WO2005082042A2 - Therapeutic methods employing nitric oxide precursors - Google Patents
Therapeutic methods employing nitric oxide precursors Download PDFInfo
- Publication number
- WO2005082042A2 WO2005082042A2 PCT/US2005/006081 US2005006081W WO2005082042A2 WO 2005082042 A2 WO2005082042 A2 WO 2005082042A2 US 2005006081 W US2005006081 W US 2005006081W WO 2005082042 A2 WO2005082042 A2 WO 2005082042A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cpsi
- nitric oxide
- citrulline
- subject matter
- presently disclosed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
- A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/10—Drugs for genital or sexual disorders; Contraceptives for impotence
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the presently disclosed subject matter relates to isolated polynucleotide molecules useful for analyzing carbamyl phosphate synthetase I phenotypes, to peptides encoded by these molecules, and to the diagnostic and therapeutic uses thereof relating to a newly identified carbamyl phosphate synthetase I polymorphism.
- diagnostic and therapeutic uses thereof relating to a newly identified carbamyl phosphate synthetase I polymorphism.
- HVOD hepatic veno-occlusive disease iNO inhaled nitric oxide
- Ornithine is combined with carbamyl phosphate to produce citrulline, which in turn is combined with aspartate, in the presence of adenosine triphosphate (ATP), to produce argininosuccinate.
- ATP adenosine triphosphate
- fumarate is split from argininosuccinate, to produce arginine.
- the degradative pathway for arginine is by the hydrolytic action of arginase, to produce ornithine and urea. These reactions form the urea cycle.
- the urea cycle serves as the primary pathway for removing waste nitrogen produced by the metabolism of endogenous and exogenous proteins, and is shown schematically in Fig.1. Disruption of metabolic processes is a frequent side effect of chemotherapy.
- the agents used in high-dose chemotherapy affect a number of cellular processes. Metabolic processes localized in chemo- sensitive tissues, such as the liver and gastrointestinal tract, face a particularly great risk to disruption. The constant turnover and processing of nitrogen involves all the tissues in the body, but the first critical steps of the urea cycle are limited to the liver and gut.
- the high-dose chemotherapy associated with bone marrow transplant (BMT) interferes with liver function and is toxic to the intestine. Idiopathic hyperammonemia, which is suggestive of urea cycle dysfunction, has been reported to be associated with high mortality in patients undergoing bone marrow transplant.
- HVOD HVOD is associated with jaundice, increased liver size and disruption of normal hepatic blood flow. HVOD occurs in approximately 20 to 40% of patients and is associated with severe morbidity and mortality.
- Nitric oxide (NO) plays a role in regulating vascular tone and in maintaining patency of hepatic and pulmonary venules following high-dose chemotherapy. Intact urea cycle function is important not only for excretion of ammonia but in maintaining adequate tissue levels of arginine, the precursor of NO.
- Carbamyl phosphate synthetase I Carbamyl phosphate synthetase I (CPSI) is the rate-limiting enzyme catalyzing the first committed step of ureagenesis via the urea cycle.
- CPSI is highly tissue specific, with function and production substantially limited to liver and intestines. Genomically encoded, CPSI is produced in the cytoplasm and transported into the mitochondria where it is cleaved into its mature 160 kD monomeric form. The enzyme combines ammonia and bicarbonate to form carbamyl with the expenditure of two ATP molecules and using the co-factor N- acetyl-glutamate (NAG). Any genetic predisposition to decreased urea cycle function would lead to hyperammonemia and would likely contribute to the severity of disorders associated with sub-optimal urea cycle function, including BMT-related toxicity.
- NAG co-factor N- acetyl-glutamate
- a method of screening for susceptibility to sub-optimal urea cycle function in a subject comprising the steps of: (a) obtaining a nucleic acid sample from the subject; and (b) detecting a polymorphism of a carbamyl phosphate synthase I (CPSI) gene in the nucleic acid sample from the subject, the presence of the polymorphism indicating that the susceptibility of the subject to sub-optimal urea cycle function.
- CPSI carbamyl phosphate synthase I
- detection of the polymorphism is particularly provided with respect to determining the susceptibility of a subject to bone marrow transplant toxicity.
- the polymorphism of the carbamyl phosphate synthetase polypeptide comprises a C to A transversion in exon 36 of the CPSI gene, and in some embodiments at nucleotide 4340 of a cDNA that corresponds to the CPSI gene.
- the C to A transversion at nucleotide 4340 of the cDNA that corresponds to the CPSI gene further comprises a change in the triplet code from AAC to ACC, which encodes a CPSI polypeptide having a threonine moiety at amino acid 1405.
- the presently disclosed subject matter also provides an isolated and purified biologically active CPSI polypeptide.
- a polypeptide of the presently disclosed subject matter is a recombinant polypeptide.
- a polypeptide of the presently disclosed subject matter comprises human CPSI having an asparagine moiety at amino acid 1405.
- the presently disclosed subject matter also provides an isolated and purified polynucleotide that encodes a biologically active CPSI polypeptide.
- a polynucleotide of the presently disclosed subject matter comprises a DNA molecule from a human.
- a polynucleotide of the presently disclosed subject matter comprises a cDNA that corresponds to the CPSI gene and which includes a C to A transversion at nucleotide 4340.
- a polynucleotide of the presently disclosed subject matter further comprises a cDNA that corresponds to the CPSI gene that includes a change in the triplet code from ACC to AAC at nucleotide 4340, and encodes a CPSI polypeptide having an asparagine moiety at amino acid 1405.
- Kits and reagents including oligonucleotides, nucleic acid probes and antibodies suitable for use in carrying out the methods of the presently disclosed subject matter and for use in detecting the polypeptides and polynucleotides of the presently disclosed subject matter are also disclosed herein. Methods for preparing the polynucleotides and polypeptides of the presently disclosed subject matter are also disclosed herein.
- the presently disclosed subject matter pertains to therapeutic methods based upon a polymorphism of a carbamyl phosphate synthase I (CPSI) gene as described herein.
- Such therapeutic methods include administration of nitric oxide precursors in the treatment and prophylaxis of disorders mediated or modulated by sub-optimal urea cycle function (e.g. bone marrow transplant toxicity) and gene therapy approaches using an isolated and purified polynucleotide of the presently disclosed subject matter. It is therefore an object of the presently disclosed subject matter to provide polynucleotide molecules that can be used in analyzing carbamyl phosphate synthetase I (CPSI) in vertebrate subjects.
- CPSI carbamyl phosphate synthetase I
- Figure 1 is a schematic of the urea cycle
- Figure 2 is a schematic of the consensus CPSI protein that does not reflect recognized mutations
- Figure 3 is a schematic of the consensus CPSI protein depicting several known mutations in the protein and depicting the T1405N polymorphism of the presently disclosed subject matter
- Figure 4 is a schematic of recognized post-transcriptional modification of CPSI
- Figure 5 is a schematic of the human genomic locus for CPSI
- Figure 6 is a schematic of a cloning strategy for a full length CPSI cDNA
- Figure 7 is a schematic of an alternative cloning strategy for a full length
- FIG. 8 is a graphical depiction of the metabolic activity of the CPSI protein expressed in COS-7 cells;
- Figure 9 is a graphical presentation of the size and position of introns in CPSI cDNA;
- Figure 10 is a diagram of exon 36 (SEQ ID NO:5) showing the locations of representative oligonucleotide primers of the presently disclosed subject matter;
- Figure 11 presents the amino acid sequence of T1405 CPSI (SEQ ID NO:4) (stop codon translated as "X", 165049 MW, 1.163602e+07 CN), with the initial amino acid methionine considered to be at a -1 position;
- Figure 12 presents the amino acid sequence of N1405 CPSI (SEQ ID NO:2) (stop codon translated as "X", 165062 MW, 1.161634E+07 CN), with the initial amino acid methionine considered to be at a -1 position;
- Figure 13 is a graph of a concentration curve of plasma arginine levels.
- CPSI carbamyl phosphate synthetase I
- the enzyme that catalyzes the rate limiting first step of the urea cycle.
- a single nucleotide change in the CPSI gene is responsible for the polymorphism of
- nucleic acid molecules derived from the tissues of vertebrate subjects can be effected to provide for the analysis of CPSI phenotypes, for the generation of peptides encoded by such nucleic acid molecules, and for diagnostic and therapeutic methods relating to the CPSI polymorphism.
- Nucleic acid molecules utilized in these contexts may be amplified, as described below, and generally include RNA, genomic DNA and cDNA derived from RNA.
- Rat CPSI polypeptide and nucleic acid sequence information is disclosed by Nyunoya, H., et al., Journal of Biological Chemistry 260:9346-9356 (1985) and at GENBANK® accession numbers AH005315, M12335, M12328, M12327, M12326, M12325, M12324, M12323, M12322, M12321 , M12320, M12319, M12318 and M11710, herein incorporated by reference.
- rat CPSI The structural information about rat CPSI is derived from sequence homology and substrate and co-factor binding studies; however, no crystallographic data is available. Mature CPSI is modular in nature, containing 2 main regions. The first region, residues 39-406, is homologous to the small subunit of the heterodimeric CPS of Escherichia coli. Bacterial and yeast CPSI polypeptide and nucleic acid sequence information is disclosed at GENBANK® accession numbers AB005063, X67573, M27174, P07258, P03965, BAA21088, SYBYCP, SYBYCS, and SYECCS, herein incorporated by reference.
- CPS domain residues 417-1500
- Meister A., Adv. Enzymol. Relat. Areas Mol. Biol. 62:315-374 (1989).
- This subunit is responsible for carbamyl phosphate synthesis from ammonia and for the binding of the substrates and cofactors.
- Meister A., Adv. Enzymol. Relat.Areas Mol. Biol. 62:315-374 (1989).
- the CPS domain arose by gene duplication and tandem fusion in the pro-genome, and, as depicted schematically in Figure 2, is itself composed of two phosphorylation domains and a C-terminal regulatory domain involved in the binding of n-acetyl- glutamate (NAG). Nyunoya, H., et al., Journal of Biological Chemistry 260:9346-9356 (1985).
- NAG n-acetyl- glutamate
- residues 407-416 act as a bridge between the two major subunits, and residues 1-38 constitute the leader peptide that directs immature CPSI to the mitochondria prior to being removed.
- the small subunit-like region is composed of two approximately equal subdomains. The interaction subdomain, residues 39-
- glutaminase subdomain, residues 213-406, is homologous to several glutamine amidotransferases and to the region of CPSI that when generated free from other components exhibited considerable glutaminase activity, as described by
- CPSI has lostthe cysteine residue necessary to split glutamine
- the CPS domain (corresponding to the large subunit in E. coli) is believed to catalyze the synthesis of carbamyl phosphate from ammonia, according to the reaction: 2 ATP + bicarbonate + ⁇ 2 ADP + phosphate + ammonia carbamyl phosphate
- this reaction comprises three steps: bicarbonate phosphorylation by an ATP molecule that is designated herein as ATP A , giving carboxyphosphate; carbamate synthesis from carboxyphosphate and ammonia; and carbamate phosphorylation by another ATP molecule (ATP B ), giving carbamyl phosphate, as described by Rubio, V. and Grisolia, S., Enzyme 26:233-239 (1981).
- ATP A an ATP molecule that is designated herein as ATP A
- ATP B carbamate phosphorylation by another ATP molecule
- the CPS domain appears to have arisen by duplication and tandem fusion of the duplicated component; therefore, its amino and COOH-terminal halves are homologous, as described by Nyunoya, H., et al., Journal of Biological Chemistry 260:9346-9356 (1985)).
- Each homologous half comprises an amino- and a COOH-terminal domain of about 40 and 20 kD, respectively, of which the domain of 40 kD of the amino- half is believed to be involved in bicarbonate phosphorylation (bicarbonate phosphorylation domain, residues 417-788) (Fig. 2).
- the corresponding domain in the COOH-half is involved in carbamate phosphorylation via the carbamate phosphorylation domain, residues 969-1329 (Fig. 2), as described by Alonso, E. and Rubio, V., European Journal of Biochemistry 229:377-384 (1995)).
- These phosphorylation domains are homologous to biotin carboxylase (Toh, H.
- Human CPSI mRNA encodes a 165 kD, 1500 amino acid pre-protein.
- the amino terminus of this precursor contains 38 residues, including 8 basic residues, and 1 acidic residue with a Pro-Gly sequence 4 residues before the start of the mature enzyme (Nyunoya, H. et al., Journal of Biological Chemistry 260:9346-9356 (1985); Lagace, M. et al., Journal of Biological Chemistry 262:10415-10418 (1987). This highly conserved signal sequence promotes enzyme entry into the mitochondrial matrix, where it is then removed to produce the 160 kD mature enzyme.
- A.2. Normal Expression of CPSI CPSI enzymatic activity is first detected in human fetal liver by 5-10 weeks gestation (Moorman, A. F. et al.
- CPSI histochemical Journal 22:457-468 (1990)).
- Tissue expression of CPSI is essentially limited to the liver, with trace amounts of activity in the intestine and kidney.
- CPSI is compartmentalized in parenchymal cells around the terminal portal venules (Moorman, A. F. et al. Histochemical Journal 22:457-468 (1990)).
- CPSI activity and expression In addition to its compartmentalization, several factors are known to be important in the regulation of CPSI activity and expression. For example, low or absent levels of ornithine decrease CPSI activity, presumably due to an inhibitory effect from accumulated carbamyl phosphate (CP) as described by Jackson, M. J. et al., Annual Review of Genetics 20:431-464 (1986); and Rubio, V., Biochemical Society Transactions 21 :198-202 (1993)). Levels of both CPSI mRNA and enzyme increase with a high protein diet, and in response to glucagon and glucocorticoids (Jackson, M. J. et a ⁇ ., Annual Review of Genetics 20:431-464 (1986); de Groot, C. J., et al., Biochemical & Biophysical Research Communications 124:882-888 (1984)). In normal unstimulated hepatic tissue that has been examined, an abundance of CPSI mRNA has been observed.
- CP carb
- a method of screening for susceptibility to sub-optimal urea cycle function resulting in decreased ammonia clearance and decreased arginine production in a subject comprises: (a) obtaining a nucleic acid sample from the subject; and (b) detecting a polymorphism of a carbamyl phosphate synthase I (CPSI) gene in the nucleic acid sample from the subject, the presence of the polymorphism indicating that the susceptibility of the subject to sub-optimal urea cycle function resulting in decreased ammonia clearance and decreased arginine production.
- CPSI carbamyl phosphate synthase I
- detection of the polymorphism is particularly provided with respect to determining the susceptibility of a subject to bone marrow transplant toxicity. It is further noted that the polymorphism of the presently disclosed subject matter may be used to predict toxicity in a number of conditions beyond BMT or valproic acid administration as disclosed herein and in the Examples. The polymorphism is also implicated in the mediation or modulation of disrupted ammonia clearance and arginine production in situations such as adult hepatic cirrhosis, other medication toxicities, newborns with impaired hepatic function, and the like.
- polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population.
- a polymorphic marker is the locus at which divergence occurs. Exemplary markers have at least two alleles, each occurring at frequency of greater than 1%.
- a polymorphic locus may be as small as one base pair.
- Useful nucleic acid molecules according to the presently disclosed subject matter include those which will specifically hybridize to CPSI sequences in the region of the C to A transversion at base 4340 and within exon 36 changing the triplet code from ACC to AAC. This transversion leads to the T1405N change in the encoded CPSI polypeptide.
- nucleic acid molecules can be labeled according to any technique known in the art, such as with radiolabels, fluorescent labels, enzymatic labels, sequence tags, etc.
- the nucleic acid molecules contain the C to A transversion at base 4340.
- Such molecules can be used as allele-specific oligonucleotide probes to track a particular mutation, for example, through a family of subjects.
- Body samples can be tested to determine whether the CPSI gene contains the C to A transversion at base 4340.
- Suitable body samples for testing include those comprising DNA, RNA or protein obtained from biopsies, including liver and intestinal tissue biopsies; or from blood, prenatal; or embryonic tissues, for example.
- a pair of isolated oligonucleotide primers is provided:
- the oligonucleotide primers are useful in diagnosis of a subject at risk for hyperammonemia such as can result as a BMT complication or toxicity.
- the primers direct amplification of a target polynucleotide prior to sequencing.
- These unique CPSI exon 36 oligonucleotide primers were designed and produced based upon identification of the C to A transversion in exon 36.
- isolated allele specific oligonucleotides are provided. Sequences substantially similar thereto are also provided in accordance with the presently disclosed subject matter.
- the allele specific oligonucleotides are useful in diagnosis of a subject at risk for hyperammonemia, such as can result as a BMT complication or toxicity.
- These unique CPSI exon 36 oligonucleotide primers were designed and produced based upon identification of the C to A transversion in exon 36.
- the terms "substantially complementary to” or “substantially the sequence of refer to sequences which hybridize to the sequences provided (e.g. SEQ ID NOs: 5-10) under stringent conditions and/or sequences having sufficient homology with any of SEQ ID NOs: 5-10, such that the allele specific oligonucleotides of the presently disclosed subject matter hybridize to the sequence.
- isolated includes oligonucleotides substantially free of other nucleic acids, proteins, lipids, carbohydrates or other materials with which they may be associated, such association being either in cellular material or in a synthesis medium.
- a "target polynucleotide” or “target nucleic acid” refers to the nucleic acid sequence of interest e.g., a CPSI- encoding polynucleotide.
- Other primers that can be used for primer hybridization are readily ascertainable to those of skill in the art based upon the disclosure herein of the CPSI polymorphism.
- the primers of the presently disclosed subject matter embrace oligonucleotides of sufficient length and appropriate sequence so as to provide initiation of polymerization on a significant number of nucleic acids in the polymorphic locus.
- the CPSI locus is depicted schematically in Fig. 5.
- the term "primer” as used herein refers to a sequence comprising in some embodiments two or more deoxyribonucleotides or ribonucleotides, in some embodiments more than three, and in some embodiments more than eight, and in some embodiments at least about 20 nucleotides of the CPSI gene wherein the DNA sequence contains the C to A transversion at base 4340 relative to CPSI contained in SEQ ID NO's:1 and 3.
- the allele including cytosine (C) at base 4340 relative to CPSI is referred to herein as the "CPSIa allele", the “T1405 allele”, or the “threonine-encoding allele”.
- the allele including adenosine (A) at base 4340 relative to CPSI is referred to herein as the "CPSIb allele", the "N1405 allele”, or the "arginine-encoding allele”.
- An oligonucleotide that distinguishes between the CPSIa and the CPSIb alleles of the CPSI gene, wherein said oligonucleotide hybridizes to a portion of said CPSI gene that includes nucleotide 4340 of the cDNA that corresponds to said CPSI gene when said nucleotide 4340 is adenosine, but does not hybridize with said portion of said CPSI gene when said nucleotide 4340 is cytosine is also provided in accordance with the presently disclosed subject matter.
- An oligonucleotide that distinguishes between the CPSIa and the CPSIb alleles of the CPSI gene, wherein said oligonucleotide hybridizes to a portion of said CPSI gene that includes nucleotide 4340 of the cDNA that corresponds to said CPSI gene when said nucleotide 4340 is cytosine, but does not hybridize with said portion of said CPSI gene when said nucleotide 4340 is adenosine is also provided in accordance with the presently disclosed subject matter.
- Such oligonucleotides are in some embodiments between ten and thirty bases in length.
- Such oligonucleotides can optionally further comprises a detectable label.
- the primer is single stranded for maximum efficiency in amplification, but can be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent for polymerization. The exact length of primer will depend on many factors, including temperature, buffer, and nucleotide composition.
- the oligonucleotide primer typically contains 12-20 or more nucleotides, although it may contain fewer nucleotides.
- Primers of the presently disclosed subject matter are designed to be "substantially" complementary to each strand of the genomic locus to be amplified. This means that the primers must be sufficiently complementary to hybridize with their respective strands under conditions that allow the agent for polymerization to perform. In other words, the primers should have sufficient complementarity with the 5' and 3' sequences flanking the transversion to hybridize therewith and permit amplification of the genomic locus. Oligonucleotide primers of the presently disclosed subject matter are employed in the amplification method which is an enzymatic chain reaction that produces exponential quantities of polymorphic locus relative to the number of reaction steps involved. Typically, one primer is complementary to the negative (-) strand of the polymorphic locus and the other is complementary to the positive
- (+) strand Annealing the primers to denatured nucleic acid followed by extension with an enzyme, such as the large fragment of DNA polymerase I (Klenow) and nucleotides, results in newly synthesized + and - strands containing the target polymorphic locus sequence. Because these newly synthesized sequences are also templates, repeated cycles of denaturing, primer annealing, and extension results in exponential production of the region (i.e., the target polymorphic locus sequence) defined by the primers.
- the product of the chain reaction is a discreet nucleic acid duplex with termini corresponding to the ends of the specific primers employed.
- oligonucleotide primers of the presently disclosed subject matter may be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments thereof.
- diethylphosphoramidites are used as starting materials and may be synthesized as described by Beaucage et al., Tetrahedron Letters 22:1859-1862 (1981 ).
- One method for synthesizing oligonucleotides on a modified solid support is described in U.S. Pat. No. 4,458,066.
- nucleic acid specimen in purified or non-purified form, can be utilized as the starting nucleic acid or acids, providing it contains, or is suspected of containing, a nucleic acid sequence containing the polymorphic locus.
- the method may amplify, for example, DNA or RNA, including messenger RNA, wherein DNA or RNA may be single stranded or double stranded.
- RNA is to be used as a template, enzymes, and/or conditions optimal for reverse transcribing the template to DNA would be utilized.
- a DNA-RNA hybrid that contains one strand of each may be utilized.
- a mixture of nucleic acids may also be employed, or the nucleic acids produced in a previous amplification reaction herein, using the same or different primers may be so utilized.
- the specific nucleic acid sequence to be amplified i.e., the polymorphic locus, may be a fraction of a larger molecule or can be present initially as a discrete molecule, so that the specific sequence constitutes the entire nucleic acid. It is not necessary that the sequence to be amplified be present initially in a pure form; it may be a minor fraction of a complex mixture, such as contained in whole human DNA.
- DNA utilized herein may be extracted from a body sample, such as blood, tissue material (in some embodiments liver tissue), and the like by a variety of techniques such as that described by Maniatis et. al. in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., p 280-281 (1982). If the extracted sample is impure, it may be treated before amplification with an amount of a reagent effective to open the cells, or animal cell membranes of the sample, and to expose and/or separate the strand(s) of the nucleic acid(s). This lysing and nucleic acid denaturing step to expose and separate the strands will allow amplification to occur much more readily.
- the deoxyribonucleotide triphosphates dATP, dCTP, dGTP, and dTTP are added to the synthesis mixture, either separately or together with the primers, in adequate amounts and the resulting solution is heated to about 90-100 °C from about 1 to 10 minutes, in some embodiments from 1 to 4 minutes. After this heating period, the solution is allowed to cool to allow for the primer hybridization. To the cooled mixture is added an appropriate agent for effecting the primer extension reaction (called herein "agent for polymerization”), and the reaction is allowed to occur under conditions known in the art. The agent for polymerization may also be added together with the other reagents if it is heat stable.
- This synthesis (or amplification) reaction may occur at room temperature up to a temperature above which the agent for polymerization no longer functions.
- the temperature is generally no greater than about 40°C. Most conveniently the reaction occurs at room temperature.
- the agent for polymerization may be any compound or system that will function to accomplish the synthesis of primer extension products, including enzymes. Suitable enzymes for this purpose include, for example, E. coli DNA polymerase I, Klenow fragment of E.
- coli DNA polymerase e.g., coli DNA polymerase, polymerase muteins, reverse transcriptase, other enzymes, including heat-stable enzymes (i.e., those enzymes which perform primer extension after being subjected to temperatures sufficiently elevated to cause denaturation), such as Tag polymerase.
- Suitable enzyme will facilitate combination of the nucleotides in the proper manner to form the primer extension products that are complementary to each polymorphic locus nucleic acid strand.
- the synthesis will be initiated at the 3' end of each primer and proceed in the 5' direction along the template strand, until synthesis terminates, producing molecules of different lengths.
- the newly synthesized strand and its complementary nucleic acid strand will form a double-stranded molecule under hybridizing conditions described above and this hybrid is used in subsequent steps of the method.
- the newly synthesized double-stranded molecule is subjected to denaturing conditions using any of the procedures described above to provide single-stranded molecules.
- the steps of denaturing, annealing, and extension product synthesis can be repeated as often as needed to amplify the target polymorphic locus nucleic acid sequence to the extent necessary for detection.
- the amount of the specific nucleic acid sequence produced will accumulate in an exponential fashion. PCR. A Practical Approach, ILR Press, Eds. McPherson et al. (1992).
- the amplification products may be detected by Southern blot analysis with or without using radioactive probes.
- a small sample of DNA containing a very low level of the nucleic acid sequence of the polymorphic locus is amplified, and analyzed via a Southern blotting technique or similarly, using dot blot analysis.
- the use of non-radioactive probes or labels is facilitated by the high level of the amplified signal.
- probes used to detect the amplified products can be directly or indirectly detectably labeled, for example, with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelator or an enzyme.
- Sequences amplified by the methods of the presently disclosed subject matter can be further evaluated, detected, cloned, sequenced, and the like, either in solution or after binding to a solid support, by any method usually applied to the detection of a specific DNA sequence such as dideoxy sequencing, PCR, oligomer restriction (Saiki et al., Bio/Technology 3:1008-1012 (1985), allele-specific oligonucleotide (ASO) probe analysis (Conner et al., Proc. Natl. Acad. Sci. U.S.A.
- the method of amplifying is by PCR, as described herein and in U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,965,188 each of which is hereby incorporated by reference; and as is commonly used by those of ordinary skill in the art.
- Alternative methods of amplification have been described and can also be employed as long as the CPSI locus amplified by PCR using primers of the presently disclosed subject matter is similarly amplified by the alternative means.
- Such alternative amplification systems include but are not limited to self-sustained sequence replication, which begins with a short sequence of RNA of interest and a T7 promoter. Reverse transcriptase copies the RNA into cDNA and degrades the RNA, followed by reverse transcriptase polymerizing a second strand of DNA.
- Another nucleic acid amplification technique is nucleic acid TM sequence-based amplification (NASBA ) which uses reverse transcription and T7 RNA polymerase and incorporates two primers to target its cycling scheme.
- TM nucleic acid TM sequence-based amplification
- NASBA amplification can begin with either DNA or RNA and finish with 8 either, and amplifies to about 10 copies within 60 to 90 minutes.
- nucleic acid can be amplified by ligation activated transcription (LAT).
- LAT works from a single-stranded template with a single primer that is partially single-stranded and partially double-stranded.
- Amplification is initiated by ligating a cDNAto the promoter oligonucleotide and 8 9 within a few hours, amplification is about 10 to about 10 fold.
- the QB replicase system can be utilized by attaching an RNA sequence called MDV-1 to RNA complementary to a DNA sequence of interest. Upon mixing with a sample, the hybrid RNA finds its complement among the specimen's mRNAs and binds, activating the replicase to copy the tag-along sequence of interest.
- Another nucleic acid amplification technique ligase chain reaction
- LCR repair chain reaction
- Nucleic acid amplification by strand displacement activation utilizes a short primer containing a recognition site for Hinc II with short overhang on the 5' end that binds to target DNA.
- a DNA polymerase fills in the part of the primer opposite the overhang with sulfur-containing adenine analogs. Hinc II is added but only cuts the unmodified DNA strand.
- a DNA polymerase that lacks 5' exonuclease activity enters at the cite of the nick and begins to polymerize, displacing the initial primer strand downstream and building a new one which serves as more primer. 7 SDA produces greater than about a 10 -fold amplification in 2 hours at 37°C.
- PCR is an exemplary method of amplification if the presently disclosed subject matter, these other methods can also be used to amplify the CPSI locus as described in the method of the presently disclosed subject matter.
- amplification technique as used herein and in the claims is meant to encompass all the foregoing methods.
- a method for diagnosing or identifying a subject having a predisposition or higher susceptibility to (at risk of) hyperammonemia comprising sequencing a target nucleic acid of a sample from a subject by dideoxy sequencing, in some embodiments, following amplification of the target nucleic acid.
- a method for diagnosing a subject having a predisposition or higher susceptibility to (at risk of) hyperammonemia comprising contacting a target nucleic acid of a sample from a subject with a reagent that detects the presence of the CPSI polymorphism and detecting the reagent.
- HVOD Hepatic veno-occlusive disease
- the frequency of both CPSI alleles was tested in an HVOD and a non-HVOD group undergoing BMT in an effort to identify evidence of disequilibrium.
- a method of screening subjects for susceptibility to BMT toxicity, and particularly to HVOD, via detection of the CPSI polymorphism is provided in accordance with the presently disclosed subject matter.
- the materials for use in the method of the presently disclosed subject matter are ideally suited for the preparation of a diagnostic kit.
- kit may comprise a carrier means being compartmentalized to receive in close confinement one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method.
- container means such as vials, tubes, and the like
- each of the container means comprising one of the separate elements to be used in the method.
- one of the container means may comprise means for amplifying CPSI DNA, the means comprising the necessary enzyme(s) and oligonucleotide primers for amplifying said target DNA from the subject.
- the oligonucleotide primers include primers having a sequence selected from the group including, but not limited to: SEQ ID NOs:6-10, or primer sequences substantially complementary or substantially homologous thereto.
- the target flanking 5' and 3' polynucleotide sequence has substantially the sequence set forth in SEQ ID NO:5, and sequences substantially complementary or homologous thereto.
- Other oligonucleotide primers for amplifying CPSI will be known or readily ascertainable to those of skill in the art given the disclosure of the presently disclosed subject matter presented herein.
- a kit in accordance with the presently disclosed subject matter can further comprise a reagent or reagents for extracting a nucleic acid sample from a biological sample obtained from a subject. Any such reagents as would be readily apparent to one of ordinary skill in the art are contemplated to fall within the scope of the presently disclosed subject matter.
- a suitable lysis buffer for the tissue along with a suspension of glass beads for capturing the nucleic acid sample and an elution buffer for eluting the nucleic acid sample off of the glass beads comprise reagents for extracting a nucleic acid sample from a biological sample obtained from a subject.
- Other examples include commercially available, such as the GENOMIC TM
- Genomic DNA Isolation System (GIBCO BRL, Gaithersburg, Md.), ELU-QUIK DNA Purification Kit (Schleicher & Schuell, Keene, N.H.), DNA Extraction Kit TM
- CPSI-encoding polynucleotide comprises a CPSI encoding polynucleotide which includes a C to A transversion at base 4340, i.e. within exon 36, of the CPSI gene which changes the triplet code from ACC to AAC and leads to the T1405N change in the encoded CPSI polypeptide.
- the encoded CPSI polypeptide comprising the T1405N change is also particularly provided.
- allelic variant polynucleotides and polypeptides encoded by same are provided in accordance with the presently disclosed subject matter.
- a biologically active CPSI polypeptide is also provided in accordance with the presently disclosed subject matter, as is a CPSI-encoding polynucleotide encoding such a CPSI polypeptide.
- Exemplary biological activities include the biological activity of mediating the first step of the urea cycle and the biological activity of cross-reacting with an anti-CPSI antibody.
- the provided CPSI-encoding polynucleotides and polypeptides have broad utility given the biological significance of the urea cycle, as is known in the art.
- the CPSI-encoding polynucleotides and polypeptides are useful in the preparation of screening assays and assay kits that are used to detect the presence of the proteins and nucleic acids of the presently disclosed subject matter in biological samples.
- isolated and purified polypeptides have utility as feed additives for livestock and polynucleotides encoding the polypeptides are thus useful in producing the polypeptides.
- the provided CPSI polynucleotides and polypeptides are isolated from vertebrate and invertebrate sources.
- homologs of CPSI including, but not limited to, mammalian, yeast and bacterial homologs are provided in accordance with the presently disclosed subject matter.
- Representative mammalian homologs of CPSI members include, but are not limited to, rat and human homologs.
- the terms "CPSI gene product”, “CPSI protein” and “CPSI polypeptide” refer to proteins having amino acid sequences which are substantially identical to the native amino acid sequences in CPSI and which are biologically active in that they are capable of mediating the synthesis of carbamyl phosphate in the urea cycle, or cross-reacting with anti-CPSI antibodies raised against a CPSI polypeptide.
- CPSI gene product also include analogs of CPSI molecules that exhibit at least some biological activity in common with native CPSI gene products. Furthermore, those skilled in the art of mutagenesis will appreciate that other analogs, as yet undisclosed or undiscovered, may be used to construct CPSI analogs. There is no need for an "CPSI gene product”, “CPSI protein” or “CPSI polypeptide” to comprise all, or substantially all of the amino acid sequence of a native CPSI gene product. Shorter or longer sequences are anticipated to be of use in the presently disclosed subject matter. Thus, the term “CPSI gene product” also includes fusion or recombinant CPSI polypeptides and proteins.
- CPSI-encoding polynucleotide refers to any DNA sequence that is substantially identical to a polynucleotide sequence encoding a CPSI gene product, CPSI protein or CPSI polypeptide as defined above.
- the terms also refer to RNA, or antisense sequences, compatible with such DNA sequences.
- a "CPSI-encoding polynucleotide”, “CPSI gene”, “CPSI gene sequence” and “CPSI gene segment” may also comprise any combination of associated control sequences.
- substantially identical when used to define either a CPSI gene product or CPSI amino acid sequence, or a CPSI gene or CPSI nucleic acid sequence, means that a particular sequence, for example, a mutant sequence, varies from the sequence of a natural CPSI by one or more deletions, substitutions, or additions, the net effect of which is to retain at least some of biological activity of CPSI.
- DNA analog sequences are "substantially identical" to specific DNA sequences disclosed herein if: (a) the DNA analog sequence is derived from coding regions of the natural CPSI gene; or (b) the DNA analog sequence is capable of hybridization of DNA sequences of (a) under moderately stringent conditions and which encode biologically active CPSI gene product; or (c) the DNA sequences are degenerative as a result of the genetic code to the DNA analog sequences defined in (a) and/or (b). Substantially identical analog proteins will be greater than about 60% identical to the corresponding sequence of the native protein. Sequences having lesser degrees of similarity but comparable biological activity are considered to be equivalents. In determining nucleic acid sequences, all subject nucleic acid sequences capable of encoding substantially similar amino acid sequences are considered to be substantially similar to a reference nucleic acid sequence, regardless of differences in codon sequences.
- Percent Similarity may be determined, for example, by comparing sequence information using the GAP computer program, available from the
- the GAP program utilizes the alignment method of Needleman et al., J. Mol. Biol. 48:443 (1970), as revised by Smith et al., Adv. Appl. Math. 2:482 (1981 ). Briefly, the GAP program defines similarity as the number of aligned symbols (i.e. nucleotides or amino acids) that are similar, divided by the total number of symbols in the shorter of the two sequences.
- Representative default parameters for the GAP program include: (1 ) a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) of nucleotides and the weighted comparison matrix of Gribskov et al., Nucl. Acids. Res.
- C.2. Nucleic Acid Sequences in certain embodiments, the presently disclosed subject matter concerns the use of CPSI genes and gene products that include within their respective sequences a sequence which is essentially that of a CPSI gene, or the corresponding protein.
- a sequence essentially as that of a CPSI gene means that the sequence substantially corresponds to a portion of a CPSI polypeptide or CPSI encoding polynucleotide and has relatively few bases or amino acids (whether DNA or protein) which are not identical to those of a CPSI protein or CPSI gene, (or a biologically functional equivalent of, when referring to proteins).
- biologically functional equivalent is well understood in the art and is further defined in detail herein.
- sequences which have in some embodiments between about 70% and about 80%, in some embodiments between about 81 % and about 90%, and in some embodiments between about 91 % and about 99%, of amino acids which are identical or functionally equivalent to the amino acids of a CPSI protein or CPSI gene will be sequences which are "essentially the same".
- CPSI gene products and CPSI genes that have functionally equivalent codons are also covered by the presently disclosed subject matter.
- the same amino acid such as the six codons for arginine or serine, and also to refer to codons that encode biologically equivalent amino acids (see Table 1 ).
- amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned.
- the addition of terminal sequences particularly applies to nucleic acid sequences which may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.
- nucleic acid sequences that are “complementary” are those that are base-pairing according to the standard Watson-Crick complementarity rules.
- complementary sequences means nucleic acid sequences which are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of hybridizing to the nucleic acid segment in question under relatively stringent conditions such as those described herein.
- a particular example of a contemplated complementary nucleic acid segment is an antisense oligonucleotide.
- Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, or organic solvents, in addition to the base composition, length of the complementary strands, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art.
- Stringent temperature conditions will generally include temperatures in excess of 30°C, typically in excess of 37°C, and in some embodiments in excess of 45°C.
- Stringent salt conditions will ordinarily be less than 1 ,000 mM, typically less than 500 mM, and in some embodiments less than 200 mM. However, the combination of parameters is much more important than the measure of any single parameter. (See e.g., Wetmur & Davidson, J. Mol. Biol.
- Probe sequences may also hybridize specifically to duplex DNA under certain conditions to form triplex or other higher order DNA complexes.
- the preparation of such probes and suitable hybridization conditions are well known in the art.
- DNA segment refers to a DNA molecule which has been isolated free of total genomic DNA of a particular species.
- a DNA segment encoding a CPSI polypeptide refers to a DNA segment which contains CPSI coding sequences, yet is isolated away from, or purified free from, total genomic DNA of a source species, such as Homo sapiens.
- DNA segment includes DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phages, viruses, and the like.
- a DNA segment comprising an isolated or purified CPSI gene refers to a DNA segment including CPSI coding sequences isolated substantially away from other naturally occurring genes or protein encoding sequences.
- gene is used for simplicity to refer to a functional protein, polypeptide or peptide encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences and cDNA sequences.
- isolated substantially away from other coding sequences means that the gene of interest, in this case, the CPSI gene, forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or cDNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man.
- the presently disclosed subject matter concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a CPSI polypeptide that includes within its amino acid sequence an amino acid sequence of any of SEQ ID NOs:2, 4, 12 and 14.
- the presently disclosed subject matter concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence the amino acid sequence of a CPSI polypeptide corresponding to human tissues. It will also be understood that the presently disclosed subject matter is not limited to the particular nucleic acid and amino acid sequences of SEQ ID NOs: 1-4 and 11-14. Recombinant vectors and isolated DNA segments may therefore variously include the CPSI polypeptide-encoding region itself, include coding regions bearing selected alterations or modifications in the basic coding region, or include encoded larger polypeptides which nevertheless include CPSI polypeptide-encoding regions or may encode biologically functional equivalent proteins or peptides which have variant amino acid sequences.
- the presently disclosed subject matter concerns isolated DNA segments and recombinant vectors which encode a protein or peptide that includes within its amino acid sequence an amino acid sequence essentially as set forth in any of SEQ ID NOs:2, 4, 12, and 14.
- the exemplary nucleic acid sequence is that which is essentially as set forth in any of SEQ ID NOs: 1 , 3, 11 , and 13 and which encode a protein that exhibits activity in the urea cycle, as may be determined by, for example, colorimetric assays to detect production of carbonyl phosphate from ammonia, as disclosed herein in Example 3.
- sequence essentially as set forth in any of SEQ ID NO:2, 4, 12 and 14 means that the sequence substantially corresponds to a portion an amino acid sequence either of SEQ ID NOs:2, 4, 12 and 14 and has relatively few amino acids which are not identical to, or a biologically functional equivalent of, the amino acids of an amino acid sequence of any of SEQ ID NOs:2, 4, 12 and 14.
- biologically functional equivalent is well understood in the art and is further defined in detail herein.
- sequences which have in some embodiments between about 70% and about 80%, in some embodiments between about 81 % and about 90%, and in some embodiments between about 91% and about 99%; of amino acids which are identical or functionally equivalent to the amino acids in any of SEQ ID NOs: 2, 4, 12 and 14, will be sequences which "a sequence essentially as set forth in SEQ ID NOs:2, 4, 12 and 14".
- the presently disclosed subject matter concerns gene therapy methods that use isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence an amino acid sequence of any of SEQ ID NOs:2, 4, 12 and 14, SEQ ID NOs:2, 4, 12 and 14 including sequences which are derived from human tissue.
- the presently disclosed subject matter concerns isolated DNA sequences and recombinant DNA vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence the amino acid sequence of the CPSI protein from human hepatic tissue.
- the presently disclosed subject matter concerns isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in any of SEQ ID NO: 1 , 3, 11 , and 13.
- sequence essentially as set forth in any of SEQ ID NO: 1 , 3, 11 , and 13 is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of any of SEQ ID NOs: 1 , 3, 11 and 13, respectively, and has relatively few codons which are not identical, or functionally equivalent, to the codons of any of SEQ ID NOs: 1 , 3, 11 and 13, respectively.
- DNA segments which encode gene products exhibiting activity in the urea cycle, cross-reactivity with an anti-CPSI antibody, or other biological activity of the CPSI gene product can be employed.
- the term "functionally equivalent codon” is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also to refer to codons that encode biologically equivalent amino acids (see Table 1 ).
- the nucleic acid segments of the presently disclosed subject matter regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, enhancers, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably.
- nucleic acid fragments of almost any length may be employed, with the total length being limited in some embodiments by the ease of preparation and use in the intended recombinant DNA protocol.
- nucleic acid fragments can be prepared which include a short stretch complementary to a nucleic acid sequence set for in any of SEQ ID NOs: 1 , 3, 11 , and 13 respectively, such as about 10 nucleotides, and which are up to 10,000 or 5,000 base pairs in length, with segments of 3,000 being preferred in certain cases.
- DNA segments with total lengths of about 1 ,000, 500, 200, 100 and about 50 base pairs in length are also contemplated to be useful.
- DNA segments of the presently disclosed subject matter encompass biologically functional equivalent CPSI proteins and peptides. Such sequences may rise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded.
- functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged, e.g. substitution of lie and Leu at amino acids 4 and 5 is SEQ ID NOs:11-14.
- Changes designed by man may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicityofthe protein or to test CPSI mutants in order to examine activity in the urea cycle, or other activity at the molecular level.
- site-directed mutagenesis techniques e.g., to introduce improvements to the antigenicityofthe protein or to test CPSI mutants in order to examine activity in the urea cycle, or other activity at the molecular level.
- one may also prepare fusion proteins and peptides, e.g., where the CPSI coding region is aligned within the same expression unit with other proteins or peptides having desired functions, such as for purification or immunodetection purposes (e.g., proteins which may be purified by affinity chromatography and enzyme label coding regions, respectively).
- Recombinant vectors form important further aspects of the presently disclosed subject matter.
- Particularly useful vectors are contemplated to be those vectors in which the coding portion of the DNA segment is positioned under the control of a promoter.
- the promoter may be in the form of the promoter which is naturally associated with the CPSI gene, e.g., in mammalian tissues, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment or exon, for example, using recombinant cloning and/or PCR technology, in connection with the compositions disclosed herein.
- a recombinant or heterologous promoter is intended to refer to a promoter that is not normally associated with a CPSI gene in its natural environment.
- Such promoters may include promoters isolated from bacterial, viral, eukaryotic, or mammalian cells.
- promoters isolated from bacterial, viral, eukaryotic, or mammalian cells.
- it will be important to employ a promoter that effectively directs the expression of the DNA segment in the cell type chosen for expression The use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al., 1989, incorporated herein by reference.
- the promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides.
- Appropriate promoter systems provided for use in high- level expression include, but are not limited to, the vaccina virus promoter and the baculovirus promoter.
- the presently disclosed subject matter provides an expression vector comprising a polynucleotide that encodes a CPSI polypeptide having activity in the urea cycle, cross-reacting with an anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter.
- an expression vector of the presently disclosed subject matter comprises a polynucleotide that encodes a human CPSI gene product. In some embodiments, an expression vector of the presently disclosed subject matter comprises a polynucleotide that encodes a polypeptide comprising an amino acid residue sequence of any of SEQ ID NOs: 2, 4, 12 and 14. In some embodiments, an expression vector of the presently disclosed subject matter comprises a polynucleotide comprising the nucleotide base sequence of any of SEQ ID NO: 1 , 3, 11 and 13. In some embodiments, an expression vector of the presently disclosed subject matter comprises a polynucleotide operatively linked to an enhancer-promoter.
- an expression vector of the presently disclosed subject matter comprises a polynucleotide operatively linked to a prokaryotic promoter.
- an expression vector of the presently disclosed subject matter comprises a polynucleotide operatively linked to an enhancer-promoter that is a eukaryotic promoter, and the expression vector further comprises a polyadenylation signal that is positioned 3' of the carboxy-terminal amino acid and within a transcriptional unit of the encoded polypeptide.
- the presently disclosed subject matter provides a recombinant host cell transfected with a polynucleotide that encodes a CPSI polypeptide having activity in the modulation of the urea cycle, cross-reactivity with an anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter.
- SEQ ID NO's: 1-4 and 11-14 set forth nucleotide and amino acid sequences from an exemplary vertebrate, human.
- Nertebrates including rat.
- a recombinant host cell of the presently disclosed subject matter is transfected with the polynucleotide that encodes human CPSI polypeptide.
- a recombinant host cell of the presently disclosed subject matter is transfected with the polynucleotide sequence of any of SEQ ID NOs: 1 , 3, 11 , and 13.
- a host cell of the presently disclosed subject matter is a eukaryotic host cell.
- a recombinant host cell of the presently disclosed subject matter is a vertebrate cell. In some embodiments, a recombinant host cell of the presently disclosed subject matter is a mammalian cell. In another aspect, a recombinant host cell of the presently disclosed subject matter is a prokaryotic host cell. In some embodiments, a recombinant host cell of the presently disclosed subject matter is a bacterial cell, in some embodiments a strain of Escherichia coli.
- a recombinant host cell comprises a polynucleotide under the transcriptional control of regulatory signals functional in the recombinant host cell, wherein the regulatory signals appropriately control expression of the CPSI polypeptide in a manner to enable all necessary transcriptional and post-transcriptional modification.
- the presently disclosed subject matter provides a method of preparing a CPSI polypeptide comprising transfecting a cell with polynucleotide that encodes a CPSI polypeptide having activity in the urea cycle, cross-reacting with an anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter, to produce a transformed host cell; and maintaining the transformed host cell under biological conditions sufficient for expression of the polypeptide.
- the transformed host cell is a eukaryotic cell.
- the eukaryotic cell is a vertebrate cell.
- the host cell is a prokaryotic cell.
- the prokaryotic cell is a bacterial cell of Escherichia coli.
- a polynucleotide transfected into the transformed cell comprises a nucleotide base sequence of any of SEQ ID NOs: 1 , 3, 11 , and 13.
- SEQ ID NOs: 1-4 and 11 -14 set forth nucleotide and amino acid sequences for an exemplary vertebrate, human.
- longer DNA segments will most often be used, in some embodiments DNA segments encoding the entire CPSI protein or functional domains or cleavage products thereof.
- shorter DNA segments to direct the expression of CPSI peptides or epitopic core regions, such as may be used to generate anti-CPSI antibodies, also falls within the scope of the presently disclosed subject matter.
- DNA segments which encode peptide antigens of in some embodiments from about 15 to about 50 amino acids in length, and of in some embodiments from about 15 to about 30 amino acids in length are contemplated to be particularly useful.
- DNA segments encoding peptides will generally have a minimum coding length in the order of about 45 to about 150, or to about 90 nucleotides.
- DNA segments encoding full length proteins may have a minimum coding length on the order of about 4,500 to about 4,600 nucleotides for a protein in accordance with any of SEQ ID NOs: 2, 4, 12 and 14.
- the presently disclosed subject matter also encompasses DNA segments which are complementary, or essentially complementary, to the sequences set forth in any of SEQ ID NO's: 1 , 3, 11 and 13.
- Sequences which are essentially the same as those set forth in any of SEQ ID NOs: 1 , 3, 11 , and 13 may also be functionally defined as sequences which are capable of hybridizing to a nucleic acid segment containing the complement in any of SEQ ID NOs: 1 , 3, 11 , and 13 under relatively stringent conditions. Suitable relatively stringent hybridization conditions are described herein and will be well known to those of skill in the art.
- C.2. Biologically Functional Equivalents
- modification and changes may be made in the structure of the CPSI proteins and peptides described herein and still obtain a molecule having like or otherwise desirable characteristics.
- certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive capacity with structures such as, for example, in the nucleus of a cell. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a protein with like or even countervailing properties (e.g., antagonistic v. agonistic).
- residues are shown to be particularly important to the biological or structural properties of a protein or peptide, e.g., residues in active sites, such residues may not generally be exchanged. This is the case in the presently disclosed subject matter, where if any changes, for example, in the phosphorylation domains of a CPSI polypeptide, could result in a loss of an aspect of the utility of the resulting peptide for the presently disclosed subject matter.
- Amino acid substitutions such as those which might be employed in modifying the CPSI proteins and peptides described herein, are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
- arginine, lysine and histidine are all positively charged residues; that alanine, glycine and serine are all a similar size; and that phenylalanine, tryptophan and tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as biologically functional equivalents. In making such changes, the hydropathic index of amino acids may be considered.
- Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); praline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
- Pat. No.4,554,101 states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a biological property of the protein. It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent protein. As detailed in U.S. Pat.
- substitution of amino acids whose hydrophilicity values are in some embodiments within +2 ofthe original value, in some embodiments within ⁇ 1 of the original value, and in some embodiments within ⁇ 0.5 of the original value can be employed in making changes based upon similar hydrophilicity values. While discussion has focused on functionally equivalent polypeptides arising from amino acid changes, it will be appreciated that these changes may be effected by alteration of the encoding DNA, taking into consideration also that the genetic code is degenerate and that two or more codons may code for the same amino acid.
- C.3. Sequence Modification Techniques Modifications to the CPSI proteins and peptides described herein may be carried out using techniques such as site directed mutagenesis.
- Site- specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA.
- the technique further provides a ready ability to prepare and test sequence variants, for example, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA.
- Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed.
- a primer of in some embodiments about 17 to 30 nucleotides in length can be employed, with about
- the technique of site-specific mutagenesis is well known in the art as exemplified by publications (e.g., Adelman et al., 1983). As will be appreciated, the technique typically employs a phage vector which exists in both a single stranded and double stranded form.
- Typical vectors useful in site- directed mutagenesis include vectors such as the M13 phage (Messing et al., 1981 ). These phage are readily commercially available and their use is generally well known to those skilled in the art.
- Double stranded plasmids are also routinely employed in site directed mutagenesis which eliminates the step of transferring the gene of interest from a plasmid to a phage.
- site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector or melting apart the two strands of a double stranded vector which includes within its sequence a DNA sequence which encodes, for example, a human CPSI polypeptide.
- An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically, for example by the method of Crea et al. (1978). This primer is then annealed with the single-stranded vector, and subjected to DNA polymerizing enzymes such as E.
- sequence variants of the selected gene using site- directed mutagenesis is provided as a means of producing potentially useful CPSI polypeptide or other species having activity in the urea cycle and is not meant to be limiting as there are other ways in which sequence variants of these peptides may be obtained.
- recombinant vectors encoding the desired genes may be treated with mutagenic agents to obtain sequence variants (see, e.g., a method described by Eichenlaub, 1979) for the mutagenesis of plasmid DNA using hydroxylamine.
- these poly A addition sites are placed about 30 to 2000 nucleotides "downstream" ofthe coding sequence at a position prior to transcription termination.
- control sequences of the specific gene i.e., a CPSI promoter for a CPSI gene
- a CPSI promoter for a CPSI gene there is no reason why other control sequences could not be employed, so long as they are compatible with the genotype of the cell being treated.
- useful promoters including, e.g., an SV40 early promoter, a long terminal repeat promoter from retrovirus, an actin promoter, a heat shock promoter, a metallothionein promoter, and the like.
- a promoter is a region of a DNA molecule typically within about 100 nucleotide pairs in front of (upstream of) the point at which transcription begins (i.e., a transcription start site). That region typically contains several types of DNA sequence elements that are located in similar relative positions in different genes.
- the term "promoter” includes what is referred to in the art as an upstream promoter region, a promoter region or a promoter of a generalized eukaryotic RNA Polymerase II transcription unit.
- Another type of discrete transcription regulatory sequence element is an enhancer.
- An enhancer provides specificity of time, location and expression level for a particular encoding region (e.g., gene).
- an enhancer A major function of an enhancer is to increase the level of transcription of a coding sequence in a cell that contains one or more transcription factors that bind to that enhancer. Unlike a promoter, an enhancer can function when located at variable distances from transcription start sites so long as a promoter is present.
- the phrase "enhancer-promoter” means a composite unit that • contains both enhancer and promoter elements.
- An enhancer-promoter is operatively linked to a coding sequence that encodes at least one gene product.
- the phrase "operatively linked” means that an enhancer-promoter is connected to a coding sequence in such a way that the transcription of that coding sequence is controlled and regulated by that enhancer-promoter.
- Means for operatively linking an enhancer-promoter to a coding sequence are well known in the art.
- the precise orientation and location relative to a coding sequence whose transcription is controlled is dependent inter alia upon the specific nature ofthe enhancer-promoter.
- a TATA box minimal promoter is typically located from about 25 to about 30 base pairs upstream of a transcription initiation site and an upstream promoter element is typically located from about 100 to about 200 base pairs upstream of a transcription initiation site.
- an enhancer can be located downstream from the initiation site and can be at a considerable distance from that site.
- An enhancer-promoter used in a vector construct of the presently disclosed subject matter can be any enhancer-promoter that drives expression in a cell to be transfected.
- an enhancer-promoter with well-known properties, the level and pattern of gene product expression can be optimized.
- introduction of, for example, the human CPSI gene including allelic variations thereof it is proposed that one will desire to employ a vector construct that will deliver the desired gene to the affected cells. This will, of course, generally require that the construct be delivered to the targeted cells, for example, mammalian hepatic cells. It is proposed that this can be achieved in some embodiments by introduction ofthe desired gene through the use of a viral vector to carry the CPSI sequence to efficiently infect the cells.
- vectors can be in some embodiments an adenoviral, a retroviral, a vaccinia viral vector, or adeno-associated virus. These vectors are preferred because they have been successfully used to deliver desired sequences to cells and tend to have high infection efficiency. Suitable vector-CPSI gene constructs are adapted for administration as pharmaceutical compositions, as described herein below. Commonly used viral promoters for expression vectors are derived from polyoma, cytomegalovirus, Adenovirus 2, and Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication.
- SV40 Simian Virus 40
- SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hind III site toward the Bgl I site located in the viral origin of replication. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.
- the origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be.derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
- the CPSI gene can thus comprise the threonine encoding allele such that amino acid 1405 of the encoded polypeptide comprises threonine.
- the CPSI gene comprises the arginine encoding allele such that amino acid 1405 ofthe encoded polypeptide comprises arginine.
- certain regions of a CPSI gene can be employed exclusively without employing an entire wild type CPSI gene or an entire allelic variant thereof. In some embodiments, the smallest region needed to modulate the urea cycle is employed so that one is not introducing unnecessary DNA into cells that receive a CPSI gene construct.
- transgenic non-human animal which expresses a CPSI gene ofthe presently disclosed subject matter or in which expression of a CPSI gene is "knocked-out".
- Provided transgenic non-human animals express either the T1405 form of CPSI or the N1405 form of CPSI.
- An exemplary transgenic animal is a mouse.
- Techniques for the preparation of transgenic animals are known in the art. Exemplary techniques are described in U.S. Patent No. 5,489,742 (transgenic rats); U.S. Patent Nos.4,736,866, 5,550,316, 5,614,396, 5,625,125 and 5,648,061 (transgenic mice); U.S. Patent No.
- transgenic pigs cloned recombinant or synthetic DNA sequences or DNA segments encoding a CPSI gene product are injected into fertilized mouse eggs.
- the injected eggs are implanted in pseudo pregnant females and are grown to term to provide transgenic mice whose cells express a CPSI gene product.
- the injected sequences are constructed having promoter sequences connected so as to express the desired protein in hepatic cells of the transgenic mouse.
- CPSI genes can be used for gene therapy in accordance with the presently disclosed subject matter. Exemplary gene therapy methods, including liposomal transfection of nucleic acids into host cells, are described in U.S. Patent Nos. 5,279,833; 5,286,634; 5,399,346; 5,646,008; 5,651 ,964; 5,641 ,484; and 5,643,567, the contents of each of which are herein incorporated by reference. Briefly, CPSI gene therapy directed toward modulation ofthe urea cycle in a target cell is described. Target cells include but are not limited to hepatic cells and intestinal cells.
- a therapeutic method of the presently disclosed subject matter provides a method for modulating of the urea cycle in a cell comprising the steps of: (a) delivering to the cell an effective amount of a DNA molecule comprising a polynucleotide that encodes a CPSI polypeptide that modulates the urea cycle; and (b) maintaining the cell under conditions sufficient for expression of said polypeptide. Delivery is accomplished in some embodiments by injecting the DNA molecule into the cell. Where the cell is in a subject, delivery can be accomplished in some embodiments by administering the DNA molecule into the circulatory system of the subject.
- administering comprises the steps of: (a) providing a vehicle that contains the DNA molecule; and (b) administering the vehicle to the subject.
- a vehicle is in some embodiments a cell transformed or transfected with the DNA molecule or a transfected cell derived from such a transformed or transfected cell.
- An exemplary transformed or transfected cell is a hepatic cell. Means for transforming or transfecting a cell with a DNA molecule of the presently disclosed subject matter are set forth above.
- the vehicle is a virus or an antibody that specifically infects or immunoreacts with an antigen ofthe tumor.
- Retroviruses used to deliver the constructs to the host target tissues generally are viruses in which the 3'-LTR (linear transfer region) has been inactivated. That is, these are enhancerless 3'- LTRs, often referred to as SIN (self-inactivating viruses) because after productive infection into the host cell, the 3'-LTR is transferred to the 5'-end and both viral LTRs are inactive with respect to transcriptional activity.
- SIN self-inactivating viruses
- a use of these viruses well known to those skilled in the art is to clone genes for which the regulatory elements of the cloned gene are inserted in the space between the two LTRs.
- An advantage of a viral infection system is that it allows for a very high level of infection into the appropriate recipient cell. Antibodies have been used to target and deliver DNA molecules.
- N-terminal modified poly-L-lysine (NPLL)-antibody conjugate readily forms a complex with plasmid DNA.
- a complex of monoclonal antibodies against a cell surface thrombomodulin conjugated with NPLL was used to target a foreign plasmid DNA to an antigen-expressing mouse lung endothelial cell line and mouse lung. Those targeted endothelial cells expressed the product encoded by that foreign DNA.
- this embodiment of the presently disclosed subject matter can be practiced using alternative viral or phage vectors, including retroviral vectors and vaccinia viruses whose genome has been manipulated in alternative ways so as to render the virus non-pathogenic. Methods for creating such a viral mutation are set forth in detail in U.S. Patent No.
- a human CPSI-encoding polynucleotide or a CPSI-encoding polynucleotide homolog from another warm-blooded vertebrate or a CPSI-encoding homolog from an invertebrate source, such as bacteria or yeast is introduced into isolated hepatic cells or other relevant cells.
- the re- injection of the transgene-carrying cells into the liver or other relevant tissues provides a treatment for susceptibility to hyperammonemia or other relevant diseases in human and animals.
- the urea cycle is the body's intrinsic source of arginine which acts as a precursor of nitric oxide (NO), a potent vasodilator.
- NO nitric oxide
- Methods of treating suboptimal urea cycle function are provided in accordance with the presently disclosed subject matter, including treatment by administration of nitric oxide precursors such as citrulline.
- the suboptimal urea cycle function is associated with the polymorphism disclosed herein.
- the sub-optimal urea cycle function can further comprise hyperammonemia or decreased citrulline and/or arginine production.
- the subject to be treated can be suffering from a disorder associated with sub-optimal urea cycle function, such as but not limited to a disorder associated with impaired production of nitric oxide precursors.
- a disorder associated with sub-optimal urea cycle function such as but not limited to a disorder associated with impaired production of nitric oxide precursors.
- disorders include but are not limited to disorders that involve impaired or damaged liver and/or gut tissue.
- Representative disorders include but are not limited to hepatitis (including hepatitis A, B and C), sclerosis, asthma, pulmonary hypertension (including primary and secondary), bone marrow transplant toxicity in a subject undergoing bone marrow transplant, and combinations thereof.
- the subject to be treated can also exposed or about to be exposed to an environmental stimulus associated with sub-optimal urea cycle function.
- environmental stimuli include but are not limited to stimuli that involve impairment or damage to liver and/or gut tissue.
- Representative environmental stimuli include but are not limited to chemotherapy or other pharmaceutical therapy, cardiac surgery (represented in some situations as increased postoperative pulmonary vascular tone), increased oxidative stress, bone marrow transplant, sepsis, acute asthma attack, hypoxia, hepatotoxin exposure, and combinations thereof.
- Representative cardiac surgeries include repair of congenital heart defects, and further includes cardiopulmonary bypass used for correction of congenital heart defects.
- Cardiac defects associated with excess pulmonary blood flow such as an atrioventricular septal defect (AVSD) or large unrestrictive ventricular septal defect (VSD) are representative cardiac defects. Sustained pulmonary overcirculation can cause hypertrophy and hyperreactivity of pulmonary vascular smooth muscle. Preoperatively, these patients often have congestive heart failure and poor weight gain.
- AVSD atrioventricular septal defect
- VSD large unrestrictive ventricular septal defect
- Surgical repair is scheduled as early as possible in order to reduce this postoperative complication.
- Additional cardiac defect correct procedures are bidirectional Glenn and modified Fontan procedures.
- patients with single ventricle lesions require surgical procedures where success depends on maintenance of low postoperative pulmonary vascular tone.
- Staged correction of a single ventricle lesion requires a series of 3 surgical procedures aimed at separating the pulmonary and systemic circulations.
- the first of these procedures, often performed in the neonatal period, is a Blalock-Taussig shunt for those patients with a hypoplastic right ventricle or a Norwood I procedure for those patients with hypoplastic left heart syndrome.
- the second surgery is a bidirectional Glenn shunt where superior vena cava flow is diverted directly into the pulmonary artery.
- the third and final stage is a modified Fontan procedure where inferior vena cava flow is diverted into the pulmonary artery, thereby completing separation of the pulmonary and systemic circulations.
- pulmonary blood flow is entirely passive and relies on an adequate pressure gradient between the venous system (SVC and IVC pressure) and the PA pressure. Any elevation in the pulmonary vascular tone in the immediate postoperative period can lead to decreased pulmonary blood flow and a subsequent fall in cardiac output. On a longer term, elevated pulmonary vascular tone after these procedures can lead to persistent pleural effusions, prolonged requirement for pleural or mediastinal drainage tubes, prolonged ventilation, and prolonged ICU stays. Additional cardiac defect correct procedures are Norwood I procedures.
- a method of treating or preventing a disorder related to sub-optimal urea cycle function in a subject comprises administering to the subject a therapeutically effective amount of a nitric oxide precursor, whereby treatment or prevention of the disorder is accomplished.
- the nitric oxide precursor can include but is not limited to citrulline, arginine and combinations thereof.
- sub-optimal nitric oxide formation resulting from sub- optimal urea cycle function can be treated.
- a method of treating or preventing a disorder selected from the group consisting hepatitis, cirrhosis, pulmonary hypertension (both primary and secondary), necrotizing enterocolitis (NEC), Acute Respiratory Distress Syndrome, ethnic specific endothelial dysfunction, erectile dysfunction, asthma, and combinations thereof, in a subject is also disclosed.
- the method comprises administering to a subject in need thereof a therapeutically effective amount of a nitric oxide precursor.
- the administering can be intravenous or oral administration.
- the nitric oxide precursor can be selected from the group consisting of citrulline, arginine and combinations thereof.
- the disorder is necrotizing enterocolitis (NEC) and the subject is a premature infant.
- a method of raising a level of a nitric acid precursor in a subject in need thereof is also disclosed.
- the method comprises administering to the subject a therapeutically effective amount of a nitric oxide precursor, whereby a level of a nitric oxide precursor in the subject is raised.
- the administering can be intravenous or oral administration.
- the nitric oxide precursor can be selected from the group consisting of citrulline, arginine and combinations thereof.
- a supplementation therapy method ofthe presently disclosed subject matter further comprises the step of initially detecting a polymorphism of a carbamyl phosphate synthase I (CPSI) gene in the subject.
- the polymorphism ofthe carbamyl phosphate synthetase polypeptide comprises in some embodiments a C to A transversion within CPSI exon 36, comprises in some embodiments a C to A transversion at nucleotide 4340 of a cDNA that corresponds to the CPSI gene, and in some embodiments, the C to A transversion at nucleotide 4340 ofthe cDNA that corresponds to the CPSI gene further comprises a change in the triplet code from AAC to ACC, which encodes a CPSI polypeptide having an threonine moiety at amino acid 1405.
- urea cycle intermediates (citrulline, arginine) was observed in subjects undergoing BMT associated with the T1405N CPSI polymorphism disclosed herein.
- a method for the treatment or prophylaxis of BMT toxicity comprising administering a therapeutically effective amount of a NO precursor, such as citrulline and/or arginine, to a subject in need thereof is also provided in accordance with the presently disclosed subject matter.
- the T1405N CPSI polymorphism disclosed herein is present in the subject.
- a therapeutically effective amount of citrulline is administered to the subject.
- a method of reducing toxicity and/or the occurrence of HVOD in a subject undergoing BMT comprises administering the BMT subject an effective amount of arginine and/or citrulline, in some embodiments citrulline, to bolster arginine and NO synthesis in the subject.
- the bolstering of arginine and NO synthesis in the subject will reduce and/or substantially prevent the occurrence of HVOD associated with BMT.
- Citrulline is a representative supplementation agent given that it is more readily converted to NO.
- subjects having the CPSI polymorphism ofthe presently disclosed subject matter are contemplated to be exemplary candidates for supplementation in accordance with this method.
- the subject treated in the presently disclosed subject matter in its many embodiments is desirably a human subject, although it is to be understood that the principles of the presently disclosed subject matter indicate that the presently disclosed subject matter is effective with respect to all vertebrate species, including warm-blooded vertebrates such as mammals and birds, which are intended to be included in the term "subject".
- a mammal is understood to include any mammalian species in which treatment of hyperammonemia, BMT toxicity and other diseases associated with impaired urea cycle function is desirable, particularly agricultural and domestic mammalian species.
- contemplated is the treatment of mammals such as humans, as well as those mammals of importance due to being endangered (such as Siberian tigers), of economical importance (animals raised on farms for consumption by humans) and/or social importance (animals kept as pets or in zoos) to humans, for instance, carnivores otherthan humans (such as cats and dogs), swine (pigs, hogs, and wild boars), ruminants (such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels), and horses.
- endangered such as Siberian tigers
- social importance animals kept as pets or in zoos
- carnivores otherthan humans such as cats and dogs
- swine pigs, hogs, and wild boars
- ruminants such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels
- domesticated fowl i.e., poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economical importance to humans.
- livestock including, but not limited to, domesticated swine (pigs and hogs), ruminants, horses, poultry, and the like.
- the amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration.
- a formulation intended for administration to humans may contain from 0.5 mg to 5 g of active agent compounded with an appropriate and convenient amount of carrier material which may vary from about 5 to about 95 percent of the total composition.
- the doses per person per administration are generally between 1 mg and 500 mg up to several times per day.
- dosage unit forms will generally contain between from about 1 mg to about 500 mg of an active ingredient, typically 25 mg, 50 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 800 mg, or 1000 mg.
- the nitric oxide precursor is administered in some embodiments in a dose ranging from about 0.01 mg to about 1 ,000 mg, in some embodiments in a dose ranging from about 0.5 mg to about 500 mg, and in some embodiments in a dose ranging from about 1.0 mg to about 250 mg.
- the nitric oxide precursor can also be administered in some embodiments in a dose ranging from about 100 mg to about 30,000 mg, and in some embodiments in a dose ranging from about 250 mg to about 1 ,000 mg.
- a representative dose is 3.8 g/m2/day of arginine or citrulline (molar equivalents, MW L-citrulline 175.2, MW L-arginine 174.2).
- Representative intravenous citrulline solutions can comprise a 100 mg/ml (10%) solution.
- Representative intravenous citrulline dosages can comprise 200 mg/kg, 400 mg/kg, 600 mg/kg, and 800 mg/kg.
- the dose can be decreased by an amount ranging from 50 mg/kg and 100 mg/kg to mitigate observed undesired effects on systemic blood pressure.
- doses can be administered to a subject, prior to exposure to an environmental stimulus (e.g.
- one dose 30 minutes before initiation of a cardiac surgery such as cardiopulmonary bypass and/or up to 1 , 2, 3, 4, 5, 6 or more dosages over a perioperative period, such as every 12 hours over a period of time prior to surgery) after exposure to an environmental stimulus (e.g. upon arrival to a postoperative care setting, and/or up to 1 , 2, 3, 4, 5, 6 or more dosages over a postoperative period, such as every 12 hours over a period of time after surgery).
- an environmental stimulus e.g. upon arrival to a postoperative care setting, and/or up to 1 , 2, 3, 4, 5, 6 or more dosages over a postoperative period, such as every 12 hours over a period of time after surgery.
- the specific dose level for any particular subject will depend upon a variety of factors including the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
- compositions comprising a polypeptide or polynucleotide ofthe presently disclosed subject matter and a physiologically acceptable carrier.
- a pharmaceutical composition comprises a polynucleotide that encodes a biologically active CPSI polypeptide.
- provided pharmaceutical compositions comprise citrulline or arginine in dosages as described above.
- a composition of the presently disclosed subject matter is typically administered orally or parenterally in dosage unit formulations containing standard, well-known nontoxic physiologically acceptable carriers, adjuvants, and vehicles as desired.
- parenteral as used herein includes intravenous, intra-muscular, intra-arterial injection, or infusion techniques.
- Injectable preparations for example sterile injectable aqueous or oleaginous suspensions, are formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
- the sterile injectable preparation can also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol.
- acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil can be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid find use in the preparation of injectables.
- exemplary carriers include neutral saline solutions buffered with phosphate, lactate, Tris, and the like.
- a representative means of purifying the vector involves the use of buoyant density gradients, such as cesium chloride gradient centrifugation.
- a transfected cell can also serve as a carrier.
- a liver cell can be removed from an organism, transfected with a polynucleotide ofthe presently disclosed subject matter using methods set forth above and then the transfected cell returned to the organism (e.g. injected intra-vascularly).
- the presently disclosed subject matter provides an antibody immunoreactive with a polypeptide or polynucleotide of the presently disclosed subject matter.
- an antibody of the presently disclosed subject matter is a monoclonal antibody.
- Means for preparing and characterizing antibodies are well known in the art (See, e.g., Antibodies A Laboratory Manual, E. Howell and D. Lane, Cold Spring Harbor Laboratory, 1988).
- antibodies distinguish between the different forms of CPSI which comprise the CPSI polymorphism.
- a polyclonal antibody is prepared by immunizing an animal with an immunogen comprising a polypeptide or polynucleotide of the presently disclosed subject matter, and collecting antisera from that immunized animal.
- an immunogen comprising a polypeptide or polynucleotide of the presently disclosed subject matter
- collecting antisera from that immunized animal A wide range of animal species can be used for the production of antisera.
- an animal used for production of anti-antisera is a rabbit, a mouse, a rat, a hamster or a guinea pig. Because of the relatively large blood volume of rabbits, a rabbit is an exemplary choice for production of polyclonal antibodies.
- a given polypeptide or polynucleotide may vary in its immunogenicity. It is often necessary therefore to couple the immunogen (e.g., a polypeptide or polynucleotide) of the presently disclosed subject matter) with a carrier.
- exemplary carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA).
- albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers.
- Means for conjugating a polypeptide or a polynucleotide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobencoyl-N-hydroxysuccinimide ester, carbodiimide and bis-biazotized benzidine.
- immunogenicity to a particular immunogen can be enhanced by the use of non-specific stimulators of the immune response known as adjuvants.
- Exemplary adjuvants include complete
- the amount of immunogen used of the production of polyclonal antibodies varies, inter alia, upon the nature of the immunogen as well as the animal used for immunization.
- routes can be used to administer the immunogen, e.g. subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal.
- the production of polyclonal antibodies is monitored by sampling blood of the immunized animal at various points following immunization. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored.
- the presently disclosed subject matter provides a method of producing an antibody immunoreactive with a CPSI polypeptide, the method comprising the steps of (a) transfecting recombinant host cells with a polynucleotide that encodes that polypeptide; (b) culturing the host cells under conditions sufficient for expression of the polypeptide; (c) recovering the polypeptide; and (d) preparing antibodies to the polypeptide.
- the CPSI polypeptide is capable of mediating the first step ofthe urea cycle, cross-reacting with anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter.
- the presently disclosed subject matter provides antibodies prepared according to the method described above.
- a monoclonal antibody of the presently disclosed subject matter can be readily prepared through use of well-known techniques such as those exemplified in U.S. Patent No 4,196,265, herein incorporated by reference.
- a technique involves first immunizing a suitable animal with a selected antigen (e.g., a polypeptide or polynucleotide of the presently disclosed subject matter) in a manner sufficient to provide an immune response. Rodents such as mice and rats are exemplary animals. Spleen cells from the immunized animal are then fused with cells of an immortal myeloma cell. Where the immunized animal is a mouse, a representative myeloma cell is a murine NS-1 myeloma cell.
- the fused spleen/myeloma cells are cultured in a selective medium to select fused spleen/myeloma cells from the parental cells.
- Fused cells are separated from the mixture of non-fused parental cells, for example, by the addition of agents that block the de novo synthesis of nucleotides in the tissue culture media.
- agents are aminopterin, methotrexate, and azaserine. Aminopterin and methotrexate block de novo synthesis of both purines and pyrimidines, whereas azaserine blocks only purine synthesis.
- the media is supplemented with hypoxanthine and thymidine as a source of nucleotides.
- azaserine is used, the media is supplemented with hypoxanthine.
- This culturing provides a population of hybridomas from which specific hybridomas are selected. Typically, selection of hybridomas is performed by culturing the cells by single-clone dilution in microtiter plates, followed by testing the individual clonal supernatants for reactivity with an antigen- polypeptides. The selected clones can then be propagated indefinitely to provide the monoclonal antibody.
- mice are injected intraperitoneally with between about 1-200 ⁇ g of an antigen comprising a polypeptide of the presently disclosed subject matter.
- B lymphocyte cells are stimulated to grow by injecting the antigen in association with an adjuvant such as complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis).
- an adjuvant such as complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis).
- mice are boosted by injection with a second dose of the antigen mixed with incomplete Freund's adjuvant.
- mice are tail bled and the sera titered by immunoprecipitation against radiolabeled antigen.
- the process of boosting and titering is repeated until a suitable titer is achieved.
- the spleen ofthe mouse with the highest titer is removed and the spleen lymphocytes are obtained by homogenizing the spleen with a syringe.
- a spleen from an immunized mouse contains approximately 7 8
- myeloma cells are obtained from laboratory animals in which such cells have been induced to grow by a variety of well-known methods. Myeloma cells lack the salvage pathway of nucleotide biosynthesis. Because myeloma cells are tumor cells, they can be propagated indefinitely in tissue culture, and are thus denominated immortal. Numerous cultured cell lines of myeloma cells from mice and rats, such as murine NS-1 myeloma cells, have been established.
- Myeloma cells are combined under conditions appropriate to foster fusion with the normal antibody-producing cells from the spleen of the mouse or rat injected with the antigen/polypeptide of the presently disclosed subject matter. Fusion conditions include, for example, the presence of polyethylene glycol.
- the resulting fused cells are hybridoma cells.
- hybridoma cells grow indefinitely in culture.
- Hybridoma cells are separated from unfused myeloma cells by culturing in a selection medium such as HAT media (hypoxanthine, aminopterin, thymidine).
- Unfused myeloma cells lack the enzymes necessary to synthesize nucleotides from the salvage pathway because they are killed in the presence of aminopterin, methotrexate, or azaserine. Unfused lymphocytes also do not continue to grow in tissue culture. Thus, only cells that have successfully fused (hybridoma cells) can grow in the selection media. Each of the surviving hybridoma cells produces a single antibody. These cells are then screened for the production of the specific antibody immunoreactive with an antigen/polypeptide ofthe presently disclosed subject matter. Single cell hybridomas are isolated by limiting dilutions of the hybridomas.
- the hybridomas are serially diluted many times and, after the dilutions are allowed to grow, the supernatant is tested for the presence ofthe monoclonal antibody.
- the clones producing that antibody are then cultured in large amounts to produce an antibody of the presently disclosed subject matter in convenient quantity.
- a monoclonal antibody of the presently disclosed subject matter specific polypeptides and polynucleotide of the presently disclosed subject matter can be recognized as antigens, and thus identified. Once identified, those polypeptides and polynucleotide can be isolated and purified by techniques such as antibody-affinity chromatography. In antibody-affinity chromatography, a monoclonal antibody is bound to a solid substrate and exposed to a solution containing the desired antigen. The antigen is removed from the solution through an immunospecific reaction with the bound antibody. The polypeptide or polynucleotide is then easily removed from the substrate and purified.
- the presently disclosed subject matter provides a method of detecting a polypeptide of the presently disclosed subject matter, wherein the method comprises immunoreacting the polypeptides with antibodies prepared according to the methods described above to form antibody-polypeptide conjugates, and detecting the conjugates.
- the presently disclosed subject matter provides a method of detecting messenger RNA transcripts that encode a polypeptide of the presently disclosed subject matter, wherein the method comprises hybridizing the messenger RNA transcripts with polynucleotide sequences that encode the polypeptide to form duplexes; and detecting the duplex.
- the presently disclosed subject matter provides a method of detecting DNA molecules that encode a polypeptide ofthe presently disclosed subject matter, wherein the method comprises hybridizing DNA molecules with a polynucleotide that encodes that polypeptide to form duplexes; and detecting the duplexes.
- the detection and screening assays disclosed herein can be used as a prognosis tool. Human CPSI-encoding polynucleotides as well as their protein products can be readily used in clinical setting as a prognostic indicator for screening for susceptibility to hyperammonemia and to other heritable CPSI- related diseases in humans.
- the detection and screening assays disclosed herein can be also used as a part of a diagnostic method.
- Human CPSI-encoding polynucleotides as well as their protein products can be readily used in clinical setting to diagnose susceptibility to hyperammonemia and to other heritable CPSI-related diseases in humans.
- H.1. Screening Assays for a Polypeptide of the Presently disclosed subject matter The presently disclosed subject matter provides a method of screening a biological sample for the presence of a CPSI polypeptide.
- the CPSI polypeptide possesses activity in the urea cycle, cross- reactivity with an anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter.
- a biological sample to be screened can be a biological fluid such as extracellular or intracellular fluid or a cell or tissue extract or homogenate.
- a biological sample can also be an isolated cell (e.g., in culture) or a collection of cells such as in a tissue sample or histology sample.
- a tissue sample can be suspended in a liquid medium or fixed onto a solid support such as a microscope slide.
- Hepatic tissues comprise particularly contemplated tissues.
- antibodies which distinguish between the N1405 CPSI polypeptide and the T1405 CPSI polypeptide are provided. Such antibodies can comprise polyclonal antibodies but are in some embodiments monoclonal antibodies prepared as described hereinabove.
- a biological sample is exposed to an antibody immunoreactive with the polypeptide whose presence is being assayed.
- exposure is accomplished by forming an admixture in a liquid medium that contains both the antibody and the candidate polypeptide.
- Either the antibody or the sample with the polypeptide can be affixed to a solid support (e.g., a column or a microtiter plate).
- the biological sample is exposed to the antibody under biological reaction conditions and for a period of time sufficient for antibody-polypeptide conjugate formation.
- Biological reaction conditions include ionic composition and concentration, temperature, pH and the like. Ionic composition and concentration can range from that of distilled water to a 2 molal solution of NaCI.
- osmolality is from about 100 mosmols/l to about 400 mosmols/l and, in some embodiments from about 200 mosmols/l to about 300 mosmols/l.
- Temperature is in some embodiments from about 4°C to about 100°C, in some embodiments from about 15°C to about 50°C, and in some embodiments is from about 25°C to about 40°C.
- pH is in some embodiments from about a value of 4.0 to a value of about 9.0, in some embodiments from about a value of 6.5 to a value of about 8.5 and in some embodiments from about a value of 7.0 to a value of about 7.5.
- Exposure time will vary inter alia with the biological conditions used, the concentration of antibody and polypeptide and the nature of the sample (e.g., fluid or tissue sample). Means for determining exposure time are well known to one of ordinary skill in the art. Typically, where the sample is fluid and the -10 concentration of polypeptide in that sample is about 10 M, exposure time is from about 10 minutes to about 200 minutes. The presence of polypeptide in the sample is detected by detecting the formation and presence of antibody-polypeptide conjugates.
- Means for detecting such antibody-antigen (e.g., receptor polypeptide) conjugates or complexes are well known in the art and include such procedures as centrifugation, affinity chromatography and the like, binding of a secondary antibody to the antibody-candidate receptor complex. In some embodiments, detection is accomplished by detecting an indicator affixed to the antibody. Exemplary and well known such indicators 32 125 14 include radioactive labels (e.g., P, I, C), a second antibody or an enzyme such as horse radish peroxidase. Means for affixing indicators to antibodies are well known in the art. Commercial kits are available.
- the presently disclosed subject matter provides a method of screening a biological sample for the presence of antibodies immunoreactive with a CPSI polypeptide.
- the CPSI polypeptide has activity in the urea cycle, cross-reactivity with an anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter.
- a biological sample is exposed to a CPSI polypeptide under biological conditions and for a period of time sufficient for antibody-polypeptide conjugate formation and the formed conjugates are detected.
- a nucleic acid molecule and, particularly a probe molecule can be used for hybridizing as an oligonucleotide probe to a nucleic acid source suspected of encoding a CPSI polypeptide of the presently disclosed subject matter.
- the CPSI polypeptide has activity in the urea cycle, cross-reactivity with an anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter.
- the probing is usually accomplished by hybridizing the oligonucleotide to a DNA source suspected of possessing a CPSI gene.
- the probes constitute only a single probe, and in others, the probes constitute a collection of probes based on a certain amino acid sequence or sequences of the polypeptide and account in their diversity for the redundancy inherent in the genetic code.
- a suitable source of DNA for probing in this manner is capable of expressing a polypeptide of the presently disclosed subject matter and can be a genomic library of a cell line of interest. Alternatively, a source of DNA can include total DNA from the cell line of interest.
- DNA molecules can be used in a number of techniques including their use as: (1 ) diagnostic tools to detect normal and abnormal DNA sequences in DNA derived from subject's cells, such as a CPSI polymorphism described herein; (2) means for detecting and isolating other members ofthe polypeptide family and related polypeptides from a DNA library potentially containing such sequences; (3) primers for hybridizing to related sequences for the purpose of amplifying those sequences; (4) primers for altering native CPSI DNA sequences; as well as other techniques which rely on the similarity of the DNA sequences to those of the DNA segments herein disclosed.
- DNA sequence information provided by the presently disclosed subject matter allows for the preparation of relatively short DNA (or RNA) sequences (e.g., probes) that specifically hybridize to encoding sequences of a selected CPSI gene.
- nucleic acid probes of an appropriate length are prepared based on a consideration of the encoding sequence for a polypeptide of the presently disclosed subject matter. The ability of such nucleic acid probes to specifically hybridize to other encoding sequences lend them particular utility in a variety of embodiments. Most importantly, the probes can be used in a variety of assays for detecting the presence of complementary sequences in a given sample.
- a representative nucleic acid sequence employed for hybridization studies or assays includes probe sequences that are complementary to at least a 14 to 40 or so long nucleotide stretch of a nucleic acid sequence of the presently disclosed subject matter, such as a sequence shown in any of SEQ ID NOs: 1 , 3, 11 , and 13.
- a size of at least 14 nucleotides in length helps to ensure that the fragment is of sufficient length to form a duplex molecule that is both stable and selective.
- Molecules having complementary sequences in some embodiments over stretches greater than 14 bases in length can be employed to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of specific hybrid molecules obtained.
- nucleic acid molecules having gene- complementary stretches of 14 to 20 nucleotides or even longer can be employed.
- Such fragments can be readily prepared by, for example, directly synthesizing the fragment by chemical means, by application of nucleic acid reproduction technology, such as the PCR technology of U.S. Pat. No. 4,683,202, herein incorporated by reference, or by introducing selected sequences into recombinant vectors for recombinant production.
- a nucleotide sequence of the presently disclosed subject matter can be used for its ability to selectively form duplex molecules with complementary stretches of the gene.
- relatively stringent conditions For applications requiring a high degree of selectivity, one typically employs relatively stringent conditions to form the hybrids.
- relatively low salt and/or high temperature conditions such as provided by 0.02M-0.15M salt at temperatures of about 50°C to about 70°C including particularly temperatures of about 55°C, about 60°C and about 65°C.
- Such conditions are particularly selective, and tolerate little, if any, mismatch between the probe and the template or target strand.
- hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results.
- an appropriate means such as a label
- an appropriate means such as a label
- a wide variety of appropriate indicator means are known in the art, including radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of giving a detectable signal.
- an enzyme tag such as urease, alkaline phosphatase or peroxidase
- calorimetric indicator substrates are known which can be employed to provide a means visible to the human eye or spectrophotometrically, to identify specific hybridization with complementary nucleic acid-containing samples.
- the hybridization probes described herein are useful both as reagents in solution hybridization as well as in some embodiments employing a solid phase.
- the sample containing test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or surface.
- This fixed, single-stranded nucleic acid is then subjected to specific hybridization with selected probes under desired conditions.
- the selected conditions depend inter alia on the particular circumstances based on the particular criteria required (depending, for example, on the G+ C contents, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.).
- specific hybridization is detected, or even quantified, by means of the label.
- the presently disclosed subject matter provides a diagnostic assay kit for detecting the presence of a polypeptide ofthe presently disclosed subject matter in biological samples, where the kit comprises a first container containing a first antibody capable of immunoreacting with the polypeptide, with the first antibody present in an amount sufficient to perform at least one assay.
- the assay kits of the presently disclosed subject matter further comprise a second container containing a second antibody that immunoreacts with the first antibody.
- the antibodies used in the assay kits of the presently disclosed subject matter are monoclonal antibodies.
- the first antibody is affixed to a solid support.
- the first and second antibodies comprise an indicator, and, in some embodiments, the indicator is a radioactive label or an enzyme.
- the presently disclosed subject matter also provides a diagnostic kit for screening agents. Such a kit can contain a polypeptide of the presently disclosed subject matter.
- the kit can contain reagents for detecting an interaction between an agent and a receptor of the presently disclosed subject matter.
- the provided reagent can be radiolabeled.
- the kit can contain a known radiolabeled agent capable of binding or interacting with a receptor of the presently disclosed subject matter.
- the presently disclosed subject matter provides diagnostic assay kits for detecting the presence, in biological samples, of a polynucleotide that encodes a polypeptide of the presently disclosed subject matter, the kits comprising a first container that contains a second polynucleotide identical or complementary to a segment of at least 10 contiguous nucleotide bases of, in some embodiments, any of SEQ ID NOs: 1 , 3, 11 , and 13.
- the presently disclosed subject matter provides diagnostic assay kits for detecting the presence, in a biological sample, of antibodies immunoreactive with a polypeptide ofthe presently disclosed subject matter, the kits comprising a first container containing a CPSI polypeptide, that immunoreacts with the antibodies, with the polypeptide present in an amount sufficient to perform at least one assay.
- the CPSI polypeptide has activity in the urea cycle, cross-reactivity on an anti-CPSI antibody, or other biological activity in accordance with the presently disclosed subject matter.
- the reagents of the kit can be provided as a liquid solution, attached to a solid support or as a dried powder.
- the reagent when the reagent is provided in a liquid solution, the liquid solution is an aqueous solution. In some embodiments, when the reagent provided is attached to a solid support, the solid support can be chromatograph media or a microscope slide. When the reagent provided is a dry powder, the powder can be reconstituted by the addition of a suitable solvent. The solvent can be provided.
- EXAMPLES The following Examples have been included to illustrate representative modes of the presently disclosed subject matter. Certain aspects of the following Examples are described in terms of techniques or procedures found or contemplated by the present inventors to work well in the practice of the presently disclosed subject matter. These Examples are exemplified through the use of standard laboratory practices ofthe inventors. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following Examples are intended to be exemplary only in that numerous changes, modification, and alterations can be employed without departing from the spirit and scope of the presently disclosed subject matter.
- Plasma amino acids were measured in the Vanderbilt Diagnostic Laboratories, Vanderbilt University, Nashville, Tennessee. Briefly, a protein free extract of plasma was prepared by protein precipitation with sulfosalicylic acid and TM filtration through a 0.45 ⁇ m ACRODISC 4 filter (Gelman Sciences, Ann Arbor, Michigan). Amino acids were separated by cation exchange chromatography using a four-component pH- and ionic strength-graded lithium citrate buffer system on a Beckmann 7300 amino acid analyzer (Beckmann, Palo Alto, California).
- Post column derivatization of amino acids with ninhydrin allowed detection of primary amine amino acids at 570 nm, and secondary amines at 440 nm. Quantification was achieved by instrument calibration with standard reference materials (Sigma, St. Louis, Missouri). Statistics. Plasma amino acid values were expressed as mean + SEM.
- the T1405N polymorphism changes the DNA sequence as follows: CCT-GCC-ACC-CCA-GTG Normal
- C to A transversion replaces the pyrimidine C with the purine A which destroys a Msh site.
- the use of a primer from within the 35th intron of CPSI and an exotic primer from exon 36 of the CPSI gene reliably PCR amplifies a 387 bp fragment encompassing the region containing the change. This combination gives a robust amplification.
- PCR Ready-to-GoTM beads are also used in amplification (Pharmacia).
- the polymorphism was detected using a non-denaturing gel to take advantage ofthe secondary structures created by the C to A transversion. This change creates enough secondary structure to prevent reliable digestion by restriction enzymes (Msl I) to detect the polymorphism.
- Non-denaturing gels take advantage of the secondary structures created by this change. Fifteen (15) individuals were compared by this method and sequence analysis. To detect the DNA fragments in the gel, a silver staining technique was adapted. This inexpensive rapid method allowed visualization of bands shortly after electrophoresis. Statistical Analysis. A sufficient sample size was obtained to perform Chi Square analysis on the results. The Hardy-Weinburg equation was used to 2 2 calculate the expected frequencies for the genotypes (p + 2pq + q ). P values were obtained from a standard Chi Square table using 2 degrees of freedom.
- the threonine is within the allosteric domain, preceding the signature sequence PV(A/S)WP(T/S)(A/Q)E, a sequence that is important in the binding of the cofactor n-acetyl-glutamate (NAG).
- NAG cofactor n-acetyl-glutamate
- the C allele also referred to herein as the CPSIa allele or the threonine encoding allele, has a frequency of .62 in the examined population and the A allele, also referred to herein as the CPSIb allele or the asparagine encoding allele, has a frequency of 0.38.
- Bone marrow transplantation (BMT) and peripheral blood stem cell transplants (PBSCT) are increasingly being used as primary therapy for selected malignancies.
- BMT bone marrow transplantation
- PBSCT peripheral blood stem cell transplants
- Use of stem cell support for hematopoietic reconstitution allows for substantial escalation in the dose of chemotherapy in an attempt to eradicate potentially lethal cancers.
- prophylaxis for infection and prevention of disabling graft-versus-host disease chemotherapy-induced organ dysfunction remains a significant barrierto more widespread use of this treatment.
- Hepatic venocclusive disease a clinical syndrome of hyperbilirubinemia (serum bilirubin > 2.0 mg/dL), hepatomegaly, and fluid retention early after BMT, is a major dose-limiting toxicity after BMT, afflicting up to 54% of patients.
- Many patients developing HVOD after BMT will also meet the criteria for acute lung injury (ALI). Nearly half of patients with severe HVOD require mechanical ventilation, with an attendant mortality in excess of 90%.
- ALI acute lung injury
- Hepatic venocclusive disease was identified in patients with bilirubin > 2 mg/dL before 21 days after transplant with either weight gain > 5% of baseline or new onset of fender hepatomegaly.
- Acute lung injury was defined as bilateral infiltrates on chest roentgenogram for three consecutive dates with a ratio of partial pressure of oxygen in arterial blood to the fraction of inspired oxygen concentration(Pa0 2 /Fi0 2 )of less than 300 in the absence of clinical cardiac dysfunction.
- Patients alive 60 days after transplant were defined as survivors. Plasma, circulating cell pellets, and urine were collected at study enrollment (before receiving chemotherapy) and on the day of BMT, several days after completing high dose chemotherapy but before marrow infusion.
- Amino Acid Analysis was performed on cryopreserved plasma samples from days -8 and 0 (pre-treatment and day of transplantation) in 60 patients. Patient samples were initially randomly selected for pilot studies; subsequently analyzed samples were specifically enriched to include extra patients with the SNP AA genotype of CPS-I (see below) and additional patients with the post-BMT complications of HVOD and ALI. A protein free extract of plasma was prepared by protein precipitation with sulfosalicylic acid and filtration through a 0.45 ⁇ m Acrodisc 4 (Gelman Sciences, Ann Arbor, Michigan).
- Amino acids were separated by cation exchange chromatography using a four-component pH- and ionic strength-graded lithium citrate buffer system on a Beckmann 7300 amino acid analyzer (Beckmann, Palo Alto, California). Post column derivatization of amino acids with ninhydrin allowed detection of primary amine amino acids at 570 nm, and secondary amines at 440 nm. Quantitation was achieved by instrument calibration with standard reference materials (Sigma, St. Louis, Missouri). Citrulline, arginine, and ornithine were examined as measurable indices of flux of intermediates through the urea cycle. Measurement of plasma nitric oxide metabolites (NO * ).
- Plasma NO x was measured in a subgroup of patients using modified Griess reagents after samples were deproteinated and incubated with cadmium beads to convert nitrate to nitrite. Detection of T1405N polymorphism. Oligonucleotide primers from within the 36 th exon (CGGAAGCCACATCAGACTGG (SEQ ID NO:15) and intron (GGAGAGTGAAACTTGACAATCATC (SEQ ID NO: 16)) of CPS1 and the polymerase chain reaction (PCR) to reliably amplify a 251 bp fragment encompassing the region containing the change from genomic DNA obtained from buffy coat preparations or urinary sediment.
- PCR polymerase chain reaction
- a cohort of 100 patients with Alzheimer's disease was analyzed to assess the distribution of CPSI SNP genotypes.
- Plasma amino acid levels before and after chemotherapy, and levels between groups of patients, were compared using Student's T-test or Wilcoxon's Rank Sum Test (if the data were not normally distributed). Distribution of genotypes of CPSI was compared across groups by calculating allelic frequency for the entire group and searching for evidence of 2
- the different preparative regimens used prior to BMT included CTC (cyclophosphamide, thiotepa, carboplatin), BuCy (busulfan, cyclophosphamide), CVP16TBI (cyclophosphamide, etoposide, total body irradiation), CBVP16 (cyclophosphamide, bis-chloroethylnitrosourea, etoposide) and TC (thiotepa, cyclophosphamide). Both morbidity and mortality are not uncommon after BMT. While the overall 60 day mortality in the study was 14%, it was 20% in patients receiving allografts.
- ALI acute lung injury
- HVOD hepatic venocclusive disease
- the relative risk for death before 60 days after BMT was 2.92 for patients with an enrollment citrulline level less than 20.
- the negative predictive value for death of a plasma citrulline level greater than 20 ⁇ M was 90%.
- O/C ratios at enrollment were significantly lower in patients never developing either HVOD (2.8+0.2) or ALI (2.9+0.2) when compared to patients who subsequently developed these complications (5.8+1.9 and 6.5+2.7, respectively; P ⁇ 0.05).
- the negative predictive value for death within 60 days after BMT associated with a baseline O/C ratio less than 2.5 was 92%.
- CPSI SNP genotypes were genotyped for a CPSI SNP. Of 200 patients, data was analyzed from 196 patients (i.e. 2 clinical exclusions; 2 unsuccessful PCR amplifications) to determine if the CPS-I C4340A SNP was in Hardy-Weinberg equilibrium with the development of HVOD. The distribution of CPSI SNP genotypes in patients undergoing BMT was identical to that ofthe control group (100 patients with Alzheimer's disease): 44% CC (wild type), 45% AC (heterozygous), and 11 % AA (homozygous for the transversion).
- HVOD remains the major dose limiting toxicity of escalated dose chemotherapy. It is clinically characterized by fluid retention, jaundice, ascites, and painful hepatic enlargement occurring within 3 weeks of BMT. Autopsy studies of those non-surviving patients fulfilling these clinical criteria provide histological confirmation in >80% of cases and are consistent with the idea that enhanced local thrombosis might be an initiating event in the pathogenesis of HVOD.
- the significant fall in citrulline levels and rise in plasma ornithine levels from patients undergoing BMT suggests a significant disturbance in flux of carbon intermediates through the hepatic UC in patients after induction chemotherapy.
- This threonine is within the allosteric domain, preceding the sequence PV(A/S)WP(T/S)(A/Q)E important in the binding of a cofactor, n-acetyl-glutamate (NAG), that increases enzyme activity.
- NAG n-acetyl-glutamate
- applicants do not wish to be bound by any particular theory of operation, it is speculated that based on the precedent of the effects of other xenobiotics, that limited availability of NAG after escalated dose chemotherapy is one of the mechanisms promoting urea cycle dysfunction. Nonetheless, it appears that the presence of the CPS-I SNP AA genotype is associated with protection against the development of HVOD, resolution of ALI if it occurs, and improved 60 day survival after BMT.
- this Example documents significant impairment in hepatic UC function in patients who receive escalated dose chemotherapy prior to BMT. Patients with more severe derangement in cycle function are more likely to develop morbid complications after BMT. Additionally, a significant association between a CPS-I C4340A SNP and both post-BMT complications and short-term survival has been found. Such data are useful in assessment of risk for patients undergoing BMT and provide a rationale for therapeutic attempts to support UC function during high-dose chemotherapy.
- Example 3 Arginine/Citrulline Supplementation Therapy
- the added decrease in urea cycle products (arginine and citrulline) and increase in precursors (ammonia, glutamine, etc.) resulting from the polymorphism contribute to BMT associated toxicity.
- urea cycle products arginine and citrulline
- precursors ammonia, glutamine, etc.
- citrulline and arginine levels were measured in 10 patients undergoing BMT.
- High-dose chemotherapy used in BMT disrupts normal functions of urea cycle enzymes and contributes to either the occurrence of or toxicity associated with HVOD.
- an analysis of stored plasma from ten patients undergoing BMT before treatment and after completion of induction chemotherapy was performed. Amino acid profiles were determined from all samples. Particular attention was paid to the urea cycle intermediates citrulline, arginine, and ornithine.
- Table 4 a marked decrease in citrulline levels of all patients from a pre-treatment baseline mean of 24 ⁇ 3 ⁇ mol/L to a post-treatment mean of 8 ⁇ 1 ⁇ mol./L (P ⁇ 0.001 ).
- Plasma arginine levels fell from a mean of 91 ⁇ 6 ⁇ mol./L to 70 ⁇ 6 ⁇ mol./L (P ⁇ 0.05), despite the use of arginine-containing parenteral nutrition in several patients:
- a method of reducing toxicity and/or the occurrence of HVOD in a patient undergoing BMT comprises administering the BMT patient arginine and/or citrulline, in some embodiments citrulline, in an amount effective to bolster arginine and NO synthesis in the patient.
- the bolstering of arginine and NO synthesis in the patient reduces and/or substantially prevents the occurrence of HVOD associated with BMT.
- Citrulline is an exemplary supplementation agent given that it is more readily converted to NO.
- FIGS. 6 and 7 present schematic diagrams illustrating the method used to construct the expression clone. This clone has been completely sequenced and does not contain any changes from the consensus CPSI sequence which has been characterized in the art. The ability ofthe clone to make CPSI protein was tested in COS-7 cells.
- COS-7 cells were chosen for their lack of native CPSI activity or production.
- a western blot analysis ofthe COS-7 cells transfected with the flCPSI-PCDNA3.1 construct was prepared.
- HepG2 cell extracts were used as a control as these liver-derived cells have retained CPSI activity.
- Untransfected COS-7 cells were used as a negative control.
- the HepG2 and COS-7-flCPSI cells demonstrated the expected 160 kD band using a rabbit anti-rat CPSI antibody.
- a colorimetric assay was performed to detect the production of carbamyl phosphate from ammonia. As shown graphically in Fig.
- the transected cells demonstrated activity similar to HepG2 cells while untransfected COS-7 cells did not.
- Site-directed mutagenesis has been performed on the T1405 containing CPSI insert and a copy with the N1405 polymorphic codon has been created.
- the N1405 polymorphic codon was sequenced for its entire length and no other changes were detected.
- the QUIKCHANGETM (Stratagene) system which takes advantage of the methylation introduced into DNA by host bacteria, was used to prepare this construct. These constructs are used to provide a steady supply of recombinant CPSI protein as encoded by both alleles, (T1405, N1405) using COS cells and the respective CPSI/PC DNA 3.1 constructs as an expression system.
- Enzymatically active CPSI has been produced using this system, as shown by the graph in Fig. 8.
- a component of these experiments is to determine the in vitro effect of the T1405N polymorphism on CPSI function. As discussed in Examples 1 and 2, this change affects the sensitivity of the enzyme to NAG concentrations. Screening of 20 individuals for the C to A change showed a heterozygosity rate of 50% with 25% ofthe group homozygous AA. This suggests that a significant portion ofthe general population has a potential qualitative abnormality in CPSI function. This abnormality, while silent under normal conditions, is unmasked by stressful conditions and toxins such as high-dose chemotherapy or valproic acid administration. Comparison of the protein products is then done in stages.
- the first stage examines the physical characteristics of the expressed mRNA and protein.
- Northern blots of message prepared from the expressing COS-7 cell lines are probed. Positive controls include HepG2 and human liver message. Negative controls were COS-7 cells transfected with empty cassette pcDNA3.1.
- the expressed flCPSI derived message is somewhat smaller than the native CPSI (4.9 kb vs. 5.7 kb) since the clone does not contain the 1 kb 3' untranslated region.
- Western blot analysis of cell lysates by SDS- PAGE are performed. Comassie blue staining is used to examine total protein production.
- a polyclonal rabbit anti-rat CPSI antibody is used for specific CPSI detection. This antibody detects the expressed CPSI from COS-7 cells as well as the control samples. Finally, changes in the protein's structure are determined by examining the mobility pattern by 2-D electrophoresis, a useful tool to detect conformational changes. Any large changes in confirmation likely explain the alteration in CPSI function for that mutation. The next stage involves measuring the functional characteristics of the expressed enzymes. A sensitive colorimetric assay has been modified for this purpose (Pierson, D. L., J. Biochem. Biophys. Methods, 3:31-37 (1980)). The modified assay allows 4-5 analyses from 20-50 mg of tissue or cells. The tissue is first homogenized in 0.75M KCl.
- carbamyl phosphate production is measured by the addition of hydroxylamine to the solution after incubation at 37°C for varying time periods (0, 5, 10, 20, 25, 30 minutes). This step, carried out at 95 °C, also serves to inactivate the enzyme and prevent further production of carbamyl phosphate.
- the hydroxylamine converts the carbamyl phosphate to hydroxyurea which is subsequently treated with a sulf uric/acetic acid solution with butanedione to derive a compound with peak absorption at 458 nm.
- the reaction is then spun at 12,000 X g for 15 minutes to remove precipitated protein. Next, the 458 nm absorbance is measured for each reaction. Activity typically begins to decrease after 20-30 minutes of reaction.
- a number of expressing cell pellets are pooled for analysis.
- expressed CPSI is quantified by Western blot analysis of the pooled sample using a CPSI antibody such as the rabbit anti-rat CPSI described hereinabove.
- Basal activity is first determined using fixed amounts of substrate and cofactor and a time course analysis. Varying amounts of ammonia bicarbonate, ATP, and NAG are then used to determine the binding efficiency for these elements. These elements are varied from 0 to 10-fold the normal amount.
- Enzyme activity is also measured after heat treatment of the homogenate. Protein labeling (pulse-chase) experiments are performed to determine the stability of the protein over time. Stable CPSI protein expression is obtained using the methods described above.
- Valproic acid is a commonly used seizure medication, particularly for the treatment of absence seizures or as an adjunct therapy of other seizure disorders.
- Toxicity from VPA treatment is a complex and multi-variant process and probably reflects several metabolic disruptions.
- Hyperammonemia and hepatic micro-vesicular steatosis and necrosis are the most commonly reported serious medical complications.
- the development of toxic hyperammonemia involves only a small number of patients, it carries a significant morbidity and mortality, and several deaths have been attributed to this complication.
- asymptomatic hyperammonemia plasma ammonia level greater than 60 ⁇ mol/L
- VPA-induced Hyperammonemia The mechanisms by which VPA causes hyperammonemia has been the subject of some debate, and a number of different theories currently have support in the art.
- a renal model proposed that the changed in glutamine metabolism resulted in an increased ammonia load to the liver, while most other theories concentrate on different aspects of urea cycle function. See, for example, Warter et al., Revue
- NAG N-acetylglutamate
- NAGA is synthesized from glutamate and acetyl CoA in mitochondria, with a cellular distribution that mirrors that of CPSI (Shigesada et al., Journal of Biological Chemistry 246: 5588-5595 (1971 )).
- VPA exposure has also been shown to decrease NAG concentrations in intact hepatocytes, by decreasing concentrations of both acetyl CoA and glutamine (Coude et al., Biochem. J. 216:233-236 (1983)).
- the decrease in glutamine concentration is attributed to inhibition of both pyruvate dehydrogenase and pyruvate carboxylase.
- depletion of mitochondrial acetyl CoA occurs because CoA is diverted on VPA therapy for the manufacture of valproyl CoA (Becker et al., Archives of Biochemistry & Biophysics 223:381-392 (1983)).
- genomic DNA is isolated from patients who are beginning valproic acid therapy for genotyping for the T1405N polymorphism in accordance with the methods described herein, such as PCR amplification and use of non-denaturing gels. After genotyping these patients, pre- and post- treatment amino acid and ammonia determination is performed for these patients. Particularly, DNA is isolated from whole blood using the QIAmpTM (Qiagen) kit described in Example I. Next, plasma total VPA concentration is determined by an enzyme- mediated immunoassay technique (EMITTM Syva-Behring, San Jose, California on a Syva 30RTM analyzer). This technique utilizes competitive binding for VPA antibody binding sites between VPA in the patient plasma and that complexed with the enzyme G6PDH.
- EMITTM Syva-Behring San Jose, California on a Syva 30RTM analyzer
- VPA enzyme complex Release of the VPA enzyme complex from the antibody reactivates the enzyme, and its activity is assessed by the rate of formation of NADH upon addition of the substrate. NADH production is monitored via spectroscopy at 340 nanometers (nm).
- Free (non-protein bound) VPA is isolated from plasma using a centrifugal micro partition filter device with a 3000 Dalton cut-off (CENTRIFREE, Amicon, Beverley, Massachusetts). The VPA concentration in the plasma ultra filtrate is measured as described for total VPA. Data collected from VPA patients is analyzed for correlations between genotype and phenotype. Additionally, free and conjugated VPA fractionation are compared to evaluate effects on NAG production and availability. The latter comparison is prepared given that there are known effects of VPA on NAG availability.
- VPA exposure has been shown to decrease NAG concentrations in intact hepatocytes by decreasing concentrations of both acetyl CoA and glutamine. See Coude et al., Biochem. J., 216:233-236 (1983). Thus, this comparison reflects that changes in the binding properties of CPSI for NAG affect the activity of CPSI.
- Example 6 Detection of Additional Polymorphisms in CPSI Using the techniques developed for mutation analysis of CPSI message, 10 non-CPSI deficient, unrelated patients are screened for additional polymorphisms in the coding region. This is done using "illegitimate" transcripts from lymphoblastoid and fibroblast cell lines. Polymorphisms with a widespread effect on the population should be evident in this size sample.
- polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population.
- a polymorphic marker is the locus at which divergence occurs. Exemplary markers have at least two alleles, each occurring at frequency of greater than 1 %.
- a polymorphic locus may be as small as one base pair.
- Provided polymorphic markers thus include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats and tetranucleotide repeats.
- VNTR's variable number of tandem repeats
- minisatellites dinucleotide repeats
- tetranucleotide repeats tetranucleotide repeats.
- a method to screen a large amount of DNA in a few reactions can be employed.
- Restriction endonuclease fingerprinting (REF) provides for the screening large DNA fragments, up to about 2,000 bp, with excellent sensitivity.
- Reverse transcriptase reactions (RT) are carried out using 1 ⁇ g of total RNA and either an oligo-dT primer or an antisense primer from the midpoint of the CPSI message. Using the RT product as template, PCR reactions are performed with 4 different primer sets creating 4 overlapping fragments spanning the 4,600 base coding region. Control PCR reactions are run with each set of experiments, to ensure that contaminating template is not amplified. Genomic DNA is not preferred for this study due to the size of the gene
- Example 3 The techniques described in Example 3 are used to express site- directed mutants containing these changes. Using this system the in vitro effects of the changes on CPSI production and activity are observed. AT344A polymorphism was detected in CPSI. Oligonucleotide primers were used from the 10th exon (U1119:tactgctcagaatcatggc - SEQ ID NO:17) and intron (LI10+37: tcatcaccaactgaacagg - SEQ ID NO:18) to amplify a 91 bp fragment containing the change. PCR cycle conditions were: 35 cycles of 1 minute anneal at 59°C, 1 minute extension at 72°C, and 1 minute denaturation at 94°C.
- PCR cycle conditions were: 35 cycles of 1 minute anneal at 59°C, 1 minute extension at 72°C, and 1 minute denaturation at 94°C. Patients were classified as having either a homozygous genotype with the 118 trinucleotide insertion or deletion, or as being heterozygous. The adult population distribution of this polymorphism is 34% CTT-, 43% heterozygous, and 23% CTT+.
- Example 7 Biochemical and Genetic Alterations in Carbamyl Phosphate Synthetase I in Neonatal Patients with With Persistent Pulmonary Hypertension
- Endogenous NO is the product of the urea cycle intermediate arginine. Production of arginine depends on the rate-determining enzyme ofthe urea cycle, carbamyl phosphate synthetase (CPSI). Newborns possess less than half the normal urea cycle function making them particularly susceptible to minor changes in enzyme form and function.
- the levels of arginine and citrulline were inversely correlated with the severity of hypoxemia as measured by oxygenation index, days of mechanical ventilation, and days requiring supplemental 0 2 .
- Infants with the CC genotype had lower arginine and citrulline means (21.5 ⁇ mol/l and 5.8 ⁇ mol/l) than infants with the AA genotype (31.5 ⁇ mol/l and 13.5 ⁇ mol/l) consistent with a functional difference between the two forms of the enzyme.
- Carbamyl phosphate synthetase (CPS I) catalyzes the rate- determining step in the urea cycle thereby determining tissue levels ofthe urea cycle intermediates including arginine and citrulline.
- CPS I Carbamyl phosphate synthetase
- a widely distributed C to A exonic polymorphism in the CPS I gene changes a conserved threonine to an asparagine at position 1405 near the critical N-acetyl glutamate binding domain.
- NO nitric oxide
- NOS nitric oxide synthetase
- decreased levels of urea cycle intermediates could predispose to disturbances in vascular tone by limiting endogenous NO production.
- endogenously produced NO functions in regulation of pulmonary vascular resistance and in the transition from fetal to neonatal circulation. Lipsitz, E. C, et al. J Pediatr Surg (1996) 31 :137-140; Abman, S.H., et al.
- Maximum oxygenation index [OI Fi0 2 x MAP/ Pa0 2 ] was used as a measure ofthe severity of respiratory distress.
- Predominant primary diagnoses included (1 ) birth asphyxia: 5-minute Apgar score ⁇ 5 with a mixed acidosis on first ABG or cord blood gas plus evidence or neurologic dysfunction and other end-organ injury, (2) respiratory distress syndrome (RDS): clinical symptoms of respiratory distress with ground-glass lung fields and air bronchograms on chest X-ray plus combined hypercarbia/hypoxia on ABG (Note: given the gestational age of these neonates, infants with this picture could have had either surfactant-deficiency or congenital pneumonia; however, in no case was a positive tracheal aspirate culture obtained), and (3) meconium aspiration syndrome (MAS): history of meconium-staining at delivery plus clinical symptoms of respiratory distress, hypoxemia, and coarse infiltrates chest X-ray.
- RDS respiratory distress syndrome
- PPHN pulmonary hypertension
- Infants were defined as having pulmonary hypertension (PPHN) if they developed significant hypoxemia (Pa0 2 ⁇ 100 on 100% 0 2 > 6 hours) with normal intracardiac anatomy and echocardiographic evidence of elevated pulmonary artery pressure.
- the latter was defines as (1 ) right-to-left or bidirectional ductal of foramen ovale flow or (2) elevated (>35 mmHg) pulmonary artery pressure based on Doppler estimate of the tricuspid regurgitation jet as read by a blinded third party. Amino acid analysis was performed on fresh plasma samples in 47 patients.
- a protein free extract of plasma was prepared by protein precipitation with sulfosalicylic acid and filtration through a 0.45 ⁇ m Acrodisc 4 (Gelman Sciences, Ann Arbor, Michigan). Amino acids were separated by cation exchange chromatography using a four-component pH- and ionic strength- graded lithium citrate buffer system on a Beckmann 7300 amino acid analyzer (Beckmann, Palo Alto, California). Post column derivatization of amino acids with ninhydrin allowed detection of primary amine amino acids at 570 nm, and secondary amines at 440 nm. Quantitation was achieved by instrument calibration with standard reference materials (Sigma, St. Louis, Missouri).
- Citrulline and arginine were detected as measurable indices of flux of intermediates through the urea cycle.
- This combination of primers gave reproducible amplification using Taq polymerase (Promega) and PCR cycle conditions as follows: 35 cycles of 1 minute anneal at 67 °C, 1 minute extension at 72 °C, and 1 minute denaturation at 94 °C.
- samples were subjected to electrophoresis for 5 hours at 4°C in a non-denaturing MDETM gel (FMC, Rockland, Maine), then stained with silver nitrate to detect DNA fragments. Patients were classified as having homozygous SNP genotypes of CC or AA, or as being heterozygous (AC). Genotyping using nondenaturing gel electrophoresis and direct sequence analysis yielded identical results as those disclosed above. Thus, the adult population distribution of the T1405N polymorphism was determined to be: 45% CC, 44% AC, and 11 % AA. An identical technique to that described above was used to detect the T344A polymorphism.
- Oligonucleotide primers were used from the 10th exon (U1119:tactgctcagaatcatggc - SEQ ID NO:17) and intron (LI10+37: tcatcaccaactgaacagg - SEQ ID NO: 18) to amplify a 91 bp fragment containing the change.
- PCR cycle conditions were: 35 cycles of 1 minute anneal at 59, 1 minute extension at 72C, and 1 minute denaturation at 94C.
- Patients were classified as having either homozygous SNP genotypes of AA or TT, or as being heterozygous (AT). The adult population distribution of this polymorphism is 35% AA, 44% AT, and 21% TT.
- An identical technique to that described above was used to detect the
- Oligonucleotide primers were used from the 5' untranslated region (U5'-74: ggttaagagaaggaggagctg - SEQ ID NO: 19) and intron (L175: aaccagtcttcagtgtcctca - SEQ ID NO:20) to amplify a 249 bp fragment containing the change.
- PCR cycle conditions were: 35 cycles of 1 minute anneal at 59°C, 1 minute extension at 72°C, and 1 minute denaturation at 94°C.
- Another infant was mistakenly enrolled with a congenital diaphragmatic hernia, and the third was enrolled at 119 hours of age after TPN had been initiated.
- One infant in the control group was excluded from analysis after karyotype analysis revealed the etiology of his hypotonia to be Prader-Willi syndrome.
- the infants who developed PPHN had significantly lower serum arginine and citrulline levels on amino acid analysis.
- There were no significant differences in the levels of other amino acids between the two groups including glutamine, glycine, alanine, lysine, valine, ornithine, and leucine.
- Arginine and citrulline values fell progressively as oxygenation index increased, days of mechanical ventilation increased, and days requiring supplemental oxygen increased birthweight, gestational age, or number of hours of postnatal life.
- Example 8 Intravenous Citrulline Supplementation Increases Plasma Arginine Levels in Piglets Intravenous citrulline has not been previously used in a clinical model.
- This Example assessed the safety of IV citrulline and its effect on serum arginine levels in piglets.
- Citrulline 600mg/kg IV was administered to 5 piglets. Saline was given to control animals. Serum amino acids were drawn before and each hour after citrulline administration. Serum arginine levels peaked at 1-2 hours following IV citrulline administration and remained sustained above baseline three hours following, reaching significance at all time points compared to controls (p ⁇ 0.001 ). No hemodynamic instability was observed.
- Pharmacokinetics Based on the above data, the pharmacokinetics were calculated for both plasma citrulline and arginine levels after the single dose of IV citrulline. Pharmacokinetic data included plasma half-life (t Vz), elimination constant (Kel), volume of distribution (Vd), and plasma clearance
- Example 9 Oral Citrulline Supplementation in Congenital Heart Surgery This Example pertains to the assessment of whether citrulline supplementation increases serum citrulline levels, decreasing risk of postoperative pulmonary hypertension through endogenous NO production. More particularly, this Example pertains to the determination of whether perioperative supplementation of oral citrulline increases serum citrulline levels leading to greater production of nitric oxide via the urea cycle, thereby decreasing the risk of postoperative pulmonary hypertension.
- a randomized, placebo-controlled, double-blinded study was conducted. Forty infants/children, undergoing surgical correction of their congenital heart lesions and at risk for developing postoperative pulmonary hypertension, received either oral citrulline or placebo.
- the eligible surgical procedures included: 1 ) the Norwood I procedure for hypoplastic left heart syndrome (HLHS) or variant of HLHS, 2) the bidirectional Glenn, 3) the modified Fontan, 4) the atrioventricular septal defect (AVSD) repair, 5) the ventriculoseptal defect (VSD) repair, or 5) the arterial switch procedure.
- Exclusion criteria included: 1 ) significant pulmonary artery narrowing not addressed surgically, 2) previous pulmonary artery stent placement, 3) previous pulmonary artery angioplasty, 4) significant left sided AV valve regurgitation, 5) pulmonary venous return abnormalities, or 6) pulmonary vein stenosis.
- Pulmonary hypertension was defined as mean pulmonary pressures of at least 1 -> systemic mean blood pressures and greater than 25 mmHg.
- Direct pulmonary artery pressure measurements were obtained from either superior vena caval central lines specifically in patients status post bidirectional Glenn or modified Fontan procedure, or transthoracic pulmonary artery catheters in all other patients except those undergoing a stage I Norwood procedure.
- pulmonary pressures were estimated via echocardiographic evaluation in all patients with two ventricle anatomy. Findings on echo which confirmed presence of pulmonary hypertension included: 1 ) significant tricuspid regurgitation, 2) enlarged or hypertrophied right ventricle without evidence of pulmonary stenosis, and/or 3) intraventricular septal flattening. All echocardiograms were interpreted by pediatric cardiologists at Vanderbilt Children's Hospital. All physicians (surgeons, cardiologists, intensivists, and PI), research nurse, PCCU nursing staff, and patients were blinded to both the randomization scheme and treatment arm assignments.
- Clinical data and patient characteristics were obtained from medical records prior to knowledge of study results.
- Adverse Event Citrulline administration had a theoretical risk of systemic hypotension. Systemic blood pressure was monitored hourly during the 48-hour study period. An adverse event was defined as a greater than a twenty-five percent fall in mean blood pressure from baseline. Patients were treated symptomatically with volume resuscitation and/or inotropic/vasopressor support. Patients were not withdrawn from the study unless hypotension was unresponsive to interventions. Study Protocol. Forty patients were randomized to receive either placebo or citrulline immediately prior to surgery. Randomization was performed by the Investigational Drug Service ofthe Vanderbilt Hospital Clinical Pharmacy, using computer generated random numbers, according to previously generated random permuted blocks of four.
- Citrulline was administered as a 100 mg/ml (10%) solution using distilled water as a suspending agent. The drug and placebo were mixed and distributed by the Investigational Drug Service. Citrulline and placebo were matched for volume and color. Citrulline was administered in 5 doses of 1.9 g/m 2 given every 12 hours for a daily dose of 3.8 g/m 2 and for a total dose of 9.5 g/m 2 . This dose was determined by current citrulline replacement therapy administered to infants/children with urea cycle defects, and is identical to the dose administered in an ongoing clinical trial of adult bone marrow transplant patients at risk for development of acute lung injury (Vanderbilt University Medical Center, Brian Christman MD).
- the first dose of placebo/citrulline was administered via an orogastric feeding tube placed by the research nurse or physician subsequent to induction of anesthesia and intubation in the operating room.
- the second dose was given immediately upon arrival in the Pediatric Critical Care Unit (PCCU) for recovery.
- PCCU Pediatric Critical Care Unit
- the 3 rd , 4 th and 5 th doses were administered at 12h, 24h, and 36hrs postoperatively in the PCCU respectively.
- Postoperative doses were given enterally via a nasogastric feeding tube positioned by the bedside nurse in the PCCU, or by mouth once the patient was extubated.
- Sample Collection Three milliliters of blood were obtained from each patient at five time points: immediately preop and postop, then 12, 24, and 48- hours postoperatively.
- the preoperative blood sample was collected following both anesthetic induction and placement of either an arterial or central venous catheter but prior to surgical incision.
- the immediate postoperative sample was collected upon arrival in the pediatric critical care unit (PCCU), and subsequent samples were collected at the respective time intervals after arrival in the PCCU.
- Samples were collected in citrated tubes, placed on ice and stored at 4°C until processing. Samples were centrifuged within 3 hours of collection for separation of plasma and cellular components. Plasma samples were frozen at -70°C until further laboratory analysis.
- the critical factor for ascertainment of outcome data was accessibility to central venous (CVL) or arterial lines (AL).
- Plasma samples were first deproteinated with a zinc sulfate solution. Nitrates were then reduced to nitrites by incubation with cadmium beads. Following centrifugation, the Griess reagents sulfanilamide and N- (1- napthyl) ethylenediamine were added sequentially to the supernatants (14). Absorbance of each sample was then measured at 540 nM, and nitric oxide metabolite concentrations then determined utilizing a standard curve of diluted sodium nitrite as the control. CPSI genotyping for the T1405N polymorphism was achieved as described herein above.
- Drug safety represented by multiple sequential measurements of mean blood pressure during the 48-hour study period, was assessed via multivariate ANCOVA.
- Continuous outcome variables amino acid and nitric oxide metabolite levels, were reported as medians with interquartile ranges (IQR) for non-normal distribution, or means with +/-SD when appropriate.
- IQR interquartile ranges
- the Mann- Whitney U test was used to compare continuous variables between groups to account for outlying values, otherwise Student's --test was used. Analysis of paired continuous values was completed with the Wilcoxon signed-rank test. Dichotomous outcomes for success of randomization and the presence or absence of pulmonary hypertension were reported as proportions and assessed with Fisher's exact test. All analyses were two-sided, and statistical significance of differences was considered with a P-value ⁇ 0.05.
- Statistical software STATA version 6.0, STATA Corporation, College Station, Texas
- SPSS Copyright ⁇ 2004, SPSS Inc.
- Inhaled nitric oxide was administered to 5 patients in the postoperative period, all of whom demonstrated desaturations and hypotension immediately postop. Three ofthe five patients had documented pulmonary hypertension by direct pulmonary pressure measurement. Two ofthe five patients (1 fontan, 1 Norwood) were placed on iNO trials.
- Urea cycle dysfunction has been associated with the development of neonatal persistent pulmonary hypertension (PPHN) and postoperative pulmonary hypertension in infants/children following bypass herein above.
- PPHN persistent pulmonary hypertension
- the T1405N polymorphism of CPSI was significantly associated with lower arginine and nitric oxide levels in neonates with PPHN, and congenital heart patients following bypass.
- the AA genotype of this polymorphism was underrepresented in both pediatric populations who developed pulmonary hypertension. We again show absence of the AA genotype in the nine patients who developed pulmonary hypertension in this study. Conclusion. Patients tolerate citrulline administration without evidence of significant side effects.
- Oral citrulline supplementation significantly increases citrulline concentrations and preserves preoperative arginine concentrations, compared with the significant fall in NO precursors in patients receiving placebo. Patients who maintained serum citrulline concentrations above normal, either by citrulline administration or predisposed factors, did not develop postoperative pulmonary hypertension.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Pulmonology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Endocrinology (AREA)
- Gastroenterology & Hepatology (AREA)
- Communicable Diseases (AREA)
- Rheumatology (AREA)
- Transplantation (AREA)
- Pain & Pain Management (AREA)
- Oncology (AREA)
- Reproductive Health (AREA)
- Gynecology & Obstetrics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18158829.4A EP3351241A1 (en) | 2004-02-24 | 2005-02-24 | Therapeutic methods employing nitric oxide precursors |
| EP05723789A EP1718289A4 (en) | 2004-02-24 | 2005-02-24 | THERAPEUTIC PROCESSES USING STAIN OXIDE PRECURSORS |
| BRPI0507960-8A BRPI0507960A (pt) | 2004-02-24 | 2005-02-24 | métodos terapêuticos empregando precursores de óxido nìtrico |
| JP2006554329A JP2007524695A (ja) | 2004-02-24 | 2005-02-24 | 一酸化窒素前駆体を用いる治療方法 |
| AU2005216270A AU2005216270A1 (en) | 2004-02-24 | 2005-02-24 | Therapeutic methods employing nitric oxide precursors |
| CN2005800126935A CN1946388B (zh) | 2004-02-24 | 2005-02-24 | 一氧化氮前体在药物制备中的应用 |
| IL177224A IL177224A (en) | 2004-02-24 | 2006-08-02 | Pharmaceutical preparations containing a previous compound of nitric oxide |
| ZA2006/06575A ZA200606575B (en) | 2004-02-24 | 2006-08-07 | Therapeutic methods employing nitric oxide precursors |
| AU2009203177A AU2009203177B2 (en) | 2004-02-24 | 2009-07-31 | Therapeutic methods employing nitric oxide precursors |
| IL225912A IL225912A (en) | 2004-02-24 | 2013-04-23 | Citrulline preparations for use in the treatment of targeted intestinal inflammation |
| IL225911A IL225911A (en) | 2004-02-24 | 2013-06-13 | Citrulline preparations for use in the treatment of asthma |
| IL232265A IL232265A0 (en) | 2004-02-24 | 2014-04-27 | Pharmaceutical preparations containing a precursor compound of nitric oxide |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/785,374 | 2004-02-24 | ||
| US10/785,374 US9486429B2 (en) | 1999-06-01 | 2004-02-24 | Therapeutic methods employing nitric oxide precursors |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005082042A2 true WO2005082042A2 (en) | 2005-09-09 |
| WO2005082042A3 WO2005082042A3 (en) | 2006-05-04 |
Family
ID=34911448
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2005/006081 Ceased WO2005082042A2 (en) | 2004-02-24 | 2005-02-24 | Therapeutic methods employing nitric oxide precursors |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US9486429B2 (https=) |
| EP (3) | EP1718289A4 (https=) |
| JP (5) | JP2007524695A (https=) |
| CN (1) | CN1946388B (https=) |
| AU (2) | AU2005216270A1 (https=) |
| BR (1) | BRPI0507960A (https=) |
| IL (4) | IL177224A (https=) |
| WO (1) | WO2005082042A2 (https=) |
| ZA (2) | ZA200606575B (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007095717A1 (en) * | 2006-02-23 | 2007-08-30 | H3 Formulations Ltd. | Rapidly dissolving solid oral dosage form for delivery of composition for increasing nitric oxide activity |
| WO2009099998A2 (en) | 2008-01-31 | 2009-08-13 | Vanderbilt University | Therapeutic treatment for lung conditions |
| JP2010506887A (ja) * | 2006-10-17 | 2010-03-04 | ユニヴェルシテ パリ デカルト | 栄養不足状態の治療のためのシトルリンの使用 |
| US8188147B2 (en) | 1999-06-01 | 2012-05-29 | Vanderbilt University | Therapeutic methods employing nitric oxide precursors |
| EP2344148B1 (en) | 2008-09-19 | 2015-10-21 | Nestec S.A. | Nutritional support to prevent or moderate bone marrow paralysis or neutropenia during anti-cancer treatment |
| US9486429B2 (en) | 1999-06-01 | 2016-11-08 | Vanderbilt University | Therapeutic methods employing nitric oxide precursors |
| US9943494B2 (en) | 2008-01-31 | 2018-04-17 | Vanderbilt University | Methods and compositions for treatment for coronary and arterial aneurysmal subarachnoid hemorrhage |
| US10525026B2 (en) | 2015-06-29 | 2020-01-07 | Vanderbilt University | Intravenous administration of citrulline during surgery |
| EP3966193A1 (en) | 2019-06-05 | 2022-03-16 | Asklepion Pharmaceuticals, LLC | Improved method of synthesis and purification of citrulline |
| US20230404956A1 (en) * | 2022-06-21 | 2023-12-21 | Asklepion Pharmaceuticals Llc | Therapeutic window for citrulline therapy |
| EP4346794A4 (en) * | 2021-06-22 | 2025-07-16 | Asklepion Pharmaceuticals Llc | ACTION OF L-CITRULLINE TO PREVENT OR TREAT ENDOTHELIAL DYSFUNCTION |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE102006021406B4 (de) * | 2006-05-08 | 2008-08-07 | B.R.A.H.M.S Aktiengesellschaft | In vitro Verfahren zur Früherkennung von arznei- und suchtmittelinduzierten Leberschäden und zur Erkennung der bereits erreichten Stufe der Leberschädigung |
| US20080228700A1 (en) | 2007-03-16 | 2008-09-18 | Expanse Networks, Inc. | Attribute Combination Discovery |
| FR2913885B1 (fr) * | 2007-03-22 | 2012-07-20 | Univ Paris Descartes | Utilisation de la citrulline pour le traitement des pathologies liees a une augmentation de la carbonylation des proteines |
| AU2014204490B2 (en) * | 2008-01-31 | 2016-05-12 | Vanderbilt University | Therapeutic treatment for lung condtions |
| US8108406B2 (en) | 2008-12-30 | 2012-01-31 | Expanse Networks, Inc. | Pangenetic web user behavior prediction system |
| US8463554B2 (en) | 2008-12-31 | 2013-06-11 | 23Andme, Inc. | Finding relatives in a database |
| WO2011051742A1 (en) * | 2009-10-28 | 2011-05-05 | Modutech S.A. | Preparation comprising amino acids and plants and its activity in the alcohol detoxification |
| US9572848B1 (en) | 2014-03-26 | 2017-02-21 | Aemes Research L.L.L.P. | Composition of matter for sexual dysfunction |
| US10265286B2 (en) * | 2016-12-28 | 2019-04-23 | Vanderbilt University | Sequelae of cardiopulmonary bypass-induced pulmonary injury |
| JP2018114414A (ja) * | 2018-05-07 | 2018-07-26 | 株式会社大一商会 | 遊技機 |
| US20220160846A1 (en) * | 2019-02-27 | 2022-05-26 | The Regents Of The University Of Michigan | Carbamoyl phosphate synthatase-1 for the treatment and prevention of internal tissue injury |
Family Cites Families (56)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US1005A (en) * | 1838-11-12 | Ing and heating booms and other apabtments beqtjibing abtrficial | ||
| ZA716628B (en) | 1970-10-15 | 1972-06-28 | Richardson Merrell Spa | Composition and method for treatment of hepatic disease and mental fatigue |
| US4196265A (en) * | 1977-06-15 | 1980-04-01 | The Wistar Institute | Method of producing antibodies |
| US4458066A (en) * | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| NL8102724A (nl) | 1980-07-11 | 1982-02-01 | Stamicarbon | Werkwijze voor de bereiding van copolymeren van etheen met tenminste een ander 1-alkeen. |
| US4554101A (en) * | 1981-01-09 | 1985-11-19 | New York Blood Center, Inc. | Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity |
| US4769331A (en) * | 1981-09-16 | 1988-09-06 | University Patents, Inc. | Recombinant methods and materials |
| US4736866B1 (en) * | 1984-06-22 | 1988-04-12 | Transgenic non-human mammals | |
| US4965188A (en) * | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US4683195A (en) * | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683202A (en) * | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US5573933A (en) * | 1987-04-14 | 1996-11-12 | Luminis Pty, Ltd. | Transgenic pigs |
| US4996236A (en) * | 1988-06-22 | 1991-02-26 | Takeda Chemical Industries, Ltd. | Therapeutic composition for hepatic encephalopathy |
| US5162215A (en) * | 1988-09-22 | 1992-11-10 | Amgen Inc. | Method of gene transfer into chickens and other avian species |
| US5399346A (en) * | 1989-06-14 | 1995-03-21 | The United States Of America As Represented By The Department Of Health And Human Services | Gene therapy |
| US5286634A (en) * | 1989-09-28 | 1994-02-15 | Stadler Joan K | Synergistic method for host cell transformation |
| US5633076A (en) * | 1989-12-01 | 1997-05-27 | Pharming Bv | Method of producing a transgenic bovine or transgenic bovine embryo |
| EP0441119A3 (en) * | 1990-01-09 | 1992-10-14 | Richard D. Levere | The use of l-arginine in the treatment of hypertension and other vascular disorders |
| US5279833A (en) * | 1990-04-04 | 1994-01-18 | Yale University | Liposomal transfection of nucleic acids into animal cells |
| US5614396A (en) * | 1990-06-14 | 1997-03-25 | Baylor College Of Medicine | Methods for the genetic modification of endogenous genes in animal cells by homologous recombination |
| US5489742A (en) * | 1990-10-23 | 1996-02-06 | Board Of Regents, The University Of Texas System | Transgenic rats and animal models of inflammatory disease |
| US5643567A (en) * | 1990-12-04 | 1997-07-01 | Board Of Regents, The University Of Texas System | Methods for the suppression of neu mediated tumors by adenoviral E1A and SV40 large T antigen |
| EP0560932B1 (en) * | 1990-12-04 | 1996-09-04 | The Board Of Regents, The University Of Texas System | Methods and compositions for the suppression of neu mediated transformation |
| US5641484A (en) * | 1990-12-04 | 1997-06-24 | Board Of Regents, The University Of Texas System | Methods for the suppression of neu mediated tumors by adenoviral E1A and SV40 large T antigen |
| WO1992010228A1 (en) * | 1990-12-05 | 1992-06-25 | The General Hospital Corporation | Devices for treating pulmonary vasoconstriction and asthma |
| US5550316A (en) * | 1991-01-02 | 1996-08-27 | Fox Chase Cancer Center | Transgenic animal model system for human cutaneous melanoma |
| US5550024A (en) * | 1991-04-19 | 1996-08-27 | Biotechnology Research & Development Corporation | Genetic markers for pig litter size |
| US5286739A (en) * | 1991-09-27 | 1994-02-15 | Board Of Regents, University Of Texas System | Parenteral formulations for the inhibition of systemic hypotension associated with nitric oxide production or endothelial derived relaxing factor |
| US5374651A (en) * | 1991-09-27 | 1994-12-20 | Board Of Regents, The University Of Texas System | Methods and compositions for the treatment of hypotension with arginine free essential and essential amino acids and arginine derivatives |
| US5334380A (en) * | 1991-09-27 | 1994-08-02 | Board Of Regents, The University Of Texas System | Anti-endotoxin, interleukin-1 receptor antagonist and anti-tumor necrosis factor antibody with arginine-free formulations for the treatment of hypotension |
| US5385940A (en) * | 1992-11-05 | 1995-01-31 | The General Hospital Corporation | Treatment of stroke with nitric-oxide releasing compounds |
| AU6232794A (en) | 1993-01-29 | 1994-08-15 | Brigham And Women's Hospital | The use of nitric oxide-delivering compounds for the treatment or prevention of alcoholic liver injury |
| US5891459A (en) * | 1993-06-11 | 1999-04-06 | The Board Of Trustees Of The Leland Stanford Junior University | Enhancement of vascular function by modulation of endogenous nitric oxide production or activity |
| US5646008A (en) * | 1993-06-22 | 1997-07-08 | The Regent Of The University Of Michigan | Vertebrate apoptosis gene: compositions and methods |
| US5625125A (en) * | 1994-08-09 | 1997-04-29 | Dnx Biotherapeutics | Phospholipase A2 expressing transgenic animals |
| US5543430A (en) * | 1994-10-05 | 1996-08-06 | Kaesemeyer; W. H. | Method and formulation of stimulating nitric oxide synthesis |
| US5648061A (en) * | 1995-05-24 | 1997-07-15 | Thomas Jefferson University | In vivo and in vitro model of cutaneous photoaging |
| US6331543B1 (en) | 1996-11-01 | 2001-12-18 | Nitromed, Inc. | Nitrosated and nitrosylated phosphodiesterase inhibitors, compositions and methods of use |
| US6028107A (en) * | 1997-02-27 | 2000-02-22 | Waugh; William Howard | Orthomolecular medical use of L-citrulline for vasoprotection, relaxative smooth muscle tone and cell protection |
| US5874471A (en) * | 1997-02-27 | 1999-02-23 | Waugh; William Howard | Orthomolecular medical use of L-citrulline for vasoprotection, relaxative smooth muscle tone and cell protection |
| US6796966B2 (en) * | 1997-10-15 | 2004-09-28 | Jeffrey E. Thomas | Apparatus, and kits for preventing of alleviating vasoconstriction or vasospasm in a mammal |
| WO1999018949A1 (en) | 1997-10-15 | 1999-04-22 | Thomas Jefferson University | Nitric oxide donor compositions, methods, apparatus, and kits for preventing or alleviating vasoconstriction or vasospasm in a mammal |
| US20010056068A1 (en) * | 1998-03-04 | 2001-12-27 | Kristof Chwalisz | Method of treatment and prevention of nitric oxide deficiency-related disorders with citrulline and citrulline derivatives |
| US20020068365A1 (en) | 1998-07-28 | 2002-06-06 | Eric H. Kuhrts | Controlled release nitric oxide producing agents |
| US6346382B1 (en) * | 1999-06-01 | 2002-02-12 | Vanderbilt University | Human carbamyl phosphate synthetase I polymorphism and diagnostic methods related thereto |
| US9486429B2 (en) | 1999-06-01 | 2016-11-08 | Vanderbilt University | Therapeutic methods employing nitric oxide precursors |
| US6182295B1 (en) * | 1999-06-14 | 2001-02-06 | Kevin Sciglia | Hat |
| CN1166339C (zh) * | 1999-11-15 | 2004-09-15 | Lg电子株式会社 | 旋风真空吸尘器中的用于集尘箱的联结装置 |
| JP3506114B2 (ja) | 2000-01-25 | 2004-03-15 | 株式会社ニコン | モニタ装置及びこのモニタ装置を具えた研磨装置及び研磨方法 |
| US6689810B2 (en) * | 2001-08-21 | 2004-02-10 | Cellular Sciences, Inc. | Method for treating pulmonary disease states in mammals by altering indigenous in vivo levels of nitric oxide |
| US7198912B2 (en) * | 2001-09-07 | 2007-04-03 | Bristol-Myers Squibb Company | Polynucleotides encoding a human G-protein coupled receptor, HGPRBMY39 |
| US20030134332A1 (en) * | 2001-11-28 | 2003-07-17 | Boykin Joseph V. | Diagnosis of endothelial dysfunction by nitric oxide bioactivity index |
| SI1841458T1 (sl) * | 2005-01-06 | 2012-04-30 | Discovery Lab Inc | Zdravljenje s predpisanim odmerjanjem surfaktanta za zdravljenje ali preprečevanje bronhopulmonalne displazije |
| US20070184554A1 (en) * | 2005-12-01 | 2007-08-09 | Nps Allelix Corp. | Biomarker of improved intestinal function |
| CN101969974A (zh) * | 2008-01-31 | 2011-02-09 | 范德比尔特大学 | 对于肺部病症的治疗 |
| WO2009099999A2 (en) * | 2008-01-31 | 2009-08-13 | Vanderbilt University | Methods and compositions for treatment for coronary and arterial aneurysmal subarachnoid hemorrhage |
-
2004
- 2004-02-24 US US10/785,374 patent/US9486429B2/en not_active Expired - Fee Related
-
2005
- 2005-02-24 EP EP05723789A patent/EP1718289A4/en not_active Withdrawn
- 2005-02-24 WO PCT/US2005/006081 patent/WO2005082042A2/en not_active Ceased
- 2005-02-24 EP EP18158829.4A patent/EP3351241A1/en not_active Ceased
- 2005-02-24 CN CN2005800126935A patent/CN1946388B/zh not_active Expired - Lifetime
- 2005-02-24 EP EP10184493A patent/EP2319507A1/en not_active Ceased
- 2005-02-24 BR BRPI0507960-8A patent/BRPI0507960A/pt not_active Application Discontinuation
- 2005-02-24 JP JP2006554329A patent/JP2007524695A/ja active Pending
- 2005-02-24 AU AU2005216270A patent/AU2005216270A1/en not_active Abandoned
-
2006
- 2006-08-02 IL IL177224A patent/IL177224A/en active IP Right Grant
- 2006-08-07 ZA ZA2006/06575A patent/ZA200606575B/en unknown
-
2008
- 2008-07-18 ZA ZA2008/06276A patent/ZA200806276B/en unknown
-
2009
- 2009-07-31 AU AU2009203177A patent/AU2009203177B2/en not_active Expired
-
2012
- 2012-09-13 JP JP2012201762A patent/JP2013040176A/ja active Pending
-
2013
- 2013-04-23 IL IL225912A patent/IL225912A/en active IP Right Grant
- 2013-06-13 IL IL225911A patent/IL225911A/en active IP Right Grant
-
2014
- 2014-04-27 IL IL232265A patent/IL232265A0/en unknown
- 2014-08-15 JP JP2014165456A patent/JP2015007090A/ja active Pending
-
2015
- 2015-11-30 JP JP2015232749A patent/JP6239571B2/ja not_active Expired - Lifetime
-
2016
- 2016-11-04 US US15/343,998 patent/US20170119715A1/en not_active Abandoned
-
2017
- 2017-08-08 JP JP2017152929A patent/JP6395912B2/ja not_active Expired - Lifetime
Non-Patent Citations (4)
| Title |
|---|
| AMIN H.J. ET AL: "Arginine supplementation prevents necrotizing enterocolitis in the premature infant", JOURNAL OF PEDIATRICS, vol. 140, no. 4, April 2002 (2002-04-01), pages 425 - 431, XP002993971 * |
| DAVIES S.M. ET AL: "Idiopathic hyperammonemia: a frequently lethal complication of bone marrow transplantation", BONE MARROW TRANSPLANTATION, vol. 17, June 1996 (1996-06-01), pages 1119 - 1125, XP008059479 * |
| MIZUTANI N. ET AL: "Oral administration of arginine and citrulline in the treatment of lysinuric protein intolerance", TOHOKU JOURNAL OF EXPERIMENTAL MEDICINE, vol. 142, 1984, pages 15 - 24, XP008059480 * |
| VASSAL G. ET AL: "Busulfan disposition and hepatic veno-occlusive disease in children undergoing bone marrow transplantation", CANCER, CHEMOTHERAPY AND PHARMACOLOGY, vol. 37, 1996, pages 247 - 253, XP008059483 * |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9486429B2 (en) | 1999-06-01 | 2016-11-08 | Vanderbilt University | Therapeutic methods employing nitric oxide precursors |
| US8188147B2 (en) | 1999-06-01 | 2012-05-29 | Vanderbilt University | Therapeutic methods employing nitric oxide precursors |
| US8536225B2 (en) | 1999-06-01 | 2013-09-17 | Vanderbilt University | Therapeutic methods employing nitric oxide precursors |
| WO2007095717A1 (en) * | 2006-02-23 | 2007-08-30 | H3 Formulations Ltd. | Rapidly dissolving solid oral dosage form for delivery of composition for increasing nitric oxide activity |
| JP2010506887A (ja) * | 2006-10-17 | 2010-03-04 | ユニヴェルシテ パリ デカルト | 栄養不足状態の治療のためのシトルリンの使用 |
| US9943494B2 (en) | 2008-01-31 | 2018-04-17 | Vanderbilt University | Methods and compositions for treatment for coronary and arterial aneurysmal subarachnoid hemorrhage |
| KR20170005155A (ko) | 2008-01-31 | 2017-01-11 | 반더빌트유니버시티 | 폐의 용태에 따른 치료 방법 |
| WO2009099998A2 (en) | 2008-01-31 | 2009-08-13 | Vanderbilt University | Therapeutic treatment for lung conditions |
| KR20180059582A (ko) | 2008-01-31 | 2018-06-04 | 반더빌트유니버시티 | 폐의 용태에 따른 치료 방법 |
| US10500181B2 (en) | 2008-01-31 | 2019-12-10 | Vanderbilt University | Methods and compositions for treatment for coronary and arterial aneurysmal subarachnoid hemorrhage |
| EP2344148B1 (en) | 2008-09-19 | 2015-10-21 | Nestec S.A. | Nutritional support to prevent or moderate bone marrow paralysis or neutropenia during anti-cancer treatment |
| EP2344148B2 (en) † | 2008-09-19 | 2024-05-08 | Société des Produits Nestlé S.A. | Nutritional support to prevent or moderate bone marrow paralysis during anti-cancer treatment |
| US10525026B2 (en) | 2015-06-29 | 2020-01-07 | Vanderbilt University | Intravenous administration of citrulline during surgery |
| EP3966193A1 (en) | 2019-06-05 | 2022-03-16 | Asklepion Pharmaceuticals, LLC | Improved method of synthesis and purification of citrulline |
| EP3966193A4 (en) * | 2019-06-05 | 2023-06-28 | Asklepion Pharmaceuticals, LLC | Improved method of synthesis and purification of citrulline |
| US12240801B2 (en) | 2019-06-05 | 2025-03-04 | Asklepion Pharmaceuticals, Llc | Method of synthesis and purification of citrulline |
| EP4346794A4 (en) * | 2021-06-22 | 2025-07-16 | Asklepion Pharmaceuticals Llc | ACTION OF L-CITRULLINE TO PREVENT OR TREAT ENDOTHELIAL DYSFUNCTION |
| US20230404956A1 (en) * | 2022-06-21 | 2023-12-21 | Asklepion Pharmaceuticals Llc | Therapeutic window for citrulline therapy |
Also Published As
| Publication number | Publication date |
|---|---|
| IL225911A (en) | 2015-05-31 |
| EP3351241A1 (en) | 2018-07-25 |
| ZA200806276B (en) | 2012-12-27 |
| BRPI0507960A (pt) | 2007-07-17 |
| JP2007524695A (ja) | 2007-08-30 |
| US20170119715A1 (en) | 2017-05-04 |
| JP6239571B2 (ja) | 2017-11-29 |
| IL225912A0 (en) | 2013-06-27 |
| JP2016074709A (ja) | 2016-05-12 |
| IL225912A (en) | 2015-07-30 |
| IL225911A0 (en) | 2013-06-27 |
| CN1946388A (zh) | 2007-04-11 |
| JP2013040176A (ja) | 2013-02-28 |
| EP2319507A1 (en) | 2011-05-11 |
| US9486429B2 (en) | 2016-11-08 |
| AU2009203177B2 (en) | 2012-03-22 |
| AU2005216270A1 (en) | 2005-09-09 |
| JP2015007090A (ja) | 2015-01-15 |
| CN1946388B (zh) | 2012-03-07 |
| ZA200606575B (en) | 2012-10-31 |
| EP1718289A2 (en) | 2006-11-08 |
| JP2018024665A (ja) | 2018-02-15 |
| EP1718289A4 (en) | 2007-04-11 |
| WO2005082042A3 (en) | 2006-05-04 |
| JP6395912B2 (ja) | 2018-09-26 |
| IL232265A0 (en) | 2014-06-30 |
| AU2009203177A1 (en) | 2009-08-20 |
| IL177224A0 (en) | 2006-12-10 |
| US20040235953A1 (en) | 2004-11-25 |
| IL177224A (en) | 2014-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8536225B2 (en) | Therapeutic methods employing nitric oxide precursors | |
| AU2009203177B2 (en) | Therapeutic methods employing nitric oxide precursors | |
| Funghini et al. | Carbamoyl phosphate synthetase 1 deficiency in Italy: clinical and genetic findings in a heterogeneous cohort | |
| Scholz et al. | Ontogeny of malate-aspartate shuttle capacity and gene expression in cardiac mitochondria | |
| US20160317484A1 (en) | Therapeutic Methods Employing Nitric Oxide Precursors | |
| AU2015202185B2 (en) | Therapeutic methods employing nitric oxide precursors | |
| AU2012203629B2 (en) | Therapeutic methods employing nitric oxide precursors | |
| HK1097437B (en) | Therapeutic use of nitric oxide precursor | |
| MXPA06009468A (es) | Metodos terapeuticos que emplean precursores de oxido nitrico | |
| Hernaningsih | Literature review of hematology division the mechanism of imanitib resistance in chronic myeloid leukemia | |
| JPWO2017170300A1 (ja) | 老化を反映するミトコンドリアバイオマーカー | |
| Seddigh et al. | " Institute of Inherited Metabolic Disorders, General Faculty Hospitaland Ist Medical Faculty of Charles University. Prague, Czech Republic:“PKU Centre Dept of Paediatrics, University Hospital |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 177224 Country of ref document: IL Ref document number: 2005216270 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200606575 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2006/009468 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006554329 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2005216270 Country of ref document: AU Date of ref document: 20050224 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005723789 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005216270 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580012693.5 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005723789 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: PI0507960 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 225912 Country of ref document: IL Ref document number: 225911 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 232265 Country of ref document: IL |