WO2005090311A1 - Novel heterocyclyl-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors - Google Patents
Novel heterocyclyl-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors Download PDFInfo
- Publication number
- WO2005090311A1 WO2005090311A1 PCT/EP2005/050946 EP2005050946W WO2005090311A1 WO 2005090311 A1 WO2005090311 A1 WO 2005090311A1 EP 2005050946 W EP2005050946 W EP 2005050946W WO 2005090311 A1 WO2005090311 A1 WO 2005090311A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alkyl
- hydrogen
- compounds
- alkoxy
- methoxy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D221/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00
- C07D221/02—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00 condensed with carbocyclic rings or ring systems
- C07D221/04—Ortho- or peri-condensed ring systems
- C07D221/06—Ring systems of three rings
- C07D221/10—Aza-phenanthrenes
- C07D221/12—Phenanthridines
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D221/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00
- C07D221/02—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00 condensed with carbocyclic rings or ring systems
- C07D221/04—Ortho- or peri-condensed ring systems
- C07D221/06—Ring systems of three rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/473—Quinolines; Isoquinolines ortho- or peri-condensed with carbocyclic ring systems, e.g. acridines, phenanthridines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/08—Bronchodilators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/10—Drugs for genital or sexual disorders; Contraceptives for impotence
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/14—Drugs for dermatological disorders for baldness or alopecia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/16—Otologicals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
- C07D401/10—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing aromatic rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
- C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
- C07D413/10—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing aromatic rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
- C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
- C07D417/10—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a carbon chain containing aromatic rings
Definitions
- the invention relates to novel heterocyclyl -substituted hydroxy-6-phenylphenanthridine derivatives, which are used in the pharmaceutical industry for the production of pharmaceutical compositions.
- the International Patent applications W099/57118 and WO02/05616 describe 6- phenylphenanthridines as PDE4 inhibitors.
- WO99/05112 substituted 6-alkylphenanthridines are described as bronchial therapeutics.
- EP 0490823 dihydroisoquinoline derivatives are described which are useful in the treatment of asthma.
- the International Patent application WO99/05111 discloses tetrazolyl -phenyl-phenanthridines as PDE4 inhibitors.
- the International Patent applications WO00/42020 and WO02/05616 disclose phenylphenanthndines as PDE4 inhibitors.
- the International Patent applications WO2004/019944 and WO2004/019945 disclose hydroxy- substituted 6-phenylphenanthridines as PDE4 inhibitors.
- the invention thus relates to compounds of the formula I,
- R1 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-4C-alkoxy
- R2 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1- C-alkoxy, or in which R1 and R2 together are a 1-2C-alkylenedioxy group,
- R3 is hydrogen or 1 -4C-alkyl
- R31 is hydrogen or 1-4C-alkyl
- R4 is -0-R41, in which
- R41 is hydrogen, 1-4C-alkyl, 1-4C-alkoxy-1-4C-alkyl, hydroxy-2-4C-alkyl, 1-7C-alkylcarbonyI, or completely or predominantly fluorine-substituted 1-4C-alkyl
- R5 is hydrogen or 1 -4C-alkyl
- R4 is hydrogen or 1-4C-alkyl
- R5 is -0-R51, in which R51 is hydrogen, 1-4C-alkyl, 1-4C-alkoxy-1-4C-alkyl, hydroxy-2-4C-alkyl, 1-7C-alkylcarbonyl, or completely or predominantly fluorine-substituted 1-4C-alkyl,
- R6 is hydrogen, halogen, 1 ⁇ 4C-alkyl or 1-4C-alkoxy
- R7 is Hetl , Het2, Har1 , Het3 or Har2, in which Het1 is optionally substituted by R71 and is a monocylic 3- to 7-membered fully saturated heterocyc- lic ring radical comprising one to three heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, in which
- R71 is 1-4C-alkyl, 1-4C-alkoxy, or completely or partially fluorine-substituted 1-4C-alkyl,
- Het2 is optionally substituted by R72 and is a monocylic 5- to 7-membered saturated or unsaturated heterocyciic ring radical, which comprises one nitrogen atom and optionally one or two further heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, and to which ring one or two oxo substituents are bonded, in which
- R72 is 1-4C-alkyl, 1-4C-alkoxy, or completely or partially fluorine-substituted 1- C-alkyl,
- Harl is optionally substituted by R73 and is a monocyclic 5-membered fully unsaturated heterocyciic ring radical comprising one to four heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, in which
- R73 is 1-4C-alkyl, 1-4C-alkoxy, or completely or partially fluorine-substituted 1-4C-alkyl,
- Het3 is optionally substituted by R74 and is a monocyclic 5- or 6-membered partially unsaturated heterocyciic ring radical comprising one nitrogen atom and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, in which
- R74 is 1-4C-alkyl, 1-4C-alkoxy, or completely or partially fluorine-substituted 1-4C-alkyl,
- Har2 is optionally substituted by R75 and/or R76 and stands for a monocyclic 6-membered fully un- saturated heterocyciic ring radical comprising one to three nitrogen atoms, in which
- R75 is 1-4C-alkyl, 1-4C-alkoxy, 1-4C-alkylthio, halogen, hydroxyl, amino, mono- ordi-1-4C- alkylamino, or completely or partially fluorine-substituted 1-4C-alkyl,
- R76 is 1-4C-alkoxy, 1-4C-alkylthio, hydroxyl, amino or mono- or di-1-4C-alkylamino, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- 1-4C-Alkyl represents a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl and preferably the ethyl and methyl radicals.
- 1-7C-Alkyl represents a straight-chain or branched alkyl radical having 1 to 7 carbon atoms. Examples which may be mentioned are the heptyl, isoheptyl (5-methylhexyl), hexyl, isohexyl (4-methylpentyl), neohexyl (3,3-dimethylbutyl), pentyl, isopentyl (3-methylbutyl), neopentyl (2,2-dimethylpropyl), butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl or methyl radicals.
- 1-4C-Alkoxy represents radicals which, in addition to the oxygen atom, contain a straight-chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy and preferably the ethoxy and methoxy radicals.
- 3-7C-Cycloalkoxy represents cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy and cyclo- heptyloxy, of which cyclopropyloxy, cyclobutyloxy and cyclopentyloxy are preferred.
- 3-7C-Cycloalkylmethoxy represents cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclohexylmethoxy and cycloheptylmethoxy, of which cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy are preferred.
- fluorine-substituted 1-4C-alkoxy for example, the 2,2,3,3,3-penta- fluoropropoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy, in particular the 1,1,2,2-tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifiuoromethoxy and preferably the difluoromethoxy radicals may be mentioned.
- "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy radicals are replaced by fluorine atoms.
- fluorine-substituted 1-4C-alkyl for example, the 2,2,3,3,3-pentafluoro- propyl, the perfluoroethyl, the 1,2,2-trifluoroethyl, in particular the 1,1,2,2-tetrafluoroethyl, the 2,2,2- trifluoroethyl, the trifluoromethyl and particularly the difluoromethyl radicals may be mentioned.
- "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkyl radicals are replaced by fluorine atoms.
- fluorine-substituted 1-4C-alkyl for example, the 2,2,3,3,3-pentafluoropropyl, the perfluoroethyl, the 1,2,2-trifluoroethyl, the 1,1,2,2-tetrafluoroethyl, the 2,2,2-trifluoroethyl, the trifluoromethyl, the difluoromethyl and, in particular, the 2,2-difluoroethyl radicals may be mentioned.
- 1-2C-Alkyle ⁇ edioxy represents, for example, the methylenedioxy [-0-CH 2 -0-] and the ethylenedioxy [-0-CH 2 -CH 2 -0-] radicals.
- 1-4C-Alkoxy-1-4C-alkyl represents one of the abovementioned 1-4C-alkyl radicals, which is substituted by one of the abovementioned 1-4C-alkoxy radicals.
- Examples which may be mentioned are the methoxymethyl, the methoxyethyl and the isopropoxyethyl radicals, particularly the 2-methoxyethyl and the 2-isopropoxyethyl radicals.
- 1-7C-Alkylcarbonyl represents a radical which, in addition to the carbonyl group, contains one of the abovementioned 1-7C-alkyl radicals. Examples which may be mentioned are the acetyl, propionyl, butanoyl and hexanoyl radicals. Hydroxy-2-4C-alkyl represents 2-4C-alkyl radicals, which are substituted by a hydroxyl group. Examples which may be mentioned are the 2-hydroxyethyl and the 3-hydroxypropyl radicals.
- mono- or di-1-4C-alkylamino radicals contain one or two of the abovementioned 1-4C-alkyl radicals.
- Di-1-4C-alkylamino is preferred and here, in particular, dimethyl-, diethyl- or diisopropylamino.
- Halogen within the meaning of the invention is bromine, chlorine or fluorine.
- 1-4C-Alkylthio represents radicals which, in addition to the sulfur atom, contain one of the abovementioned 1-4C-alkyl radicals. Examples which may be mentioned are the butylth ⁇ o, propylthio and preferably the ethylthio and methylthio radicals.
- Hetl is optionally substituted by R71 and stands for a monocylic 3- to 7-membered fully saturated heterocyciic ring radical comprising one to three heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur.
- Hetl is optionally substituted by R71 and refers within the meaning of this invention, in a special facet (facet 1) according to the present invention, to a monocyclic 3- to 7-membered fully saturated heterocyciic ring radical comprising one nitrogen atom and optionally one further heteroatom selected from the group consisting of oxygen, nitrogen and sulfur.
- Hetl can be bonded to the phenyl moiety of the 6- phenylphenanthridine backbone, in one facet (facet 1a) of this invention, via a ring carbon atom or, in particular, in another facet (facet 1a'), via a ring nitrogen atom. Yet more precisely, Hetl is optionally substituted by R71 on a ring nitrogen or ring carbon atom.
- Hetl may include, without being restricted thereto, aziridinyl, azetidinyl, pyrrolidinyi, piperidinyl, ho- mopiperidinyl, morpholinyl, thiomorpholinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, pyrazolidinyl, imidazolidinyl, piperazinyl or homopiperazinyl.
- Hetl may include according to facet 1a, without being restricted thereto, piperidin-3-yl, morpholin-3-yl or piperidin-4-yI.
- Hetl may in particular include according to facet 1a', without being restricted thereto, aziridin-1-yl, azetidin-1-yl, pyrrolidin-1-yl, piperidin-1-yl, homopiperidin-1-yl, pyra- zolidin-1-yl, piperazin-1-yl, homopiperazin-1-yl, morphoIin-4-yl or thiomorpholin-4-yl.
- Hetl As further examples for Hetl according to this invention may be mentioned, without being restricted thereto, R71 -substituted derivatives of the abovementioned exemplary Hetl radicals, notably, for example, Hetl radicals, which are substituted by R71 on a ring nitrogen atom and which are selected from a group consisting of pyrazolidinyl, piperazinyl, homopiperazinyl and piperidinyl.
- Hetl includes, without being restricted thereto, morpholin-4-yl, thiomor- pholin-4-yl, 4-N-(R71)-piperazin-1-yl or 4-N-(R71)-homopiperazin-1-yl.
- Hetl radicals may be mentioned, for example, without being restricted thereto, morpholin- -yl or 4-N-methyl-piperazin-1-yl.
- Het2 is optionally substituted by R72 and stands for a monocylic 5- to 7-membered saturated or unsaturated heterocyciic ring radical, which comprises one nitrogen atom and optionally one or two further heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur, and to which ring one or two oxo substituents are bonded.
- Het2 can be bonded to the phenyl moiety of the 6- phenylphenanthridine backbone, in one facet (facet 2a) of this invention, via a ring carbon atom or, in another facet (facet 2a'), via a ring nitrogen atom. Yet more precisely, Het2 is optionally substituted by R72 on a ring nitrogen or ring carbon atom.
- Het2 is optionally substituted by R72 and stands for a monocylic 5- to 7-membered fully saturated heterocyciic ring radical, which comprises one nitrogen atom and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, such as, for example, one of the 5- to 7-membered heterocyciic rings Hetl according to facet 1 mentioned exemplarily above, and to which ring one or two oxo substituents are bonded.
- Het2 may include according to this detail 2A, without being restricted thereto, 1,4-diazepan-5-onyl, piperidin-2-onyl, piperidin-4-onyl, piperazin-2-onyl, pyrrolidin-2-onyl, imidazolidin-2-onyl, glutarimidyl or succinimidyl.
- Het2 is optionally substituted by R72 and stands for a monocylic 5- to 7-membered fully unsaturated (heteroaromatic) ring (heteroaryl) radical, which comprises one nitrogen atom and optionally one or two further heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur, such as, for example, one of the heteroaryl rings Har1 or Har2 mentioned exemplarily below, and to which ring one oxo substituent is bonded.
- heteroaryl monocylic 5- to 7-membered fully unsaturated (heteroaromatic) ring (heteroaryl) radical, which comprises one nitrogen atom and optionally one or two further heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur, such as, for example, one of the heteroaryl rings Har1 or Har2 mentioned exemplarily below, and to which ring one oxo substituent is bonded.
- Het2 may include according to this detail 2B, without being restricted thereto, 1 ,2,4-triazol-3-onyl,
- Het2 As further examples for Het2 according to this invention may be mentioned, without being restricted thereto, R72-substituted derivatives of the abovementioned exemplary Het2 radicals according to details 2A or 2B.
- keto and enol functions can hereby mutually exchange in equilibrium.
- This invention includes in this context both the stable keto and the stable enol forms of the compounds according to this invention, as well as the mixtures thereof in any mixing ratio.
- Har1 is optionally substituted by R73 and stands for a monocyclic 5-membered fully unsaturated (heteroaromatic) heterocyciic ring (heteroaryl) radical comprising one to four heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur.
- heteroaryl monocyclic 5-membered fully unsaturated (heteroaromatic) heterocyciic ring (heteroaryl) radical comprising one to four heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur.
- Harl is optionally substituted by R73 and refers within the meaning of this invention, in a special facet (facet 3) according to the present invention, to a monocyclic 5-membered fully unsaturated (heteroaromatic) heterocyciic ring radical comprising one nitrogen atom and optionally up to three further heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur.
- facet 3 to a monocyclic 5-membered fully unsaturated (heteroaromatic) heterocyciic ring radical comprising one nitrogen atom and optionally up to three further heteroatoms, each of which is selected from the group consisting of nitrogen, oxygen and sulfur.
- Harl can be bonded to the phenyl moiety of the 6- phenylphenanthridine backbone, in one facet (facet 3a) of this invention, via a ring carbon atom or, in another facet (facet 3a'), via a ring nitrogen atom. Yet more precisely, Harl is optionally substituted by R73 on a ring nitrogen or ring carbon atom.
- Harl may include, without being restricted thereto, furanyl, thiophenyl, pyrrolyl, oxazoiyl, isoxazolyl, thiazolyl, isothiazolyl, imidazolyl, pyrazolyl, triazolyl (more detailed: 1,2,4-triazolyl or 1,2,3-triazolyl), thiadiazolyl (more detailed: 1 ,3,4-thiadiazolyl, 1 ,2,5-thiadiazolyl, 1 ,2,3-thiadiazolyl or 1 ,2,4- thiadiazolyl), oxadiazolyl (more detailed: 1 ,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1 ,2,3-oxadiazolyl or 1,2,4-oxadiazolyl) or tetrazolyl.
- Harl radicals may include, without being restricted thereto, imidazolyl, pyrrolyl, pyrazolyl, tetrazolyl, thiadiazolyl, thiazolyl, oxazoiyl, triazolyl or oxadiazolyl.
- Harl may be mentioned, without being restricted thereto, R73-substituted derivatives of the abovementioned exemplary Harl radicals.
- Harl radicals may include, without being restricted thereto, pyrraH-yl, imi- dazol-1-yl, pyrazol-1-yl, 1,2,4-triazoM-yl, 2H-tetrazol-5-yl, oxazol-5-yl, thiazol-4-yl, 1,2,3-thiadiazol-4- yl, 1,2,4-oxadiazol-3-yl or 1 ,3,4-oxadiazol-2-yl, or the R73-substituted derivatives thereof, such as e.g.
- Harl radicals may be mentioned, for example, without being restricted thereto, tetrazolyl, thiadiazolyl or imidazolyl, or, more detailed, 2H-tetrazol-5-yl, 1,2,3- thiadiazol-4-yl or imidazol-1-yl, or the R73-subst ' rtuted derivatives thereof.
- Harl radicals may be mentioned, for example, without being restricted thereto, tetrazolyl, thiadiazolyl (such as particularly 1 ,2,3-thiadiazolyl), imidazolyl, thiazolyl, oxazoiyl, triazolyl (such as particularly 1 ,2,4-triazolyl) or oxadiazolyl (such as particularly 1,2,4-oxadiazolyl), or, more detailed, 2H-tetrazol-5-yl, 1,2,3-thiadiazol-4-yl, imidazol-1-yl, thiazol-4-yl, oxazol-5-yl, 1,2,4- triazol-1-yl, or 1,2,4-oxadiazol-3-yl, or the R73-substituted derivatives thereof.
- Harl radicals may be mentioned, for example, without being restricted thereto, 2-propyl-2H-tetrazol-5-yl, 2-ethyl-2H-tetrazol-5-yl, 1 ,2,3-thiadiazol-4-yl or imidazol-1- yi-
- 2-(1-4C-alkyl)-2H-tetrazol-5-yl such as e.g. 2-propyl-2H-tetrazol-5-yl or 2-ethyl-2H- tetrazol-5-yl, 1 ,2,3-thiadiazol-4-yl, imidazol-1-yl, 2-(1-4C-alkyl)-thiazol-4-yl such as e.g.2-methyl- thiazol-4-yl, oxazol-5-yl, 1,2,4-triazol-1-yl, or 5-(1-4C-alkyl)-1,2,4-oxadiazol-3-yl such as e.g.5-methyl- 1 ,2,4-oxadiazol-3-yl.
- 2-(1-4C-alkyl)-2H-tetrazol-5-yl such as e.g. 2-propyl-2H-tetrazol-5-yl or 2-ethyl-2H- tetrazol-5-yl,
- Het3 is optionally substituted by R74 and stands for a monocyclic 5- or 6-membered partially unsaturated heterocyciic ring radical comprising one nitrogen atom and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur.
- Het3 is bonded to the phenyl moiety of the 6- phenylphenanthridine backbone via a ring carbon atom.
- Het3 is optionally substituted by R74 on a ring nitrogen or ring carbon atom.
- Het3 may include without being restricted thereto, 2-imidazolinyl, 2-oxazolinyl, 2-thiazolinyl, 2- pyrrazolinyl or 1-pyrrolinyl.
- Harl may include, without being restricted thereto, 2-imidazolin-2-yl, 2-oxazolin- 2-yl, 2-thiazolin-2-yl or 1-pyrrolin-2-yl.
- Het3 may be mentioned, without being restricted thereto, R74-substituted derivatives of the abovementioned exemplary Het3 radicals.
- Het3 radicals may include, without being restricted thereto, 2-imidazolin-2- yl, or the R74-substituted derivatives thereof, such as e.g. 1-methyl-4,5-dihydro-1H-imidazol-2-yl.
- Har2 is optionally substituted by R75 and/or R76 and stands for a monocyclic 6-membered fully unsaturated (heteroaromatic) heterocyciic ring (heteroaryl) radical comprising one to three, in particular one or two, nitrogen atoms.
- Har2 is bonded to the phenyl moiety of the 6- phenylphenanthridine backbone via a ring carbon atom.
- Har2 is optionally substituted by R75 and/or R76 on a ring carbon atom.
- Har2 may include, without being restricted thereto, pyridinyl, pyrimidinyl, pyrazinyl or pyridazinyl. As further examples for Har2 may be mentioned, without being restricted thereto, R75- and/or R76- substituted derivatives of the abovementioned exemplary Har2 radicals.
- Har2 radical may be mentioned, for example, without being restricted thereto, pyrimidinyl, or, more specifically, pyrimidin-2-yl, or the R75- and/or R76-substituted derivatives thereof.
- Har2 radical may be mentioned, for example, without being restricted thereto, 4,6-dimethoxy-pyrimidin-2-yl.
- compounds comprising nitrogen atoms can be form N- oxides.
- N-oxide(s) as used in this invention therefore encompasses all possible, and in particular all stabile, N-oxide forms, such as mono-N-oxides, bis-N-oxides or multi-N-oxides, or mixtures thereof in any mixing ratio.
- Possible salts for compounds of the formula I -depending on substitution- are all acid addition salts or all salts with bases. Particular mention may be made of the pharmacologically tolerable salts of the inorganic and organic acids and bases customarily used in pharmacy. Those suitable are, on the one hand, water-insoluble and, particularly, water-soluble acid addition salts with acids 'such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, acetic acid, citric acid, D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulfosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulfonic acid, methanesulfonic acid or 3-hydroxy-2-naphthoic acid,
- salts with bases are also suitable.
- examples of salts with bases which may be mentioned are alkali metal (lithium, sodium, potassium) or calcium, aluminum, magnesium, titanium, ammonium, meglumine or guanidinium salts, where here too the bases are employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.
- Pharmacologically intolerable salts which can initially be obtained, for example, as process products in the preparation of the compounds according to the invention on an industrial scale are converted into pharmacologically tolerable salts by processes known to the person skilled in the art.
- the compounds according to the invention and their salts when they are isolated, for example, in crystalline form, can contain various amounts of solvents.
- the invention therefore also comprises all solvates and in particular all hydrates of the compounds of the formula I, and also all solvates and in particular all hydrates of the salts of the compounds of the formula I.
- the substituents R6 and R7 of compounds of formula I can be attached in the ortho, meta or para position with respect to the binding position in which the 6-phenyl ring is bonded to the phenanthridine ring system, whereby, in one embodiment, preference is given to the attachement in the meta or, particularly, in the para position; in another embodiment, preference is given to the attachement of R7 in the meta or para position; and, in yet another embodiment, preference is given to the attachement of R7 in the meta or para position and R6 is hydrogen.
- phenyl radicals substituted by R6 and R7 which may be mentioned are the radicals 4-(2-propyl-2H-tetrazol-5-yl)-phenyl, 4-(2-ethyl-2H-tetrazol-5-yl)-phenyl, 4-(1,2,3-thiadiazol-4-yl)- phenyl, 4-(4,6-dimethoxy-pyrimidin-2-yl)-phenyl, 4-(morpholin-4-yl)-phenyl, 4-(4-methyl-piperazin-1- yl)-phenyl, 4-(imidazol-1-yI)-phenyl, 4-(pyrrol-1-yl)-phenyl, 3-(2-ethyl-2H-tetrazol-5-yl)-phenyl, 4- (pyrazol-l-yl)-phenyl, 4-(1 ,2,4-triazol-1-yl)-phenyl, 4-(oxazol-5-yl)-phenyl,
- R1 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R2 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R3 is hydrogen
- R31 is hydrogen, either, in a first embodiment (embodiment a) according to the present invention,
- R4 is -0-R41 , in which
- R41 is hydrogen or 1-4C-alkylcarbonyl
- R5 is hydrogen, or, in a second embodiment (embodiment b) according to the present invention,
- R4 is hydrogen
- R5 is -0-R51 , in which
- R51 is hydrogen or 1-4C-alkyIcarbonyl
- R6 is hydrogen, halogen, 1-4C-alkyl or 1-4C-alkoxy
- R7 is Hetl , Het2, Harl , Het3 or Har2, in which
- Hetl is optionally substituted by R71 and is a monocylic 3- to 7-membered fully saturated heterocyciic ring radical comprising one to three heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, in which
- R71 is 1-4C-alkyl, 1-4C-alkoxy, or completely or partially fluorine-substituted 1-4C-alkyl,
- Het2 is optionally substituted by R72 and is a monocylic 5- to 7-membered saturated or unsaturated heterocyciic ring radical, which comprises one nitrogen atom and optionally one or two further heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, and to which ring one or two oxo substituents are bonded, in which
- R72 is 1 -4C-alkyl, or completely or partially fluorine-substituted 1 -4C-alkyl,
- Harl is optionally substituted by R73 and is a monocyclic 5-membered fully unsaturated heterocyciic ring radical comprising one to four heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, in which
- R73 is 1-4C-alkyl, 1-4C-alkoxy, or completely or partially fluorine-substituted 1 -4C-alkyl
- Het3 is optionally substituted by R74 and is a monocyclic 5- or 6-membered partially unsaturated heterocyciic ring radical comprising one nitrogen atom and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, in which
- R74 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-4C-alkyl
- Har2 is optionally substituted by R75 and/or R76 and stands for a monocyclic 6-membered fully unsaturated heterocyciic ring radical comprising one to three nitrogen atoms, in which
- R75 is 1-4C-alkyl, 1-4C-alkoxy, 1-4C-alkylthio, halogen, hydroxyl, amino, mono- or di-1-4C- alkylamino, or completely or partially fluorine-substituted 1-4C-aIkyl,
- R76 is 1 -4C-alkoxy, 1 -4C-alkylthio, hydroxyl, amino or mono- or di-1 -4C-alkylamino, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R2 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which
- R41 is 1-4C-alkylcarbonyl or, in particular, in an individual embodiment according to this invention, hydrogen,
- R5 is hydrogen
- R6 is hydrogen
- R7 is Hetl , Harl , Het3 or Har2, in which
- Hetl is optionally substituted by R71 and is a monocylic 3- to 7-membered fully saturated heterocyciic ring radical comprising one nitrogen atom and optionally one or two further heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, in which
- R71 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-4C-alkyl
- Harl is optionally substituted by R73 and is a monocyclic 5-membered fully unsaturated heterocyciic ring radical comprising one nitrogen atom and optionally up to three further heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, in which
- R73 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-4C-alkyl
- Het3 is optionally substituted by R74 and is a monocyclic 5-membered partially unsaturated heterocyciic ring radical comprising one nitrogen atom and one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, in which
- R74 is 1 -4C-alkyl, or completely or partially fluorine-substituted 1 -4C-alkyl,
- Har2 is optionally substituted by R75 and/or R76 and stands for a monocyclic 6-membered fully unsaturated heterocyciic ring radical comprising one or two nitrogen atoms, in which R75 is 1-4C-alkyl, 1-4C-alkoxy, 1 -4C-alkyithio, halogen, hydroxyl, amino, mono- or di-1-4C- alkylamino, or completely or partially fluorine-substituted 1-4C-alkyl, R76 is 1-4C ⁇ alkoxy, 1-4C-alkylthio, hydroxyl, amino or mono- or di-1-4C-alkylamino, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1 -2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R2 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41 , in which
- R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is Hetl , Harl , Het3 or Har2, in which
- Hetl is pyrrolidin-1-yl, piperidin-1 -yl, morpholin-4-yl orthiomorpholin-4-yl, or4-N-(R71)-piperazin-1-yl or4-N-(R71)-homopiperazin-1-yl, in which
- R71 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-2C-alkyl,
- Harl is optionally substituted by R73 and is a monocyclic 5-membered fully unsaturated heterocyciic ring radical comprising one nitrogen atom and optionally up to three further heteroatoms selected independently from the group consisting of nitrogen, oxygen and sulfur, in which
- R73 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-2C-alkyl,
- Het3 is 1-N-(R74)-4,5-dihydro-1H-imidazol-2-yl, in which
- R74 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-2C-alkyl,
- Har2 is optionally substituted by R75 and/or R76 and stands for a monocyclic 6-membered fully unsaturated heterocyciic ring radical comprising one or two nitrogen atoms, in which
- R75 is 1-2C-alkyl, 1-4C-alkoxy, mono- or di-1-2C-alkylamino, or completely or partially fluorine- substituted 1-2C-alkyl,
- R76 is 1-4C-alkoxy or mono- or di-1-2C-alkylamino, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 1 -2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which
- R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is Har2, in which
- Har2 is optionally substituted by R75 and/or R76 and stands for a monocyclic 6-membered fully unsaturated heterocyciic ring radical comprising one or two nitrogen atoms, in which
- R75 is 1-2C-alkyl, 1-4C-alkoxy, mono- or di-1-2C-alkylamino, or completely or partially fluorine- substituted 1-2C-alkyl,
- R76 is 1-4C-alkoxy or mono- or di-1-2C-alkylamino, and the enantiomers, as well as the salts, the N-oxides and the salts of the N-oxides of these compounds and enantiomers.
- R1 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41 , in which R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is Hetl , Harl , Het3 or Har2, in which Hetl is pyrrolidin-1-yl, piperidin-1-yl, morpholin-4-yl or thiomorpholin-4-yl, or 4-N-(R71)-piperazin-1-yl or4-N-(R71)-homopiperazin-1-yl, in which R71 is 1 -4C-alkyl, or completely or partially fluorine-substituted 1 -2C-alkyl, Harl is optionally substituted by R73 and is pyrrolyl, imidazolyl, pyrazolyl, 1 ,2,4-triazolyl, tetrazolyl, oxazoiyl, thiazolyl, 1,2,3-thiadiazolyl, 1,2,4-oxadiazolyl or 1 ,3,4-oxadiazolyl, in which R73 is 1 -4C-alkyl, or completely or partially fluorine-substit
- R1 is 1 -2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41 , in which R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 Har2 in which
- Har2 is optionally substituted by R75 and/or R76 and is pyridinyl or pyrimidinyl, in which R75 is 1-4C-alkoxy, R76 is 1-4C-alkoxy, and the enantiomers, as well as the salts, the N-oxides and the salts of the N-oxides of these compounds and enantiomers.
- R1 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 1 -2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41 , in which R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is Hetl , Harl , Het3 or Har2, in which Hetl is morpholin-4-yl or thiomorpholin-4-yl, or 4-N-(R71 )-piperazin-1 -yl or 4-N-(R71 )-homopiperazin- 1-yl, in which R71 is 1 -4C-alkyl, or completely or partially fluorine-substituted 1 -2C-alkyl, Harl is optionally substituted by R73 and is py ⁇ Olyl, imidazolyl, pyrazolyl, 1 ,2,4-triazolyl, oxazoiyl, thiazolyl, 1,2,3-thiadiazolyl, 1,2,4-oxadiazolyl or 1,3,4-oxadiazolyl, in which R73 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-2C-alkyl, Het3 is 1-N-(R74)-4,5-d
- R1 and R2 are methoxy, and the other is methoxy, ethoxy, difluoromethoxy or 2,2- difluoroethoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is Hetl , Harl or Har2, in which
- Hetl is morpholin-4-yl or 4-N-(R71)-piperazin-1-yl, in which R71 is 1-4C-alkyl;
- Harl is optionally substituted by R73 and is 2H-tetrazol-5-yl, 1 ,2,3-thiadiazol-4-yl, imidazol-1-yl, thia- zol- -yl, oxazol-5-yl, 1,2,4-triazoH-yl, or 1,2,4-oxadiazol-3-yl, in which R73 is 1-4C-alkyl, such as, for example, 2-(1-4C-alkyl)-2H-tetrazol-5-yl such as e.g.2-propyl-2H-tetrazol-5-yl or 2- ethyI-2H-tetrazol-5-yl, 1,2,3-thiadiazol-4-yl, imidazol-1-yl, 2-(1-4C-alkyl)-thiazol-4-yl such as e.g.
- Har2 is optionally substituted by R75 and/or R76 and is pyridinyl or pyrimidinyl, in which R75 is 1-4C-alkoxy, R76 is 1-4C-alkoxy, such as, for example, 4,6-dimethoxy-pyrimidin-2-yl;
- R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is Har2, in which
- Har2 is optionally substituted by R75 and/or R76 and is pyridinyl or pyrimidinyl, in which
- R75 is 1-4C-alkoxy
- R76 is 1-4C-alkoxy, such as, for example, 4,6-dimethoxy-pyrimidin-2-yl; and the enantiomers, as well as the salts, the N-oxides and the salts of the N-oxides of these compounds and enantiomers.
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41 , in which
- R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is Harl or Har2, in which
- Harl is optionally substituted by R73 and is 1 ,2,3-thiadiazol-4-yl, imidazol-1-yl, thiazol-4-yl, oxazol-5- yl, 1,2,4-triazoH-yl, or 1 ,2,4-oxadiazol-3-yl, in which
- R73 is 1-4C-alkyl, such as, for example, 1,2,3-thiadiazol-4-yl, imidazol-1-yl, 2-(1-4C-alkyl)-thiazol-4-yl such as e.g. 2-methyl-thiazol-4-yl, oxazol-5-yl, 1,2,4-triazol-l-yl, or 5-(1-4C-alkyl)-1,2,4-oxadiazol-3-yl such as e.g.5-methyl-1 ,2,4-oxadiazol-3-yl;
- Har2 is optionally substituted by R75 and/or R76 and is pyridinyl or pyrimidinyl, in which
- R75 is 1-4C-alkoxy
- R76 is 1-4C-alkoxy, such as, for example, 4,6-dimethoxy-pyrimidin-2-yl; and the enantiomers, as well as the salts, the N-oxides and the salts of the N-oxides of these compounds and enantiomers.
- R1 is methoxy, or ethoxy
- R2 is methoxy, ethoxy, difluoromethoxy, or 2,2-difluoroethoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which
- R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R7 is bonded to the meta or para position with respect to the binding position in which the phenyl ring is bonded to the phenanthridine ring system, and is Hetl , Harl or Har2, in which
- Hetl is morpholin-4-yl or 4-N-(R71 )-piperazin-1-yl, in which R71 is methyl;
- Harl is 2-(1-4C-alkyl)-2H-tetrazol-5-yl such as e.g.2-propyl-2H-tetrazol-5-yl or 2-ethyl-2H-tetrazol-5- yl, 1 ,2,3-thiadiazol-4-yl, imidazol-1-yl, 2-methyl-thiazol-4-yl, oxazol-5-yl, 1,2,4-triazol-l-yl, or 5- methyl-1 ,2,4-oxadiazol-3-yl;
- Har2 is optionally substituted by R75 and/or R76 and is pyridinyl or pyrimidinyl, in which R75 is methoxy, R76 is methoxy, such as, for example, 4,6-dimethoxy-pyrimidin-2-yl;
- R1 is methoxy
- R2 s methoxy, ethoxy, difluoromethoxy, or 2,2-difluoroethoxy
- R31 is hydrogen
- R5 is hydrogen
- R7 s bonded to the meta or para position with respect to the binding position in which the phenyl ring is bonded to the phenanthridine ring system, and is Hetl, Harl or Har2, in which
- Hetl is morpholin-4-yl or 4-N-(R71 )-piperazin-1-yl, in which R71 is methyl; Harl is 2-(1-4C-alkyl)-2H-tetrazol-5-yl such as e.g.2-propyl-2H-tetrazol-5-yl or 2-ethyl-2H-tetrazol-5- yl, 1,2,3-thiadiazol-4-yl, imidazol-1-yl, 2-methyl-thiazol-4-yl, oxazol-5-yl, 1,2,4-triazol-l-yl, or 5- methyl-1 ,2,4-oxadiazol-3-yl;
- Har2 is optionally substituted by R75 and/or R76 and is pyridinyl or pyrimidinyl, in which R75 is methoxy, R76 is methoxy, such as, for example, 4,6-dimethoxy-pyrimidin-2-yl; and the enantiomers, as well as the salts, the N-oxides and the salts of the N-oxides of these compounds and enantiomers.
- a special interest in the compounds according to this invention relates to those compounds which are included -within the meaning of the present invention- by one or, when possible, by more of the following embodiments:
- a special embodiment of the compounds of the present invention include those compounds of formula I in which R1 and R2 are independently 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 and R2 are independently 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 and R2 are independently 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy, and R3, R31 and R6 are all hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which one of R1 and R2 is methoxy, and the other is methoxy, ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is ethoxy or, particularly, methoxy, and R2 is methoxy, or, particularly, ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is methoxy, ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another spedal embodiment of the compounds of the present invention include those compounds of formula I in which one of R1 and R2 is 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is ethoxy or, particularly, methoxy, and R2 is 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is ethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is difluoromethoxy, and R3 and R31 are both hydrogen.
- R5 or, particularly, R4 is the radical (1-4C-alkylcarbonyl)-0- such as e.g. acetoxy, or hydroxyl, and all the other substituents are as defined in any compound which is said to be mentioned above.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R5 or, particularly, R4 is hydroxyl.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R6 is hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R7 is Harl, Har2 or Het3. Another special embodiment of the compounds of the present invention include those compounds of formula I in which R7 is Har2.
- a preferred embodiment according to the present invention is embodiment a.
- a further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 and R41 are both hydrogen, and in which R1 and R2 are independently 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C- alkoxy, and R3, R31 and R6 are all hydrogen.
- a yet further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 is hydrogen, and in which R1 is methoxy, and R2 is ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3, R31 and R6 are all hydrogen.
- a still yet further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 and R41 are both hydrogen, and in which R1 is methoxy, and R2 is ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3, R31 and R6 are all hydrogen.
- Suitable compounds according to the present invention include those compounds of formula I, in which R5 or, particularly, R4 is hydroxyl.
- Exemplary compounds according to the present invention may include those selected from
- the compounds according to the present invention which are listed in the Table A in the appended "Biological Investigations” and, particulariy, the enantiomers thereof, particularly those having the formula la*****, as well as the salts of these compounds and enantiomers, are to be mentioned as a particular interesting aspect of the present invention.
- the compounds of formula I are chiral compounds having chiral centers at least in positions 4a and 10b and depending on the meanings of R3, R31 , R4 and R5 additional chiral centers in positions 1 , 2, 3 and 4. Numbering
- the invention includes all conceivable stereoisomers in pure form as well as in any mixing ratio. Preference is given to compounds of formula I in which the hydrogen atoms in po-sitions 4a and 10b are in the cis position relative to one another.
- the pure cis enantiomers and their mixtures in any mixing ratio and including the racemates are more preferred in this context.
- Preferred compounds of the formula I according to embodiment b are those which have, with respect to the positions 3, 4a and 10b, the same configuration as shown in the formulae lb** and lb*** and
- More preferred compounds of the formula I according to embodiment b are those which have, with respect to the positions 3, 4a and 10b, the same configuration as shown in the formula lb*****:
- the enantiomers can be separated in a manner known per se (for example by preparation and separation of appropriate diastereoisomeric compounds).
- an enantiomer separation can be carried out at the stage of the starting compounds having a free amino group such as starting compounds of formulae IVa or Vllb as defined below.
- Separation of the enantiomers can be carried out, for example, by means of salt formation of the racemic compounds of the formulae IVa or Vllb with optically active acids, preferably carboxylic acids, subsequent resolution of the salts and release of the desired compound from the salt.
- optically active acids preferably carboxylic acids
- optically active carboxylic acids which may be mentioned in this connection are the enantiomeric forms of mandelic acid, tartaric acid, 0,0'-dibenzoyltartaric acid, camphoric acid, quinic acid, glutamic acid, pyroglutamic acid, malic acid, camphorsulfonic acid, 3-bromocamphorsulfonic acid, ⁇ -methoxyphenylacetic acid, ⁇ -methoxy- ⁇ -trifluoromethylphenylacetic acid and 2-phenylpropionic acid.
- enantiomerically pure starting compounds of the formulae IVa or Vllb can be prepared via asymmetric syntheses.
- Enantiomerically pure starting compounds as well as enantiomeri- cally pure compounds of the formula I can be also obtained by chromatographic separation on chiral separating columns; by derivatization with chiral auxiliary reagents, subsequent diastereomer separation and removal of the chiral auxiliary group; or by (fractional) crystallization from a suitable solvent.
- the compounds according to the invention can be prepared, for example, as shown in the reaction schemes below and according to the following specified reaction steps, or, particularly, in a manner as described by way of example in the following examples, or analogously or similarly thereto according to preparation procedures or synthesis strategies known to the person skilled in the art.
- the nitro group of compounds of the formula Va in which R1, R2, R3, R31, R41 and R5 have the meanings mentioned above in embodiment a whereby R41 is other than hydrogen, is reduced to the amino group of the corresponding compounds of the formula IVa.
- Said reduction is carried out in a manner known to the person skilled in the art, for example as described in J. Org. Chem. 1962, 27, 4426 or as described in the following examples.
- the reduction can be carried out, for example, by catalytic hy- drogenation, e.g.
- the reduction is carried out using a hydrogen- producing mixture, for example, metals such as zinc, zinc-copper couple or iron with organic acids such as acetic acid or mineral acids such as hydrochloric acid. More preferably, the reduction is carried out using a zinc-copper couple in the presence of an organic or an inorganic acid.
- a zinc- copper couple is accessible in a way known to the person of ordinary skill in the art.
- compounds of the formula Ila can also be prepared from the corresponding compounds of the formula IVa and corresponding compounds of the formula III, in which X is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art.
- amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodi- imides (e.g. dicyclohexylcarbodiimide or, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), azodicarboxylic acid derivatives (e.g. diethyl azodicarboxylate), uronium salts [e.g.
- amide bond linking reagents are uronium salts and, particularly, carbodiimides, preferably, 1 -ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride.
- Said cyclocondensation reaction is carried out in a manner known per se to the person skilled in the art or as described by way of example in the following examples, according to Bischler-Napieralski (e.g. as described in J. Chem. Soc, 1956, 4280-4282) in the presence of a suitable condensing agent, such as, for example, polyphosphoric acid, phosphorus pentachloride, phosphorus pentoxide or phosphorus oxychloride, in a suitable inert solvent, e.g.
- said cydocondensation reaction can be carried out in the presence of one or more suitable Lewis Acids such as, for example, suitable metal halogenides (e.g. chlorides) or sulphonates (e.g. triflates), including rare earth metal salts, such as e.g. anhydrous aluminum trichloride, aluminum tribromide, zinc chloride, boron trifluoride ethereate, titanium tetrachloride or, in particular, tin tetrachloride, and the like.
- suitable Lewis Acids such as, for example, suitable metal halogenides (e.g. chlorides) or sulphonates (e.g. triflates), including rare earth metal salts, such as e.g. anhydrous aluminum trichloride, aluminum tribromide, zinc chloride, boron trifluoride ethereate, titanium tetrachloride or, in particular, tin tetrachloride, and the like.
- Suitable reducing agents for the above- mentioned reduction reaction may include, for example, metal hydride compounds such as, for example, diisopropylaluminium hydride, borane, sodium borohydride, sodium triacetoxyborohydride, sodium cyanoborohydride, zinc borohydride, potassium tri-sec-butylborohydride, sodium tri-sec- butylborohydride, lithium tri-sec-butylborohydride, ⁇ -isopinocampheyl-9-borabicyclo[3.3.1]nonane and the like.
- metal hydride compounds such as, for example, diisopropylaluminium hydride, borane, sodium borohydride, sodium triacetoxyborohydride, sodium cyanoborohydride, zinc borohydride, potassium tri-sec-butylborohydride, sodium tri-sec- butylborohydride, lithium tri-sec-butylborohydride, ⁇ -isopinocampheyl-9-borabicyclo[3.3.1]
- the preferred examples of said reducing agents are sodium cyanoborohydride, ⁇ - isopinocampheyl-9-borabicyclo[3.3.1]nonane and potassium tri-sec-butylborohydride.
- the most preferred examples of the abovementioned reducing agents are ⁇ -isopinocampheyl-9- borabicyclo[3.3.1]nonane and potassium tri-sec-butylborohydride, which both allow to prepare compounds of the formula Via stereoselectively.
- “Stereoselectively" in this connection means that those compounds of the formula Via, in which the hydrogen atoms in positions 1 and 3 are located at the opposite side of the plane defined by the cyclohexane ring, are obtained preferentially.
- the compounds of the formula Vila in which R1, R2, R3, R31 and R5 have the meanings mentioned in embodiment a, are either known or can be obtained by the reaction of compounds of the formula IXa, in which R1 and R2 have the meanings mentioned above, with compounds of the formula Villa, in which R3, R31 and R5 have the meanings mentioned above in embodiment a.
- the cydoaddition reaction is carried out in a manner known to the person skilled in the art according to Diels-Alder, e.g. as described in J. Amer. Chem. Soc. 1957, 79, 6559 or in J. Org. Chem. 1952, 17, 581 or as described in the following examples.
- the reduction can be carried out, for example, by contacting compounds of the formula Vlllb with a hydrogen-producing mixture such as, preferably, metallic zinc in a mildly acidic medium such as acetic acid in a lower alcohol such as methanol or ethanol at room temperature or at elevated temperature or, preferably, at the boiling temperature of the solvent mixture.
- a hydrogen-producing mixture such as, preferably, metallic zinc in a mildly acidic medium such as acetic acid in a lower alcohol such as methanol or ethanol at room temperature or at elevated temperature or, preferably, at the boiling temperature of the solvent mixture.
- the reduction can be carried out by selective reduction of the nitro group in a manner known to the person skilled in the art, fbr example by hydrogen transfer reaction in the presence of a metal catalyst, for example palladium or preferably Raney nickel, in a suitable solvent, preferably a lower alcohol, using, fbr example ammonium formiate or preferably hydrazine hydrate as hydrogen donor.
- compounds of the formula Vlb in which R1, R2, R3, R31, R4, R6 and R7 have the meanings given above in embodiment b, can also be prepared, for example, from corresponding compounds of the formula Vllb and corresponding compounds of the formula III, in which X is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art.
- amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodiimides (e.g.
- azodicarboxylic acid derivatives e.g. diethyl azodi- carboxylate
- uronium salts e.g. 0-(benzotriazol-1-yl)-N,N,N',N'-tetramethyl
- preferred amide bond linking reagents are uronium salts and, particularly, carbodiimides, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride.
- compounds of the formula Vlb are converted into corresponding compounds of the formula Vb by epoxidation reaction, which can be carried out as described in the following examples or in a manner known to one of ordinary skill in the art employing, for example, suitable epoxidation methods or suitable epoxidation reagents such as, for example, peracids (e.g. m-chloroperbenzoic acid) or organic or inorganic peroxides (e. g. dimethyldioxirane, hydrogene peroxide or persulfates).
- suitable epoxidation methods or suitable epoxidation reagents such as, for example, peracids (e.g. m-chloroperbenzoic acid) or organic or inorganic peroxides (e. g. dimethyldioxirane, hydrogene peroxide or persulfates).
- compounds of the formula Vb can be converted largely regio- and diastereoselectively into compounds of the formula IVb, wherein the hydroxyl radical in position 1 and the amido radical in position 3 are located at the same side of the plane defined by the cyclohexane ring.
- said inversion of configuration of position 1 of compounds of the formula IVb can be also obtained, for example, as described by way of example in the following examples according to subsequently specified two step procedure shown in reaction scheme 4 below.
- exemplary compounds of the formula IVb* in which R1 , R2, R6 and R7 have the meanings indicated above in embodiment b, and R3, R31 and R4 are hydrogen and position 1 has the R configuration, are converted by oxidation reaction into corresponding compounds of the formula IXb.
- Said oxidation is likewise carried out under conditions customary per se using, for example, chloranil, atmospheric oxygen, manganese dioxide or, preferably, chromium oxides as an oxidant.
- compounds of the formula IXb obtained are converted by art-known reduction reaction of the keto group, preferably with metal hydride compounds or, more specifically, metal borohydrides, such as, for example, sodium borohydride, into corresponding compounds of formula IVb**, in which position 1 has now S configuration and thus the configuration of the carbon atom in position 1 is now inverted regarding to said compounds of the formula IVb * .
- the cycloaddition is in this case carried out in a manner known to the person skilled in the art according to Diels-Alder, e.g. as described in J. Amer. Chem. Soc. 1957, 79, 6559 or in J. Org. Chem. 1952, 17, 581 or as described in the following examples.
- the compounds of the formula Xb are either known or can be prepared in a known manner.
- compounds of the formula lib in which R1, R2, R3, R31, R4, R51, R6 and R7 have the meanings given above in embodiment b whereby R51 is other than hydrogen (particularly compounds of formula lib, in which R1 , R2 and R51 have the meanings given above in embodiment b whereby R51 is other than hydrogen, and R3, R31 and R4 are all hydrogen) can also be obtained as shown in reaction scheme 6 and as described by way of example in the following examples.
- the amino group of compounds of the formula Vllb is protected with an art-known protective group PG1, such as e.g. the tert- butoxycarbonyl group.
- the proteced compounds are subjected to hydroboration reaction to obtain over two steps compounds of formula Xlb.
- Said hydroboration reaction is carried out as described in the following examples using an appropriate (hydro)borating agent, such as e.g. 9-BBN, isopinocampheyl- borane or the like, or, particularly, borane-tetrahydrofuran (H 3 B-THF), advantageously at ambient temperature.
- an appropriate (hydro)borating agent such as e.g. 9-BBN, isopinocampheyl- borane or the like, or, particularly, borane-tetrahydrofuran (H 3 B-THF), advantageously at ambient temperature.
- the compounds obtained are then converted into compounds of the formula Xlb by introduction of the group R51 whereby R51 is other than hydrogen in a manner analogously as described above.
- the product obtained via said hydroboration reaction or, suitably, the R51 -substituted derivative thereof is purified from resulting stereo- and/or regioisomeric side products by methods known to the person skilled in the art, such as e.g. by chromatographic separation techniques.
- the heterocyclyl moiety of the 6- heterocyclylphenyl group of the compounds according to this invention is introduced within the hetero- cyclylbenzoic acid of formula III
- the heterocyclyl moiety can be also introduced or formed, if suitable and necessary, in another step of the synthesis route.
- heterocyclyl moiety of the 6-heterocyclylphenyl group of the compounds according to this invention can be also formed in any suitable level of the synthesis by art-known derivatization of a cyano, carbamoyl, formyl, amino, amidino, ester or amide group or the like resulting in a heterocycle.
- the heterocyclyl moiety can be formed according to the art, such as e.g. according to J. Org. Chem. 1993, 58, 3381-3383; J. Org. Chem. 1993, 58, 2628-2630; J. Med. Chem. 1986, 29, 2174-2183; or Biorg. Med. Chem. 2001, 9, 585-592, the disclosure of these are inco ⁇ orated herein, and as shown in the following reaction scheme 7 or analogously or similarly thereto.
- certain compounds of formula 1 may be also obtained via Buchwald-Hartwig coupling reaction starting from the corresponding bromo-phenyl-phenanthridine compound obtainable analogously as described and a suitable heterocydic compound comprising at least one NH atom.
- compounds of the formula I can be also converted into further compounds of the formula I by methods known to one of ordinary skill in the art. More specifically, for example, from compounds of the formula I in which a) R41 or R51 is hydrogen, the corresponding ester compounds can be obtained by esterification reactions; b) R41 or R51 is hydrogen, the corresponding ether compounds can be obtained by etherification reactions; c) R41 or R51 is an acyl group, such as e.g. acetyl, the corresponding hydroxyl compounds can be obtained by deesterification (e.g. saponification) reactions; d) R75 is chlorine, further compounds of formula I can be obtained via nucleophilic substitution reactions with N, S or O nucleophiles;
- compounds of the formula I can be converted into their salts, or, optionally, salts of the compounds of the formula I can be converted into the free compounds.
- the compounds of the formula I can be converted, optionally, into their N-oxides, for example with the aid of hydrogen peroxide in methanol or with the aid of m-chloroperoxybenzoic acid in dichloromethane.
- the person skilled in the art is familiar on the basis of his/her expert knowledge with the reaction conditions which are specifically necessary for carrying out the N-oxidation.
- the substances according to the invention are isolated and purified in a manner known per se, for example by distilling off the solvent under reduced pressure and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as, for example, column chromatography on a suitable support material. Salts are obtained by dissolving the free compound in a suitable solvent (e.g.
- a ketone such as acetone, methyl ethyl ketone or methyl isobutyl ketone
- an ether such as diethyl ether, tetrahydrofuran or dioxane
- a chlorinated hydrocarbon such as methylene chloride or chloroform
- a low-molecular- weight aliphatic alcohol such as ethanol or isopropanol
- the salts are obtained by filtering, reprecipitating, precipitating with a nonsolvent for the addition salt or by evaporating the solvent. Salts obtained can be converted into the free compounds, which can in turn be converted into salts, by alkalization or by acidification. In this manner, pharmacologically unacceptable salts can be converted into pharmacologically acceptable salts.
- m.p. stands for melting point, h for hour(s), min for minutes, R f for rentention factor in thin layer chromatography, s.p. for sintering point, EF for empirical formula, MW for molecular weight, MS for mass spectrum, M for molecular ion, fnd. for found, calc. for calculated, other abbreviations have their meanings customary per se to the skilled person.
- the symbols RS and SR are used to denote the specific configuration of each of the chiral centers of a racemate.
- (2RS,4aRS,10bRS) stands for a racemate (racemic mixture) comprising the one enantiomer having the configuration (2R,4aR,10bR) and the other enantiomer having the configuration (2S,4aS,10bS).
- reaction mixture is cooled with an ice bath and a mixture of 10 ml of dichloromethane and 10 ml of triethylamine is added, than cautiously 5 ml of water with vigorous strirring, followed by the addition of 5 ml of saturated sodium hydrogencar- bonate solution.
- the organic layer is dried over magnesium sulfate and the crude product purified by flash chromatography to give 851 mg of the title compound.
- CHIRALPAK ® AD 20 ⁇ m (285 x 110 mm), 30 °C, acetonitrile/isopropanol 95:5; 570 ml/min, detection at 250 nm or 280 nm;
- Solution A 55.2 g (180 mmol) of racemic acetic acid (1 RS,3RS,4RS)-4-amino-3-(3-ethoxy-4-methoxy- phenyl)-cyclohexyl ester (compound B1) are dissolved in 540 ml of isopropyl acetate.
- Solution B 18.6 g (144 mmol) of L-pyroglutamic acid are dissolved in 260 ml of isopropanol under heating, then 290 ml of isopropyl acetate is added carefully.
- Solution B is added to solution A and left for 48 hours.
- the solid is filtered off and washed with a little isopropyl acetate to give after drying 32.48 g colorless crystals with a ratio of the enantiomers of 97:3 in favour of the title compound.
- the compounds according to the invention have useful pharmacological properties which make them industrially utilizable.
- selective cyclic nucleotide phosphodiesterase (PDE) inhibitors specifically of type 4
- they are suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action but also on account of their respiratory rate- or respiratory drive-increasing action) and for the removal of erectile dysfunction on account of their vascular dilating action, but on the other hand especially for the treatment of disorders, in particular of an inflammatory nature, e.g.
- the compounds according to the invention are distinguished by a low toxicity, a good enteral absorption (high bioavailability), a large therapeutic breadth and the absence of significant side effects.
- the compounds according to the invention can be employed in human and veterinary medicine as therapeutics, where they can be used, for example, for the treatment and prophylaxis of the following illnesses: acute and chronic (in particular inflammatory and allergen-induced) airway disorders of varying origin (bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD); dermatoses (espe ⁇ ally of proliferative, inflammatory and allergic type) such as psoriasis (vulgaris), toxic and allergic contact eczema, atopic eczema, seborrhoeic eczema,
- acute and chronic airway disorders of varying origin bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD
- dermatoses espe ⁇ ally of proliferative, inflammatory and allergic type
- psoriasis vulgaris
- the compounds of the invention are useful in the treatment of diabetes insipidus and conditions associated with cerebral metabolic inhibition, such as cerebral senility, senile dementia (Alzheimer's disease), memory impairment associated with Parkinson's disease or multiin- farct dementia; and also illnesses of the central nervous system, such as depressions or arterioscle- rotic dementia; as well as for enhancing cognition.
- the compounds of the invention are useful in the treatment of diabetes mellitus, leukaemia and osteoporosis.
- the invention further relates to a method for the treatment of mammals, including humans, which are suffering from one of the above mentioned illnesses.
- the method is characterized in that a therapeutically active and pharmacologically effective and tolerable amount of one or more of the compounds according to the invention is administered to the ill mammal.
- the invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of illnesses, especially the illnesses mentioned.
- the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the illnesses mentioned.
- the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions for treating disorders which are mediated by phosphodiesterases, in particular PDE4-mediated disorders, such as, for example, those mentioned in the specification of this invention or those which are apparent or known to the skilled person.
- the invention also relates to the use of the compounds according to the invention for the manufacture of pharmaceutical compositions having PDE4 inhibitory activity.
- the invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the illnesses mentioned comprising one or more of the compounds according to the invention.
- compositions comprising one or more compounds according to this invention and a pharmaceutically acceptable carrier.
- Said compositions can be used in therapy, such as e.g. for treating, preventing or ameliorating one or more of the abovementioned diseases.
- the invention still yet furthermore relates to pharmaceutical compositions according to this invention having PDE, particularly PDE4, inhibitory activity.
- the invention relates to an article of manufacture, which comprises packaging material and a pharmaceutical agent contained within said packaging material, wherein the pharmaceutical agent is therapeutically effective for antagonizing the effects of the cyclic nucleotide phosphodi- esterase of type 4 (PDE4), ameliorating the symptoms of an PDE4-mediated disorder, and wherein the packaging material comprises a label or package insert which indicates that the pharmaceutical agent is useful for preventing or treating PDE4-mediated disorders, and wherein said phamiaceutical agent comprises one or more compounds of formula 1 according to the invention.
- the packaging material, label and package insert otherwise parallel or resemble what is generally regarded as standard packaging material, labels and package inserts for pharmaceuticals having related utilities.
- compositions are prepared by processes which are known per se and familiar to the person skilled in the art.
- the compounds according to the invention are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, cap- lets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice of the auxiliaries and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
- suitable pharmaceutical auxiliaries and/or excipients e.g. in the form of tablets, coated tablets, capsules, cap- lets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being
- auxiliaries excipients, carriers, vehicles, diluents or adjuvants which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge.
- solvents gel formers, ointment bases and other active compound excipients, for example antioxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
- compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art.
- suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Oral delivery is preferred.
- the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 ⁇ m, advantageously of 2 to 6 ⁇ m.
- Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of micronized active compounds from inhalation capsules.
- the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of metered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
- propellants e.g. Frigen in the case of metered aerosols
- surface-active substances e.g. Frigen in the case of metered aerosols
- emulsifiers emulsifiers
- stabilizers emulsifiers
- preservatives e.g. lactose in the case of powder inhalers
- flavorings e.g. lactose in the case of powder inhalers
- fillers e.g. lactose in the case of powder inhalers
- further active compounds e.g. lactose in the case of powder inhalers
- Nebulator®, Volumatic®), and automatic devices emitting a puffer spray for metered aerosols, in particular in the case of powder inhalers, a number of technical solutions are available (e.g. Diskhaler®, Rotadisk®, Turbohaler® or the inhaler described in European Patent Application EP 0 505 321), using which an optimal administration of active compound can be achieved.
- the compounds according to the invention are in particular administered in the form of those pharmaceutical compositions which are suitable for topical application.
- suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
- compositions according to the invention are prepared by processes known per se.
- the dosage of the active compounds is carried out in the order of magnitude customary for PDE inhibitors.
- Topical application forms (such as ointments) for the treatment of dermatoses thus contain the active compounds in a concentration of, for example, 0.1-99%.
- the dose for administration by inhalation is customariy-between 0.01 and 3 mg per day.
- the customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.003 and 3 mg/kg per day.
- the dose for administration by inhalation is between 0.1 and 3 mg per day, and the dose in the case of systemic therapy (p.o. or i.v.) is between 0.03 and 3 mg/kg per day.
- the second messenger cyclic AMP (cAMP) is well-known for inhibiting inflammatory and immuno- competent cells.
- the PDE4 isoenzyme is broadly expressed in cells involved in the initiation and propagation of inflammatory diseases (H Tenor and C Schudt, in intricatePhosphodiesterase Inhibitors", 21- 40, sentThe Handbook of Immunopharmacology", Academic Press, 1996), and its inhibition leads to an increase of the intracellular cAMP concentration and thus to the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000).
- Examples are the su- peroxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991) or eosino- phiiic (A Hatzelmann et al., Brit J Pharmacol 114: 821 -831 , 1995) granulocytes, which can be measured as luminol-enhanced chemiluminescence, or the synthesis of tumor necrosis factor- ⁇ in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121: 221-231, 1997, and Pulmonary Pharmacol Therap 12: 377-386, 1999).
- the PDE4B2 (GB no. M97515) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers Rb9 (5'- GCCAGCGTGCAAATAAT- GAAGG -3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Groningen, NL).
- the recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells.
- the expression plasmid was cotransfected with Bac-N-Blue (Invitrogen, Groningen, NL) or Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg).
- Wt virus-free recombinant virus supernatant was selected using plaque assay methods. After that, high-titre virus supernatant was prepared by amplifying 3 times.
- PDE was expressed in SF21 cells by infecting 2x10 6 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies, Paisley, UK).
- the cells were cultured at 28°C for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000 g and 4°C.
- the SF21 insect cells were resuspended, at a concentration of approx. 10 7 cells/ml, in ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCl, 3.8 mM KCI, 1 mM EGTA, 1 mM MgCI 2 , 10 mM ⁇ -mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 ⁇ M leupeptin, 10 ⁇ M pepstatin A, 5 ⁇ M trypsin inhibitor) and disrupted by ultrasonication.
- the ho- mogenate was then centrifuged for 10 min at 1000xg and the supernatant was stored at -80°C until subsequent use (see below).
- the protein content was determined by the Bradford method (BioRad, Kunststoff) using BSA as the standard.
- PDE4B2 activity is inhibited by the said compounds in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodiesterase [3H]cAMP SPA enzyme assay, code TRKQ 709O"), carried out in 96-well microtitre plates (MTP's).
- modified SPA sintillation proximity assay
- the test volume is 100 ⁇ l and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg z+ , 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]cAMP), 1 ⁇ l of the respective substance dilution in DMSO and sufficient recombinant PDE (1000xg supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions.
- the final concentration of DMSO in the assay (1 % v/v) does not substantially affect the activity of the PDE investigated.
- the reaction is started by adding the substrate (cAMP) and the assay is incubated for a further 15 min; after that, it is stopped by adding SPA beads (50 ⁇ l).
- the SPA beads had previously been resuspended in water, but were then diluted 1:3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop.
- the MTP's are analyzed in commercially available luminescence detection devices.
- the corresponding IC 50 values of the compounds for the inhibition of PDE activity are determined from the concentration-effect curves by means of non-linear regression.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Pulmonology (AREA)
- Dermatology (AREA)
- Rheumatology (AREA)
- Urology & Nephrology (AREA)
- Cardiology (AREA)
- Hospice & Palliative Care (AREA)
- Pain & Pain Management (AREA)
- Ophthalmology & Optometry (AREA)
- Heart & Thoracic Surgery (AREA)
- Transplantation (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Gynecology & Obstetrics (AREA)
- Endocrinology (AREA)
- Reproductive Health (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Other In-Based Heterocyclic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BRPI0508256-0A BRPI0508256A (pt) | 2004-03-03 | 2005-03-03 | hidróxi-6-fenilfenantridinas heterociclila-substituìdas e o uso da mesma como inibidores de pde4 |
| AU2005223370A AU2005223370A1 (en) | 2004-03-03 | 2005-03-03 | Novel heterocyclyl-substituted hydroxy-6-phenylphenanthridines and their use as PDE4 inhibitors |
| JP2007501292A JP2007526284A (ja) | 2004-03-03 | 2005-03-03 | 複素環で置換された新規のヒドロキシ−6−フェニルフェナントリジン及びpde4インヒビターとしてのそれらの使用 |
| EP05716896A EP1812400A1 (en) | 2004-03-03 | 2005-03-03 | Novel heterocyclyl-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| CA002557730A CA2557730A1 (en) | 2004-03-03 | 2005-03-03 | Novel heterocyclyl-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| NZ549109A NZ549109A (en) | 2004-03-03 | 2005-03-03 | Novel hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US10/590,805 US20070191413A1 (en) | 2004-03-03 | 2005-03-03 | Novel heterocycle-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| IL177301A IL177301A0 (en) | 2004-03-03 | 2006-08-06 | Heterocyclyl-substituted hydroxy-6-phenylphenanthridine derivatives and pharmaceutical compositions containing the same |
| NO20064220A NO20064220L (no) | 2004-03-03 | 2006-09-18 | Nye heterocyklylsubstituerte hydroksy-6-fenylfenantridiner og deres anvendelse som PDE4-inhibitorer |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP04005005.6 | 2004-03-03 | ||
| EP04005005 | 2004-03-03 | ||
| EP04106372.8 | 2004-12-07 | ||
| EP04106372 | 2004-12-07 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005090311A1 true WO2005090311A1 (en) | 2005-09-29 |
| WO2005090311A8 WO2005090311A8 (en) | 2006-10-26 |
Family
ID=34961674
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2005/050946 Ceased WO2005090311A1 (en) | 2004-03-03 | 2005-03-03 | Novel heterocyclyl-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US20070191413A1 (https=) |
| EP (1) | EP1812400A1 (https=) |
| JP (1) | JP2007526284A (https=) |
| KR (1) | KR20060130684A (https=) |
| AR (1) | AR049419A1 (https=) |
| AU (1) | AU2005223370A1 (https=) |
| BR (1) | BRPI0508256A (https=) |
| CA (1) | CA2557730A1 (https=) |
| IL (1) | IL177301A0 (https=) |
| NO (1) | NO20064220L (https=) |
| NZ (1) | NZ549109A (https=) |
| TW (1) | TW200540157A (https=) |
| WO (1) | WO2005090311A1 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7423046B2 (en) | 2002-08-29 | 2008-09-09 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| US7585872B2 (en) | 2004-02-18 | 2009-09-08 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines as effective phosphodiesterase (PDE) 4 inhibitors |
| US7718668B2 (en) | 2005-03-02 | 2010-05-18 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US7723391B2 (en) | 2007-10-04 | 2010-05-25 | Roche Palo Alto Llc | Cyclopropyl aryl amide derivatives and uses thereof |
| US8003798B2 (en) | 2004-03-03 | 2011-08-23 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2495827C (en) * | 2002-08-29 | 2012-05-08 | Altana Pharma Ag | 2-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| JP2007527901A (ja) * | 2004-03-10 | 2007-10-04 | アルタナ ファルマ アクチエンゲゼルシャフト | アミド置換された新規のヒドロキシ−6−フェニルフェナントリジン及びpde4インヒビターとしてのそれらの使用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999005111A1 (en) * | 1997-07-25 | 1999-02-04 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Novel tetrazole derivatives |
| WO2000042020A1 (en) * | 1999-01-15 | 2000-07-20 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Phenylphenanthridines with pde-iv inhibiting activity |
| WO2004019944A1 (en) * | 2002-08-29 | 2004-03-11 | Altana Pharma Ag | 2-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
Family Cites Families (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1082959A1 (en) * | 1991-09-20 | 2001-03-14 | Glaxo Group Limited | NK1 Antagonists for the treatment of depression |
| UA48216C2 (uk) * | 1996-01-31 | 2002-08-15 | Бік Гулден Ломберг Кеміше Фабрік Гмбх | Фенантридини та лікарський засіб для лікування захворювань дихальних шляхів |
| US6127378A (en) * | 1996-03-26 | 2000-10-03 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Phenanthridines substituted in the 6 position |
| EE03829B1 (et) * | 1996-11-11 | 2002-08-15 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Bensonaftüridiinid, nende kasutamine bronhiaalravimi valmistamiseks ning neid sisaldav ravim |
| JP2001510827A (ja) * | 1997-07-25 | 2001-08-07 | ビイク グルデン ロンベルク ヒエーミツシエ フアブリーク ゲゼルシヤフト ミツト ベシユレンクテル ハフツング | 置換6−フェニルフェナントリジン |
| DK1000034T3 (da) * | 1997-07-25 | 2003-01-27 | Altana Pharma Ag | Substituerede 6-alkylphenanthridiner |
| DK1075477T3 (da) * | 1998-05-05 | 2003-06-30 | Altana Pharma Ag | Nye benzonaphthyridin-N-oxider |
| ATE294793T1 (de) * | 1999-01-15 | 2005-05-15 | Altana Pharma Ag | Phenantrhridin-n-oxides mit pde-iv hemmender wirkung |
| SI1147087T1 (en) * | 1999-01-15 | 2005-10-31 | Altana Pharma Ag | Phenanthridine-n-oxides with pde-iv inhibiting activity |
| PT1303506E (pt) * | 2000-07-14 | 2005-06-30 | Altana Pharma Ag | 6-heteroarilfenantridinas |
| US6936622B2 (en) * | 2001-02-21 | 2005-08-30 | Altana Pharma Ag | 6-phenylbenzonaphthyridines |
| AU2003253408A1 (en) * | 2002-08-17 | 2004-03-11 | Nycomed Gmbh | Novel phenanthridines |
| ES2281658T3 (es) * | 2002-08-29 | 2007-10-01 | Nycomed Gmbh | 3-hidroxi-6-fenilfenantridinas como inhibidores de pde-4. |
| WO2004031724A2 (en) * | 2002-09-30 | 2004-04-15 | Ciphergen Biosystems, Inc. | Apparatus and method for expression and capture of biomolecules and complexes on adsorbent surfaces |
| AU2005212857B2 (en) * | 2004-02-18 | 2011-04-28 | Takeda Gmbh | Novel guanidinyl-substituted hydroxy-6-phenylphenenthridines as effective phosphodiesterase (PDE) 4 inhibitors |
| JP2007527899A (ja) * | 2004-03-09 | 2007-10-04 | アルタナ ファルマ アクチエンゲゼルシャフト | 新規のイソアミド置換されたヒドロキシ−6−フェニルフェナントリジン |
| JP2007527901A (ja) * | 2004-03-10 | 2007-10-04 | アルタナ ファルマ アクチエンゲゼルシャフト | アミド置換された新規のヒドロキシ−6−フェニルフェナントリジン及びpde4インヒビターとしてのそれらの使用 |
| EP1725532A1 (en) * | 2004-03-10 | 2006-11-29 | Altana Pharma AG | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| CA2558390A1 (en) * | 2004-03-10 | 2005-09-22 | Altana Pharma Ag | Novel thio-containing hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| WO2006082185A1 (en) * | 2005-02-01 | 2006-08-10 | Nycomed Gmbh | Novel 6-pyridylphenanthridines |
| WO2006092417A1 (en) * | 2005-03-02 | 2006-09-08 | Nycomed Gmbh | 6 -heteroaryl-1, 2, 3,4,4a, 1ob-hexahydro-phenanthridines as pde-4 inhibitors for the treatment of inflammatory disorders |
| CA2599368A1 (en) * | 2005-03-09 | 2006-09-14 | Nycomed Gmbh | Amido-substituted 6-phenylphenanthridines |
| US20070161018A1 (en) * | 2005-11-04 | 2007-07-12 | Johji Inazawa | Method for detecting cancer and a method for suppressing cancer |
-
2005
- 2005-03-02 AR ARP050100781A patent/AR049419A1/es unknown
- 2005-03-03 US US10/590,805 patent/US20070191413A1/en not_active Abandoned
- 2005-03-03 EP EP05716896A patent/EP1812400A1/en not_active Withdrawn
- 2005-03-03 CA CA002557730A patent/CA2557730A1/en not_active Abandoned
- 2005-03-03 JP JP2007501292A patent/JP2007526284A/ja not_active Withdrawn
- 2005-03-03 KR KR1020067019918A patent/KR20060130684A/ko not_active Ceased
- 2005-03-03 WO PCT/EP2005/050946 patent/WO2005090311A1/en not_active Ceased
- 2005-03-03 AU AU2005223370A patent/AU2005223370A1/en not_active Abandoned
- 2005-03-03 NZ NZ549109A patent/NZ549109A/en unknown
- 2005-03-03 BR BRPI0508256-0A patent/BRPI0508256A/pt not_active IP Right Cessation
- 2005-03-03 TW TW094106491A patent/TW200540157A/zh unknown
-
2006
- 2006-08-06 IL IL177301A patent/IL177301A0/en unknown
- 2006-09-18 NO NO20064220A patent/NO20064220L/no not_active Application Discontinuation
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999005111A1 (en) * | 1997-07-25 | 1999-02-04 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Novel tetrazole derivatives |
| WO2000042020A1 (en) * | 1999-01-15 | 2000-07-20 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Phenylphenanthridines with pde-iv inhibiting activity |
| WO2004019944A1 (en) * | 2002-08-29 | 2004-03-11 | Altana Pharma Ag | 2-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7423046B2 (en) | 2002-08-29 | 2008-09-09 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| US8202880B2 (en) | 2002-08-29 | 2012-06-19 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as PDE4 inhibitors |
| US7585872B2 (en) | 2004-02-18 | 2009-09-08 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines as effective phosphodiesterase (PDE) 4 inhibitors |
| US8329906B2 (en) | 2004-02-18 | 2012-12-11 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines |
| US8003798B2 (en) | 2004-03-03 | 2011-08-23 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8318944B2 (en) | 2004-03-03 | 2012-11-27 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8324391B2 (en) | 2004-03-03 | 2012-12-04 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8455653B2 (en) | 2004-03-03 | 2013-06-04 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8883818B2 (en) | 2004-03-03 | 2014-11-11 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9149479B2 (en) | 2004-03-03 | 2015-10-06 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9387205B2 (en) | 2004-03-03 | 2016-07-12 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9962377B2 (en) | 2004-03-03 | 2018-05-08 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US7718668B2 (en) | 2005-03-02 | 2010-05-18 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8354535B2 (en) | 2005-03-02 | 2013-01-15 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8754218B2 (en) | 2005-03-02 | 2014-06-17 | Takeda Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8829189B2 (en) | 2005-03-02 | 2014-09-09 | Takeda Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US7723391B2 (en) | 2007-10-04 | 2010-05-25 | Roche Palo Alto Llc | Cyclopropyl aryl amide derivatives and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2005223370A1 (en) | 2005-09-29 |
| US20070191413A1 (en) | 2007-08-16 |
| JP2007526284A (ja) | 2007-09-13 |
| TW200540157A (en) | 2005-12-16 |
| WO2005090311A8 (en) | 2006-10-26 |
| EP1812400A1 (en) | 2007-08-01 |
| BRPI0508256A (pt) | 2007-07-31 |
| IL177301A0 (en) | 2006-12-10 |
| NZ549109A (en) | 2010-05-28 |
| AR049419A1 (es) | 2006-08-02 |
| KR20060130684A (ko) | 2006-12-19 |
| CA2557730A1 (en) | 2005-09-29 |
| NO20064220L (no) | 2006-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9962377B2 (en) | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors | |
| US8329906B2 (en) | Guanidinyl-substituted hydroxy-6-phenylphenanthridines | |
| US20070185149A1 (en) | Novel amido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibtors | |
| US20080161339A1 (en) | Novel Thio-Containing Hydroxy-6-Phenylphenanthridines and their Use as Pde4 Inhibitors | |
| US20070191413A1 (en) | Novel heterocycle-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors | |
| US20070191414A1 (en) | Novel isoamido-substituted hydroxy-6-phenylphenanthridines | |
| WO2005085203A1 (en) | Novel difluoroethoxy-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors | |
| EP1846390A1 (en) | Novel 6-pyridylphenanthridines | |
| MXPA06009667A (en) | Novel heterocyclyl-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors | |
| MXPA06009893A (en) | Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006/06450 Country of ref document: ZA Ref document number: 200606450 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 177301 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 549109 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2006/009667 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10590805 Country of ref document: US Ref document number: 2007191413 Country of ref document: US Ref document number: 2007501292 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2557730 Country of ref document: CA Ref document number: 200580006343.8 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005716896 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1144/MUMNP/2006 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020067019918 Country of ref document: KR Ref document number: 2005223370 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2005223370 Country of ref document: AU Date of ref document: 20050303 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005223370 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020067019918 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: PI0508256 Country of ref document: BR |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005716896 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 10590805 Country of ref document: US |