WO2005090602A2 - Method for diagnosing or predicting susceptibility to optic nueropathy - Google Patents

Method for diagnosing or predicting susceptibility to optic nueropathy Download PDF

Info

Publication number
WO2005090602A2
WO2005090602A2 PCT/JP2005/005601 JP2005005601W WO2005090602A2 WO 2005090602 A2 WO2005090602 A2 WO 2005090602A2 JP 2005005601 W JP2005005601 W JP 2005005601W WO 2005090602 A2 WO2005090602 A2 WO 2005090602A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
polymorphism
codon
substitution
endothelin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2005/005601
Other languages
English (en)
French (fr)
Other versions
WO2005090602A3 (en
Inventor
Yukihiko Mashima
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sucampo GmbH
Original Assignee
Sucampo GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sucampo GmbH filed Critical Sucampo GmbH
Priority to JP2007503564A priority Critical patent/JP5129563B2/ja
Priority to US10/593,103 priority patent/US8182990B2/en
Publication of WO2005090602A2 publication Critical patent/WO2005090602A2/en
Publication of WO2005090602A3 publication Critical patent/WO2005090602A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/06Antiglaucoma agents or miotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • TECHNICAL FIELD The present invention relates to a set of genetic polymorphisms linked to optic neuropathy.
  • BACKGROUND ART Glaucoma is a major cause of blindness worldwide, and estimated approximately 67 million peopl e suffered from some form of glaucoma. The majority of cases occur as late adult onset (typically over age 40 years) o ⁇ primary open- angle glaucoma (POAG) , which is the most common form of glaucoma and affects approximately 2% in wfc.ite population and 7% of black population over 40 years old. POAG results in a characteristic visual field changes corresponding to the excavation of the optic disc that is usually associated with an elevation of intraocular pressure (IOP) .
  • IOP intraocular pressure
  • NTG Normal- tension glaucoma
  • IOP intraocular pressure
  • Risk factors to develop glaucoma include high IOP, age, race, positive family history, myopia, the presence of diabetes or hypertension, and genetic factors. Although the exact pathogenesis of glaucomatous optic neuropathy is remains unclear, it is generally accepted that an increased IOP is a major risk factor. Current treatment for glaucoma consists of interventions which lower IOP. However, in some patients with glaucoma, NTG or advanced stage of POAG, reduction of IOP- does not prevent the progression of the disease, indicating that factors other than an increased IOP may be involved in the development or progress of glaucoma.
  • POAG and NTG are a heterogeneous group of conditions probably with different multi-factorial etiologies resulting in the observed patterns of neuronal loss in the optic disk.
  • the association between glaucoma and the presence of many systemic vascular diseases including low systemic blood pressure, nocturnal dips in blood pressure, hypertension, migraine, vasospasm, and diabetes has been reported.
  • the presence of optic disc hemorrhages in NTG patients suggests that vascular insufficiencies are deeply involved in the development and progression of NTG.
  • a high percentage of patients with POAG receive a wide variety of medications for coexisting disorder. Especially, systemic hypertension was the most common disorder, occurring in 48% of the total population.
  • LHON Leber's hereditary optic neuropathy
  • DAO dominant optic atrophy
  • the 3460 and 14484 mutations are associated with better visual prognosis than the 11778 mutation which shows visual recovery rates of only 4% to 7% (OostraRJ et. al., J med Genet 1994;31:280-286, Riordan-Eva P et . al., Brain 1995; 118:319-337, Mashima Y et. al., Curr Eye Res 1998;17:403- 408, the contents .of the cited reference are herein incorporated by reference) .
  • visual recovery has been documented in some patients with the 11778 mutation and an age of onset in the low teens (Stone EM et.
  • the primary mutations are the major risk factors in LHON, but additional etiologic factors that augment or modulate the pathogenic phenotypes appear to be necessary.
  • Considerable evidence indicates that heavy alcohol and/or tobacco use increases the risk of optic neuropathy in LHON families (Smith PR et. al . , Q J Med 1993;86:657-660, Chalmers RM et. al . , Brain 1996; 119: 1481- 1486 and Tsao K et. al . , Br J Ophthalmol 1999;83:577-581, the contents of the cited reference are herein incorporated by reference) , although one study did not find this association.
  • Possible secondary genetic interactions are complex and not firmly established (Kerrison JB et .
  • Oxidative stress has been implicated in many disorders associated with mutations of mtDNA.
  • ROS reactive oxygen species
  • a recent investigation in an animal model identified reactive oxygen species (ROS) as a likely factor in the pathogenesis of LHON (Qi X et. al . , Invest Ophthalmol Vis Sci 2003; 44 : 1088- 1096, the contents of the cited reference are herein incorporated by reference) .
  • ROS reactive oxygen species
  • the mtDNA 'LHON pathogenic mutations were found to predispose cells to Fas- dependent apoptotic death in vi tro (Danielson SR et. al .
  • the present invention provides a set of genetic polymorphisms being associated with optic neuropathy, which comprises at least one polymorphism selected from the group consisting of: (1) AAG to AAT substitution at codon 198 of the Endothelin- 1 gene (Lysl98Asn) ;
  • the present invention also provides a method for diagnosing or predicting susceptibility to optic neuropathy in a human subject, which comprising the • steps of: i) obtaining a biological sample from the subject, ii) determining genotype of the sample in respect of the set of the polymorphisms defined as above, and iii) diagnosing or predicting susceptibility to optic neuropathy in the subject based on the genotype.
  • the optic neuropathy may preferably be glaucoma or Laber's disease.
  • the polymorphism (l)-(39) and (42) -(48) may be used especially for glaucoma.
  • those (1), (2), (5)- (7), (16), (26), (32), (43) and (45) may be used especially for normal tension glaucoma and those (4), (14), (25), (35), (36), (38), (42), (44), (47)- (48) may be used especially for primary open angle glaucoma.
  • the polymorphisms (40) and (41) may be used especially for Laber's disease.
  • the set of polymorphisms may - further comprise at least one other polymorphism which has been known to be associated with optic neuropathy.
  • kits for diagnosing or predicting susceptibility to optic neuropathy in a human subject which comprises primer set and/or probe suitable for determining genotype in respect of the set of genetic polymorphisms defined as above.
  • • neuly identified SNPs are provided in Mitocondorial gene, Myocilin gene and Noelin 2 gene. Accordingly, the present invention encompass nucleotide fragment covering those SNPs.
  • 90 or more contignous nucleotide sequence containing the SNP may be required. Namely, an isolated polynucleotide consisting of a segment of the sequence:
  • the segment comprises at least 90 contignuous nucleotide, and the at least 90 contignuous nucleotide includes position 9099 of the sequence, and wherein position 9099 of the sequence is A or an isolated polynucleotide which is entirely complementary to the above segment ; or wherein the segment comprises at least 90 contignuous nucleotide, and the at least 90 contignuous nucleotide includes position 9101 of the sequence, and wherein position - 9101 of the sequence is G; or an isolated polynucleotide which is entirely complementary to either of the above segment .
  • the present invention further provides an isolated polynucleotide consisting of a segment of the sequence : 301 actggaaagc acgggtgctg tggtgtactc ggggagcctc tatttccagg gcgctgagtc 361 cagaactgtc ataagatatg agctgaatac cgagacagtg aaggctgaga aggaaatccc 421 tggagctggc taccacggac ag cccgta ttcttggggt ggctacacgg acattgactt 481 ggctgtggat gaagca ' ggcc tctgggtcat ttacagcacc gatgaggcca aaggtgccat
  • the present invention further provides an isolated polynucleotide consisting of a segment of the sequence :
  • the segment comprises at least 90 contignuous nucleotide, and the at least 90 contignuous nucleotide includes codon 144, which is corresponding to the underlined nucleotides of the sequence, and wherein codon 144 is substituted such that it codes for Gin, or an isolated polynucleotide which is entirely complementary to the above segment .
  • Fig. 1 represents correlation of' clinical Characteristics of NTG Patients with AT2R 31230A Polymorphism and ACE I/D Polymorphism
  • Fig. 2 represents DHPLC tracing patterns in the Exon3C of the MYOC gene.
  • Fig. 3 represents novel missense mutation, Phe369Leu detected in exon 3 of the MYOC gene.
  • Fig. 4 represents a DHPLC tracing of MYOC gene from a patient with POAG.
  • Fig. 5A represents the IOP after oral candesartan cilexetil or placebo.
  • Fig.. 5B represents the ocular perfusion pressure after oral candesartan cilexetil or placebo Fig.
  • 5C represents the IOP after oral candesartan cilexetil in each of the 15 subjects.
  • genetic polymorphism means genomic diversity between individuals at a locus. Genetic polymorphism may be single nucleotide substitution called as "Single nucleotide polymorphisms" or "SNPs" as well as those consisting of plural nucleotides. The genetic polymorphism may or may not be those affect on the phenotype of the individual.
  • nucleotide sequence of an individual is different from the corresponding wild type sequence, i.e., having insertion, deletion or substitution on the wild type sequence, said nucleotidesequence is called as "genetic mutant” and the genetic mutant is also included in "polymorphic variant” according to the present invention.
  • expression like “9099OA” or “C9099A” means that the gene has a polymorphsm at position 9099, that is, there are two alleles of the gene and the one has cytosine or C- and -the • other has adenine or A at 9099 (bi-allelic) . It does not necessarily mean the frequent allele has C whereas the rare allele has A at said position. The .
  • Glnl92Arg represents an amino acid substitution due to the base substitution in the gene coding for the amino acid sequence.
  • Glnl92Arg represents Glycine at codon 192, i.e. amino acid number 192, is replaced with Arginine or Arg.
  • determining genotype in respect of the genetic polymorphisms may be carried out by every single polymorphism, or plurality or 5 all polymorphisms may be determined at the same time.
  • the method for diagnosing or predicting susceptibility to optic neuropathy in a human subject which comprises determining genotype in respect of the set of genetic polymorphism of which relationship with0 optic neuropathy is newly reported in this application.
  • any other polymorphism which had been revealed as being linked to optic neuropathy may be detected together.
  • the method used for determining genotype in respect of the genetic polymorphisms is not limited and may be any of those known0 to the art.
  • PCR-RFLP polymerase chain reaction restriction fragment length polymorphism
  • PCR-SSCP polymerase chain reaction followed by single strand conformation polymorphism
  • 5 ASO hybridization analysis direct sequencing analysys
  • ARMS analysis DGGE analysis
  • RNaseA cleaving analysis chemical restriction analysis
  • DPL analysis DPL analysis
  • TaqMctn® PCR analysis .
  • Invader® assay MALDI-TOF/MS analysis
  • TDI analysis single nucleotide extension assay
  • WAVE assay one molecular fluorescent detection assay.
  • the detection method may be one of those or combination of two or more.
  • biological sample to be used for detecting the genetic polymorphism is not specifically limited and may be hair, blood, saliva- lymph fluid, respiratory tract ucosa, cultured cells and urine.
  • diagnosis or predicting susceptibility to optic neuropathy includes not only diagnosing onset of optic neuropathy but also determining risk factors which hasten onset of the disease as well as accelerate the disease progresses.
  • kits for detecting the genetic polymorphism as well as protein polymorphism identified as above are also provided.
  • Said ki"ts may comprise . primers and/or probes which are specifically designed for detecting the above-identified genetic polymorphisms; antibodies for detecting the above- identified protein polymorphism.
  • said kit may be used for diagnosing or predicting susceptibility to optic neuropathy.
  • the term "primer” denotes a specific oligonucleotide sequence which is complementary to a part of the target nucleotide sequence and used to hybridize to the target nucleotide sequence.
  • a primer serves as an initiation point for nucleotide polymerization catalyzed by either DNA polymerase, RNA polymerase or reverse transcriptase.
  • probe denotes a defined nucleic acid segment which can be used to identify a specific polynucleotide sequence present in samples or confirming target DNA or RNA in a gene modifying process, said nucleic acid segment comprising a nucleotide sequence complementary to the specific polynucleotide sequence to be identified.
  • primers and probes may be designed based on the targeted sequence so that they are specific to the position at which the targeted polymorphism is expected and/or surrounding sequence of the position so long as they are not identical to some other genes, i.e. it is necessary not to be repeating sequence nor palindrome sequence.
  • genetic polymorphisms which are linked to optic neuropatriy, especially glaucoma and Leber's disease are identified. Based on the findings, the genotype in respect of the genetic polymorphisms of a biological sample obtained from an individual is determined and based on thus obtained genotype, onset of the disease or predicted risk for onset of the disease can be determined. In addition to the polymorphisms identified (l)-(48) as above, genotypes in respect of some other genetic polymorphisms which had been known to the art being highly associated with optic neuropathy may be determined for improved relaiability of the diagnosis or prediction.
  • said SNPs may prefereably be used for diagnosing or predicting the risk for optic neuropathy in the specified group.
  • statical analysis of the genotyp in respect of the set of polymorphisms may provide useful information such as predictive age of onset, predictive association with lifestyle-related diseases, predictive association with symptom factors.
  • effect of some medical treatments may also be predictable based on the information.
  • predicting susceptibility to optic neuropathy can be carried out before onset of the disease based- on the genotype, and the subject can receive advice on how to remove the risk factor, for example, to improve life style or alter the environment.
  • those "order made treatment” can reduce the risk for vision loss.
  • inhibition of onset reduction of the risk of onset or relief of symptoms can be expected by introducing to the subject the genotype linked to low risk for onset and expressing the same.
  • anti sence to the mRNA of the allele of high risk for onset of optic neuropathy or RNAi method may be used for inhibiting expression of the high risk allele.
  • genetic etiology of optic neuropathy may be revealed and thus obtained etiology may be useful for development of novel medical agents.
  • genotype information which is associated with optic neuropathy obtained by the present invention and the other genotype information which is associated with life style diseases and the like, comprehensive risk for age-related, life-style related diseases can be predicted and used for high quality of life.
  • the present invention will be further illustrated by means of the examples shown below. It is to be expressly understood, however, that the examples are for purpose of illustration only and is not intended to limit of the scope of the invention.
  • EXAMPLE 1 Genetic Variants of TP53 and EPHXl in Leber's Hereditary Optic Neuropathy and their Relationship to Age at Onset
  • the codon 72 genotype in TP53 and the codon 113 genotype in EPHXl were significantly associated with younger age at onset of Leber's hereditary optic neuropathy.
  • Table 2-2 the co-existence of the Codon 72 genotype in TP53 and the codon 113 genotype in EPHXl were significantly associated with younger age at onset of Leber's hereditary optic neuropathy.
  • Arg72 variant was more efficient than the Pro72 variant at inducing apoptosis, with at least one mechanism underlying this greater efficiency being enhanced localization of Arg72 variant to mitochondria in tumor cells.
  • the synthetic p53 inhibitors might be highly effective in treating LHON in which neurons died by apoptosis triggered by mitochondrial impairment and oxidative stress. Partial nucleotide sequences for EPHXl and TP53 genes containing the targeted polymorphism are as follows:
  • EPHXl Tyrll3His Codon 113 (underlined) (TAC to CAC change) 181 tgctgggctt tgccatctac tggttcatct cccgggacaa agaggaaact ttgccacttg 241 aagatgggtg gtgggggcca ggcacgaggt ccgcagccag ggaggacgac agcatccgcc 301 ctttcaaggt ggaaacgtca gatgaggaga tccacgactt acaccagagg atcgataagt 361 tccgtttcac ccacctttg gaggacagct gctccacta tggcttcaac tccaactacc 421 tgaagaaagt catctcctac tggaatg
  • Example 2 Mitochondrial DNA mutations related with Leber's hereditary optic neuropathy in primary open-angle glaucoma and normal-tension glaucoma
  • Invader® assay FRET-detection 256-well plates contains the generic components of an Invader® assay (Cleavase® enzyme VIII, FRET probes, MOPS buffer, and polyethylene glycol) dried in each of the individual wells.
  • the biplex format of the Invader® assay enabled simultaneous detection of two DNA sequences in a single well. The detail method was described previously. In brief,
  • mtDNA mutations including 2 novel mtDNA mutations in glaucoma patients .
  • mtDNA mutations is one of the risk factor to develop or progress the glaucoma, and detection of the mtDNA mutations makes possible the early diagnosis and early treatment of glaucoma.
  • Partial nucleotide sequences of mitochondrial ' gene containing the targeted mutations/polymorphism are as follows :
  • Example 3 Gene polymorphisms of the renin-angiotensin aldosterone system associate with risk for developing primary open-angle glaucoma and normal-tension glaucoma
  • R-A-A renin-angiotensin-aldosterone
  • MATERIALS and METHODS Patients and Control study subjects A total of 551 blood samples were collected at seven institutes in Japan. They were 162 POAG patients, 1-93 NTG patients, and 196 normal subjects, and none of the subjects was related to others in this study. The average age at examination was 58.8 ⁇ 13.7 years in NTG, 62.0 ⁇ 15.4 years in POAG, and 71.2 ⁇ 10.4 years in normal subjects.
  • the average age of the normal control subjects is significantly higher than NTG patients (p ⁇ 0.001) or POAG patients (p ⁇ 0.001), respectively. This could reduce the possibility that a subset will eventually develop glaucoma.
  • the familial history was recorded in 66 (34.2%) out of 127 NTG patients and 49 (30.2%) out of 113 POAG patients.
  • Male patients were 89 (46.1%) in NTG and 87 (53.7%) in POAG, and 77 (39.3%) in normal subjects.
  • One hundred ninety-six Japanese control samples were obtained from individuals who had no known eye abnormalities except cataract. These subjects were older than 40 years with IOP below 21 mmHg, no glaucomatous disc change, and no family history of glaucoma.
  • AT1R angiotensin II type 1 receptor
  • angiotensin II type 2 receptor. (AT2R) 31230A (Katsuya T et . al . , Mol Cell Endocrinol 1997;127:221-228, the contents of the cited reference are herein incorporated by reference)
  • cytochrome P45011B1 (CYP11B1) -344T>C (Tsujita Y et . al .
  • chymase 31230A were identified using by polymerase chain reaction-restriction fragment length polymorphism (PCR- RFLP) .
  • PCR- RFLP polymerase chain reaction-restriction fragment length polymorphism
  • I/D angiotensin-converting enzyme
  • I allele specific amplification was carried out following the protocol of Lindpaintner et al (N Engl J Med 1995; 332: 706-711, the contents of the cited reference are herein incorporated by reference) .
  • Genomic DNA was isolated from peripheral blood lymphocytes by phenol-chloroform extraction. The primer sets and restriction enzymes used were listed in Table 6.
  • a 31230A polymorphism was associated with only female patients with NTG.
  • A Subjects with two -521 alleles and two -713G alleles
  • B Subjects not satisfying the criteria for Group A.
  • the AT2R 3123 corresponds nucleotide number 4926) 4741 gtgtttctta gtggggttttat atatccattt ttatcaggat ttcctcttga accagaacca 4801 gtctttcaac tcattgcatc atttacaaga caacattgta agagagatga gcacttctaa 4861 gttgagtata ttataataga ttagtactgg attattcagg ctttaggcat atgcttcttt 4921 aaaaacgcta taaattatat tcctcttgca ttfccacttga gtggaggttt atagttaatc 4981 tataactaca tattgaatag ggctaggaat aat a
  • G/T polymorphism of endothelin (ET) gene by Invader assay DNA was isolated from peripheral blood lymphocytes by standard methods of phenol-chloroform extraction, and G/T polymorphism (Lys/lys, Lys/Asn and Asn/Asn) at codon 198 in exon 5 of ET gene was determined by the Invader® assay.
  • the primary probes (wild and mutant probes) and Invader ® oligonucleotides (Invader ® probe) used to detect the G/T polymorphism of ET gene are shown in Table 9.
  • Invader® assay FRET-detection 96-well plates contains the generic components of an Invader® assay (Cleavase® enzymes VIII, FRET probes, MOPS buffer, and polyethylene glycol) dxied in each of the individual wells.
  • an Invader® assay Cleavase® enzymes VIII, FRET probes, MOPS buffer, and polyethylene glycol
  • 8 ⁇ l of the primary probe/Invader ® /mixture and total DNA (HO ng) samples were added to each well of a 96-well plate, and were denatured by incubation at 95° C for 10 min.
  • A-fter 15 ⁇ l of mineral oil (Sigma, St.
  • Lys/Lys homozygote of ET-1 gene at codon 198 in exon 5 is one of the risk factor to develop or progress the NTG, and detection of the Lys/Lys homozygote makes possible the early diagnosis and early treatment of NTG.
  • Partial sequence of EDN1 comprising codon 198 is as follows :
  • EDNl Codon 198 (underlined) : aag (Lys) to aat (Asn)
  • Genomic DNA was isolated from peripheral blood lymphocytes by standard methods. The seven exonic regions of the MYOC gene were amplified by polymerase chain • reaction (PCR) using the primer sets listed in Table 11. For high-throughput analysis of the patients, samples from three patients were pooled. The PCR reaction was performed with a thermal cycler (iCycler; Bio Rad, Hercules, CA) in a total volume of 25 ⁇ l.
  • PCR polymerase chain • reaction
  • PCR conditions were: denaturation at 95° C for 9 min; followed by 35 cycles at 95° C for 1 min; 58° C for 30 sec (Table 1); and 72° C for 1.5 min; a final extension step was then carried out at 72° C for 7 min.
  • each PCR product 25 ⁇ l was denatured at 95° C for 5 min and gradually cooled to 25° C.
  • each of seven exonic regions was amplified simultaneously by PCR in a 96-well plate (96-well Multiplate, MLP-9601; MJ Research, Waltha , MA) . Seven wells were used for each patient. Primer sets were designed to be effective using a single annealing temperature of 58° C (Table 11) .
  • PCR products were purified with a QIA Quick PCR purification kit (Qiagen, Valencia, CA) to remove unused primers and precursors.
  • the PCR products were directly sequenced with the same forward and reverse PCR amplification primers on an ABI310 automated sequencer using BigDye chemistry according to the manufacturer's recommended protocol (Applied Biosystems, Foster City, CA) .
  • Results Screening of Pools of DNA in 171 Patients Four DHPLC tracing patterns in the Exon3C region were shown in Figure 2. The upper most pattern (A) has a normal appearance, while the middle pattern (B) showed a broad shoulder, and the lower patterns (C and D) had a characteristic double peak pattern indicative of sequence variations in this region.
  • Partial nucleotide sequences for MYOC exon 3 gene containing the targeted polymorphism is as follows: • MYOC Exon 3, codon 369 (underlined) TTC(Phe) to CTC (Leu) 301 actggaaagc acgggtgctg tggtgtactc ggggagcctc tatttccagg gcgctgagtc 361 cagaactgtc ataagatatg agctgaatac cgagacagtg aaggctgaga aggaaatccc 421 tggagctggc taccacggac agttcccgta ttcttggggt ggctacacgg acattgactt 481 ggctgtggat gaagcaggcc tctgggtcat ttacagcacc gatgaggcca
  • a 20-base GC-clamp was attached to some of the forward primers to detect mutations in the higher melting temperature domain by DHPLC analysis (Narayanaswami G et. al . , Genet Test. 2001;5:9-16). In high-throughput analysis, samples from three patients were pooled.
  • PCR was performed with a thermal cycler (iCycler, Bio-Rad; Hercules, CA) in a total volume of 20 ⁇ l containing; 45 ng of genomic DNA, 2 ⁇ l GeneAmp lOx PCR buffer II, 2 ⁇ l of GeneAmp dNTP mix with a 2.0 itiM concentration of each dNTP, 2.4 ⁇ l of a 25 mM MgCl 2 solution; 4 pmol of each primer, and 0.1 U of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA) .
  • a thermal cycler iCycler, Bio-Rad; Hercules, CA
  • PCR conditions were; denaturation at 95° C for 9 min, followed by 35 cycles at 95° C for 1 min, 55° to 60° C for 30 sec (Table 13) , and 72° C for 1 min and 30 sec, and a final extension step at 72° C for 7 min. Table 13 .
  • DHPLC analysis was performed using the WAVE ® SYSTEMS (Transgenomic, Omaha, NE) .
  • WAVE ® SYSTEMS Transgenomic, Omaha, NE
  • products of each PCR (20 ⁇ l ) were denatured at 95° C for 5 min and gradually cooled to 25° C .
  • the annealed PCR products from the three mixed samples were automatically inj ected into a DNASep ® cartridge (Transgenomic, Omaha, NE)
  • Buffer A Transgenomic, Omaha, NE
  • Buffer B was made up of 0.1 M triethylammonium acetate (TEAA)
  • Buffer B of 0.1 M TEAA and 25% acetonitrile.
  • Direct DNA Sequencing To detect mutations by direct sequencing, the PCR products were first purified with the QIAquick PCR Purification Kit (QIAGEN, Valenica, CA, USA) to remove unreacted primers and precursors. The sequencing reactions were then performed using the ABI PRISM BigDye Terminator (v.3.1) Cycle Sequencing Kit, according to the manufacturer's protocol (Applied Biosystems). The data were collected by the ABI PRISM 310 Genetic Analyzer and analyzed by the ABI PRISM sequencing analysis program (v.3.7) .
  • QIAquick PCR Purification Kit QIAGEN, Valenica, CA, USA
  • the sequencing reactions were then performed using the ABI PRISM BigDye Terminator (v.3.1) Cycle Sequencing Kit, according to the manufacturer's protocol (Applied Biosystems). The data were collected by the ABI PRISM 310 Genetic Analyzer and analyzed by the ABI PRISM sequencing analysis program (v.3.7) .
  • Genotyping OPTN c.412G>A (Thr3 Thr) Polymorphism The G to A substitution at position c.412 in exon 4 of the OPTN gene was detected by using restriction enzyme, ffpyCH ⁇ IV (New England BioLabs, Beverly, MA) , with the same primers listed in Table 13 for the DHPLC analysis.
  • the G allele sequence was cut into two fragments (188 bp + 129 bp) by i ⁇ pyCH ⁇ IV, while the A allele sequence remained intact (317 bp) .
  • the polymorphism was confirmed by • restriction-enzyme assay and the chromatographic pattern of DHPLC .
  • Genotyping OPTN c.603T>A (Met98Lys) Polymorphism
  • the T to A substitution at position c.603 in exon 5 of the OP N gene was detected by restriction enzyme, Stu I (TaKaRa, Shiga, Japan) , using the same primers as for the DHPLC analysis (Table 13) .
  • the A allele sequence was cut into two fragments (175 bp + 102 bp) by Stu I, while the T allele sequence remained intact (277 bp) .
  • the polymorphism was confirmed by restriction-enzyme assay and the chromatographic pattern of DHPLC.
  • Genotyping TNF- ⁇ -308G>A Polymorphism Genotyping the -308G>A polymorphism in the TNF- promoter region was performed by using restriction enzyme Wcol (New England BioLabs, Beverly, MA) , with the forward primer, 5' -AGGCAATAGGTTTTGAGGGCCAT-3' , and the reverse primer, 5' -GTAGTGGGCCCTGCACCTTCT -3'.
  • the forward primer contained one nucleotide mismatch (bold and underlined) , which allowed the use of the restriction enzyme.
  • the G allele sequence was cut into two fragments (192 bp +20 bp) by Ncol while the A allele sequence remained intact (212 bp) .
  • Genotyping T ⁇ F- ⁇ -8570T Polymorphism Genotyping the -8570T polymorphism in the T ⁇ F- ⁇ ; promoter region was performed by using restriction enzyme Hindi (TaKaRa, Shiga, Japan), with the forward primer, 5'- AAGTCGAGTATGGGGACCCCCCGTTAA-3' , and the reverse primer, 5'- CCCCAGTGTGTGGCCATATCTTCTT-3' .
  • the forward primer contained one nucleotide mismatch (bold and underlined) , which allowed the use of the restriction enzyme.
  • the C allele sequence was cut into two fragments (106 bp +25 bp) by ffincll, while the T allele sequence remained intact (131 bp) .
  • Genotyping TNF- ⁇ -8630A Polymorphism Genotyping the -8630A polymorphism in the TNF- ⁇ . promoter region was done by using restriction enzyme EcoNI (New England BioLabs r Beverly, MA) with the forward primer, 5'-GCTGAGAAGATGAAGGAAAAGTC-3 f , and the reverse primer, 5'- CCTCTACATGGCCCTGTCCT-3' .
  • the reverse primer contained one nucleotide mismatch (bold and underlined) , which allowed the use of the restriction enzyme.
  • the C allele sequence was cut into two fragments (183 bp +23 bp) by EcoNI, while the A allele sequence remained intact (206 bp) . •Transcriptional activity of the -863A allele was significantly greater than that of -863C allele.
  • Statistical Analyses The frequencies of the genotypes and alleles in patients . and controls were compared with the chi-square test and Fisher's exact test. The odds ratio and 95% confidence intervals (CI) also were calculated. The Hardy- Weinberg equilibrium for the observed frequencies was also calculated. Comparisons of the clinical characteristics between the two groups were performed using Mann-Whitney U test or Student's unpaired t-test when appropriate.
  • a deletion of Leu47 (3-bp deletion, CTC) was found in 1 control.
  • a Met98Lys was identified in 33 POAG patients, 48 NTG patients, and 36 controls, and an Arg545Gln was identified in 11 POAG patients, 15 NTG patients, and 11 controls.
  • Four synonymous nucleotide substitutions c.412G>A (Thr34Thr) , c.421G>A (Pro37Pro) , c.4570T (Thr49Thr) , and C.2023OT (His571His) were found.
  • the Thr34Thr substitution was present in 69 (35.6%) POAG patients, 69 (31.8%) NTG patients, and 52 (23.9%) controls, and the Pro37Pro was found in 1 NTG patient.
  • the Thr49T_hr was identified in 1 POAG patient, and the His571His was present in 2 controls.
  • No significant difference was detected between glaucoma patients and controls in either genotype or allele frequency for the Met98Lys (c.603T>A) or the Arg545Gln (c.l944G>A) polymorphisms.
  • the Met98Lys polymorphism had a higher tendency to be associated with NTG than with POAG.
  • the observed genotype frequencies were in agreement with those predicted by the Hardy-Weinberg equilibrium.
  • POAG patients who were TNF- ⁇ /-857T and optineurin/412A carriers had significantly worse (P 0.020) visual field scores than those who were TNF- ⁇ /-857T and non- optineurin/412A carriers.
  • P 0.020
  • Partial nucleotide sequence of OPTN exon 4 comprising the targeted polymorphism, 412G>A (underlined) caacagtgac ttttccacag gaacttctgc aatgtcccat caacctctca gctgcctcac tgaaaggag gacagcccca gtgaaagcac aggaaatgga cccccccacc tggcccaccc aaacctggac acgttaccc cggaggagct gctgcagcag atgaaagagc tcctgaccga gaaccaccaccag ctgaaaggtg agcagggctg gcctgtgt ' gccccattca tcctgggcct Sequence of OPTN gene, GeneBan Accession No.
  • TNF- ⁇ ge e comprising the targeted polymorphic position is as follows: TNF- ⁇ -8630A; -8570T (underlined) 3121 ccacatgtag cggctctgag gaatgggtta caggagacct ctgggg_ ⁇ agat gtgaccacag 3181 caatgggtag gagaatgtcc agggctatga aagtc
  • each subject was given either 12 mg oral candesartan cilexetil (Blopress®, Takeda, Japan) or the placebo in a randomized crossover double-blind fashion.
  • the baseline heart rate, systolic/diastolic arterial pressures (SBP/DBP) , and IOP were recorded.
  • the subjects then received oral candesartan cilexetil or placebo, and measurements were repeated hourly for 6 hr and after 24 hr.
  • the ocular perfusion pressure (OPP) is defined as the difference between the pressure in the arteries entering the tissue and the veins leaving it.
  • the OPP can be approximated by the following formula using the mean blood pressure (BPm) and the IOP.
  • BPm mean blood pressure
  • IOP IOP
  • a search for polymorphisms in ATR1 and ATR2 was performed in the 20 subjects and correlated with the changes in the IOP. This research followed the tenets of the Declaration of Helsinki. Written informed consent was obtained after the nature and possible consequences of the study were explained. Where applicable, the research was approved by the institutional human experimentation committee for analysis of DNA. Statistical Analysis Statistical analysis of the results following ARB was performed with StatView (SAS Institute, USA) using repeated measure ANOVA test.
  • ET-1 Endothelin 1
  • ET-1 a potent vasoconstrictor
  • ET-1 and its receptors may contribute to development of glaucoma.
  • ET-1 ⁇ EDNl gene polymorphisms of ET-1 ⁇ EDNl
  • ET A ET A
  • ET B ET B
  • Methods Study population A total of 650 Japanese subjects (224 normal controls, 176 POAG patients, and 250 NTG patients), recruited from seven Japanese medical institutions, were examined in this study. All subjects were unrelated. Mean age ( ⁇ standard deviation) at diagnosis of OAG was 57.2112.8 years.
  • OAG subjects were divided into POAG patients and NTG patients, aged 58.8+12.2 and 56.1+13.2 years at diagnosis, respectively (Table 1) .
  • Mean age at the time of examination was 70.0+11.2 years in controls. We- purposely selected older control subjects to reduce the likelihood that a subset of controls would later develop glaucoma.
  • Ophthalmic examinations included slit-lamp biomicroscopy, optic disc examination, IOP measurement by Goldmann applanation tonometry, and gonioscopy. Visual fields were assessed with Humphrey automated perimetry (program 30-2) or Goldmann perimetry. Severity of visual field defects was scored from 1 to 5.
  • SNPs single nucleotide polymorphisms
  • EDN1/G8002A in the intron 4 region was highly coincident with EDJW1/K198N, except in one sample (data not shown) .
  • Distribution of genotypes for other polymorphisms showed no significant differences between any patient group and controls. Characteristics of patients are examined in dominant model and recessive model of each polymorphism, and data with significant differences are shown in Table 23. In OAG patients overall and in POAG patients, no characteristic showed a significant difference between genotype groups.
  • Genotype frequency p value Genotype frequency p value KK KN+NN KK KN+NN
  • the A138insertion/deletion(A138I/D) polymorphism in exon 1 of the Endothelin-1 gene is associated with both o-f POAG and NTG (Table 24) .
  • the -231A>G polymorphism of promoter region of the Endothelin receptor A gene is associated with NTG, especially with patients with intraocular pressure at less than 15mmHg (Table 25) .
  • the CAC to CAT substitution at codon No. 233 in exon 6 of the Endothelin receptor A gene (His323His) is associated with NTG, especially with patients with intraocular pressure at less than 15mr ⁇ Hg (Table 26) .
  • H-NTG NTG patients with intraocular pressure at 16 mmHg- 21mmHg .
  • L-NTG NTG patients with maximal intraocular pressure at 15mmHg or less.
  • Table 26 Endothelin Receptor A H323H OT His323His (Male)
  • H-NTG NTG patients with intraocular pressure at 16 itiHg- 21mmHg .
  • L-NTG MTG patients with maximal intraocular pressure at 15mmHg or less
  • H-NTG NTG patients with -intraocular pressure at 16 mmHg- 21 ⁇ r ⁇ mHg.
  • L-NTG MTG patients with maximal intraocular pressure at 15mmHg or less.
  • Partial nucleotide secquences of endothelin-1 (EDNl) and endothelin receptor A (EDNRA) and endothelin receptor B (EDNRB) comprising the targeted polymorphisms are shown below EDNl -1370 (underlined) T>G 2101 ttgaattcca ccctccatcc ccagsaaaac tggagtaaa caaaaagagg agat ggacaa 2161 agtgtgtatt tgatggcatc cctc ggaag agactctaaa tttatcccat aggt cttact 2221 gggccactgt gagcgctttg
  • EDNRA codon No . 323 (underlined) (T>C) His323His 60721 gaggtagagg cagtgtaagc caggctgttc tcctggctct tctttgaatt attctttctc 60781 tggtgtctgc tacttcttgg tactgtagtt cttgcatcta gtataaaaac actaaatttg
  • Example 9 Association between Gene Polymorphism of ⁇ l adrenergic receptor (ADRB1) and Glaucoma Methods Association between gene polymorphism of ADRBl and glaucoma was examined among POAG, NTG patients and normal (control) subjects using PCR-RFLP techniques (Table 32-1) .
  • Partial nucleotide sequence of E-selectin comprising the targeted polymorohism is as follows: SELE No. 1402 (underlined) OT 7561 tgtttttatt ttattttaag ataaaaagaa ctattgaaga gcttgggaac ttggttacct 7621 tgggaacgt attgctggag atgcaaacaa acttctaaag tgctctctcg tgtgtccag 7681 ctgtgagatg cgatgctgtc caccagccccc cgaagggttt ggtgaggtgt gctcattccc 7741 ctattggaga attcacctac aagtcctcttt gtgccttcag ctgtgagg
  • Example 11 Paraoxonase 1 gene polymorphisms are associated with clinical features of open-angle glaucoma Purpose: Oxidative derivatives of low-density lipoprotein (LDL) are injurious to endothelium. Endothelial dysfunction is known to be involved in the pathogenesis of open-angle glaucoma (OAG) . High-density lipoprotein (HDL) prevents the oxidative modification of LDL.
  • PON1 paraoxonase 1
  • PON2 platelet-activating factor acetylhydrolase
  • HDL-associated antioxidant enzymes were associated with OAG in a Japanese population.
  • MATERIALS and METHODS Patients and control study subjects Six hundred and ninety-eight blood samples were collected at seven Japanese institutions. Subjects included 190 POAG patients, 268 NTG patients, and 240 normal controls. None subject was related to any other. Age at the blood sampling (mean ⁇ SD) was 65.3 ⁇ 11.9 years in POAG patients, 58.8 ⁇ 13.4 years in NTG patients, and 69.7 ⁇ 11.2 years in normal subjects, normal control subjects were significantly older than POAG patients (p ⁇ 0.001) or NTG patients (p ⁇ 0.001), which would reduce the likelihood of control subjects eventually developing glaucoma. Clinical features recorded in glaucoma patients were age at diagnosis, IOP at diagnosis, and visual field defects at diagnosis.
  • glaucoma patients were diagnosed according to the following criteria: the presence of typical optic disc damage with glaucomatous cupping (cup/disc ratio >0.7) and loss of neuroretinal rim; reproducible visual field defects compatible with the glaucomatous cupping; and open angles on gonioscopy.
  • OAG patients POAG was diagnosed if they had an IOP >21 mm Hg at any time during the follow-up period. Patients with exfoliative glaucoma, pigmentary glaucoma, and corticosteroid-induced glaucoma were excluded.
  • NTG was diagnosed when: the untreated peak IOP was consistently equal to or less than 21 mm Hg at all times including the 3 baseline measurements and that -during the diurnal testing values (every 3 hours from 6 AM to 24 PM) ; the peak IOP with or without medication after diagnosis was consistently ⁇ 22 mm Hg throughout the follow- up period; and the absence of a secondary cause for glaucomatous optic neuropathy, such as a previously elevated IOP following trauma, a period of steroid administration, or uveitis. Control subjects were recruited from among Japanese individuals who had no known eye abnormalities except for cataracts.
  • Genotyping Genomic DNA was isolated from peripheral blood lymphocytes by standard methods . Four SNPs were then detected in all participants: two for PON1 (L55M, Q192R) ; one for P0N2 (Cys311Ser, C311S) ; and one for PAF-AH (V279F) . These SNPs were genotyped by means of the Invader ® assay (Third Wave Technologies, Inc, Madison, WI, USA) which was recently developed for high-throughput genotyping of SNPs. - The oligonucleotide sequences of primary probes and Invader ® probes used in this study were listed in Table 34.
  • the L55M polymorphism of the PON1 gene had a significantly different genotype frequency in patients with NTG. Distribution of genotypes for polymorphisms in the PON2 gene and PAF-AH gene showed no significant differences between any patient group and controls (Table 35) . And there was no significant difference in allele frequency of the 4 SNPs.
  • the Glyl92Arg (Q192R) polymorphism in PONlgene was associated with POAG (Table 39) .
  • the Leu55Met polymorphism was associated with NTG, especially with less than 15mmHg ( Table 40 )
  • H-NTG NTG patients with intraocular pressure at 16 mmHg- 2ImmHg.
  • L-NTG MTG patients with maximal intraocular pressure at 15mmHg or less.
  • PONl gene polymorphisms may influence features of Japanese patients with OAG, especially those with NTG.
  • Partial nucleotide sequence of Paraoxonase 1 gene containing the targeted polymorphisms is as follows: • PONl Codon 55 (underlined) TTG(Leu) to ATG(Met) (Leu55Met) and
  • Genomic DNA was isolated from peripheral blood lymphocytes by phenol-chloroform extraction.
  • the 6 exonic coding regions of the Noelin 2 gene were amplified by polymerase chain reaction (PCR) using the primer sets listed in Table 41.
  • PCR was performed with a thermal cycler (iCycler, Bio-Rad; Hercules, CA) in a .total volume of 20 ⁇ l containing; 45 ng of genomic DNA, 2 ⁇ l GeneAmp lOx PCR buffer II, 2 ⁇ l of GeneAmp dNTP mix with a 2.0 iciM concentration of each dNTP, 2.4 ⁇ l of a 25 mM MgCl 2 solution; 4 pmol of each primer-, and 0.1 U of AmpliTaq Gold DNA polymerase (Applied Biosystems, Foster City, CA) .
  • iCycler Bio-Rad; Hercules, CA
  • the PCR conditions were; denaturatio at 95° C for 9 min, followed by 35 cycles at 95° C for 1 min, 65° C or 67° C for 30 sec (Table 1), and 72° C for 1 min and 30 sec, and a final extension step at 72° C for 7 min.
  • Denaturing HPLC Analysis For high-throughput analysis, a 25 ⁇ l volume of PCR products from the three patients was automatically injected into the chromatograph for analysis using the WAVE ® System for DHPLC analysis (Transgenomic, Omaha, NE) . The DHPLC melting temperatures are listed in Table 41. When abnormal chromatographic patterns were detected in the pooled samples by the high-throughput protocol, the sample was reanalyzed individually in the WAVE ®' System. The PCR product that showed the abnormal chromatographic pattern was then sequenced.
  • PCR products were purified with a QIA Quick PCR purification kit (Qiagen, Valencia, CA) to remove unused primers and precursors.
  • the PCR products were directly sequenced with the same forward and reverse PCR amplification primers on an ABI310 automated sequencer using BigDye chemistry according to the manufacturer's recommended protocol (Applied Biosystems, Foster City, CA) .
  • Noelin 2 codon 144 (underlined) CGG(Arg) to CAG(Gln) : (GG: 200 bp+144 bp, GA: 344 bp+200 bp+144 bp, AA: 344 bp) • (BstUl) codon 140 (underlined) Lysl40Lys (AAOAAA) codon 152 (underlined) Glul52Glu (GAOCAA)
  • HSP70-1 HSP70-1 gene in the etiology of glaucoma Association between glaucoma and gene polymorphism of HSP70-1 (Biogerontology 4: 215-220, 2003 and Hum Genet 114: 236-241, 2004) was examined among POAG, NTG patients and control subject using Invader assay.
  • Invader ® oligonucleotides used to detect the polymorphism of HSP70-1 gene are shown in Table 43. Table 43. The oligonucleotide sequence of HSP70-1 Gene Polymorphism nucleotide change format Probe Sequence A Flap sequence-TTTTCGCCTCCCGT HSP70-1 -110AX) A o C PCR C Flap sequence-GTTTCGCCTCCCGT Invader GCTGCCAGGTCGGGAATATTCCAGGGC PCR F CGCCATGGAGACCAACACCC R GCCGGTTCCCTGCTCTCTGTC
  • Example 14 Evaluation of the Endothelin converting enzyme 1 (ECE1) gene in the etiology of glaucoma Association between glaucoma and gene polymorphism of ECEl was examined in POAG and NTG patients using Invader assay.
  • the primary probes (wild and mutant probes ) and Invader ® oligonucleotides ( Invader ® probe) us ed to detect the polymorphism of ECEl gene are shown in TabXe 45.
  • Partial nucleotide sequence of ECE-1 comprising the targeted polymorphism is shown as follows:
  • Example 15 Evaluation of the CD50 gene in the etiology of ope -angle glaucoma Polymorphism of CD50 gene was identified using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques ( Table 47 ) .
  • PCR-RFLP polymerase chain reaction-restriction fragment length polymorphism
  • Mutation nucleotide change Target Probe Sequence Length Tm Dye Wild Flap sequence-CTTAGTCTTGAAGTGAGGG 29 62.7 FAI ⁇ EPHX1 K119 G to A Sense Mutant Flap sequence-TTTAGTCTTGAAGTGAGGG 31 62.3 RED Invader TCTCTGGCTGGCGTTTTGCAMCATACCTTCAATA 35
  • Partial nucleotide sequence of EPHXl comprising the targeted polymoprhisms is as follows:
  • Example 17 Evaluation of the ⁇ 2 adrenergic receptor (ADRB2) gene in the etiology of glaucoma Association between glaucoma and gene polymorphism of ADRB2 was examined in open angle glaucoma patients (POAG and NTG patients) using Invader assay.
  • the primary probes (wild and mutant probes) and Invader ® oligonucleotides (Invader ® probe) used to detect the polymorphism of ADRB2 gene are shown in Table 51.
  • the polymorphism of Gln27Glu is associated with high intraocular pressure (IOP) in OAG, especially POAG.
  • Glyl6Arg GGA>AGA
  • Gln27Glu CAA>GAA

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Ophthalmology & Optometry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/JP2005/005601 2004-03-18 2005-03-18 Method for diagnosing or predicting susceptibility to optic nueropathy Ceased WO2005090602A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2007503564A JP5129563B2 (ja) 2004-03-18 2005-03-18 視神経症に対する感受性を診断または予測するための方法
US10/593,103 US8182990B2 (en) 2004-03-18 2005-03-18 Method for diagnosing or predicting susceptibility to optic neuropathy

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US55398604P 2004-03-18 2004-03-18
US60/553,986 2004-03-18
US60470404P 2004-08-27 2004-08-27
US60/604,704 2004-08-27
US60735904P 2004-09-07 2004-09-07
US60/607,359 2004-09-07

Publications (2)

Publication Number Publication Date
WO2005090602A2 true WO2005090602A2 (en) 2005-09-29
WO2005090602A3 WO2005090602A3 (en) 2006-04-13

Family

ID=34979405

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2005/005601 Ceased WO2005090602A2 (en) 2004-03-18 2005-03-18 Method for diagnosing or predicting susceptibility to optic nueropathy

Country Status (3)

Country Link
US (1) US8182990B2 (https=)
JP (1) JP5129563B2 (https=)
WO (1) WO2005090602A2 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008130009A1 (ja) * 2007-04-17 2008-10-30 Santen Pharmaceutical Co., Ltd. 緑内障進行リスクの判定方法
WO2011128646A3 (en) * 2010-04-14 2012-02-23 The University Court Of The University Of Edinburgh Genetic markers for paget's disease
US9278085B2 (en) 2006-02-22 2016-03-08 Edison Pharmaceuticals, Inc. Side-chain variants of redox-active therapeutics for treatment of mitochondrial diseases and other conditions and modulation of energy biomarkers
US9370496B2 (en) 2009-04-28 2016-06-21 Edison Pharmaceuticals, Inc. Treatment of leber's hereditary optic neuropathy and dominant optic atrophy with tocotrienol quinones
WO2018003523A1 (ja) * 2016-06-30 2018-01-04 京都府公立大学法人 広義原発開放隅角緑内障の発症リスクの判定方法
US10703701B2 (en) 2015-12-17 2020-07-07 Ptc Therapeutics, Inc. Fluoroalkyl, fluoroalkoxy, phenoxy, heteroaryloxy, alkoxy, and amine 1,4-benzoquinone derivatives for treatment of oxidative stress disorders
US10736857B2 (en) 2008-09-10 2020-08-11 Ptc Therapeutics, Inc. Treatment of pervasive developmental disorders with redox-active therapeutics
US11021424B2 (en) 2005-06-01 2021-06-01 Ptc Therapeutics, Inc. Redox-active therapeutics for treatment of mitochondrial diseases and other conditions and modulation of energy biomarkers

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7838250B1 (en) 2006-04-04 2010-11-23 Singulex, Inc. Highly sensitive system and methods for analysis of troponin
JP5308328B2 (ja) 2006-04-04 2013-10-09 シングレックス,インコーポレイテッド トロポニンの分析のための高感度のシステムおよび方法
WO2010044459A1 (ja) * 2008-10-16 2010-04-22 独立行政法人国立病院機構 緑内障のリスクの予測方法
JP4515524B2 (ja) * 2008-11-27 2010-08-04 株式会社メニコン 正常眼圧緑内障疾患感受性遺伝子及びその利用
US20100197537A1 (en) * 2009-02-02 2010-08-05 R.T. Vanderbilt Company, Inc. Ashless lubricant composition
US9315760B2 (en) 2009-02-02 2016-04-19 Vanderbilt Chemicals, Llc Ashless lubricant composition
EA201101576A1 (ru) * 2009-04-28 2012-04-30 Эдисон Фармасьютикалз, Инк. Лекарственная форма токотриенол хинонов для лечения офтальмических (глазных) заболеваний
WO2010144358A1 (en) 2009-06-08 2010-12-16 Singulex, Inc. Highly sensitive biomarker panels
WO2014159679A1 (en) 2013-03-12 2014-10-02 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Methods for using lubiprostone to absorb fluid from the subretinal space
RU2597784C2 (ru) * 2014-11-19 2016-09-20 Федеральное государственное автономное образовательное учреждение высшего профессионального образования "Белгородский государственный национальный исследовательский университет" (НИУ "БелГУ") Способ прогнозирования риска развития первичной открытоугольной глаукомы у индивидуумов в зависимости от наличия/отсутствия сопутствующей патологии глаз
IT201700079495A1 (it) * 2017-07-14 2019-01-14 Optikon 2000 Spa Sistema e metodo di controllo della pressione di infusione oculare per interventi di chirurgia oftalmica

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT943014E (pt) * 1996-12-05 2007-03-30 Alcon Mfg Ltd Métodos para diagnóstico do glaucoma e descoberta de farmacos antiglaucoma
US6475724B1 (en) * 1997-01-28 2002-11-05 The Regents Of The University Of California Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
AU2001294559A1 (en) * 2000-09-11 2002-03-26 Dzgenes, L.L.C. Endothelin-1 promoter polymorphism
WO2002024747A2 (en) * 2000-09-19 2002-03-28 Epidauros Biotechnologie Ag Polymorphisms in human genes of cardiovascular regulators and their use in diagnostic and therapeutic applications

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11021424B2 (en) 2005-06-01 2021-06-01 Ptc Therapeutics, Inc. Redox-active therapeutics for treatment of mitochondrial diseases and other conditions and modulation of energy biomarkers
US9932286B2 (en) 2006-02-22 2018-04-03 Bioelectron Technology Corporation Side-chain variants of redox-active therapeutics for treatment of mitochondrial diseases and other conditions and modulation of energy biomarkers
US9278085B2 (en) 2006-02-22 2016-03-08 Edison Pharmaceuticals, Inc. Side-chain variants of redox-active therapeutics for treatment of mitochondrial diseases and other conditions and modulation of energy biomarkers
JP2013150628A (ja) * 2007-04-17 2013-08-08 Shigeru Kinoshita 緑内障進行リスクの判定方法
US8431345B2 (en) 2007-04-17 2013-04-30 Shigeru Kinoshita Method for determination of progression risk of glaucoma
JP5624763B2 (ja) * 2007-04-17 2014-11-12 木下 茂 緑内障進行リスクの判定方法
JP2015180219A (ja) * 2007-04-17 2015-10-15 茂 木下 緑内障進行リスクの判定方法
JPWO2008130008A1 (ja) * 2007-04-17 2010-07-22 木下 茂 緑内障発症リスクの判定方法
WO2008130008A1 (ja) * 2007-04-17 2008-10-30 Santen Pharmaceutical Co., Ltd. 緑内障発症リスクの判定方法
JP2017201995A (ja) * 2007-04-17 2017-11-16 茂 木下 緑内障進行リスクの判定方法
WO2008130009A1 (ja) * 2007-04-17 2008-10-30 Santen Pharmaceutical Co., Ltd. 緑内障進行リスクの判定方法
US10736857B2 (en) 2008-09-10 2020-08-11 Ptc Therapeutics, Inc. Treatment of pervasive developmental disorders with redox-active therapeutics
US10195161B2 (en) 2009-04-28 2019-02-05 Bioelectron Technology Corporation Treatment of leber's hereditary optic neuropathy and dominant optic atrophy with tocotrienol quinones
US9370496B2 (en) 2009-04-28 2016-06-21 Edison Pharmaceuticals, Inc. Treatment of leber's hereditary optic neuropathy and dominant optic atrophy with tocotrienol quinones
WO2011128646A3 (en) * 2010-04-14 2012-02-23 The University Court Of The University Of Edinburgh Genetic markers for paget's disease
US10703701B2 (en) 2015-12-17 2020-07-07 Ptc Therapeutics, Inc. Fluoroalkyl, fluoroalkoxy, phenoxy, heteroaryloxy, alkoxy, and amine 1,4-benzoquinone derivatives for treatment of oxidative stress disorders
US10981855B2 (en) 2015-12-17 2021-04-20 Ptc Therapeutics, Inc. Fluoroalkyl, fluoroalkoxy, phenoxy, heteroaryloxy, alkoxy, and amine 1,4-benzoquinone derivatives for treatment of oxidative stress disorders
US11680034B2 (en) 2015-12-17 2023-06-20 Ptc Therapeutics, Inc. Fluoroalkyl, fluoroalkoxy, phenoxy, heteroaryloxy, alkoxy, and amine 1,4-benzoquinone derivatives for treatment of oxidative stress disorders
WO2018003523A1 (ja) * 2016-06-30 2018-01-04 京都府公立大学法人 広義原発開放隅角緑内障の発症リスクの判定方法

Also Published As

Publication number Publication date
JP2007529218A (ja) 2007-10-25
US8182990B2 (en) 2012-05-22
WO2005090602A3 (en) 2006-04-13
JP5129563B2 (ja) 2013-01-30
US20080221050A1 (en) 2008-09-11

Similar Documents

Publication Publication Date Title
US8182990B2 (en) Method for diagnosing or predicting susceptibility to optic neuropathy
Funayama et al. Variants in optineurin gene and their association with tumor necrosis factor-α polymorphisms in Japanese patients with glaucoma
Aung et al. A major marker for normal tension glaucoma: association with polymorphisms in the OPA1 gene
Bisceglia et al. VSX1 mutational analysis in a series of Italian patients affected by keratoconus: detection of a novel mutation
Aragon-Martin et al. Evaluation of LOXL1 gene polymorphisms in exfoliation syndrome and exfoliation glaucoma
Xu et al. Association of CFH, LOC387715, and HTRA1 polymorphisms with exudative age-related macular degeneration in a northern Chinese population
EP1520039B1 (en) Mitochondrial polymorphisms linked to a predisposition for the development of inappropriate scarring or fibrosis
Lima et al. Three major loci involved in age-related macular degeneration are also associated with polypoidal choroidal vasculopathy
Sullivan et al. Genomic rearrangements of the PRPF31 gene account for 2.5% of autosomal dominant retinitis pigmentosa
EP2635704B1 (en) Predicting progression to advanced age-related macular degeneration using a polygenic score
US7651840B2 (en) Genetic polymorphisms associated with Alzheimer's disease, methods of detection and uses thereof
US20100196400A1 (en) Genetic polymorphisms associated with alzheimer's disease, methods of detection and uses thereof
WO2010085542A2 (en) Biomarkers related to age-related macular degeneration (amd)
US20110294121A1 (en) Methods and compositions for prognosing, detecting, and treating age-related macular degeneration
US20120115925A1 (en) Allelic Variants Associated with Advanced Age-Related Macular Degeneration
US20080085878A1 (en) Superoxide dismutase-2 expression and modulation for glaucoma diagnosis and therapy
Martin-Merida et al. Analysis of the PRPF31 gene in Spanish autosomal dominant retinitis pigmentosa patients: a novel genomic rearrangement
Gorin Identification of mutations in UBIAD1 following exclusion of coding mutations in the chromosome 1p36 locus for Schnyder crystalline corneal dystrophy
CA2703877C (en) Genetic polymorphisms associated with liver fibrosis, methods of detection and uses thereof
Wolf et al. Lysyl oxidase-like 1 gene polymorphisms in German patients with normal tension glaucoma, pigmentary glaucoma and exfoliation glaucoma
US20090221670A1 (en) Method for diagnosis and treatment of a mental disease
Chen et al. Screening of the LTBP2 gene in 214 Chinese sporadic CYP1B1-negative patients with primary congenital glaucoma
Garcia-Hoyos et al. Mutational screening of the RP2 and RPGR genes in Spanish families with X-linked retinitis pigmentosa
WO2015135583A1 (en) Method for identifying a candidate subject for anti-vascular endothelial growth factor (vegf) therapy
Garcia-Hoyos et al. Mutation analysis at codon 838 of the Guanylate Cyclase 2D gene in Spanish families with autosomal dominant cone, cone-rod, and macular dystrophies

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 10593103

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007503564

Country of ref document: JP

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase