Source SEQ-ID-NO: 2, GenBank Accession Number: AJ634061, length: 53724 bp, contains the pks2 operon (bp 1 .. 52130)
  • Bacillus amyloliquefaciens pks2 operon genes (pks2A, B, C, D, E, F, G, H)
  • Table 9 The pks3 gene cluster from Bacillus amyloliquefaciens FZB42
  • Source SEQ-ID-NO: 3, GenBank Accession Number: AJ634062, length: 74700 bp, contains the ⁇ ks3-oreron (bp 3469..73761) rbamOl 165 gene, rbamOl 163 gene, nusG gene, prol gene and the pks3 operon (pks3A, B, C, D, E, F, G, H, I, J, K, L, M gene) from Bacillus amyloliquefaciens

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Die Erfindung betrifft DNA-Sequenzen, die für Polypeptide kodieren, die wiederum an der enzymatischen Biosynthese von Polyketidverbindungen beteiligt sind sowie die Aminosäure-Sequenzen der Polypeptide. Weiterhin umfasst die Erfindung die Verwendung der erfindungsgemässen DNA- und Aminosäure-Sequenzen zur kombinatorischen Neusynthese von Polyketiden, die eine verbesserte Stabilität und/oder Wirkung gegenüber phyto-, tier- und/oder humanpathogenen Bakterien aufweisen. Die Anwendungsgebiete der Erfindung sind die Biologie, die Medizin und die Pharmazie.

Description

Sequenzen für die Synthese antibakteriell wirkender Polyketide
Die Erfindung betrifft DNA-Sequenzen, die für Polypeptide kodieren, die wiederum an der enzymatischen Biosynthese von Polyketidverbindungen beteiligt sind sowie die Aminosäure-Sequenzen der Polypeptide.
Weiterhin betrifft die Erfindung die erstmalige Beschreibung von Synthesewegen für die Herstellung von Polyketidantibiotika aus Bacillus amyloliquefaciens FZB42. Dabei weist mindestens ein Polyketidantibiotikum eine spezifische Wirkung gegen Bakterien, vorzugsweise Gram-positive Bakterien auf, besitzt jedoch keine Hemmwirkung gegen eukaryotische Organismen.
Die Anwendungsgebiete der Erfindung sind die Biologie, die Medizin und die Pharmazie.
Stand der Technik
Das sporenbildende Gram-positive Bakterium Bacillus amyloliquefaciens FZB42 fördert das Pflanzenwachstum und unterdrückt das Wachstum phytopathόgener Mikroorganismen im Bereich der pflanzlichen Wurzelzone (Idriss et al. 2002. Microbiology 148: 2097-2109).
Die Suppression des phytopathogenen Pilzes Fusarium oxysporum wird durch die kombinierte Wirkung der cyclischen Lipopeptide BacillomycinD und Fengycin verursacht. Die Sequenz für das BacillomycinD Operon weist auf das Vorhandensein von drei modularen Peptidsynthetasen BmyA, B und C in FZB42 hin (Borriss et al. Anmeldung Deutsches Patent- und Markenamt C12N 15/52- Akz. 10326394.2).
Durch Inaktivierung des BmyA kodierenden Gens wurde nicht nur die BacillomycinD Synthese sondern auch die antifungale Wirkung von FZB42 auf Fusarium oxysporum eliminiert. Dagegen blieb die antibakterielle Wirkung von Kulturfiltraten der FZB42- Mutanten auf Gram-negative und Gram-positive Bakterien bestehen. (Koumoutsi et al. 2004, J.Bacteriol. 186, 1084-1096).
Die Ausschaltung der Fengycin- und Surfactinsynthese hatte keinen Einfluss auf die antibakterielle Wirkung von FZB42. Eine antibakterielle Wirkung wurde bereits für verschiedene konjugierte Polyen- Antibiotika der Gattung Bacillus beschrieben (z.B. Zimmermann et al. 1987. J. Antibiotics 40:1677-1681, Patel et al. 1995. J. Antibiotics 48, 997-1003).
Gensequenzen, die die Synthese dieser antibakteriellen Wirkstoffe in Bacillus Biokontroll-Stämmen determinieren, sind jedoch nicht bekannt.
Das verstärkte Auftreten von Antibiotika-resistenten pathogenen Mikroorganismen hat zu einer intensiven Suche nach neuen wirksamen antibakteriellen und antifungalen Verbindungen geführt. Von mindestens ebenso großer Bedeutung ist die Suche nach antiviralen Verbindungen.
Dabei wird die Entdeckung neuer geeigneter Naturstoffe immer schwieriger. Neben dem Screening von natürlichen Produzentenstämmen verspricht die kombinatorische Biosynthese eine effiziente Alternative für die Entwicklung neuer wirksamer Medikamente zu werden.
Polyketide und nichtribosomale Peptide sind zwei große Naturstoff-Familien, die zahlreiche klinisch bedeutsame Verbindungen beinhalten, z.B. antimikrobielle Verbindungen (Penicillin, Bacitracin, Erythromycin, Oleandomycin, Tylosin und Vancomycin), Immunsuppressiva (Cyclosporin, FK506 und Rapamycin) und Antitumorverbindungen (Doxorubicin, Bleomycin und Epothilone).
Polyketide sind eine Klasse von Sekundärmetaboliten mit bemerkenswerter Vielfalt in Struktur und Funktion, die sowohl antimikrobielle als auch antivirale und antiparasitische Eigenschaften aufweisen können.
Ihr weites Aktivitätsspektrum macht sie zu einer der am meisten gesuchten Molekülgruppe in biologischen Screens. Z.B. ist das Polyketid Mupirocin für die Biokontroll-Funktion des Gram-negativen Bakteriums Pseudomonas fluorescens verantwortlich (El-Sayed et al. 2004. Chemistry & Biology 1:419-430). Das Polyketid Bacillaen, das in bisher unbekannter Weise in einigen Bacillus subtilis Stämmen produziert wird, ist als Inhibitor der prokaryotischen Proteinsynthese bekannt und weist ein Molekulargewicht von 580 und eine empirisch ermittelte Summenformel von C35H48O7 auf. Im Agar-Diffusionstest ist Bacillaen gegen eine Vielzahl von Bakterien, nicht aber gegenüber eukaryotischen Organismen aktiv (Patel et al. 1995. Journal of Antibiotics 48, 997-1003).
Durch Anwendung der „Suppression Subtractive Hybridization" (SSH) Methode wurden in FZB42 drei Gencluster identifiziert, die Homologie zu Polyketid-Synthasen aufwiesen (Koumoutsi et al. 2004. J.Bacteriol. 186). Eine Bestimmung der kompletten DNA Sequenzen sowie der translatierten Proteine erfolgte jedoch nicht. Ein Nachweis der Synthese von Polyketiden in Bacillus amyloliquefaciens bzw. einer damit verbundenen antibiotischen Aktivität wurde nicht durchgeführt. Es erfolgte keine Zuordnung der Polyketid-Synthase-Gencluster zur Synthese eines Polyketids.
Die meisten Entwicklungen der kombinatorischen Biosynthese basieren auf Verbindungen, die durch modulare Polyketidsynthasen (PKSs) synthetisiert werden. Daneben werden auch nichtribosomalen Peptidsynthasen (NRPSs) und PKSs für die Synthese aromatischer Polyketide und für die kombinatorische Biosynthese eingesetzt.
Kombinatorische Biosynthese beruht auf der genetischen Manipulation von Biosynthesewegen „klassischer" Antibiotika (z.B. von Lipopeptiden), die durch Polyketidsynthasen (PKS) bzw. nichtribosomalen Peptidsynthasen (NRPSs) synthetisiert werden.
Modulare PKSs und NRPSs sind polyfunktionelle „Megasynthasen", die in repetitiven Einheiten oder „Modulen" organisiert sind. Jedes Modul ist für einen diskreten Schritt der Polyketid- oder Polypeptidkettenverlängerung verantwortlich.
Da jedes Modul die funktionellen Domänen für die Erkennung, Aktivierung und Kondensation einer Substrataminosäure einschließlich der Stereospezifität determiniert, ist es möglich, neue Verbindungen durch Manipulation der Domänen oder Module zu synthetisieren. Da die Strukturen von Polyketiden sehr komplex und reich an Stereozentren sind, erlaubt diese Technik die Manipulation von Verbindungen, die durch Anwendung konventioneller, chemischer Methoden schwer zu erhalten sind (E. Rodriguez and R. Daniel. 2001. Combinatorial biosynthesis of antimicrobials and other natural products. Current Opinion in Microbiology 4: 526-534).
Voraussetzung für die Anwendung der kombinatorischen Neusynthese ist die Kenntnis der Gensequenzen, die für die erforderlichen PKSs und NRPSs kodieren und eines Wirtsstammes, der die stabile Expression großer heterologer DNA-Bereiche erlaubt.
Die Aufgabe der vorliegenden Erfindung war die Identifizierung und Charakterisierung von Genclustern im Genom des Bakteriums Bacillus amyloliquefaciens FZB42, die für die Synthese von Polyketiden verantwortlich sind sowie die Identifizierung von Synthesewegen für Polyketidantibiotika. Eine weitere Aufgabe der Erfindung war die Identifizierung von Polyketidantibiotika, die auf diesen Synthesewegen hergestellt werden.
Die Erfindung wird gemäß den Ansprüchen realisiert.
Gegenstand der vorliegenden Erfindung sind DNA-Sequenzen, die für Polypeptide kodieren, die wiederum an der enzymatischen Biosynthese von Polyketidverbindungen beteiligt sind sowie die Aminosäure-Sequenzen der Polypeptide.
Weiterhin betrifft die Erfindung die Beschreibung von Synthesewegen für die Herstellung von Polyketidantibiotika aus Bacillus amyloliquefaciens FZB42. Dabei weist mindestens ein Polyketidantibiotikum eine spezifische Wirkung gegen Bakterien, vorzugsweise Gram-positive Bakterien auf, besitzt jedoch keine Hemmwirkung gegen eukaryotische Organismen.
In dem Stamm FZB42 wurden drei Gencluster für die Synthese von Polyketiden identifiziert und durch Sequenzanalyse vollständig charakterisiert. Im Genom des Bakteriums Bacillus amyloliquefaciens (Stamm FZB42) konnten überraschenderweise die DNA-Sequenzen mit den SEQ-ID NO: 1, 2 und 3 identifiziert und charakterisiert werden. Die DNA-Sequenzen kodieren für Polypeptide, die wiederum an der enzymatischen Biosynthese von Polyketidverbindungen mit antibakterieller Wirkung beteiligt sind.
Umfangreiche Untersuchungen ergaben, dass die Expressionsprodukte der Sequenz mit der SEQ-ID NO: 1 die enzymatische Biosynthese des antibakteriellen Polyketids Bacillaen bewirken. Die Expressionsprodukte der Sequenz mit der SEQ-ID NO: 2 bewirken die enzymatische Biosynthese der antibakteriellen Polyketide Difficidin und/oder Oxydifficidin und die Expressionsprodukte der Sequenz mit der SEQ-ID NO: 3 sind für die Synthese eines bisher nicht bekannten antibakteriellen Polyketids verantwortlich.
Die Erfindung umfaßt darüber hinaus DNA-Sequenzen ausgewählt aus: a) DNA-Sequenzen gemäß den SEQ-ID NO: 1, 2 oder 3 oder deren komplementären Strängen; b) DNA-Sequenzen, die unter stringenten Bedingungen an die unter a) genannten Sequenzen oder an Fragmente davon hybridisieren; c) alle Variationen und durch Substitution, Insertion oder Deletion entstandenen Mutanten der unter a) und b) definierten DNA-Sequenzen, die isofunktionelle Expressionsprodukte ergeben, sowie rekombinante Expressionsvektoren umfassend mindestens eine unter a) bis c) definierte DNA-Sequenz.
Gegenstand der Erfindung sind auch prokaryotische oder eukaryotische Zellen, die mit mindestens einer unter a) bis c) definierten DNA-Sequenz oder mit mindestens einem rekombinanten Expressionsvektor transformiert oder tranfiziert sind sowie Verfahren zur enzymatischen Biosynthese von Polyketidverbindungen mit antibakterieller Wirkung.
Die Verfahren sind dadurch gekennzeichnet, dass Zellen mit mindestens einer unter a) bis c) definierten DNA-Sequenz oder mit mindestens einem rekombinanten Expressionsvektor transformiert oder tranfiziert werden, die Zellen in einem geeigneten Kulturmedium kultiviert werden und die Polyketidverbindung aus dem Kulturüberstand isoliert wird.
Mit diesem Verfahren können die Polyketide Bacillaen, Difficidin und/oder Oxydifficidin sowie ein bisher nicht charakterisiertes Polyketid mit antibakterieller Wirkung hergestellt werden.
Weiterhin umfaßt die Erfindung die Verwendung der unter a) bis c) definierten DNA- Sequenzen sowie der erfϊndungsgemäßen Expressionsvektoren zur kombinatorischen Neusynthese von Polyketiden, die eine verbesserte Stabilität und/oder Wirkung gegenüber phyto-, tier- und/oder humanpathogenen Bakterien aufweisen.
Die Aminosäure-Sequenzen von Polypeptiden, die an der enzymatischen Biosynthese von Polyketidverbindungen beteiligt sind, umfassend die Sequenzen mit den SEQ-ID NO: 4 bis 42 sowie die Verwendung der Aminosäure-Sequenzen zur kombinatorischen Neusynthese von Polyketiden, die eine verbesserte Stabilität und/oder Wirkung gegenüber phyto-, tier- und/oder humanpathogenen Bakterien aufweisen, sind ebenfalls Gegenstand der Erfindung.
Die modularen Anordnung von Typ 1 -Polyketid-Synthasen erlaubt die gezielte Manipulation der nichtribosomalen Proteinmatrizen und befähigt somit erfindungsgemäß zum rationalen Design neuer Polyketidantibiotika.
Funktionelle Hybrid-Matrizen können in vitro und in vivo hergestellt werden. Zahlreiche modifizierende Enzyme (z.B. Reduktasen, Dehydratasen, Methyltransferasen) aus einem der drei in FZB42 vorhandenen PKS-Cluster können ebenfalls für die kombinatorische Biosynthese neuer Polyketidwirkstoffe eingesetzt werden.
Weiterhin erlaubt die natürliche Kompetenz für DNA-Aufnahme und Rekombination und die Kenntnis der DNA-Sequenzen bei FZB42 den gezielten Einsatz stärkerer und regulierbarer Promotoren um die Produktausbeute zu steigern. Die Erfindung wird nachfolgend näher erläutert und durch Ausführungsbeispiele belegt, ohne dass diese Erläuterungen eine einschränkende Wirkung hätten.
Antibakterielle Aktivität von FZB42
Kulturfiltrate von FZB42 nach 24 h bzw. 48 h Kultur weisen sowohl antibakterielle Aktivität gegenüber den meisten überprüften Bakterien, als auch antifungale Aktivität (Arxula adeninovorans, Saccharomyces cerevisiae) auf. Die höchste Empfindlichkeit wurde bei Gram-positiven Bakterien (Ausnahme Bacillus subtilis, Staphylococcus aureus) beobachtet. Auch die überprüften Vertreter der α-Proteobakterien wurden durch das Kulturfiltrat von FZB42 deutlich gehemmt. Dagegen waren Vertreter der Enterobakterien und andere Repräsentanten der γ-Proteobakterien relativ unempfindlich (siehe Tabelle 1).
Tabelle 1: Hemmung von Mikroorganismen durch Kulturfiltrate von FZB42 (24 und 48 h Wachstum). Der Durchmesser der Hemmzonen ist in cm angegeben.
Stamm 24h 48h taxon Bacillus subtilis - - 0,3 trüb Gram+ IowGC Bacillus megaterium 1,3 klar 1,1 klar Gram+ IowGC Paenibacillus larvae larvae l1 klar 1,32 klar Gram-r- IowGC Streptococcus faecalis 0,8 klar 0,6 klar Gram+ IowGC Micrococcus luteus - - 0,5 klar Gram+ IowGC Staphylococcus aureus - - - - Gram-)- IowGC Arthrobacter spec. 0,7 klar 0,9 klar Gram-t- IowGC Streptomyces coelicolor 40/233 1,6 klar 1,2 klar Gram+ highGC Streptomyces viridochromogenes 40110 1,6 klar 1,2 klar Gram+ highGC Streptomyces F2 0,8 klar 0,8 klar Gram-t- highGC
Agrobacterium tumefaciens 0,4 klar 0,9 klar -proteobacteria
Agrobacterium tumefaciens AGL1 0,5 klar 1 klar α -proteobacteria
Flavobacterium spec. 0,3 trüb 0,3 trüb α -proteobacteria
Acinetobacter spec. - - - - α -proteobacteria
Klebsiella terrigena 0,3 klar 0,2 klar γ-proteobacteria
Klebsiella pneumoniae 0,2 trüb 0,2 klar γ -proteobacteria
1 Bestimmung nach 5 Tagen Wachstum auf Blutagar
2 Bestimmung nach 8 Tagen Wachstum auf Blutagar Enterobacter spec. 0,3 trüb _ _ γ -proteobacteria Erwinia carotovora 0,3 trüb 0,4 trüb γ -proteobacteria Serratia marcescens 0,6 klar 0,5 klar γ -proteobacteria Proteus vulgaris 0,2 trüb 0,2 trüb γ -proteobacteria Pseudomonas aeruginosa 0,2 trüb 0,4 trüb γ -proteobacteria Pseudomonas fluorescens 0,5 trüb 0,4 trüb γ -proteobacteria Pseudomonas fluorescens 15 0,2 trüb - - γ -proteobacteria Pseudomonas aureofaciens PS49 - - - - γ -proteobacteria Pseudomonas putida 62 - - - - γ -proteobacteria Pseudomonas spec. 14a 0,3 trüb 0,2 klar γ -proteobacteria Pseudomonas spec. 20 0,4 klar 0,3 klar γ -proteobacteria Pseudomonas spec. 79 - - - - γ -proteobacteria Pseudomonas spec. Kl 9 - - - - γ -proteobacteria
Arxula adeninovorans 0,2 klar 0,6 klar Hefen Saccharomyces cerevisiae 1,2 klar 1,1 klar Hefen
Im Kulturfiltrat von FZB42 und in Mutanten, in denen die Synthese der antifungal wirkenden Lipopeptide BacillomycinD, Fengycin und Surfactin ausgeschaltet wurde, konnte überraschenderweise eine spezifische antibakterielle Wirkung, insbesondere gegenüber Gram-positiven Bakterien (u.a, Bacillus sp., Streptomyces sp., Streptococcus sp.) nachgewiesen werden.
Durch Ausschaltung der pks3 -Gensequenz in der Mutante CH8 wurde der antibakterielle Effekt gegen . die. genannten Bakterienweitgehend aufgehoben. Dieser Befund beweist, dass durch die Polyketidsynthetasen des pks3 Genclusters ein Polyketid mit spezifischer antibakterieller Wirkung synthetisiert wird. Eine chemische Charakterisierung des Polyketids durch Massenspektroskopie war bisher nicht möglich. Eine Ähnlichkeit zu den bisher aus Bacillus beschriebenen Polyketiden (Bacillaen und Difficidin/Oxydifficidin) konnte j edoch ausgeschlossen werden.
Im Kulturfiltrat des Bakteriums Bacillus amyloliquefaciens FZB42 und einzelnen Mutanten konnten überraschenderweise die Polyketide Bacillaen und Difficidin/Oxydifficidin nachgewiesen werden. Nach Auftrennung des Kul urfiltrats von FZB42 durch HPLC konnte in dem nach 18 min. Retentionszeit eruierten Peak durch Electrospray-Massenspektroskopie (ESM) ein Peak mit m/z von 581.1 nachgewiesen werden, der dem Bacillaen entspricht. Die höchste Intensität dieses Peaks wurde nach 48 h Kultur in Landy-Medium beobachtet.
Ein optimierter Wirkstoff auf der Basis des Polyketids Bacillaen stellt eine Alternative bei dem Einsatz gegen pathogene Gram-positive Bakterien der Gattungen Staphylococcus sp. und Streptococcus sp. dar, deren medizinische Behandlung durch die sich rasant verbreitende Multiresistenz gegenüber herkömmlichen Antibiotika zunehmend erschwert wird.
Hinzu kommt, dass das pks3 -Polyketid keine Inhibition eukaryotischer Zellen verursacht und somit potentiell für den Einsatz im humanen Bereich geeignet ist.
Diese besonders vorteilhafte Eigenschaft konnte dadurch belegt werden, dass in der Mutante CH8 keine Reduktion der antifungalen Wirkung gegenüber Fusarium oysporum oder Saccharomyces cerevisiae verursacht wurde.
Zur Identifizierung der für die antibakterielle Aktivität möglicherweise verantwortlichen Gencluster (pksl, pks2, pks3) wurden alle drei Gencluster komplett sequenziert (SEQ-ID NO: l=pksl, SEQ-ID NO: 2=pks2, und SEQ-ID NO: 3=pks3) und durch Homologie-Sequenzvergleich weiter charakterisiert.
Genomanalyse: pks-Gencluster
An verschiedenen Positionen im Genom von B. amyloliquefaciens FZB42 wurden drei große Gencluster mit Homologie zu dem Polyketidsynthase-Operon (pksX) von B.subtilis (Albertini et al. 1995. Microbiology 141,299-309) nachgewiesen. Pksl (SEQ- ID NO: 1, 72612 bp, Tab.2 und 7), pks2 (SEQ-ID NO: 2, 53724 bp, Tab.3 und 8) und pks3 (SEQ-ID NO: 3, 74700, Tab.4 und 9) weisen strukturelle Gemeinsamkeiten auf und sind wahrscheinlich durch Genduplikation aus einem gemeinsamen Vorfahren entstanden. Konstruktion von gene-knock-out Mutanten in FZB42
Die Ausschaltung der Genexpression erfolgte durch Kassettenmutagenese in das jeweils erste Keto-Synthase Modul (KS) unter Verwendung von Erythromycin- (EmR) und Chloramphenicol-Resistenz (CmR) vermittelnder Gene (Koumoutsi et al. 2004. J. Bacteriol. 186,1084-1096). pMX39 (EmR) wurde mit Spei verdaut. Das resultierende 2.9 kb Fragment wurde mit Hindlll verdaut und ein 1.8 kb emrAM Fragment erhalten. emrAM wurde in die Polylinker-region von Hindlll verdauten pUC18 inseriert. Das Plasmid (pUCemR) wurde für die weiteren Geninsertionsexperimente zur Einführung der Erythromycin-Resistenz genutzt.
Ein 1.8 kb Fragment mit dem CmR-Markergen wurde durch SphI and Hindlll Verdau aus pDG268 erhalten und in pUC18 kloniert. In dem resultierende Plasmid (pUCemR) war das CmR-Gen durch die Polylinker-Region von pUC18 flankiert. Unter Nutzung der Primer pkslUp 5'-AAAGGAGCGGAGTGCAACATC und pkslDw 5'-TGAGATGATGCCGTCCTCTTC, wurde ein 3.3 kb Fragment durch PCR amphfiziert und in den Vektor pGEM-T kloniert. Dieser wurde mit EcoRI and Hpal verdaut und ein 1,4 kb Fragment mit der ersten KS-Domäne (KSl, Tabelle 2) entfernt. Das CmR-Gen aus EcoRI/Smal geschnittenen pUCemR wurde inseriert und das Plasmid pCH6 erhalten. Nach Linearisierung durch Seal wurde das Plasmid in kompetente B. amyloliquefaciens FZB42 Zellen (Koumoutsi et al. 2004. J.Bacteriol. 186,1084-1096) transformiert. Durch Gensubstitution via homologe Rekombination wurde die Cm^pksl Mutante CH6 erhalten. Ein 3.0 kp PCR Fragment mit dem 5' Teil des pks2-Operons wurde durch die Primer pks2Up 5'-AGCTCATTGACAGCGATGCTGC and pks2Dw 5'-
ATGATCGCCGCTTCCTCATCAG erhalten und in den Vector.pGEMT kloniert. Ein 1.3 kb Fragment mit der ersten KS-Domäne vonpks2 (KSl, Tab.3), wurde durch EcoRI und Kpnl herausgeschnitten und durch das 1.3 kb CmR Gen aus pUCCmR ersetzt. Nach Linearisierung mit ScaJ wurden kompetente FZB42 Zellen transformiert und die CmR pks2 knock out Mutante CH7 erhalten. Das pks3 Gen wurde durch Insertion einer EmR cassette aus pUCemR zerstört. Ein 2.2 kb pks3 Genfragment wurde mit den Primern pks3Up 5'- ACATTGACCGCATCCTCAATCTG und pks3Dw 5'-
TCAGCTGCTGTTCGGAATGTG amplifiziert und in den Vektor pGEM-T kloniert. Durch Verdau mit EcoRI und Eco72J wurde ein 376 bp Fragment in der Mitte der amplifizierten Region entfernt. Die ermAM Kassette (1.9 kb) wurde von pUCemR durch EcoRI IPvuII Verdau erhalten und inseriert. Das resultierende Plasmid pCH8 wurde mit Apal linearisiert und in kompetente FZB42 Zellen transformiert. Die EmR pks3 Mutante CH8 wurde erhalten.
Die genetische Konfiguration der Mutanten wurde durch PCR der chromosomalen DNA mit den spezifischen Primern bestätigt.
Tabelle 5: Stämme und Plasmide. Für die Herstellung der gewünschten Knockout-Stämme wurden die Plasmide pCH6, pCH7 und pCH8 zur Transformation in FZB42 eingesetzt.
Beschreibung, Resistenz Quelle/Herstellung B. amyloliquefaciens Stämme
FZB42 Produzent von Surfactin, Fengycin, Bacillomycin FZB Biotech GmbH Berlin
CH6 Δpksl ::Cmr pCH6^FZB42
CH7 Apks2::Cmr pCH7^FZB42
CH8 Apks3:: Emr pCH8- FZB42 Plasmide pMX39 ApR, Emr, Tetr Derivat von pDB 101 pDG364 amyE ApR, CmR Integrativer Vektor pGEM-T Cloning Vector , ApR Labor Kollektion pUC18 Cloning Vector, ApR Labor Kollektion pUCemR pUC18 mit erm_amp , ApR pUCemR pUC18 mit cat , AmpR, CmR
pCH6 pGEM-T mit einem 1.9 kb Fragment von pksl::Cmr, ApR pCH7 pGEM-T mit einem 1.7 kb fragment frompks2::Cmr, ApR pCH8 pGEM-T mit einem 1.8 kb fragment from pksf3 : :Emr, ApR
Antibakterielle und antifungale Aktivität von Gen-Knock-out Mutanten
Bei Ausschaltung des pks3 Gens durch Kassetten-Mutagenese wurde nahezu die gesamte antibakterielle Aktivität in dem Mutantenstamm CH8 ausgeschaltet (Indikatorstamm B.megaterium, Abb. 1). Dagegen wies die pks2 Mutante CH7 unverändert antibakterielle Aktivität gegenüber den eingesetzten Indikatorstämmen Bacillus megaterium und Arthrobacter spec. auf. Beide Mutanten waren in ihrer antifungalen Wirkung (Saccharomyces cerevisiae, Fusarium oxyspomm) gegenüber dem Wildtyp nicht verändert. Umgekehrt war keiner der Lipopeptidsynthese-Mutanten (AK1, AK2, AK3, CH1, CH2, CH3) in der Wirkung gegenüber Bacillus megaterium und Arthrobacter spec. beeinflusst. Die Ausschaltung des sfp-G&as, das für eine Phosphopantetheinyl Transferase kodiert, hat den Ausfall der Synthese biologisch aktiver Lipopeptide und Polyketide zur Folge (Tab.5). Von besonderem Interesse ist der Effekt der .yczE-Mutation (CH4) durch die sowohl die Synthese von Lipopeptiden der Iturin-Familie als auch der Polyketide unterbunden wird. Der Ausfall der Synthese von Bacillomycin D in CH4 (yczE), und von BacillomycinD, Fengycin und Surfactin in der sfp, yczE Doppelmutante CH5 konnte durch Matrix-unterstützte Laser Desorptions- Ionisations-Flugzeit Massenspektroskopie (MALDI TOF MS) nachgewiesen werden. Der Ausfall der Synthese von Bacillaen und Difficidin/Oxydifficidin in CH4 (yczE), und von BacillomycinD, Fengycin und Surfactin in der sfp, yczE Doppelmutante CH5 konnte durch Matrix-unterstützte Laser Desorptions-Ionisations-Flugzeit Massenspektroskopie (MALDI TOF MS) nachgewiesen werden. Die entsprechende Untersuchung der Kulturfiltrate der pks-Mutanten (CH6-CH8) ergab, dass das pksl Gencluster die Synthese von Bacillaen und das pks2-Gencluster die Synthese von Difficidin/Oxydifficidin bewirkt. Überraschenderweise hatte die Ausschaltung der Bacillaen-Biosynthese keinen drastischen Einfluss auf die inhibitorische Wirkung gegenüber den eingesetzten Indikatorstämmen im Agar-Diffusionstest. Gegenüber B.megaterium war der inhibitorische Effekt des Kulturfiltrats leicht reduziert, gegenüber St. aureus - ähnlich wie in der CH8 pks3 knock out Mutante - überhaupt erst nachweisbar. Ursache könnte die gegenüber dem Wildtyp erhöhte Bildung von Difficidin und Oxydifficidin in beiden Mutanten sein. Nach Ausschaltung des pks2 Genclusters war kein Difficidin Oxydifficidin im Kulturfiltrat von CH7 nachweisbar. Die antibiotische Aktivität gegenüber B.megaterium blieb unverändert während keine inhibitorische Aktivität gegenüber St. aureus verblieb (Abb.2). Obwohl bisher kein 3. Polyketid durch die von uns ein eingesetzten Untersuchungsmethoden in FZB 42 nachgewiesen werden konnte, zeigt der deutliche Abfall in der inhibitorischen Aktivität gegenüber dem Indikatorstamm B.megaterium bei der pks-3 knock out Mutante CH8, dass durch dieses Gencluster ein potentes Antibiotikum mit spezifischer Wirkung produziert wird (Abb.l, Tabelle 6). Insbesondere die Gencluster pks2 (Difficidin/Oxydifficidin-Biosynthese) und pks3 (unbekanntes Polyketid) sind für die Synthese von Wirkstoffen mit spezifischer Wirkung gegenüber phyto-, tier- und humanpathogenen Bakterien (z.B. dem Erreger des Kartoffelschorfes, Streptomyces scabies, dem Erreger der Faulbrut bei Bienenlarven, Paenibacillus larvae lai-vae und dem humanpathogenen Staphylococcus aureus) von Interesse.
Durch Domänen-Shuffling innerhalb der drei pks-Gencluster in FZB 42 besteht die Möglichkeit zur Synthese „massgeschneiderter" Polyketide, die eine verbesserte Haltbarkeit und Wirksamkeit gegenüber den pathogenen Zielmikroorganismen aufweisen. Da alle drei Polyketide keine Wirksamkeit gegenüber den eingesetzten eukaryotischen Modellorganismen S. cerevisiae und Fusarium oxysporum aufwiesen ist der Einsatz der Wirkstoffe auch im medizinischen Bereich möglich.
Tab. 6: Antibakterielle, antifungale und hämolytische Aktivität von Gen-knock-out Mutanten. Herstellung der Mutanten CH6, CH7 und CH8 s.o. Übrige Mutanten wie beschrieben (Koumoutsi et al. 2004, J. Bacteriol, 186, 1084- 1096)
Figure imgf000014_0001
Nachweis in dem Kulturfiltrat nach HPLC Chromatographie und Massenspektroskopie nicht bestimmt Tabelle 2: Das pksl -Gencluster von B. amyloliquefaciens FZB42 Größe/ Gene/pks orf Modul Domäne Position G+C aa pkslB Hydroxyacylglutathione hydrolase (EC 3.1.2.6) 229aa 4254_pksl 4254 1..690 42.79% pkslC Malonyl-CoA-[acyl-carrier-protein] transacylase (EC 2.3.1.39) 293 aa 4255_pksl 4255 Load AT 1009..1878 44.03% pkslD Malonyl-CoA-[acyl-carrier-protein] transacylase (EC 2.3.1.39) 379aa 4256_pksl 4256 Load AT 1850..2989 47.49% pkslE 746aa
^ 4257_pksl 4257 Load AT FabD, (acyl-carrier-protein) S-rhalonyltransferase 1...287 2991..5231 48.57% Dioxygenases related to 2-nitropropane dioxygenase 330...672 pkslF 82aa 5297..5545 ACP Acyl carrier protein 46.34%
,- pkslG " 4260jpksl 4260 HMG CoA PksG, 3-hydroxy-3-methylglutaryl CoA synthase 420aa 5597..6859 50.32%
Figure imgf000015_0001
' 4261_pksl 4261 ECH Enoyl-CoA hydratase (EC 4.2ΛΛ1) 260aa 6841..1629 49.36%
Fortsetzung von Tabelle 2
4262_pksl 4262 ECH Enoyl-CoA hydratase fEC 4.2.1.17 249aa 7639..8388 49.13% pksJΛ Putative polyketide synthase pksK 4556aa
4273_pksl 4273 EntF Non-ribosomal peptide synthetase modules 32...474
8428..23376 50.32% Load CaiC Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II 22...567 AMP-binding enzyme 61. „477 ACP AcpP, Acyl carrier protein 580...658 PP-binding, Phosphopantetheine attachment site 593...652 Condensation domain 679...974 EntF Non-ribosomal peptide synthetase modules 904...1557 CaiC Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II 11333...1632 AMP-binding enzyme 1167...1564 Ml COG3321 Polyketide synthase modules 1750...3777 KSl FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 1754...2178 Beta-ketoacyl synthase, N-terminal domain 1751...2000 Beta-ketoacyl synthase, C-terminal domain 2008...2177 KR1 beta-ketoacyl-ACP reductase 2880...3038 ACPI PP-binding, Phosphopantetheine attachment site 3098...3163 ACP PP-binding, Phosphopantetheine attachment site 3190...3256 M2 COG3321 Polyketide synthase modules 3307...4064 KS2 FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 3306...3745 Beta-ketoacyl synthase, N-terminal domain 3307...3556 Beta-ketoacyl synthase, C-terminal domain 3564...3745 ACP2 PP-binding, Phosphopantetheine attachment site 4418...4484 frame shift
Fortsetzung von Tabelle 2 pksJ' ' Putative polyketide synthase pksK 445aa
4274_pksl 4274 M3 COG3321 Polyketide synthase modules 1...435 22040...23374 51.24% KS3 FabB, 3-oxoacyl-(acyl-caπier-protein) synthase 10...399 Beta-ketoacyl synthase, N-terminal domain 9...226 Beta-ketoacyl synthase, C-terminal domain 234-398
pksL Putative polyketide synthase pksL 448 laa
4281_pksl 4281 M4 COG3321 Polyketide synthase modules 418...1455
23360..36805 50.23% KS4 FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 418...855 Beta-ketoacyl synthase, N-terminal domain 419...673 Beta-ketoacyl synthase, C-terminal domain 681...858 KR FabG, Dehydrogenases with different specificities 1498...1656 ACP4 PP-binding, Phosphopantetheine attachment site 1772...1836 M5 Polyketide synthase modules 1899...2509 KS5 FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 1898...2330 Beta-ketoacyl synthase, N-terminal domain 1898...2153 Beta-ketoacyl synthase, C-terminal domain 21161...2338 ACP5 PP-binding, Phosphopantetheine attachment site 2609...2667 PP-binding, Phosphopantetheine attachment site 2717...2783 M6 COG3321 Polyketide synthase modules 2839...3479 KS6 FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 2844...3264 Beta-ketoacyl synthase, N-terminal domain 2844...3087 Beta-ketoacyl synthase, C-terminal domain 3095...3263 KR FabG, Dehydrogenases with different specificities 3643...3781 ACP6 PP-binding, Phosphopantetheine attachment site 3927...3993 M7 Polyketide synthase modules 4030...4056 KS7 FabB, 3-oxoacyl-(acyl-caπier-protein) synthase 4032...4436 Beta-ketoacyl synthase, N-terminal domain 4030...4230 Beta-ketoacyl synthase, C-terminal domain 4271...4435
Fortsetzung von Tabelle 2
Putative polyketide synthase pksL 3518aa
4290_pksl 4290 ACP7 PP-binding, Phosphopantetheine attachment site. 299-363
36802..47358 49.82% M8 COG3321 Polyketide synthase modules 397...1474 KS8 3-oxoacyl-(acyl-carrier-protein) synthase (I and II) 398...833 Beta-ketoacyl synthase, N-terminal domain 397...642 Beta-ketoacyl synthase, C-terminal domain 655...832 KR adh short, short chain dehydrogenase 1533...1669 ACP8 PP-binding, Phosphopantetheine attachment site. 2169...2234 M9 COG3321 Polyketide synthase modules 2290...2878 KS9 FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 2290...2707 Beta-ketoacyl' synthase, N-terminal domain 2292...2526 Beta-ketoacyl synthase, C-terminal domain 2534...2702 KR adh_short, short chain dehydrogenase 3136...3237 ACP9 PP-binding, Phosphopantetheine attachment site. 3389...3454 pksN ( Putative polyketide synthase pksK 5433 aa 4302_pksl 4302 pfam00668 Condensation domain 35...326
47348..63649 50.30% MIO COG1020 EntF, Non-ribosomal peptide synthetase modules 256...913 CaiC Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II 479...987 pfam00501 AMP-binding enzyme 514...913 ACP10 PP-binding, Phosphopantetheine attachment site. 1007...1071 Ml l COG3321 Polyketide synthase modules 1103...2125 KSl l FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 1106...1531 Beta-ketoacyl synthase, N-terminal domain 1103...1353 Beta-ketoacyl synthase, C-terminal domain 1361...1530 KR FabG, Dehydrogenases with different specificities 2198...2409 ACPl l PP-binding, Phosphopantetheine attachment site. 2453...2519 M12 COG3321 Polyketide synthase modules 2572...3610 KS12 FabB, 3-oxoacyl-(acyl-caπier-protein) synthase 2575...3009
Fortsetzung von Tabelle 2 Beta-ketoacyl synthase, N-terminal domain 2575. ,.2823 Beta-ketoacyl synthase, C-terminal domain 2831.,3009 KR adh_short, short chain dehydrogenase 3679...3780 ACP12 PP-binding, Phosphopantetheine attachment site. 3933..3999 M13 COG3321 Polyketide synthase modules 4051...5029 KS13 FabB, 3-oxoacyl-(acyI-caπier-protein) synthase 4053...4487 Beta-ketoacyl synthase, N-terminal domain 4052...4298 Beta-ketoacyl synthase, C-terminal domain 4306...4487
pksR Polyketide synthase 2377aa
4306_pksl 4306 MeT methyltransferase 102...243
63753..70886 50.30% ACP13 PP-binding, Phosphopantetheine attachment site. 352...412 M14 COG3321 Polyketide synthase modules 477...995 KS14 FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 479...913 Beta-ketoacyl synthase, N-terminal domain 479...730 Beta-ketoacyl synthase, C-terminal domain 738...913 PP-binding, Phosphopantetheine attachment site. 1350...1409 M15 COG3321 Polyketide synthase modules 1457...2374 KS15 FabB, 3-oxoacyl-(acyl-carrier-protein) synthase 1458...1870 Beta-ketoacyl synthase, N-terminal domain 1458...1686 Beta-ketoacyl synthase, C-terminal domain 1686...1870 PP-binding, Phosphopantetheine attachment site. 2062...2120 TE Thioesterase domains of type I polyketide synthases 2149...2349 pksS Cytochrome P450 fEC 1.14.-.-) 415aa
4307_pksl 4307 CypX CypX, Cytochrome P450 11...415
71247..72494 46.51%
Tabelle 3: Das pks2-GenclustervonJδ.αmv/o we äc/eH5 FZB42 Größe/
Gene/pks G+C Modul Domäne Reduktion Funktion Position AS/bp pks2A 2146 768aa
2146jpks2 43% Load AT Malonyl-CoA-[acyl-carrier-protein] transacylase (EC 2.3.1.39) 1...302
1..2307 Dioxygenases related to 2-nitropropane dioxygenase 332-646 pks2B 2150 4086aa
2150_pks2 44% MI COG3321 Polyketide synthase module 10...583
2329..14589 KSl 3-oxoacyl-(acyl-carrier-protein) synthase 10...430 Beta-ketoacyl synthase, N-terminal domain 1...256 Beta-ketoacyl synthase, C-terminal domain 264-433 KRl hydroxyl beta-ketoacyl- ACP reductase 1166...1344 ACPI PP-binding, Phosphopantetheine attachment site 1440...1503 M2 COG3321 Polyketide synthase module 1548...1988 KS2 3-oxoacyl-(acyl-carrier-protein) synthase 1556-1985 Beta-ketoacyl synthase, N-terminal domain 1550-1800 Beta-ketoacyl synthase, C-terminal domain 1808..1984 KR2 hydroxyl beta-ketoacyl-ACP reductase 2703-2863 ACP2 PP-binding, Phosphopantetheine attachment site 2954-3018 PP-binding, Phosphopantetheine attachment site 3048-3114 Mi COG3321 Polyketide synthase module 3164...4002 KS3 3-oxoacyl-(acyl-carrier-protein) synthase 3163-3602 Beta-ketoacyl synthase, N-terminal domain 3164...3413 Beta-ketoacyl synthase, C-terminal domain 3421-3602
Fortsetzung von Tabelle 3 pks2C 2153 1590aa
2153jpks2 KR3 hydroxyl beta-ketoacyl- ACP reductase 278-455
14589..19361 ACP3 PP-binding, Phosphopantetheine attachment site 547-611 M4 COG3321 Polyketide synthase module 657...1257 KS4 hydroxyl 3-oxoacyl-(acyl-carrier-protein) synthase 661...1086 Beta-ketoacyl synthase, N-terminal domain 660...907 Beta-ketoacyl synthase, C-terminal domain 915...1085 DH1 Dehydratase 1289-1430 pks2D 2154 2912 aa
2154_pks2 44% KR4 alkene beta-ketoacyl- ACP reductase 331.. .435
19379..28117 ACP4 PP-binding, Phosphopantetheine attachment site 555-619 M5 COG3321 Polyketide synthase module 672-1247 KS5 3-oxoacyl-(acyl-carrier-protein) synthase 674...1090 Beta-ketoacyl synthase, N-terminal domain 674-917 Beta-ketoacyl synthase, C-terminal domain 925.. 1093 ACP5 keto PP-binding, Phosphopantetheine attachment site 2030 ..2096 M6 COG3321 Polyketide synthase module 2155...2626 KS6 3-oxoacyl-(acyl-carrier-protein) synthase 2155 2584 Beta-ketoacyl synthase, N-terminal domain 2155...2410 Beta-ketoacyl synthase, C-terminal domain 2408 2587 ACP6 PP-binding, Phosphopantetheine attachment site 2644 2710
Fortsetzung von Tabelle 3 pks2E 2157 2334 aa
2157_pks2 45% KR5 hydroxyl beta-ketoacyl- ACP reductase 277-433
28110..35114 M7 COG3321 Polyketide synthase module 646...1223
Figure imgf000022_0001
KS7 3 -oxoacyl-(acyl-caπier-protein) synthase 649-1069 Beta-ketoacyl synthase, N-terminal domain 648-869 Beta-ketoacyl synthase, C-terminal domain 901-1069 KR6 hydroxyl beta-ketoacyl-ACP reductase 1470...1601 ACP7 PP-binding, Phosphopantetheine attachment site 1753-1819 M8 COG3321 Polyketide synthase module 1867-2306 KS8 3-oxoacyl-(acyl-carrier-protein) synthase 1864...2283 Beta-ketoacyl synthase, N-terminal domain 1868-2109 Beta-ketoacyl synthase, C-terminal domain 2112-2284
pks2F 2160 1906 aa
2160_pks2 44% ACP8 PP-binding, Phosphopantetheine attachment site 329-393
35129..40849 ACP PP-binding, Phosphopantetheine attachment site 431-495 KR7 hydroxyl beta-ketoacyl-ACP reductase 759-964 M9 COG3321 Polyketide synthase module 1021-1549 KS9 3 -oxoacyl-(acyl-carrier-protein) synthase 1022...1444 Beta-ketoacyl synthase, N-terminal domain 1021-1266 Beta-ketoacyl synthase, C-terminal domain 1274...1443
Fortsetzung von Tabelle 3 pks2G 2162 2460aa
2162_pks2 43% KR8 hydroxyl beta-ketoacyl-ACP reductase 294-462
40846..48228 ACP9 PP-binding, Phosphopantetheine attachment site 545-607
Figure imgf000023_0001
MIO COG3321 Polyketide synthase module 665-1125 KSIO 3-oxoacyl-(acyl-carrier-protein) synthase 665-1087 Beta-ketoacyl synthase, N-terminal domain 665-901 Beta-ketoacyl synthase, C-terminal domain 909...1086 ACP PP-binding, Phosphopantetheine attachment site 1 145-1211 KR9 hydroxyl beta-ketoacyl-ACP reductase 1604...1786 ACPIO PP-binding, Phosphopantetheine attachment site 1892...1952 Ml l COG3321 Polyketide synthase module 1999...2431 KSl l 3-oxoacyl-(acyl-carrier-protein) synthase 1998...2412 Beta-ketoacyl synthase, N-terminal domain 1998...2240 Beta-ketoacyl synthase, C-terminal domain 2248...2412 pks2H 2164 1283aa
2164jpks2 42% ACPl l PP-binding, Phosphopantetheine attachment site 393-459
48279..52130 KR10 hydroxyl beta-ketoacyl-ACP reductase 729-860 TE Thioesterase 1077-1166
Tabelle 4: Das pks3- Gencluster von B. amyloliquefaciens FZB42
Größe/
Gene/pks G+C Modul Domäne Position aa/nt pks3A 1160 Malonyl-CoA-[acyl-carrier-protein] transacylase (EC
1160j)ks3 46% Loading AT 2.3.1.39) 791
4085..6460 40-325 FMN dependent oxidoreductase 350-790 pks3B 1157 457
1157_pks3 47% CaiC Long-chain-fatty-acid— CoA ligase (EC 6.2.1.3) 2-452
7775..9139 pks3C 1155
1155_pks3 49% KR adh hydroxyl 3-oxoacyl-[acyl-carrier protein] reductase (EC 1.1.1.100) 8-245
9154..9891 pks3D 1154 polyketide synthase 4196
1154_pks3 50% ACP PP-binding, Phosphopantetheine attachment site 6...71
9931..22521 Ml COG3321 Polyketide synthase module 1 117-914 KSl 3-oxoacyl-(acyl-carrier-protein) synthase 118-541 Beta-ketoacyl synthase, N-terminal domain 115-364 Beta-ketoacyl synthase, C-terminal domain 372-541 KR KRl hydroxyl keto reductase [module 1] 1245-1393 ACPI PP-binding, Phosphopantetheine attachment site 1873-1937 PP-binding, Phosphopantetheine attachment site 1980-2047
Fortsetzung von Tabelle 4 M2 COG3321 Polyketide synthase module 2 2095-3002 KS2 3-oxoacyl-(acyl-carrier-protein) synthase 2094-2482 Beta-ketoacyl synthase, N-terminal domain 2096-2330 Beta-ketoacyl synthase, C-terminal domain 2338-2515 DH alkene Dehydratase 2710-2873 KR KR2 Beta-keto-acyl-reductase 3182-3383 ACP2 PP-binding, Phosphopantetheine attachment site 3427-3493 M3 COG3321 Polyketide synthase module 3 3536-4139 KS3 3-oxoacyl-(acyl-carrier-protein) synthase 3541-3976 Beta-ketoacyl synthase, N-terminal domain 3539-3787 Beta-ketoacyl synthase, C-terminal domain 3795-3976 pks3E 1150 polyketide synthase 2098
1150_pks3 COG3321 Polyketide synthase modules 32-288
22540..28836 ACP3 keto PP binding, phosphopantetheine attachement site 333-395 M4 COG3321 Polyketide synthase module 4 450- 1056 KS4 3-oxo-acyl-(acyl carrier protein) synthase 452-832 Beta ketoacyl synthase N terminal domain 449-699 Beta ketoacyl synthase C terminal domain 707-884 KR KR3 hydroxyl keto reductase, related to short-chain alcohol dehydrogenases 1267-1468 ACP4 PP binding, phosphopantetheine attachement site 1539-1605 M5 COG3321 Polyketide synthase module 5 1642-2079 KS5 3-oxo-acyl-(acyl carrier protein) synthase 1646-2050 Beta ketoacyl synthase N terminal domain 1644- 1877 Beta ketoacyl synthase C terminal domain 1885-2049
Fortsetzung von Tabelle 4 pks3F 1148 polyketide synthase 1913
1148_pks3 50% ACP5 keto PP binding, phosphopantetheine attachement site 322-386
28861..34602 M6 COG3321 Polyketide synthase module 6 431-923 KS6 3-oxoacyl-(acyl-carrier-protein) synthase 431-868 Beta ketoacyl synthase N terminal domain 431-683 Beta ketoacyl synthase C terminal domain 691-868 ACP6 keto PP binding, phosphopantetheine attachement site 930-994 MZ COG3321 Polyketide synthase module 7 1015-1426 KR KR4 hydroxyl beta-ketoacyl-ACP reductase 1695-1908 ρks3G 1144 polyketide synthase 5182
1144_pks3 51% MeT MeTl Methyltransferase 139-264
34720..50268 ACP7 PP-binding, Phosphopantetheine attachment site 373-438 ACP PP-binding, Phosphopantetheine attachment site 471-536 M8 COG3321 Polyketide synthase module 8 598-1297 KS7 3-oxoacyl-(acyl-carrier-protein) synthase 598-1016 Beta-ketoacyl synthase, N-terminal domain 597-830 Beta-ketoacyl synthase, C-terminal domain 838-1015 KR KR5 hydroxyl beta-ketoacyl-ACP reductase 1674-1837 ACP8 Acyl carrier protein 1956-2020 M9 COG3321 Polyketide synthase module 9 2071-2960 KS8 3-oxoacyl-(acyI-carrier-protein) synthase 2076-2479 Beta-ketoacyl synthase, N-terminal domain 2076-2479 Beta-ketoacyl synthase, C-terminal domain 2310-2479 DH DH2 alkene dehydratase 2670-2833 KR KR6 short chain dehydrogenase 3145-3343 ACP9 PP-binding, Phosphopantetheine attachment site 3388-3454
Fortsetzung von Tabelle 4 MIO COG3321 Polyketide synthase module 10 3505-4521 KS9 3-oxoacyl-(acyl-carrier-protein) synthase 3507-3936 Beta-ketoacyl synthase, N-terminal domain 3505-3754 Beta-ketoacyl synthase, C-terminal domain 3762-3936 KR KR7 hydroxyl ketoreductase 4329-4450 ACPIO PP-binding, Phosphopantetheine attachment site 4607-4673 Mll COG3321 Polyketide synthase module 11 4714-5144 KSIO 3-oxoacyl-(acyl-carrier-protein) synthase 4714-5131 Beta-ketoacyl synthase, N-terminal domain 4714-4956 Beta-ketoacyl synthase, C-terminal domain 4964-5131 pks3H 1134 polyketide synthase 2537
U34_pks3 50% ACPl l PP-binding, Phosphopantetheine attachment site 248-362
50378..57991 KR KR8 hydroxyl ketoreductase 570-778 M12 COG3321 Polyketide synthase module 12 839-1428 KSl l 3 -oxoacyl-(acyl-carrier-protein) synthase 843-1263 Beta-ketoacyl synthase, N-terminal domain 843-1091 Beta-ketoacyl synthase, C-terminal domain 1099-1270 KR KR9 hydroxyl ketoreductase 1670-1876 ACP12 PP-binding, Phosphopantetheine attachment site 1947-2012 M13 COG3321 Polyketide synthase module 13 2055-3481 KS12 3-oxoacyl-(acyl-carrier-protein) synthase 257-2466 Beta-ketoacyl synthase, N-terminal domain 2056-2290 Beta-ketoacyl synthase, C-terminal domain 2298-2466
Fortsetzung von Tabelle 4 pks3I 1129 polyketide synthase 2050
1129_pks3 51% ACP13 keto PP-binding, Phosphopantetheine attachment site 274-340
58014..64166 M14 COG3321 Polyketide synthase module 14 653-1723 KS13 3-oxoacyl-(acyl-carrier-protein) synthase 655-1081 Beta-ketoacyl synthase, N-terminal domain 655-902 Beta-ketoacyl synthase, C-terminal domain 910-1080 DH DH3 Dehydratase 1281-1431 KR KR10 ketoreductase 1800-1937
pks3J 1127 polyketide synthase 2071
1127_pks3 49% MeT MeT2 Methyltransferases 166-340
64163..70378 ACP 14 PP-binding, Phosphopantetheine attachment site 403-467 ER ER1 methylene enoyl reductase 532-851 M15 COG3321 Polyketide synthase module 15 882-1459 KS14 3-oxoacyl-(acyl-carrier-protein) synthase 883-1288 Beta-ketoacyl synthase, N-terminal domain 881-1114 Beta-ketoacyl synthase, C-terminal domain 1122-1291 ACP 15 PP-binding, Phosphopantetheine attachment site 1542-1608 PP-binding, Phosphopantetheine attachment site 1646-1712 TE TE1 hydrolysis Thioesterase domains of type I polyketide synthases 1755-1959
pks3K 1123 MO MO Cytochrome P450 109 (EC 1.14.-.-) 386
1123_pks3 46% CypX, Cytochrome P450 [Secondary metabolites biosynthesis 9-386
70454..71614
Fortsetzung von Tabelle 4 pks3L 1122 415
U22_pks3 HMGS Hydroxymethylglutaryl-CoA synthase (EC 4.1.3.5)
71672..72919 PksG 3-hydroxy-3-methyIglutaryl CoA synthase 1-413 pks3M 1120
1120_pks3 49% ER Enoyl-CoA hydratase (EC 4.2.1.17) 248
12919..13125 CaiD Enoyl-Co A hydratase/carnithine racemase [Lipid metabolism] 1 -246
Tabelle 7: Das pksl-Genkluster von Bacillus amyloliquefaciens FZB42
Quelle: SEQ-ID-NO: 1, GenBank Accession Number: AJ634060, Länge: 72612 bp, beinhaltet das pksl-Operon (bp 1..71249)
Gene des Bacillus amyloliquefaciens pksl Operons (pkslB, C, D, E, F, G, H, I, J, L, M, N, R) und das pkslS Gen
Figure imgf000030_0001
Tabelle 8: Das pks2-Genkluster von Bacillus amyloliquefaciens FZB42
Quelle: SEQ-ID-NO: 2, GenBank Accession Number: AJ634061, Länge: 53724 bp, beinhaltet das pks2-Operon (bp 1.. 52130)
Gene des Bacillus amyloliquefaciens pks2 Operons (pks2A, B, C, D, E, F, G, H)
Figure imgf000031_0001
Tabelle 9: Das pks3-Genkluster von Bacillus amyloliquefaciens FZB42
Quelle: SEQ-ID-NO: 3, GenBank Accession Number: AJ634062, Länge: 74700 bp, beinhaltet das ρks3-Oρeron (bp 3469..73761) rbamOl 165 Gen, rbamOl 163 Gen, nusG Gen, prol Gen und das pks3 operon (pks3A, B, C, D, E, F, G, H, I, J, K, L, M Gen) von Bacillus amyloliquefaciens
Figure imgf000032_0001

Claims

Patentansprüche
1. DNA-Sequenzen, die für Polypeptide kodieren, die wiederum an der enzymatischen Biosynthese von Polyketidverbindungen beteiligt sind, umfassend die Sequenzen mit den SEQ-ID NO: 1, 2 und 3.
2. DNA-Sequenzen nach Anspruch 1, dadurch gekennzeichnet, dass die Sequenzen aus einem Bakterium der Familie Bacillus stammen.
3. DNA-Sequenzen nach einem der vorgehenden Ansprüche, dadurch gekennzeichnet, dass die Sequenzen aus einem Bakterium der Gattung Bacillus amyloliquefaciens stammen.
4. DNA-Sequenzen nach einem der vorgehenden Ansprüche, dadurch gekennzeichnet, dass die Sequenzen aus dem Stamm FZB42 des Bakteriums Bacillus amyloliquefaciens stammen.
5. DNA-Sequenzen nach einem der vorgehenden Ansprüche, deren Expressionsprodukte für die enzymatische Biosynthese von Polyketiden mit antibakterieller Wirkung verantwortlich sind, umfassend die Sequenz mit der SEQ-ID NO: 1, 2 und 3.
6. DNA-Sequenzen nach einem der vorgehenden Ansprüche, deren Expressionsprodukte die enzymatische Biosynthese des antibakteriellen Polyketids Bacillaen bewirken oder daran beteiligt sind, umfassend die Sequenz mit der SEQ-ID NO: 1.
7. DNA-Sequenzen nach einem der Ansprüche 1-5, deren Expressionsprodukte die enzymatische Biosynthese der antibakteriellen Polyketide Difficidin und/oder Oxydifficidin bewirken oder daran beteiligt sind, umfassend die Sequenz mit der SEQ-ID NO: 2.
8. DNA-Sequenzen nach einem der Ansprüche 1-5, deren Expressionsprodukte die enzymatische Biosynthese eines bisher nicht bekannten antibakteriellen Polyketids bewirken oder daran beteiligt sind, umfassend die Sequenz mit der SEQ-ID NO: 3.
9. DNA-Sequenzen nach einem der vorgehenden Ansprüche umfassend DNA- Sequenzen ausgewählt aus: a) DNA-Sequenzen gemäß den SEQ-ID NO: 1, 2 oder 3 oder deren komplementären Strängen; b) DNA-Sequenzen, die unter stringenten Bedingungen an die unter a) genannten Sequenzen oder an Fragmente davon hybridisieren; c) alle Variationen und durch Substitution, Insertion oder Deletion entstandenen Mutanten der unter a) und b) definierten DNA-Sequenzen, die isofunktionelle Expressionsprodukte ergeben.
10. Rekombinanter Expressionsvektor umfassend mindestens eine Sequenz nach einem der Ansprüche 1 bis 9.
11. Prokaryotische oder eukaryotische Zelle, die mit mindestens einer DNA nach einem der Ansprüche 1 bis 9 oder mit mindestens einem rekombinanten Expressionsvektor nach Anspruch 8 transformiert oder tranfiziert ist.
12. Verfahren zur enzymatischen Biosynthese von Polyketidverbindungen, dadurch gekennzeichnet, dass a) Zellen mit mindestens einer DNA nach einem der Ansprüche 1 bis 9 oder mit mindestens einem rekombinanten Expressionsvektor nach Anspruch 8 transformiert oder tranfiziert werden; b) die Zellen in einem geeigneten Kulturmedium kultiviert werden; und c) die Polyketidverbindung aus dem Kulturüberstand isoliert wird.
13. Verfahren nach Anspruch 12 zur Herstellung von Polyketiden mit antibakterieller Wirkung.
14. Verfahren nach Anspruch 13 zur Herstellung des Polyketids Bacillaen.
15. Verfahren nach Anspruch 13 zur Herstellung der Polyketide Difficidin und/oder Oxydifficidin.
16. Verfahren nach Anspruch 13 zur Herstellung eines bisher nicht charakterisierten Polyketids mit antibakterieller Wirkung.
17. Polyketid mit antibakterieller Wirkung vorzugsweise gegen Gram-positive Bakterien, hergestellt vom Stamm FZB42 des Bakteriums Bacillus amyloliquefaciens, wobei die DNA-Sequenz mit der SEQ-ID NO: 2 für die Polyketidsynthetasen kodiert.
18. Verwendung von DNA-Sequenzen nach einem der Ansprüche 1 bis 9 oder von rekombinanten Expressionsvektoren nach Anspruch 10 zur kombinatorischen Neusynthese von Polyketiden, die eine verbesserte Stabilität und/oder Wirkung gegenüber phyto-, tier- und/oder humanpathogenen Bakterien aufweisen.
19. Aminosäure-Sequenzen von Polypeptiden, die an der enzymatischen Biosynthese von Polyketidverbindungen beteiligt sind, umfassend die Sequenzen mit den SEQ-ID NO: 4 bis 42.
20. Verwendung von Aminosäure-Sequenzen nach Anspruch 16 zur kombinatorischen Neusynthese von Polyketiden, die eine verbesserte Stabilität und/oder Wirkung gegenüber phyto-, tier- und/oder humanpathogenen Bakterien aufweisen.
PCT/DE2005/000949 2004-05-27 2005-05-24 Sequenzen für die synthese antibakteriell wirkender polyketide WO2005116061A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102004027335.9 2004-05-27
DE102004027335.9A DE102004027335B4 (de) 2004-05-27 2004-05-27 Sequenzen für die Synthese antibakteriell wirkender Polyketide

Publications (2)

Publication Number Publication Date
WO2005116061A2 true WO2005116061A2 (de) 2005-12-08
WO2005116061A3 WO2005116061A3 (de) 2006-06-29

Family

ID=35423330

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2005/000949 WO2005116061A2 (de) 2004-05-27 2005-05-24 Sequenzen für die synthese antibakteriell wirkender polyketide

Country Status (2)

Country Link
DE (1) DE102004027335B4 (de)
WO (1) WO2005116061A2 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2179652A1 (de) * 2008-09-10 2010-04-28 ABiTEP GmbH Gesellschaft für AgroBioTechnische Entwicklung und Produktion Antibakterielles Mittel zur Behandlung von Feuerbrand bei Obstgehölzen und anderen bakteriell verursachten Pflanzenkrankheiten

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102011015803A1 (de) 2011-04-01 2012-10-04 Abitep Gmbh Mittel zur Behandlung von mikrobiellen Erkrankungen bei Kulturpflanzen

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4681846A (en) * 1983-06-13 1987-07-21 Merck & Co., Inc. Process for the preparation of difficidin and derivative antibacterials

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HUANG G ET AL: "Analysis of the genes flanking xabB: a methyltransferase gene is involved in albicidin biosynthesis in Xanthomonas albilineans" GENE, ELSEVIER, AMSTERDAM, NL, Bd. 255, Nr. 2, 19. September 2000 (2000-09-19), Seiten 327-333, XP004217647 ISSN: 0378-1119 *
KOUMOUTSI A ET AL: "Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42" JOURNAL OF BACTERIOLOGY, WASHINGTON, DC, US, Bd. 186, Nr. 4, Februar 2004 (2004-02), Seiten 1084-1096, XP002301555 ISSN: 0021-9193 *
UNEYAMA K ET AL: "Preparation of 2,2-Difluoroenol Silyl Ethers by Electroreductive Defluorination of Trifluoromethyl Ketones" TETRAHEDRON LETTERS, ELSEVIER, AMSTERDAM, NL, Bd. 39, Nr. 22, 28. Mai 1998 (1998-05-28), Seiten 3741-3744, XP004118726 ISSN: 0040-4039 *
XUE Y ET AL: "Genetic architecture of the polyketide synthases for methymycin and pikromycin series macrolides" GENE, ELSEVIER, AMSTERDAM, NL, Bd. 245, Nr. 1, März 2000 (2000-03), Seiten 203-211, XP004202977 ISSN: 0378-1119 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2179652A1 (de) * 2008-09-10 2010-04-28 ABiTEP GmbH Gesellschaft für AgroBioTechnische Entwicklung und Produktion Antibakterielles Mittel zur Behandlung von Feuerbrand bei Obstgehölzen und anderen bakteriell verursachten Pflanzenkrankheiten
EP2179652B1 (de) 2008-09-10 2019-05-08 ABiTEP GmbH Gesellschaft für AgroBioTechnische Entwicklung und Produktion Verwendung eines antibakteriellen Mittels zur Behandlung von bakteriellen Infektionen bei Kulturpflanzen

Also Published As

Publication number Publication date
DE102004027335A1 (de) 2006-01-19
DE102004027335B4 (de) 2017-08-03
WO2005116061A3 (de) 2006-06-29

Similar Documents

Publication Publication Date Title
Wu et al. Bacilysin from Bacillus amyloliquefaciens FZB42 has specific bactericidal activity against harmful algal bloom species
DE69937732T2 (de) Biosynthetische gene zur spinosyn-insektizidherstellung
US10047363B2 (en) NRPS-PKS gene cluster and its manipulation and utility
Fyans et al. Characterization of the coronatine-like phytotoxins produced by the common scab pathogen Streptomyces scabies
Menegatti et al. Paenibacillus polymyxa associated with the stingless bee Melipona scutellaris produces antimicrobial compounds against entomopathogens
JP4765032B2 (ja) 新規スピノシンを産生するポリケチド合成酵素
DE69930515T2 (de) Polyketide, ihre herstellung, und darin benutzte materialien
Jasim et al. Identification of a novel endophytic Bacillus sp. from Capsicum annuum with highly efficient and broad spectrum plant probiotic effect
KR102480072B1 (ko) 스트렙토마이세스 속 돌연변이주 u67-46 균주
WO2005116061A2 (de) Sequenzen für die synthese antibakteriell wirkender polyketide
Zhang et al. Unusual acylation of chloramphenicol in Lysobacter enzymogenes, a biocontrol agent with intrinsic resistance to multiple antibiotics
US20130211100A1 (en) Method to Generate Novel Bioactive Molecules
DE60016231T2 (de) Streptomyces avermitilis gen zum regulieren des verhältnisses der b2:b1 avermectinen
DE60031126T2 (de) Streptomyces avermitilis gen zum regulieren des verhältnisses der b2:b1 avermectinen
DE112004001054B4 (de) Sequenz für die BacillomycinD Synthese in Bacillus amyloliquefaciens FZB42
WO2009147984A1 (ja) ハーボキシジエンの生合成に関与するポリペプチドをコードするｄｎａ
KR102509351B1 (ko) 스트렙토마이세스 속 돌연변이주 u67-46 균주 또는 이의 배양액을 포함하는 작물관리용 조성물 및 이를 이용한 해충방제 방법
KR102509349B1 (ko) 스트렙토마이세스 속 돌연변이주 u67-46 균주를 이용한 작물관리용 조성물의 제조방법
CN102021187A (zh) Fr-008聚酮抗生素生物合成相关的基因簇
WO2011043666A1 (en) Antibiotic compositions, methods for providing the same and streptomyces coelicolor mutants for use in such methods
DE102004027516A1 (de) Neuer Efomycin Biosynthesegencluster
WO2006032232A2 (de) Neuer lysolipin biosynthesegencluster
Nikodinovic Molecular genetics of amphotericin biosynthesis in Streptomyces nodosus
Nimbeshaho et al. Unravelling the secondary metabolome and biocontrol potential of the recently described species Bacillus nakamurai
Alvarez et al. Burkholderia gladioli BNM349 as a promising source of bacterial metabolites for biocontrol of common bacterial blight of bean

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase