WO2005059144A1 - Psod-expressionseinheiten - Google Patents

Psod-expressionseinheiten Download PDF

Info

Publication number
WO2005059144A1
WO2005059144A1 PCT/EP2004/014337 EP2004014337W WO2005059144A1 WO 2005059144 A1 WO2005059144 A1 WO 2005059144A1 EP 2004014337 W EP2004014337 W EP 2004014337W WO 2005059144 A1 WO2005059144 A1 WO 2005059144A1
Authority
WO
WIPO (PCT)
Prior art keywords
activity
nucleic acids
expression
genes
acids encoding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2004/014337
Other languages
German (de)
English (en)
French (fr)
Inventor
Burkhard Kröger
Oskar Zelder
Corinna Klopprogge
Hartwig Schröder
Stefan Haefner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BRPI0417728-2A priority Critical patent/BRPI0417728A/pt
Priority to DE502004011835T priority patent/DE502004011835D1/de
Priority to AT04803950T priority patent/ATE486131T1/de
Priority to US10/583,191 priority patent/US20080274516A1/en
Priority to JP2006544337A priority patent/JP2007514426A/ja
Priority to EP04803950A priority patent/EP1697526B1/de
Application filed by BASF SE filed Critical BASF SE
Priority to CA002549171A priority patent/CA2549171A1/en
Publication of WO2005059144A1 publication Critical patent/WO2005059144A1/de
Anticipated expiration legal-status Critical
Priority to ZA2006/05857A priority patent/ZA200605857B/en
Priority to US12/030,575 priority patent/US8071365B2/en
Priority to US12/546,651 priority patent/US20100062535A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity

Definitions

  • the present invention relates to the use of nucleic acid sequences for regulating the transcription and expression of genes, the new promoters and expression units themselves, methods for changing or causing the transcription rate and / or expression rate of genes, expression cassettes containing the expression units, genetically modified microorganisms with modified or caused transcription rate and / or expression rate and method for
  • biosynthetic products such as fine chemicals such as amino acids, vitamins but also proteins
  • fine chemicals such as amino acids, vitamins but also proteins
  • These substances, collectively referred to as fine chemicals / proteins include, among others, organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, as well as proteins and enzymes , They are most conveniently produced on a large scale by growing bacteria that have been developed to produce and secrete large quantities of the desired substance.
  • Organisms that are particularly suitable for this purpose are coryneform bacteria, gram-positive non-pathogenic bacteria.
  • Process improvements can include fermentation-related measures, such as stirring and supply with oxygen, or the composition of the nutrient media, such as the sugar concentration during fermentation, or processing to produce the product, for example by ion exchange chromatography or spray drying, or the intrinsic performance properties of the microorganism concern yourself.
  • recombinant DNA technology has also been used to improve the strains of fine chemicals / protein-producing strains of Corynebacterium by amplifying individual genes and examining the effects on the production of fine chemicals / proteins.
  • Other ways to develop a process for the production of fine chemicals, amino acids or proteins, or to increase or improve the productivity of an existing process for the production of fine chemicals, amino acids or proteins are to increase the expression of one or more genes or to change and or to influence the translation of an mRNA by means of suitable polynucleotide sequences.
  • influencing can include increasing, decreasing or other parameters of the expression of genes such as temporal expression patterns.
  • RNA polymerase holoenzymes also called -35 and -10 regions
  • ribosomal 16S-RNA also known as ribosomal binding site or Shine-Dalgarno sequence called.
  • a sequence of a ribosomal binding site is understood to mean polynucleotide sequences which are located up to 20 bases upstream of the translation initiation codon.
  • Nucleic acid sequences with promoter activity can influence the formation of mRNA in different ways. Promoters whose activity is independent of the physiological growth phase of the organism are called constitutive. Still other promoters react to external chemical, such as physical stimuli such as oxygen, metabolites, heat, pH, etc. Still others show a strong dependence of their activity in different growth phases. For example, promoters are described in the literature which show a particularly pronounced activity during the exponential growth phase of microorganisms, or else precisely in the stationary phase of microbial growth. Both characteristics of promoters can have a positive impact on productivity for the production of fine chemicals and proteins depending on the metabolic pathway.
  • promoters that turn off gene expression during growth, but turn it on after optimal growth can be used to regulate a gene that controls the production of a metabolite.
  • the modified strain then has the same growth parameters as the original strain, but produces more product per cell. This type of modification can increase both the titer (g product / liter) and the C yield (g product / gC source).
  • nucleotide sequences could be isolated that can be used to increase or decrease the gene expression.
  • These regulated promoters can increase or decrease the rate at which a gene is transcribed, depending on the internal and / or external conditions of the cell.
  • the presence of a particular factor known as an inducer can stimulate the rate of transcription from the promoter.
  • Inducers can directly or indirectly influence the transcription from the promoter.
  • Another class of factors known as suppressors is able to reduce or inhibit transcription from the promoter. Like the inducers, the suppressors can act directly or indirectly.
  • promoters that are regulated by temperature are also known. For example, the level of transcription of such promoters can be increased or decreased by increasing the growth temperature above the normal growth temperature of the cell.
  • C. glutamicum promoters A small number of C. glutamicum promoters have been described to date.
  • the promoter of the malate synthase gene from C. glutamicum has been described in DE 4440118. This promoter was placed upstream of a structural gene coding for a protein. After transformation of such a construct into a coryne-shaped bacterium, the expression of the structural gene downstream of the promoter is regulated. The expression of the structural gene is induced as soon as an appropriate inducer is added to the medium.
  • the object of the invention was to provide further promoters and / or expression units with advantageous properties.
  • nucleic acids with promoter activity are included
  • transcription means the process by which a complementary RNA molecule is produced starting from a DNA template. Proteins such as RNA polymerase, so-called sigma factors and transcriptional regulatory proteins, are involved in this process. The synthesized RNA then serves as a template in the process of translation, which then leads to the biosynthetically active protein.
  • the rate of formation at which a biosynthetically active protein is produced is a product of the rate of transcription and translation. Both rates can be influenced according to the invention and thus influence the rate of product formation in a microorganism.
  • a “promoter” or a “nucleic acid with promoter activity” is understood to mean a nucleic acid which, in functional connection with a nucleic acid to be transcribed, regulates the transcription of this nucleic acid.
  • a “functional link” is understood to mean, for example, the sequential arrangement of one of the nucleic acids according to the invention with promoter activity and a nucleic acid sequence to be transcribed and, if appropriate, further regulatory elements such as nucleic acid sequences that ensure the transcription of nucleic acids, and for example a terminator of this type that each of the regulatory elements can fulfill its function in the transcription of the nucleic acid sequence. This does not necessarily require a direct link in the chemical sense.
  • Genetic control sequences can also function from more distant positions or even from other DNA molecules onto the target sequence are preferred, in which arrangements in which the nucleic acid sequence to be transcribed is positioned behind (ie at the 3 'end) of the promoter sequence according to the invention, so that at de sequences are covalently linked.
  • the distance between the promoter sequence and the nucleic acid sequence to be expressed transgenically is preferably less than 200 base pairs, particularly preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.
  • promoter activity means the amount of RNA formed by the promoter in a certain time, that is to say the transcription rate.
  • promoter activity is understood to mean the amount of RNA per promoter formed by the promoter in a certain time.
  • wild type is understood to mean the corresponding starting microorganism.
  • microorganism can be understood to mean the starting microorganism (wild type) or a genetically modified microorganism according to the invention, or both.
  • wild type is used for the change or causation of the promoter activity or transcription rate, for the change or causation of the expression activity or expression rate and for the increase in the content biosynthetic products each a reference organism Roger that.
  • this reference organism is Corynebacterium glutamicum ATCC 13032.
  • starting microorganisms are used which are already able to produce the desired fine chemical.
  • Particularly preferred among the particularly preferred microorganisms of the bacteria of the genus Corynebacteria and the particularly preferred fine chemicals L-lysine, L-methionine and L-threonine are those starting microorganisms which are already capable of L-lysine, L-methionine and / or To produce L-threonine.
  • such bacteria in the ask gene have a mutation that lead to a reduction or elimination of the feedback inhibition, such as the mutation T311I.
  • RNA in comparison with the wild type With a "caused promoter activity" or transcription rate in relation to a gene in comparison to the wild type, the formation of an RNA in comparison with the wild type is caused, which was not present in the wild type.
  • the amount of RNA formed is thus changed in a certain time compared to the wild type.
  • the increased promoter activity or transcription rate can be achieved, for example, by regulating the transcription of genes in the microorganism by nucleic acids according to the invention with promoter activity or by nucleic acids with increased specific promoter activity, the genes being heterologous with respect to the nucleic acids with promoter activity.
  • the regulation of the transcription of genes in the microorganism is preferably carried out by nucleic acids according to the invention with promoter activity or by nucleic acids. ren with increased specific promoter activity by that
  • nucleic acids according to the invention with promoter activity, possibly with changed specific promoter activity, into the genome of the microorganism, so that the transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid with promoter activity, possibly with changed specific promoter activity
  • nucleic acid constructs containing a nucleic acid according to the invention with promoter activity, possibly with changed specific promoter activity, and functionally linked and introducing one or more nucleic acids to be transcribed into the microorganism.
  • the nucleic acids according to the invention with promoter activity contain A) the nucleic acid sequence SEQ. ID. NO. 1 or B) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides and which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1 or C) a nucleic acid sequence which is identical to the nucleic acid sequence SEQ. ID. NO. 1 hybridizes under stringent conditions or D) functionally equivalent fragments of the sequences under A), B) or C)
  • SEQ. ID. NO. 1 shows the promoter sequence of superoxide dismutase (Psod) from Corynebacterium glutamicum.
  • SEQ. ID.NO. 1 corresponds to the wild-type promoter sequence.
  • the invention further relates to nucleic acids with promoter activity containing a sequence derived from this sequence by substitution, insertion or deletion of nucleotides, which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1 has.
  • promoters according to the invention can be obtained, for example, from various organisms whose genomic sequence is known by comparing the identity of the nucleic acid sequences from data. easily find banks with the sequences described above SEQ ID NO: 1.
  • substitution is to be understood as the exchange of one or more nucleotides by one or more nucleotides.
  • “Deletion” is the replacement of a nucleotide by a direct binding. Inserts are insertions of nucleotides into the nucleic acid sequence, whereby a direct binding is formally replaced by one or more nucleotides.
  • Identity between two nucleic acids is understood to mean the identity of the nucleotides over the respective total nucleic acid length, in particular the identity which is obtained by comparison using the Vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins DG, Sharp PM.Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) is calculated using the following parameters:
  • a nucleic acid sequence which has at least 90% identity with the sequence SEQ ID NO: 1 is accordingly understood to mean a nucleic acid sequence which, when its sequence is compared with the sequence SEQ ID NO: 1, especially according to the program logarithm with the above parameter set has an identity of at least 90%.
  • Particularly preferred promoters have the nucleic acid sequence SEQ. ID. NO. 1 an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, particularly preferably 99%.
  • promoters can furthermore be easily found by hybridization techniques in a manner known per se, starting from the nucleic acid sequences described above, in particular starting from the sequence SEQ ID NO: 1, from various organisms whose genomic sequence is not known.
  • Another object of the invention therefore relates to nucleic acids with promoter activity, containing a nucleic acid sequence that matches the nucleic acid sequence SEQ. ID. No. 1 hybridized under stringent conditions.
  • This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50 or particularly preferably more than 150 nucleotides.
  • the hybridization takes place under stringent conditions.
  • Hybridization conditions are described, for example, by Sambrook, J., Fritsch, EF, Manatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6:
  • Stringent hybridization conditions are understood to mean in particular: The overnight incubation at 42 ° C. in a solution consisting of 50% formamide, 5 ⁇ SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6) ), 5x Denhardt's solution, 10% dextran sulfate and 20 g / ml denatured, sheared salmon sperm DNA, followed by washing the filter with 0.1x SSC at 65 ° C.
  • a “functionally equivalent fragment” is understood for nucleic acid sequences with promoter activity, fragments which have essentially the same or a higher specific promoter activity as the starting sequence.
  • “Essentially the same” means a specific promoter activity which has at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, particularly preferably 95% of the specific promoter activity of the starting sequence. “Fragments” mean partial sequences of the nucleic acids with promoter activity described by embodiment A), B) or C). These fragments preferably have more than 10, but more preferably more than 12, 15, 30, 50 or particularly preferably more than 150 contiguous nucleotides the nucleic acid sequence SEQ.ID.NO.1.
  • nucleic acid sequence SEQ is particularly preferred. ID. NO. 1 as a promoter, i.e. for the transcription of genes.
  • the SEQ. ID. NO. 1 has been described without a function assignment in the genebank entry AP005283. Therefore, the invention further relates to the new nucleic acid sequences according to the invention with promoter activity.
  • the invention relates to a nucleic acid with promoter activity, containing
  • nucleic acid with the sequence SEQ. ID. NO. 1 is excluded.
  • nucleic acids with promoter activity can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • the invention further relates to the use of an expression unit containing one of the nucleic acids according to the invention with promoter activity and additionally functional links a nucleic acid sequence that ensures the translation of ribonucleic acids for the expression of genes.
  • an expression unit is understood to mean a nucleic acid with expression activity, that is to say a nucleic acid which, in functional association with a nucleic acid or gene to be expressed, regulates the expression, that is to say the transcription and translation, of this nucleic acid or of this gene.
  • a “functional link” is understood to mean, for example, the sequential arrangement of an expression unit according to the invention and a nucleic acid sequence to be expressed transgenically and, if appropriate, further regulatory elements such as, for example, a terminator such that each of the regulatory elements has its function in the transgenic Expression of the nucleic acid sequence can do this, which does not necessarily require a direct link in the chemical sense, Genetic control sequences, such as enhancer sequences, can also perform their function on the target sequence from more distant positions or even from other DNA molecules are arrangements in which the nucleic acid sequence to be expressed transgenically is positioned behind (ie at the 3 'end) the expression unit sequence according to the invention, so that the two sequences are covalently linked to one another the expression unit sequence and the transgenic nucleic acid sequence to be expressed less than 200 base pairs, particularly preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.
  • expression activity means the amount of protein formed by the expression unit in a certain time, that is to say the expression rate.
  • specific expression activity means the amount of protein per expression unit formed by the expression unit in a certain time.
  • the increased expression activity or rate of expression can be achieved, for example, by regulating the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity, the genes being heterologous with respect to the expression units.
  • the regulation of the expression of genes in the microorganism is preferably achieved by expression units according to the invention or by expression units according to the invention with increased specific expression activity by
  • nucleic acid constructs containing an expression unit according to the invention, optionally with changed specific expression activity, and functionally linked, introducing one or more nucleic acids to be expressed into the microorganism.
  • the expression units according to the invention contain a nucleic acid according to the invention described above with promoter activity and additionally functionally linked a nucleic acid sequence which ensures the translation of ribonucleic acids.
  • This nucleic acid sequence which ensures the translation of ribonucleic acids, preferably contains the nucleic acid sequence SEQ. ID. NO. 42 as a ribosomal binding site.
  • the expression unit according to the invention contains:
  • nucleic acid sequence SEQ. ID. NO. 2 or F a sequence derived from this sequence by substitution, insertion or deletion of nucleotides, which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2 or G) a nucleic acid sequence which is identical to the nucleic acid sequence SEQ. ID. NO. 2 hybridized under stringent conditions or H) functionally equivalent fragments of the sequences under E), F) or G).
  • the nucleic acid sequence SEQ. ID. NO. 2 shows the nucleic acid sequence of the expression unit of the superoxide dismutase (Psod) from Corynebacterium glutamicum. SEQ. ID.NO. 2 corresponds to the sequence of the wild-type expression unit.
  • the invention further relates to expression units containing a sequence derived from this sequence by substitution, insertion or deletion of nucleotides, which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2 has.
  • a nucleic acid sequence which has an identity of at least 90% with the sequence SEQ ID NO: 2 is accordingly understood to mean a nucleic acid sequence which, when comparing its sequence with the sequence SEQ ID NO: 2, in particular according to the above program logarithm with the above parameter set Identity of at least 90%.
  • Particularly preferred expression units have the nucleic acid sequence SEQ. ID. NO. 2 an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, particularly preferably 99%.
  • expression units can furthermore easily be found in a manner known per se by hybridization techniques, starting from the nucleic acid sequences described above, in particular starting from the sequence SEQ ID NO: 2, from various organisms whose genomic sequence is not known.
  • Another object of the invention therefore relates to expression units containing a nucleic acid sequence which is identical to the nucleic acid sequence SEQ. ID. No. 2 hybridized under stringent conditions.
  • This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50 or particularly preferably more than 150 nucleotides.
  • Hybridizing means the ability of a poly- or oligonucleotide to bind to an almost complementary sequence under stringent conditions, while under these conditions unspecific bonds between non-complementary partners are omitted.
  • the sequences should preferably be 90-100% complementary.
  • the property of complementary sequences of being able to specifically bind to one another is used, for example, in Northern or Southern blot technology or in primer binding in PCR or RT-PCR.
  • the hybridization takes place under stringent conditions.
  • stringent conditions are described, for example, by Sambrook, J., Fritsch, EF, Manatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6:
  • Stringent hybridization conditions are understood to mean in particular: The overnight incubation at 42 ° C. in a solution consisting of 50% formamide, 5 ⁇ SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6) ), 5x Denhardt's solution, 10% dextran sulfate and 20 g / ml denatured, sheared
  • the nucleotide sequences according to the invention also enable the generation of probes and primers which can be used for the identification and / or cloning of homologous sequences in other cell types and microorganisms.
  • probes or primers usually comprise a nucleotide sequence region which hybridizes under stringent conditions to at least about 12, preferably at least about 25, for example about 40, 50 or 75 successive nucleotides of a sense strand of a nucleic acid sequence according to the invention or a corresponding antisense strand.
  • nucleic acid sequences which comprise so-called silent mutations or which have been changed in accordance with the codon usage of a specific source or host organism, in comparison to a specifically named sequence, as well as naturally occurring variants, such as e.g. Splice variants or allele variants, thereof.
  • a “functionally equivalent fragment” means for expression units, fragments which have essentially the same or a higher specific expression activity as the starting sequence.
  • “Essentially the same” is understood to mean a specific expression activity which has at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, particularly preferably 95% of the specific expression activity of the starting sequence.
  • “Fragments” mean partial sequences of the expression units described by embodiment E), F) or G). These fragments preferably have more than 10, but more preferably more than 12, 15, 30, 50 or particularly preferably more than 150 contiguous nucleotides the nucleic acid sequence SEQ.ID.NO.1.
  • nucleic acid sequence SEQ is particularly preferred. ID. NO. 2 as an expression unit, i.e. for expression of genes.
  • the SEQ. ID. NO. 2 has been described without a function assignment in the genebank entry AP005283.
  • the invention therefore further relates to the new expression units according to the invention.
  • the invention relates to an expression unit containing a nucleic acid according to the invention with promoter activity additionally functionally linked to a nucleic acid sequence which ensures the translation of ribonucleic acids.
  • the invention particularly preferably relates to an expression unit comprising E) the nucleic acid sequence SEQ. ID. NO. 2 or F) a sequence derived from this sequence by substitution, insertion or deletion of nucleotides, which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2 or G) a nucleic acid sequence which is identical to the nucleic acid sequence SEQ. ID. NO. 2 hybridizes under stringent conditions or H) functionally equivalent fragments of the sequences under E), F) or G),
  • nucleic acid with the sequence SEQ. ID. NO. 2 is excluded.
  • the expression units according to the invention comprise one or more of the following genetic elements: a minus 10 ("-10") sequence; a minus 35 (“-35”) sequence; a transcription start, an enhancer region; and an operator region.
  • These genetic elements are preferably specific for the species Corynebacteria, especially for Corynbacterium glutamicum.
  • All of the expression units mentioned above can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • nucleic acid molecules of the present invention are preferably in the form of an isolated nucleic acid molecule.
  • An "isolated" nucleic acid molecule is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid and, moreover, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or free of chemical precursors or other chemicals be when it's chemically synthesized.
  • the invention further comprises the nucleic acid molecules complementary to the specifically described nucleotide sequences or a section thereof.
  • the promoters and / or expression units according to the invention can, for example, be used particularly advantageously in improved processes for the fermentative production of biosynthetic products, as described below.
  • the promoters and / or expression units according to the invention have the particular advantage that they are induced in microorganisms by stress. By appropriately controlling the fermentation process, this stress induction can be controlled at the same time to increase the transcription / expression rate of desired genes. In the production of L-lysine in particular, this stress phase is reached very early, so that an increased transcription / expression rate of desired genes can be achieved very early here.
  • nucleic acids according to the invention with promoter activity can be used to change, that is to say increase or decrease, or to cause the transcription rate of genes in microorganisms in comparison to the wild type.
  • the expression units according to the invention can be used to change, that is to say increase or decrease, or to cause the expression rate of genes in microorganisms in comparison to the wild type.
  • the nucleic acids according to the invention with promoter activity and the expression units according to the invention can be used to regulate and enhance the formation of various biosynthetic products, such as, for example, fine chemicals, proteins, in particular amino acids, in microorganisms, in particular in Corynebacterium species.
  • the invention therefore relates to a method for changing or causing the transcription rate of genes in microorganisms compared to the wild type by a) changing the specific promoter activity in the microorganism of endogenous nucleic acids according to the invention with promoter activity which regulate the transcription of endogenous genes compared to the wild type or b) regulation of the transcription of genes in the microorganism by nucleic acids according to the invention with promoter activity or by nucleic acids with changed specific promoter activity according to embodiment a), the genes being heterologous with respect to the nucleic acids with promoter activity.
  • the transcription rate of genes in microorganisms can be changed or caused in comparison to the wild type by changing the specific promoter activity in the microorganism, ie increasing or decreasing it.
  • This can be done, for example, by targeted mutation of the nucleic acid sequence according to the invention with promoter activity, that is to say through targeted substitution, deletion or insertion of nucleotides.
  • An increased or decreased promoter activity can be achieved by exchanging nucleotides in the binding site of the RNA polymerase holoenzyme binding sites (also known to the person skilled in the art as the -10 region and - 35 region).
  • the distance between the described RNA polymerase holoenzyme binding sites from one another is reduced or increased by deletions of nucleotides or insertions of nucleotides.
  • binding sites also as -
  • repressors and activators Operators known) for regulatory proteins (known to the person skilled in the art as repressors and activators) are brought into spatial proximity to the binding sites of the RNA polymerase holoenzyme, that these regulators bind to and bind to a promoter sequence and transcription activity of the RNA polymerase holoenzyme weaken or strengthen, or put under a new regulatory influence.
  • the nucleic acid sequence SEQ. ID. NO. 44 preferably represents the ribosomal binding site of the expression units according to the invention, the sequences SEQ. ID. NOs. 42 or 43 represent the -10 region of the expression units according to the invention. Changes in the nucleic acid sequence in these regions lead to a change in the specific expression activity.
  • the invention therefore relates to the use of the nucleic acid sequence SEQ. ID. NO. 44 as a ribosomal binding site in expression units which enable the expression of genes in bacteria of the genus Corynebacterium or Brevibacteriu.
  • the invention further relates to the use of the nucleic acid sequences SEQ. ID. NOs. 42 or 43 as a -10 region in expression units which enable the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium.
  • the invention relates to an expression unit which enables the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, containing the nucleic acid sequence SEQ. ID. NO. 44.
  • the nucleic acid sequence SEQ. ID. NO. 44. used as a ribosomal binding site.
  • the invention further relates to an expression unit which enables the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, comprising at least one of the nucleic acid sequences SEQ. ID. NOs. 42 or 43.
  • an expression unit which enables the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, comprising at least one of the nucleic acid sequences SEQ. ID. NOs. 42 or 43.
  • One of the nucleic acid sequences SEQ. ID. NOs. 42 or 43 used as the -10 region.
  • an increase or reduction in comparison to the wild type means an increase or reduction in the specific activity with respect to the nucleic acid according to the invention with wild type promoter activity, that is to say, for example, with respect to SEQ. ID. NO. 1.
  • the transcription rate of genes in microorganisms can be changed or caused in comparison to the wild type by regulating the transcription of genes in the microorganism by nucleic acids according to the invention with promoter activity or by nucleic acids with changed specific promoter activity according to embodiment a), the Genes are heterologous with respect to the nucleic acids with promoter activity.
  • embodiment b1) introduces one or more nucleic acids according to the invention with promoter activity, possibly with changed specific promoter activity, into the genome of the microorganism, so that the transcription of one or more endogenous genes takes place under the control of the introduced nucleic acid with promoter activity, optionally with changed specific promoter activity or
  • one or more nucleic acid constructs containing a nucleic acid according to the invention with promoter activity, possibly with changed specific promoter activity, and functionally linked, introduces one or more endogenous nucleic acids to be transcribed into the microorganism.
  • embodiment b2) introduces one or more exogenous genes into the genome of the microorganism, so that the transcription of one or more of the introduced, exogenous genes under the control of the endogenous nucleic acids according to the invention with promoter activity, optionally with changed specific pro- motor activity, occurs or
  • one or more nucleic acid constructs containing a nucleic acid according to the invention with promoter activity, possibly with changed specific promoter activity, and functionally linked, introduces one or more exogenous nucleic acids to be transcribed into the microorganism.
  • the insertion of genes according to embodiment b2) can take place in such a way that the gene is integrated into coding regions or non-coding regions.
  • the insertion is preferably carried out in non-coding areas.
  • nucleic acid constructs can take place chromosomally or extrachromosomally.
  • the nucleic acid constructs are preferably inserted chromosomally.
  • a “chromosomal” integration is the insertion of an exogenous DNA fragment into the chromosome of a host cell. This term is also used for the homologous recombination between an exogenous DNA fragment and the corresponding region on the chromosome of the host cell.
  • nucleic acids according to the invention with modified specific promoter activity according to embodiment a) are also preferably used.
  • these can be present and produced in the microorganism or introduced into the microorganism in isolated form.
  • Endogenous means genetic information, such as genes, that are already contained in the wild-type genome.
  • Exogenous is understood to mean genetic information, such as genes, that are not contained in the wild-type genome.
  • genes in relation to regulation of the transcription by the nucleic acids according to the invention with promoter activity is preferably understood to mean nucleic acids which have a region to be transcribed, that is to say for example a region which regulates translation, a coding region and optionally further regulatory elements such as for example one Terminator included.
  • genes in relation to the regulation of expression by the expression units according to the invention described below is preferably understood to mean nucleic acids which encode a coding region and, if appropriate, tere regulatory elements, such as a terminator included.
  • a “coding region” is understood to mean a nucleic acid sequence which codes for a protein.
  • Heterologous in relation to nucleic acids with promoter activity and genes is understood to mean that the genes used in the wild type are not transcribed under regulation of the nucleic acids according to the invention with promoter activity, but that a new functional link that does not occur in the wild type is created and the functional combination of the invention Nucleic acid with promoter activity and specific gene does not occur in the wild type.
  • Heterologous in relation to expression units and genes is understood to mean that the genes used are not expressed in the wild type under regulation of the expression units according to the invention, but that a new functional link that does not occur in the wild type is created and the functional combination of the expression unit according to the invention and specific gene does not occur in the wild type.
  • the invention further relates to a method for increasing or causing the transcription fats of genes in microorganisms in comparison to the wild type by comparing ah) the specific promoter activity in the microorganism of endogenous nucleic acids with promoter activity which regulate the transcription of endogenous genes increased to wild type or bh) regulates the transcription of genes in the microorganism by nucleic acids according to the invention with promoter activity or by nucleic acids with increased specific promoter activity according to embodiment a), the genes being heterologous with respect to the nucleic acids with promoter activity.
  • the regulation of the transcription of genes in the microorganism is preferably achieved by nucleic acids according to the invention with promoter activity or by nucleic acids according to the invention with increased specific promoter activity according to embodiment ah) in that bh1) one or more nucleic acids according to the invention with promoter activity, optionally with increased specific promoter activity , into the genome of the microorganism so that the transcription of one or more dogen genes under the control of the introduced nucleic acid with promoter activity, possibly with increased specific promoter activity, or bh2) introduces one or more genes into the genome of the microorganism, so that the transcription of one or more of the introduced genes under the control of the endogenous invention Nucleic acids with promoter activity, optionally with increased specific promoter activity, are carried out or bh3) one or more nucleic acid constructs containing a nucleic acid according to the invention with promoter activity, optionally with increased specific promoter activity, and functionally linked, introducing one or more nucleic acids to be transcribed into the microorgan
  • the invention further relates in a preferred embodiment to a method for reducing the transcription rate of genes in microorganisms compared to the wild type by ar) the specific promoter activity in the microorganism of endogenous nucleic acids according to the invention with promoter activity which regulate the transcription of the endogenous genes Reduced compared to the wild type or br) introduces nucleic acids with reduced specific promoter activity according to embodiment a) into the genome of the microorganism, so that the transcription of endogenous genes takes place under the control of the introduced nucleic acid with reduced promoter activity.
  • the invention further relates to a method for changing or causing the expression rate of a gene in microorganisms compared to the wild type by c) changing the specific expression activity in the microorganism of endogenous expression units according to the invention, which regulate the expression of the endogenous genes, in comparison to the wild type or d) Regulation of the expression of genes in the microorganism by expression units according to the invention or by expression units according to the invention with modified specific expression activity according to embodiment c), the genes being heterologous with respect to the expression units.
  • the expression rate of genes in microorganisms can be changed or caused in comparison to the wild type by changing, ie increasing or decreasing, the specific expression activity in the microorganism.
  • the lengthening of the distance between the Shine-Dalgarno sequence and the translational start codon generally leads to a change, a reduction or an increase in the specific expression activity.
  • a change in the specific expression activity can also be achieved in that the sequence of the Shine-Dalgarno region (ribosomal binding site) is shortened or extended in its distance from the translational start codon by deletions or insertions of nucleotides. But also by changing the sequence of the Shine-Dalgarno region so that the homology to complementary 3 'side 16S rRNA is either increased or also reduced.
  • an increase or reduction in comparison to the wild type means an increase or reduction in the specific activity compared to the wild type expression unit according to the invention, that is to say, for example, to SEQ. ID. NO. 2.
  • the expression rate of genes in microorganisms can be changed or caused in comparison to the wild type by regulating the expression of genes in the microorganism by expression units according to the invention or by expression units according to the invention with changed specific expression activity according to embodiment c), the genes are heterologous with respect to the expression units.
  • embodiment d1) introduces one or more expression units according to the invention, optionally with changed specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes takes place under the control of the expression units introduced or
  • one or more genes are introduced into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with changed specific expression activity
  • one or more nucleic acid constructs containing an expression unit according to the invention, optionally with changed specific expression activity, and functionally linked, introduces one or more nucleic acids to be expressed into the microorganism.
  • one or more exogenous genes are introduced into the genome of the microorganism, so that the expression of one or more of the genes introduced is carried out under the control of the endogenous expression units according to the invention, optionally with changed specific expression activity
  • one or more nucleic acid constructs containing an expression unit according to the invention, optionally with changed specific expression activity, and functionally linked, introduces one or more exogenous nucleic acids to be expressed into the microorganism.
  • the insertion of genes according to embodiment d2) can take place in such a way that the gene is integrated into coding regions or non-coding regions.
  • the insertion is preferably carried out in non-coding areas.
  • the insertion of nucleic acid constructs according to embodiment d3) can take place chromosomally or extrachromosomally.
  • the nucleic acid constructs are preferably inserted chromosomally.
  • nucleic acid constructs are also referred to below as expression cassettes.
  • expression units according to the invention with modified specific expression activity according to embodiment c) are also preferably used.
  • these can be present and produced in the microorganism as described in embodiment d) or introduced into the microorganism in isolated form.
  • the expression of genes in the microorganism is regulated by expression units according to the invention or by expression units with increased specific expression activity according to embodiment c), the genes being heterologous with respect to the expression units.
  • the regulation of the expression of genes in the microorganism is preferably achieved by expression units according to the invention or by expression units with increased specific expression activity according to embodiment c) by introducing one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes takes place under the control of the introduced expression units, possibly with increased specific expression activity, or dh2) introduces one or more genes into the genome of the microorganism, so that the expression of one or more of the introduced genes under the con trolls of the endogenous expression units according to the invention, given if there is increased specific expression activity, or dh3) one or more nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked, introduces one or more nucleic acids to be expressed into the microorganism.
  • the invention further relates to a method for reducing the expression rate of genes in microorganisms compared to the wild type by:
  • dr introduces expression units with reduced specific expression activity according to embodiment er) into the genome of the microorganism, so that the expression of endogenous genes takes place under the control of the introduced expression units with reduced expression activity.
  • the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of fine chemicals, the genes optionally being able to contain further regulatory elements.
  • the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway , Nucleic acids encoding a protein from the biosynthetic pathway of aromatic compounds, Nucleic acids encoding a protein from the biosynthetic pathway of vitamins, Nucleic acids encoding a protein encoding the group nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding
  • the proteins from the biosynthetic pathway of amino acids are selected from the group aspartate kinase, aspartate semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase 3, glycerol dehydrogenase , 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate-quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogehydrogenase , Transketolase, transaldolase, homoserine-O-acetyltransferase, cystahionin-gamma synthase, cystahionin-beta
  • Preferred proteins and nucleic acids encoding these proteins of the above-described proteins from the biosynthetic pathway of amino acids are protein sequences or nucleic acid sequences of microbial origin, preferably from bacteria of the genus Corynebacterium or Brevibacterium, preferably from coryneform bacteria, particularly preferably from Corynebacterium glutamicum.
  • Another example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of fructose-1, 6-bisphosphatase 2, or also fbr2, (SEQ. ID. NO. 41) and the corresponding nucleic acid sequence encoding a fructose-1,6-bisphosphatase 2 (SEQ. ID. NO. 40).
  • Another example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of the protein in sulfate reduction, or also called RXA077 (SEQ. ID. NO. 4) and the corresponding nucleic acid sequence a protein in sulfate reduction (SEQ. ID. NO. 3)
  • proteins from the biosynthetic pathway of amino acids each have the amino acid sequence given in Table 1 for this protein, the respective protein having a different proteinogenic amino acid than at least one of the amino acid positions given in Table 2 / column 2 for this amino acid sequence the respective amino acid given in Table2 / Column3 in the same row.
  • the proteins have at least one of the amino acid positions given in Table 2 / column 2 for the amino acid sequence with the amino acid given in Table 2 / column 4 in the same line.
  • the proteins listed in Table 2 are mutated proteins of the biosynthetic pathway of amino acids which have particularly advantageous properties and are therefore particularly suitable for the expression of the corresponding nucleic acids by the promoter according to the invention and for the production of amino acids.
  • the T311 I mutation leads to switching off the feedback inhibition of ask.
  • nucleic acids which encode a mutated protein from Table 2 described above can be produced by customary methods.
  • a suitable starting point for producing the nucleic acid sequences encoding a mutated protein is, for example, the genome of a Corynebacterium glutamicum strain which is available from the American Type Culture Collection under the name ATCC 13032 or the nucleic acid sequences referred to in Table 1.
  • a Corynebacterium glutamicum strain which is available from the American Type Culture Collection under the name ATCC 13032 or the nucleic acid sequences referred to in Table 1.
  • Corynebacterium glutamicum it is advantageous for Corynebacterium glutamicum to use the codon usage of Corynebacterium glutamicum.
  • the codon usage of the respective organism can be determined in a manner known per se from databases or patent applications which describe at least one protein and one gene which codes for this protein from the desired organism.
  • the nucleic acids according to the invention with promoter activity, the expression units according to the invention, the genes described above and the nucleic acid constructs or expression cassettes described above are introduced into the microorganism, in particular into corynomomic bacteria, preferably by the SacB method.
  • the SacB method is known to the person skilled in the art and is described, for example, in Schwarz A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A; Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum, genes. 1994 Jul 22; 145 (1): 69-73 and Blomfield IC, Vaughn V, rest RF, Eisenstein Bl .; Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon; Mole of microbiol. 1991 Jun; 5 (6): 1447-57.
  • the transcription rate and / or expression rate of genes in microorganisms are changed or caused by introducing nucleic acids according to the invention with promoter activity or expression units according to the invention into the microorganism.
  • the transcription rate and / or expression rate of genes in microorganisms are changed or caused by introducing the nucleic acid constructs or expression cassettes described above into the microorganism.
  • the invention therefore also relates to an expression cassette comprising
  • At least one further nucleic acid sequence to be expressed ie one gene to be expressed and if necessary, further genetic control elements, such as a terminator,
  • At least one expression unit and a further nucleic acid sequence to be expressed are functionally linked to one another and the further nucleic acid sequence to be expressed is heterologous with respect to the expression unit.
  • the nucleic acid sequence to be expressed is preferably at least one nucleic acid encoding a protein from the biosynthetic pathway of fine chemicals.
  • the nucleic acid sequence to be expressed is particularly preferably selected from the group nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids , Nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, Nucleic acids encoding a protein from the biosynthetic pathway of diols, Nucleic acids encoding a protein from the biosynthetic pathway of Konien hydrates, Nucleic acids encoding a protein from the biosynthetic pathway of aromatic compounds, Nucleic acids encoding a protein Biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the bio
  • Preferred proteins from the amino acid biosynthetic pathway are described above and their examples in Tables 1 and 2.
  • the physical position of the expression unit relative to the gene to be expressed is selected such that the expression unit regulates the transcription and preferably also the translation of the gene to be expressed, thus enabling the formation of one or more proteins.
  • the “enable education” includes the constitutive increase in education, the weakening or blocking of education under specific conditions and or the increase in education under specific conditions.
  • the “conditions” include: (1) adding a component to the culture medium, (2) removing a component from the culture medium, (3) replacing a component in the culture medium with a second component, (4) increasing the temperature of the culture medium, (5) Lowering the temperature of the culture medium, and (6) regulating the atmospheric conditions such as the oxygen or nitrogen concentration at which the culture medium is kept.
  • the invention further relates to an expression vector containing an expression cassette according to the invention described above.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985).
  • vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.
  • plasmids are those which are replicated in coryneform bacteria.
  • Numerous known plasmid vectors such as. B. pZ1 (Menkel et al., Applied and Environmental Microbiology (1989) 64: 549-554), pEKExl (Eikmanns et al., Gene 102: 93-98 (1991)) or pHS2-1 (Sonnen et al., Gene 107: 69-74 (1991)) are based on the cryptic plasmids pHM1519, pBL1 or pGA.
  • Other plasmid vectors such as e.g. B.
  • pCLiK5MCS or those based on pCG4 (US-A 4,489,160) or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) or pAG1 (US-A 5,158,891) can in can be used in the same way.
  • plasmid vectors are also suitable, by means of which the method of gene amplification can be applied by integration into the chromosome, as described, for example, by Remscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for the duplication or amplification of the hom-thrB operon.
  • the complete gene is cloned into a plasmid vector that can replicate in a host (typically E. coli) but not in C. glutamicum.
  • vectors examples include pSUP301 (Simon et al., Bio / Technology 1, 784-791 (1983)), pK18mob or pK19mob (Schäfer et al., Gene 145, 69-73 (1994)), Bernard et al., Journal ofMolecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al. 1991, Journal of Bacteriology 173: 4510-4516) or pBGS8 (Spratt et al., 1986, Gene 41: 337-342) in question.
  • the plasmid vector containing the gene to be amplified is then transformed into the desired strain of C. glutamicum by transformation.
  • the invention further relates to a genetically modified microorganism, the genetic modification leading to a change or causation of the transcriptional rate of at least one gene compared to the wild type and is caused by
  • the regulation of the transcription of genes in the microorganism is achieved by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with changed specific promoter activity according to embodiment a) in that
  • b1) introduces one or more nucleic acids with promoter activity according to claim 1, optionally with modified specific promoter activity, into the genome of the microorganism, so that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity according to claim 1, optionally with changed specific promoter activity, takes place or
  • b2) introduces one or more genes into the genome of the microorganism, so that the transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids with promoter activity according to claim 1, optionally with changed specific promoter activity
  • nucleic acid constructs containing a nucleic acid with promoter activity according to claim 1, optionally with changed specific promoter activity, and functionally linked introducing one or more nucleic acids to be transcribed into the microorganism.
  • the invention further relates to a genetically modified microorganism with an increased or caused transcription rate of at least one gene compared to the wild type, wherein
  • the transcription of genes in the microorganism is regulated by nucleic acids with promoter activity according to claim 1 or by nucleic acids with increased specific promoter activity according to embodiment ah), the genes being heterologous with respect to the nucleic acids with promoter activity.
  • the regulation of the transcription of genes in the microorganism is achieved by nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with changed specific promoter activity according to embodiment a) in that
  • bh1 introduces one or more nucleic acids with promoter activity according to claim 1, optionally with increased specific promoter activity, into the genome of the microorganism, so that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity, optionally with increased specific promoter activity , is done or
  • bh2 introduces one or more genes into the genome of the microorganism, so that the transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids with promoter activity according to claim 1, optionally with increased specific promoter activity
  • Promoter activity according to claim 1, optionally with increased specific promoter activity, and functionally linked introduces one or more nucleic acids to be transcribed into the microorganism.
  • the invention further relates to a genetically modified microorganism with a reduced transcription rate of at least one gene compared to the wild type, wherein
  • nucleic acids with reduced promoter activity according to embodiment a) have been introduced into the genome of the microorganism, so that the transcription of at least one endogenous gene is under the control of the introduced one Nucleic acid with reduced promoter activity takes place.
  • the invention further relates to a genetically modified microorganism, the genetic change leading to a change or causation of the expression rate of at least one gene compared to the wild type and being caused by
  • the regulation of the expression of genes in the microorganism is achieved by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with changed specific expression activity according to embodiment a) in that
  • d1) introduces one or more expression units according to claim 2 or 3, optionally with changed specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes under the control of the introduced expression units according to claim 2 or 3, optionally with changed specific expression activity, takes place or
  • d2) introduces one or more genes into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to claim 2 or 3, if appropriate with changed specific expression activity
  • nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with changed specific expression activity, and functionally linked introducing one or more nucleic acids to be expressed into the microorganism.
  • the invention further relates to a genetically modified microorganism with an increased or caused expression rate of at least one gene compared to the wild type, wherein one ch) the specific expression activity in the microorganism of at least one endogenous expression units according to claim 2 or 3, which regulates the expression of the endogenous genes, compared to the wild type, or ie) the expression of genes in the microorganism by expression units according to claim 2 or 3 or by expression units regulated according to claim 2 or 3 with increased specific expression activity according to embodiment a), the genes being heterologous with respect to the expression units.
  • the regulation of the expression of genes in the microorganism is achieved by expression units according to claim 2 or 3 or by expression units according to claim 2 or 3 with increased specific expression activity according to embodiment a) by dh1) one or more expression units according to claim 2 or 3, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes takes place under the control of the introduced expression units according to claim 2 or 3, optionally with increased specific expression activity, or • dh2 ) introduces one or more genes into the genome of the microorganism, so that the expression of one or more of the genes introduced is under the control of the endogenous expression units according to claim 2 or 3, optionally with increased specific expression activity, ie or3) one or more nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with increased specific expression activity, and functionally linked introducing one or more nucleic acids to be expressed into the microorganism.
  • the invention further relates to a genetically modified microorganism with a reduced expression rate of at least one gene compared to the wild type, wherein he) the specific expression activity in the microorganism of at least one endogenous expression unit according to claim 2 or 3, which expresses at least one edogenic gene regulated, reduced compared to the wild type, or dr) one or more expression units according to claim 2 or 3 with reduced expression activity were introduced into the genome of the microorganism, so that the expression of at least one gene under the control of the introduced expressions Sions unit according to claim 2 or 3 with reduced expression activity.
  • the invention relates to a genetically modified microorganism containing an expression unit according to claim 2 or 3 and functionally linked to a gene to be expressed, the gene being heterologous with respect to the expression unit.
  • This genetically modified microorganism particularly preferably contains an expression cassette according to the invention.
  • the present invention particularly preferably relates to genetically modified microorganisms, in particular coryneform bacteria, which contain a vector, in particular a pendulum vector or plasmid vector, which carries at least one recombinant nucleic acid construct of the definition according to the invention.
  • the genes described above are at least one nucleic acid encoding a protein from the biosynthetic pathway of fine chemicals.
  • the genes described above are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, encoding nucleic acids a protein from the biosynthetic pathway of organic acids, encoding nucleic acids a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of Konienhydrates, nucleic acids encoding a protein from the aromatics pathway Compound encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthesis
  • Preferred proteins from the biosynthetic pathway of amino acids are selected from the group aspartate kinase, aspartate semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde dehydrogenase-3-phosphate dehydrogenase-3-phosphate Kinase, pyruvate carboxylase, triosephosphate isomerase, transcript tional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate-quinone oxidoreductase, glucose-6-phosphate-deoxygenase, 6-phosphogluconate-dehydrognease, transketolase, transaldolase, homoserine-O-acetyltransinase-cystahin-cystahinase, cyst
  • Preferred microorganisms or genetically modified microorganisms are bacteria, algae, fungi or yeasts.
  • microorganisms are, in particular, coryneform bacteria.
  • Preferred coryneform bacteria are bacteria of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum, Corynebacterium acetoglutami- cum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola and Corynebacterium efficiens or the genus Brevibacterium, in particular of the species Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum.
  • Particularly preferred bacteria of the genera Corynebacterium and Brevibacterium are selected from the group Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, 444M4nomiumnebium539, Cassnobacterium4395, Meloryecnobellium DS39, C65nn4m4e5395, C5n4e4e4e5a5.
  • the abbreviation KFCC means the Korean Federation of Culture Collection, with the abbreviation ATCC the American type strain culture collection, with the abbreviation DSM the German collection of microorganisms.
  • NRRL ARS Culture Collection, Northern Regional Research Laboratory, Peoria, IL, USA
  • DSMZ German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany
  • nucleic acids according to the invention with promoter activity and the expression units according to the invention make it possible, with the aid of the methods according to the invention described above, to regulate the metabolic pathways to specific biosynthetic products in the genetically modified microorganisms described above.
  • metabolic pathways leading to a specific biosynthetic product are increased by causing or increasing the transcription rate or expression rate of genes of this biosynthetic pathway in which the increased amount of protein leads to an increased overall activity of these proteins of the desired biosynthetic pathway and thus to an increased metabolic flow to the desired one leads biosynthetic product.
  • metabolic pathways leading away from a specific biosynthetic product can be weakened by reducing the transcription rate or expression rate of genes of this leading biosynthetic pathway, in which the reduced amount of protein leads to a reduced overall activity of these proteins of the undesired biosynthetic pathway and thus in addition to an increased metabolic flow to the desired biosynthetic product leads.
  • the genetically modified microorganisms according to the invention are able, for example, to produce biosynthetic products from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol.
  • the invention therefore relates to a method for producing biosynthetic products by cultivating genetically modified microorganisms according to the invention. men.
  • the transcription rate or expression rate of different genes must be increased or reduced.
  • At least one modified, that is to say increased or reduced, transcription rate or expression rate of a gene can be attributed to a nucleic acid according to the invention with promoter activity or expression unit according to the invention.
  • Transcription rates or expression rates of further genes in the genetically modified microorganism can, but do not have to go back to the nucleic acids according to the invention with promoter activity or the expression units according to the invention.
  • the invention therefore further relates to a method for producing biosynthetic products by cultivating genetically modified microorganisms according to the invention.
  • Preferred biosynthetic products are fine chemicals.
  • fine chemical is known in the art and includes compounds produced by an organism and used in various industries, such as, but not limited to, the pharmaceutical, agricultural, cosmetic, food and feed industries. These compounds include organic acids such as tartaric acid, itaconic acid and diaminopimelic acid, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides and nucleotides (as described, for example, in Kuninaka, A. (1996) Nucleotides and related compounds , Pp. 561-612, in Biotechnology Vol. 6, Rehm et al., Ed. VCH: Weinheim and the citations contained therein), lipids, saturated and unsaturated fatty acids (e.g.
  • arachidonic acid arachidonic acid
  • diols e.g. propanediol and Butanediol
  • carbohydrates e.g. hyaluronic acid and trehalose
  • aromatic compounds e.g. aromatic amines, vanillin and indigo
  • vitamins and cofactors as described in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, "Vitamins", p. 443-613 (1996) VCH: Weinheim and the quotations contained therein; and Ong, AS, Niki, E. and Packer, L (1995) "Nutrition, Lipids, Health and Disease” Proceedings of the UNESCO / Confederation of Scientific and Technological Associations in Malaysia and the Society for Free Radical Research - Asia, held on 1 .-3.
  • amino acids comprise the basic structural units of all proteins and are therefore essential for normal cell functions.
  • amino acid is known in the art.
  • the proteinogenic amino acids of which there are 20 types, serve as structural units for proteins in which they are linked to one another via peptide bonds, whereas the non-proteinogenic amino acids (of which hundreds are known) are usually not found in proteins (see Ullmann's Encyclopedia of Industrial Chemistry, Vol. A2, pp. 57-97 VCH: Weinheim (1985)).
  • the amino acids can be in the D or L configuration, although L-amino acids are usually the only type found in naturally occurring proteins.
  • Biosynthetic and degradation pathways of each of the 20 proteinogenic amino acids are well characterized in both prokaryotic and eukaryotic cells (See, for example, Stryer, L. Biochemistry, 3rd edition, pp. 578-590 (1988)).
  • the "essential" amino acids histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine
  • amino acids histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine
  • nonessential amino acids alanine, arginine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine and tyrosine
  • Higher animals have the ability to synthesize some of these amino acids, but the essential amino acids have to be ingested in order for normal protein synthesis to take place.
  • Lysine is not only an important amino acid for human nutrition, but also for monogastric animals such as poultry and pigs.
  • Glutamate is most commonly used as a flavor additive (monosodium glutamate, MSG) and is widely used in the food industry, as is aspartate, phenylalanine, glycine and cysteine.
  • Glycine, L-methionine and tryptophan are all used in the pharmaceutical industry.
  • Glutamine, valine, leucine, isoleucine, histidine, arginine, proline, serine and alanine are used in the pharmaceutical and cosmetic industries. Threonine, tryptophan and D- / L-methionine are widespread feed additives (Leuchtenberger, W. (1996) Amino acids - technical production and use, pp. 466-502 in Rehm et al., (Ed.) Biotechnology Vol. 6, chapter 14a, VCH: Weinheim).
  • amino acids can also be used as precursors for the synthesis of synthetic amino acids and proteins such as N-acetylcysteine, S-carboxymethyl-L-cysteine, (S) - ⁇ -hydroxytryptophan and others, in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A2, pp. 57-97, VCH, Weinheim, 1985 are suitable substances.
  • Ketoglutarate an intermediate in the citric acid cycle, synthesized.
  • Glutamine, proline and arginine are each produced from glutamate in succession.
  • the biosynthesis of serine is carried out in a three-step process and begins with 3-phosphoglycerate (an intermediate in glycolysis) and, after oxidation, transamination and hydrolysis steps, gives this amino acid.
  • Cysteine and glycine are each produced from serine, the former by condensation of homocysteine with serine, and the latter by transferring the side chain ⁇ -carbon atom to tetrahydrofolate, in a reaction catalyzed by serine transhydroxymethylase.
  • Phenylalanine and tyrosine are synthesized from the precursors of the glycolysis and pentosephosphate pathways, erythrose-4-phosphate and phosphoenolpyruvate in a 9-step biosynthetic pathway that differs only in the last two steps after the synthesis of prephenate. Tryptophan is also produced from these two starting molecules, but its synthesis takes place in an 11-step way. Tyrosine can also be produced from phenylalanine in a reaction catalyzed by phenylalanine hydroxylase. Alanine, valine and leucine are each biosynthetic products from pyruvate, the end product of glycolysis.
  • Aspartate is made from oxaloacetate, an intermediate of the citrate cycle. Asparagine, methionine, threonine and lysine are each produced by converting aspartate. Isoleucine is made from threonine. In a complex 9-step process, histidine is formed from 5-phosphoribosyl-1-pyrophosphate, an activated sugar.
  • Amino acids the amount of which exceeds the protein biosynthesis requirement of the cell, cannot be stored and are instead broken down, so that intermediates are provided for the main metabolic pathways of the cell (for an overview see Stryer, L., Biochemistry, 3rd ed. Chap. 21 "Amino Acid Degradation and the Urea Cycle "; S 495-516 (1988)).
  • the cell is able to convert unwanted amino acids into useful metabolic intermediates, the amino acid production is complex in terms of energy, precursor molecules and the enzymes required for their synthesis.
  • amino acid biosynthesis is regulated by feedback inhibition, the presence of a particular amino acid slowing or completely stopping its own production (for an overview of the feedback mechanism in amino acid biosynthetic pathways, see Stryer, L., Biochemistry, 3rd ed., Chapter 24, "Biosynthesis of Amino Acids and Heme", pp. 575-600 (1988).
  • the output of a certain amino acid is therefore restricted by the amount of this amino acid in the cell.
  • Vitamins, cofactors and nutraceuticals comprise another group of molecules. Higher animals have lost the ability to synthesize them and must therefore absorb them, although they are easily synthesized by other organisms such as bacteria. These molecules are either biologically active molecules per se or precursors of biologically active substances that serve as electron carriers or intermediates in a number of metabolic pathways. In addition to their nutritional value, these compounds also have a significant industrial value as dyes, antioxidants and catalysts or other processing aids. (For an overview of the structure, activity and the industrial applications of these compounds, see, for example, Ullmann's Encyclopedia of Industrial Chemistry, "Vitamins", Vol. A27, pp. 443-613, VCH: Weinheim, 1996).
  • vitamin is known in the art and encompasses nutrients which are required by an organism for normal function, but which cannot be synthesized by this organism itself.
  • the group of vitamins can include cofactors and nutraceutical compounds.
  • cofactor includes non-proteinaceous compounds that are necessary for normal enzyme activity to occur. These compounds can be organic or inorganic; the cofactor molecules according to the invention are preferably organic.
  • nutraceutical encompasses food additives which are beneficial to plants and animals, in particular humans. Examples of such molecules are vitamins, antioxidants and also certain lipids (e.g. polyunsaturated fatty acids).
  • vitamin B ⁇ is obtained by chemical coupling of pyrimidine and thiazole
  • Riboflavin (vitamin B 2 ) is synthesized from guanosine 5'-triphosphate (GTP) and ribose 5'-phosphate. Riboflavin in turn is used to synthesize flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD).
  • GTP guanosine 5'-triphosphate
  • FMN flavin mononucleotide
  • FAD flavin adenine dinucleotide
  • the family of compounds commonly referred to as "Vitamin B6" e.g. pyridoxine, pyridoxamine, pyridoxal-5'-phosphate and the commercially used pyridoxine hydrochloride are all derivatives of the common structural unit 5-hydroxy-6-methylpyridine.
  • Panthothenate (pantothenic acid, R - (+) - N- (2,4-dihydroxy-3,3-dimethyl-1-oxobutyl) -ß-alanine) can be produced either by chemical synthesis or by fermentation.
  • the final steps in pantothenate biosynthesis consist of the ATP-driven condensation of ß-alanine and pantoic acid.
  • the enzymes responsible for the biosynthetic steps for the conversion into pantoic acid, into ß-alanine and for the condensation into pantothenic acid are known.
  • the metabolically active form of pantothenate is coenzyme A, whose biosynthesis takes place over 5 enzymatic steps.
  • Pantothenate pyridoxal-5'-phosphate, cysteine and ATP are the precursors of coenzyme A. These enzymes not only catalyze the formation of pantothenate, but also the production of (R) -pantoic acid, (R) -pantolactone, (R) - Panthenol (provitamin B 5 ), pantethein (and its derivatives) and coenzyme A.
  • Lipoic acid is derived from octanoic acid and serves as a coenzyme in energy metabolism, where it becomes part of the pyruvate dehydrogenase complex and the ⁇ -ketoglutarate dehydrogenase complex.
  • the folates are a group of substances that are all derived from folic acid, which in turn is derived from L-glutamic acid, p-aminobenzoic acid and 6-methylpterine.
  • guanosine 5'-triphosphate GTP
  • L-glutamic acid L-glutamic acid
  • p-aminobenzoic acid The biosynthesis of folic acid and its derivatives, starting from the metabolic intermediates guanosine 5'-triphosphate (GTP), L-glutamic acid and p-aminobenzoic acid, has been extensively investigated in certain microorganisms.
  • Corrinoids like the cobalamins and especially vitamin B 2
  • the porphyrins belong to a group of chemicals that are characterized by a tetrapyrrole ring system.
  • the biosynthesis of vitamin B 12 is sufficiently complex that it has not been fully characterized, but a large part of the only known enzymes and substrates.
  • Nicotinic acid (nicotinate) and nicotinamide are pyridine derivatives, which are also called "niacin”.
  • Niacin is the precursor of the important coenzymes NAD (nicotinamide adenine dinucleotide) and NADP (nicotinamide adenine dinucleotide phosphate) and their reduced forms.
  • purine and pyrimidine metabolism and their corresponding proteins are important targets for the therapy of tumor diseases and viral infections.
  • purine or pyrimidine encompasses nitrogenous bases which are part of the nucleic acids, coenzymes and nucleotides.
  • nucleotide includes the basic structural units of the nucleic acid molecules, which are a nitrogenous base, a pentose sugar (for RNA, the sugar is ribose, for DNA, the sugar is D-
  • nucleoside encompasses molecules which serve as precursors of nucleotides, but which, in contrast to the nucleotides, have no phosphoric acid unit.
  • nucleotides that do not form nucleic acid molecules, but serve as energy stores (i.e. AMP) or as coenzymes (i.e. FAD and NAD).
  • pyrimidine bases, nucleosides and nucleotides also have other possible uses: as intermediates in the biosynthesis of various fine chemicals (e.g. thiamine, S-adenosyl methionine, folate or riboflavin), as energy sources for the cell (e.g. ATP or GTP) and for chemicals themselves , are usually used as flavor enhancers (for example IMP or GMP) or for many medical applications (see for example Kuninaka, A., (1996) "Nucleotides and Related Compounds in Biotechnology Vol. 6, Rehm et al., ed. VCH: Weinheim, pp. 561-612)
  • Enzymes that are involved in purine, pyrimidine, nucleoside or nucleotide metabolism are also increasingly used as targets against chemicals for crop protection, including fungicides, herbicides and insecticides be developed.
  • the purine nucleotides are synthesized from ribose 5-phosphate via a series of steps via the intermediate compound innosine 5'-phosphate (IMP), which leads to the production of guanosine 5'-'monophosphate (GMP) or adenosine 5'-monophosphate (AMP) leads from which the triphosphate forms used as nucleotides can be easily produced. These compounds are also used as energy stores so that their degradation provides energy for many different biochemical processes in the cell. Pyrimidine biosynthesis takes place via the formation of uridine 5'-monophosphate (UMP) from ribose 5-phosphate UMP in turn is converted into cytidine 5'-triphosphate (CTP).
  • IMP innosine 5'-phosphate
  • UMP uridine 5'-monophosphate
  • CTP cytidine 5'-triphosphate
  • the deoxy forms of all nucleotides are produced in a one-step reduction reaction from the diphosphate ribose form of the nucleotide to the diphosphate deoxyribose form of the nucleotide. After phosphorylation, these molecules can participate in DNA synthesis.
  • Trehalose consists of two glucose molecules that are linked together via an ⁇ , ⁇ -1, 1 bond. It is commonly used in the food industry as a sweetener, as an additive for dried or frozen foods, and in beverages. However, it is also used in the pharmaceutical, cosmetic, and biotechnology industries (see, e.g., Nishimoto et al., (1998) U.S. Patent No. 5,759,610; Singer, MA and Lindquist, S. Trends Biotech. 16 (1998) 460-467; Paiva, CLA and Panek, AD Biotech Ann. Rev. 2 (1996) 293-314; and Shiosaka, MJ Japan 172 (1997) 97-102). Trehalose is produced by enzymes from many microorganisms and is naturally released into the surrounding medium from which it can be obtained by methods known in the art.
  • biosynthetic products are selected from the group of organic acids, proteins, nucleotides and nucleosides, both proteinogenic and non-proteinogenic amino acids, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, enzymes and proteins.
  • Preferred organic acids are tartaric acid, itaconic acid and diaminopimelic acid
  • nucleosides and nucleotides are described, for example, in Kuninaka, A. (1996) Nucleotides and related compounds, pp. 561-612, in Biotechnology Vol. 6, Rehm et al., Ed. VCH: Weinheim and the citations contained therein.
  • Preferred biosynthetic products are also lipids, saturated and unsaturated fatty acids such as arachidonic acid, diols such as propanediol and butanediol, carbohydrates such as hyaluronic acid and trehalose, aromatic compounds such as aromatic amines, vanillin and indigo, vitamins and cofactors such as described for example in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim and the citations contained therein; and Ong, AS, Niki, E. and Packer, L.
  • Particularly preferred biosynthetic products are amino acids, particularly preferably essential amino acids, in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid, L -Serine, L-proline, L-valine, L-isoleucine, L-cysteine, L-tyrosine, L-histidine, L-arginine, L-asparagine, L-aspartic acid and L-threonine, L-homoserine, especially L- Lysine, L-methionine and L-threonine.
  • essential amino acids in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid, L -Ser
  • an amino acid such as lysine, methionine and threonine means both the L- and the D-form of the amino acid, preferably the L-form, for example L-lysine, L-methionine and L-threonine.
  • the invention relates in particular to a process for the production of lysine by cultivating genetically modified microorganisms with an increased or caused expression rate of at least one gene compared to the wild type, wherein
  • ch increases the specific expression activity in the microorganism of at least one endogenous expression unit according to the invention, which regulates the expression of the endogenous genes, in comparison to the wild type or
  • the expression of genes in the microorganism is regulated by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment ch), the genes being heterologous with respect to the expression units,
  • genes are selected from the group nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a diaminopimelate dehydrogenase, nucleic acids encoding a diaminopimelate decarboxylase, nucleic acids encoding a dihydrodipidicolinate nuclein acids -Reductase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a transcriptional nucleic acid, a transcriptional nucleic acid LysR1 regulator, nucleic acids encoding a transcriptional LysR2 regulator
  • one or more expression units according to the invention are inserted into the genome of the microorganism brings, so that the expression of one or more of these endogenous genes under the control of the introduced expression units according to the invention, optionally with increased specific expression activity, or
  • dh2 introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with increased specific expression activity
  • nucleic acid constructs containing an expression unit according to the invention optionally with increased specific expression activity, and functionally linked, introducing one or more nucleic acids to be expressed into the microorganism.
  • a further preferred embodiment of the method for producing lysine described above is characterized in that the genetically modified microorganisms additionally have an increased activity compared to the wild type, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase activity , Diaminopimelate dehydrogenase activity, diaminopimelate decarboxylase activity, dihydrodipicolinate synthetase activity, dihydridipicolinate reductase activity, glyceraldehyde 3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity , Triosephosphate isomerase activity, activity of the transcriptional regulator LuxR, activity of the transcriptional regulator LysR1, activity of the transcriptional regulator LysR2, malate-quinone oxodoreductase activity, glucose-6-phosphate-deydrognease activity, 6-phosphogluconate de
  • Another particularly preferred embodiment of the process for the production of lysine described above is characterized in that the genetically modified microorganisms additionally have a reduced activity compared to the wild type, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acetyltransferase activity, O-acetylhomoserine sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, homoserine kinase activity, homoserine dehydrogenase activity, threonine exporter activity, threonine efflux protein activity Activity, asparaginase activity, aspartate Have decarboxylase activity and threo ⁇ in synthase activity.
  • the genetically modified microorganisms additionally have a reduced activity compared to the wild type, at least one of the activities selected from the group threonine dehydratase activity, homoser
  • nucleic acid according to the invention with promoter activity and / or an expression unit according to the invention.
  • the invention further relates to a method for producing methionine by cultivating genetically modified microorganisms with an increased or caused expression rate of at least one gene compared to the wild type, wherein
  • ch increases the specific expression activity in the microorganism of at least one endogenous expression unit according to the invention, which regulates the expression of the endogenous genes, in comparison to the wild type or
  • the expression of genes in the microorganism is regulated by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment ch), the genes being heterologous with respect to the expression units,
  • genes are selected from the group nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a homoserine dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, Pyruvate carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine O-acetyltransferase, nucleic acids encoding a cystahionin-gamma synthase, nucleic acids encoding a cystahionin-beta-lyase, nucleic acids encoding a serine-hydroxymethyl-acetylsulfase, a nucleic acid-
  • dh1 introduces one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more of these endogenous genes takes place under the control of the expression units according to the invention, optionally with increased specific expression activity, or
  • dh2 introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, possibly with increased specific expression activity
  • nucleic acid constructs containing an expression unit according to the invention optionally with increased specific expression activity, and functionally linked, introducing one or more nucleic acids to be expressed into the microorganism.
  • a further preferred embodiment of the method for the production of methionine described above is characterized in that the genetically modified microorganisms additionally have an increased activity compared to the wild type, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase activity , Homoserine dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, homoserine O-acetyltransferase activity, cystahionin gamma synthase activity, cystahionin beta -Lyase activity Serine hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase activity, methylene tetrahydrofolate reductase activity, phosphoserine aminotransfera
  • a further particularly preferred embodiment of the method for the production of methionines described above is characterized in that the genetically modified microorganisms additionally have a reduced activity compared to the wild type, at least one of the activities selected from the homoserine kinase activity, threonine dehydratase -Activity, threonine synthase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthase activity, dihydrodipicolinate reductase activity, and diaminopicolinate decarboxylase activity.
  • nucleic acid according to the invention with promoter activity and / or an expression unit according to the invention.
  • the invention further relates to a method for producing threonine by cultivating genetically modified microorganisms with an increased or caused expression rate of at least one gene compared to the wild type, wherein
  • ch increases the specific expression activity in the microorganism of at least one endogenous expression unit according to the invention, which regulates the expression of the endogenous genes, in comparison to the wild type or
  • the expression of genes in the microorganism is regulated by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment ch), the genes being heterologous with respect to the expression units,
  • genes are selected from the group nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvic acid carboxylase Triose phosphate isomerase, nucleic acids encoding a homoserine kinase, nucleic acids encoding a threonine synthase, nucleic acids encoding a threonine exporter carrier, nucleic acids encoding a glucose-6-phosphate dehydrogenase, nucleic acids encoding a transaldolase, nucleic acids encoding a transketolase, nucleic acids encoding a malate quinone oxidoreductase,
  • dh1 introduces one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more of these endogenous genes takes place under the control of the introduced expression units according to the invention, optionally with increased specific expression activity, or
  • dh2 introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with increased specific expression activity
  • nucleic acid constructs containing an expression unit according to the invention optionally with increased specific expression activity, and functionally linked, introducing one or more nucleic acids to be expressed into the microorganism.
  • a further preferred embodiment of the method for producing threonine described above is characterized in that the genetically modified microorganisms additionally have an increased activity compared to the wild type, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase activity , Glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, threonine synthase activity, activity of a threonine export carrier, transaldolase activity, transketola se activity, glucose-6-phosphate dehydrogenase activity, malate qinone oxidoreductase activity, homoserine kinase activity, biotin ligase activity, phosphoenolpyruvate carboxylase activity, threonine efflux protein activity, protein OpcA -Activity, 1-phospho
  • a further particularly preferred embodiment of the method for producing threonine described above is characterized in that the genetically modified microorganisms additionally have a reduced activity compared to the wild type, at least one of the activities selected from the group threonine dehydratase activity, homoserine O- Acetyltransferase activity, serine hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthetase activity, dihydrase activity Activity, aspartate decarboxylase activity, lysine exporter activity, acetolactate synthase activity, ketol aid reductoisomerase activity, branched chain aminotransferase activity, coenzyme B12-dependent methionine synthas
  • nucleic acid according to the invention with promoter activity and / or an expression unit according to the invention.
  • activity of a protein is understood to mean the enzyme activity of the corresponding protein in the case of enzymes, the physiological activity of the proteins in the case of other proteins, for example structure or transport proteins.
  • the enzymes are able to convert a substrate into a product or to catalyze this conversion step.
  • the "activity" of an enzyme is understood to mean the amount of substrate or amount of product converted by the enzyme in a certain time.
  • the amount of substrate converted by the enzyme is thus in a certain time compared to the wild type or the amount of product formed increases.
  • This increase in activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, especially at least in all the activities described above and below 600% of wild type activity ".
  • the amount of substrate converted or the amount of product formed is reduced in a certain time by the enzyme compared to the wild type.
  • a reduced activity is preferably understood to mean the partially or essentially complete inhibition or blocking of the functionality of this enzyme in a microorganism based on different cell biological mechanisms.
  • a reduction in activity includes a quantitative reduction of an enzyme up to an essentially complete absence of the enzyme (i.e. lack of detectability of the corresponding activity or a lack of immunological
  • the activity in the microorganism is preferably reduced by at least 5%, more preferably by at least 20%, more preferably by at least 50%, more preferably by 100% compared to the wild type.
  • “reduction” also means the complete absence of the corresponding activity.
  • the activity of certain enzymes in genetically modified microorganisms and in the wild type and thus the increase or decrease in the enzyme activity can be determined by known methods, such as enzyme assays.
  • a pyruvate carboxylase is understood to mean a protein which has the enzymatic activity to convert pyruvate to oxaloacetate.
  • a pyruvate carboxylase activity is understood to mean the amount of pyruvate or amount of oxaloacetate converted by the protein pyruvate carboxylase in a certain time.
  • the amount of pyruvate or the amount of oxaloacetate formed is increased in a certain time by the protein pyruvate carboxylase compared to the wild type.
  • This increase in pyruvate carboxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the pyruvate carboxylase activity of the wild type.
  • a phosphoenolpyruvate carboxykinase activity means the enzyme activity of a phosphoenolpyruvate carboxykinase.
  • a phosphoenolpyruvate carboxykinase is understood to be a protein which has the enzymatic activity to convert oxaloacetate to phosphoenolpyruvate.
  • phosphoenolpyruvate carboxykinase activity is understood to mean the amount of oxaloacetate or amount of phosphoenolpyruvate converted or formed by the protein phosphoenolpyruvate in a certain time.
  • the amount of oxaloacetate converted or the amount of phosphoenolpyruvate formed is reduced in a certain time by the protein phosphoenolpyruvate carboxykinase compared to the wild type.
  • a reduction in the phosphoenolpyruvate carboxykinase activity includes a quantitative reduction in a phosphoenolpyruvate carboxykinase up to an essentially complete absence of the phosphoenolpyruvate carboxykinase (i.e. lack of detectability of phosphoenolpyruvate carboxykinase activity or a lack of immunological detectability of the phosphoenolpyrukate kinase).
  • the phosphoenolpyruvate carboxykinase activity is preferably reduced by at least 5%, more preferably by at least 20%, more preferably by at least 50%, more preferably by 100% compared to the wild type.
  • “reduction” also means the complete absence of phosphoenolpyruvate carboxykinase activity.
  • the additional increase in activities can take place in various ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression of nucleic acids encoding the proteins described above compared to the wild type.
  • the increase in the gene expression of the nucleic acids encoding the proteins described above compared to the wild type can also be achieved in various ways, for example by inducing the gene by activators or the like described above by increasing the promoter activity or increasing the expression activity or by introducing one or more gene copies into the microorganism.
  • Increasing the gene expression of a nucleic acid encoding a protein also means, according to the invention, the manipulation of the expression of the microorganism's own endogenous proteins.
  • the person skilled in the art can take further different measures individually or in combination to achieve an increase in gene expression.
  • the number of copies of the corresponding genes can be increased, or the promoter and regulatory region or the ribosome binding site, which is located upstream of the structural gene, can be mutated.
  • Inducible promoters also make it possible to increase expression in the course of fermentative production.
  • the expression is also improved by measures to extend the life of the mRNA.
  • preventing the breakdown of the enzyme protein also increases the enzyme activity.
  • the genes or gene constructs can either be present in plasmids with different copy numbers or can be integrated and amplified in the chromosome. Alternatively, overexpression of the genes in question can also be achieved by changing the media composition and culture management.
  • the gene expression of a nucleic acid encoding one of the proteins described above is increased by introducing at least one nucleic acid encoding a corresponding protein into the microorganism.
  • the nucleic acid can be introduced in a chromosomal or extrachromosomal manner, that is to say by increasing the number of copies on the chromosome and or a copy of the gene on a replicating plasmid in the host microorganism.
  • the nucleic acid is preferably introduced, for example in the form of an expression cassette containing the nucleic acid, chromosomally, in particular by means of the SacB method described above.
  • any gene encoding one of the proteins described above can be used for this purpose.
  • nucleic acid sequences which have already been processed such as the corresponding cDNAs, are preferred use.
  • the activities in microorganisms described above are preferably reduced by at least one of the following methods:
  • Knockout mutants can preferably be generated by targeted insertion into the desired target gene by homologous recombination or by introducing sequence-specific nucleases against the target gene.
  • Each of these methods can reduce the amount of protein, amount of mRNA and / or activity of a protein.
  • a combined application is also conceivable.
  • Other methods are known to the person skilled in the art and can include the hindrance or inhibition of the processing of the protein, the transport of the protein or its mRNA, inhibition of ribosome attachment, inhibition of RNA splicing, induction of an RNA-degrading enzyme and / or inhibition of translation elongation or termination ,
  • the cultivation step of the genetically modified microorganisms is preferably followed by isolation of biosynthetic products from the microorganisms or / or from the fermentation broth. These steps can take place simultaneously and / or preferably after the cultivation step.
  • the genetically modified microorganisms according to the invention can be carried out continuously or discontinuously in a batch process (batch cultivation) or in a fed batch (feed process) or repeated fed batch process (repetitive feed process) for the production of biosynthetic products, in particular L-lysine, L-methionine and L-threonine.
  • a batch process batch cultivation
  • feed process fed batch
  • repetitive feed process repeated fed batch process
  • biosynthetic products in particular L-lysine, L-methionine and L-threonine.
  • the culture medium to be used must suitably meet the requirements of the respective strains. Descriptions of culture media of various microorganisms are contained in the manual "Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington DC, USA, 1981).
  • These media which can be used according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.
  • Preferred carbon sources are sugars, such as mono-, di- or polysaccharides.
  • sugars such as mono-, di- or polysaccharides.
  • very good carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose.
  • Sugar can also be added to the media through complex compounds such as molasses or other by-products of sugar refining. It may also be advantageous to add mixtures of different carbon sources.
  • Other possible carbon sources are oils and fats such as e.g. B. Soybean oil. Sunflower oil.
  • Peanut oil and coconut fat fatty acids such as As palmitic acid, stearic acid or linoleic acid, alcohols such as. As glycerol, methanol or ethanol and organic acids such as. B. acetic acid or lactic acid.
  • Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds.
  • Exemplary nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soy flour, soy protein, yeast extract, meat extract and others.
  • the nitrogen sources can be used individually or as a mixture.
  • Inorganic salt compounds that may be included in the media include the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron
  • Inorganic compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, but also organic sulfur compounds, such as mercaptans and thiols, can be used as the sulfur source for the production of fine chemicals, in particular methionine.
  • Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
  • Chelating agents can be added to the medium to keep the metal ions in solution.
  • Particularly suitable chelating agents include dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.
  • the fermentation media used according to the invention usually also contain other growth factors, such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine.
  • growth factors and salts often come from complex media components such as yeast extract, molasses, corn steep liquor and the like. Suitable precursors can also be added to the culture medium.
  • the exact composition of the media connections strongly depends on the respective experiment 'and is decided individually for each specific case. Information about media optimization is available from the textbook "Applied Microbiol. Physiology, A Practical Approach” (ed. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3).
  • Growth media can also be obtained from commercial suppliers, such as Standard 1 (Merck) or BHI (Brain heart infusion, DIFCO) and the like.
  • All media components are sterilized either by heat (20 min at 1.5 bar and 121 ° C) or by sterile filtration.
  • the components can either be sterilized together or, if necessary, separately. All media components can be present at the beginning of the cultivation or optionally added continuously or in batches.
  • the temperature of the culture is normally between 15 ° C and 45 ° C, preferably 25 ° C to 40 ° C and can be kept constant or changed during the experiment.
  • the pH of the medium should be in the range from 5 to 8.5, preferably around 7.0.
  • the pH for cultivation can be checked during the cultivation by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid.
  • anti-foaming agents such as B. fatty acid polyglycol esters can be used.
  • suitable selectively acting substances such as, for. B. antibiotics.
  • oxygen or oxygen-containing gas mixtures such as e.g. B. ambient air
  • the temperature of the culture is usually 20 ° C to 45 ° C.
  • the culture is continued until a maximum of the desired product has formed. This goal is usually achieved within 10 hours to 160 hours.
  • the fermentation broths thus obtained usually have a dry matter of 7.5 to 25% by weight.
  • the fermentation is carried out with limited sugar at least at the end, but in particular for at least 30% of the fermentation period. This means that the concentration of usable sugar in the fermentation medium is maintained or reduced to 0 to 3 g / l during this time.
  • the isolation of biosynthetic products from the fermentation broth and / or the microorganisms is carried out in a manner known per se in accordance with the physico-chemical properties of the biosynthetic product of value and the biosynthetic by-products.
  • the fermentation broth can then be processed further, for example.
  • the biomass can be wholly or partly separated using separation methods such as. B. centrifugation, filtration, decanting or a combination of these methods can be removed from the fermentation broth or left completely in it.
  • the fermentation broth can then be prepared using known methods, such as, for. B. with the help of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration, thickened or concentrated.
  • This concentrated fermentation broth can then be worked up by freeze drying, spray drying, spray granulation or by other processes.
  • Methionine and L-threonine to further purify.
  • the product-containing broth is subjected to chromatography with a suitable resin after the biomass has been separated off, the desired product or the impurities being wholly or partly retained on the chromatography resin. If necessary, these chromatographic steps can be repeated, the same or different re chromatography resins can be used.
  • the person skilled in the art is skilled in the selection of the suitable chromatography resins and their most effective application.
  • the purified product can be concentrated by filtration or ultrafiltration and kept at a temperature at which the stability of the product is maximum.
  • the biosynthetic products can be obtained in various forms, for example in the form of their salts or esters.
  • the identity and purity of the isolated compound (s) can be determined by prior art techniques. These include high performance
  • an allelic exchange of the lysC wild-type gene in Corynebacterium glutamicum ATCC13032 was carried out.
  • a nucleotide exchange was carried out in the lysC gene, so that the amino acid Thr at position 311 in the resulting protein was replaced by an III.
  • the oligonucleotide primers SEQ ID NO: 5 and SEQ ID NO: 6 were used to amplify lysC using the Pfu-Turbo PCR system (Stratagene USA) according to the manufacturer.
  • SEQ ID NO: 6 5'-CTCTCTCTGTCGACGAATTCAATCTTACGGCCTG-3 ' Chromosomal DNA from C. glutamicum ATCC 13032 was developed according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828.
  • the amplified fragment is flanked at its S 'end by a Sall restriction cut and at its 3' end by a Mlul restriction cut. Before cloning, the amplified fragment was digested by these two restriction enzymes and purified using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg).
  • the polynucleotide obtained was cloned integrally via the Sall and Mlul restriction sections in pCLIK5 MCS in the following called SacB in the following pCIS (SEQ ID NO: 7) and transformed into E.coli XL-1 blue.
  • Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190). The plasmid was isolated and the expected nucleotide sequence was confirmed by sequencing.
  • the plasmid DNA was prepared using methods and materials from Quiagen. Sequencing reactions were carried out according to Sanger et al.
  • the directed mutagenesis of the lysC gene from C. glutamicum was carried out using the Quick Change Kit (from Stratagene / USA) according to the manufacturer's instructions.
  • the mutagenesis was carried out in the plasmid pCIS lysC, SEQ ID NO: 8.
  • the following oligonucleotide primers were synthesized for the exchange of thr 311 after 311 ile using the Quickchange method (Stratagene):
  • oligonucleotide primers in the Quickchange reaction leads to an exchange of the nucleotide in position 932 (from C to T) in the lysC gene SEQ ID NO: 11.
  • the resulting amino acid exchange Thr3111le in the lysC gene was transformed by a sequencing reaction after transformation in E.coli XL1-blue and plasmid preparation. confirmed.
  • the plasmid was named pCIS lysC thr311ile and is called SEQ ID NO: 11.
  • the plasmid pCIS lysC thr311 ile was in C. glutamicum ATCC13032 by means of electroporation as in Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303. Modifications to the protocol are described in DE 10046870.
  • the chromosomal arrangement of the lysC locus of individual transformants was determined using standard methods by Southemblot and hybridization as described in Sambrook et al. (1989) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor. This ensured that the transformants are those which have integrated the transformed plasmid by homologous recombination at the lysC locus.
  • sucrose CM agar medium (10% sucrose, 10 g / l glucose; 2.5 g / l NaCl; 2 g / l urea, 10 g / l Bacto Peptone (Difco); 10 g / l yeast extract, 22.0 g / L agar (Difco)) plated out and incubated at 30 ° C for 24 hours.
  • the sacB gene contained in the vector pCIS lysC thr311ile converts sucrose into a toxic product, only those colonies can grow which have deleted the sacB gene by a second homologous recombination step between the wild-type lysC gene and the mutated lysC thr311ile gene. During the homologous recombination, either the wild-type gene or the mutated gene together with the sacB gene can be deleted. If the sacB gene is removed together with the wild-type gene, a mutant transformant results.
  • SEQ ID 14 sodl: 5'- tacgaccagggccacgggtaaaaatcctttcgtaggtttccgcaccgagcatatacatcttttg-3 '
  • the primers were used in a PCR reaction with chromosomal DNA from C. glutamicum ATCC 13032. With this approach, a DNA fragment could be amplified that corresponded to the expected size of 657 bp.
  • the primers were used in a PCR reaction with chromosomal DNA from C. glutamicum ATCC13032 lysC fbr . With this approach, a DNA fragment could be amplified that corresponded to the expected size of 1638 bp.
  • the primers sodl and ask2 contain an overlapping sequence and are homologous to one another at their 5 'ends.
  • PCR products obtained above were used as templates for a further PCR in which the following primers were used.
  • SEQ ID 18 lysC4: 5'- tcggttgcctgagtaatgtctt-3 '
  • oligonucleotides were defined for the amplification of a 5 ′ region of the lysC gene:
  • the primers were used in a PCR reaction with chromosomal DNA from C. glutamicum. With this approach, a DNA fragment could be amplified that corresponded to the expected size of 674 bp.
  • This DNA fragment was cloned into the vector pCR2.1 (Invitrogen GmbH, Düsseldorf, Germany).
  • a 787 bp Spel / Xbal fragment was then cloned into the vector pK19 mob sacB Psod lysC, which had previously been digested with the restriction enzyme 'Nhel.
  • the resulting plasmid was named pK19 mob sacB Psod lysC + US (SEQ ID 22).
  • all clonings were carried out in Escherichia coli XL-1 Blue (Stratagene, Amsterdam, Nierderouche).
  • E. coli Mn522 (Stratagene, Amsterdam, Nierderlander) was then transformed with the plasmid pK19 mobsacB Psod lysC + US together with the plasmid pTc15AcglM according to Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303.
  • the plasmid pTd 5AcglM enables the methylation of DNA according to the methylation pattern of Corynebacterium glutamicum (DE 10046870). This step enables subsequent electroporation of Corynebacterium glutamicum with the integration plasmid pK19 mob sacB Psod lysC + US.
  • transconjugants were obtained from this electroporation and the subsequent selection on CM plates with kanamycin (25 ⁇ g / ml). These transconjugants were grown in CM medium overnight without kanamycin and then selected for selection on CM plates with 10% for selection for the second recombination event which is to lead to excision of the vector including the lysC promoter and the lysC gene. Sucrose plated.
  • the sacB gene present on the vector pK19 mob sacB codes for the enzyme laevansucrase and, when grown on sucrose, leads to the synthesis of laevan. Since Laevan is toxic to C. glutamicum, only C.
  • sucrose-containing medium a sucrose-containing medium
  • sucrose-resistant clones were checked for their kanamycin sensitivity. For 57 of the clones tested, resistance to sucrose was also demonstrated to be sensitive to kanamycin.
  • a polymerase chain reaction (PCR) was used to check whether the desired exchange of the natural expression unit by the psod expression unit had also taken place. For this analysis, chromosomal DNA was isolated from the parent strain and 20 clones.
  • the respective clones were removed from the agar plate with a toothpick and suspended in 100 ⁇ l H 2 O and boiled at 95 ° C. for 10 min. 10 ⁇ l of the solution obtained were used as templates in the PCR. Oligonucleotides which are homologous to the psod expression unit and the lysC gene were used as primers.
  • the PCR conditions were chosen as follows: pre-denaturation: 5 min at 95 ° C; Denaturation 30 sec at 95 ° C; Hybridization 30 sec at 55 ° C; Amplification at 72 ° C for 2 min; 30 cycles; Final expression 5 min at 72 ° C.
  • C. glutamicum strains which contained either a chromosomal copy of the lysC ⁇ gene with the natural promoter or a chromosomal copy of the Psod lysC "* construct were in MMA medium (20 g / l glucose, 10 g / l (NH 4 ) 2 SO 4 , 0.5 g KH 2 PO 4 , 0.5 g K 2 HPO 4 , 2.5 g urea, 5 g NaCl, 400 mg MgSO 4 + 7H 2 O, 10 mg FeSO 4 * 7H 2 O , MnSO 4 * 6 H 2 O, 100 mg L-leucine, 100 mg L-cysteine, 250 mg pantothenic acid, 5 mg nicotinamide, 100 ⁇ g biotin, 200 ⁇ g thiamine, 15 g MOPS, pH 6.8) at 30 ° C to grown to an OD600 of 8.
  • the cells were centrifuged at 4 ° C. and washed twice with cold Tris-HCl buffer (0.1%, pH 8.0). After centrifugation again, the cells were washed in cold Tris-HCl- Buffer (0.1%, pH 8.0) was added and an OD 60 o of 160.
  • 1 ml of this cell suspension was transferred into 2 ml ribolysis tubes from Hybaid and in a ribolyser from Hybaid a rotation setting of 6.0 three times for each Lysed for 30 sec.
  • the lysate was clarified by centrifugation at 15,000 rpm at 4 ° C. in an Ependorf centrifuge for 30 minutes and the supernatant was transferred to a new Eppendororf cup.
  • the protein content was anal according to Bradford, MM (1976). Biochem. 72: 248-254.
  • the aspartokinase enzymatic activity was carried out as follows. Reaction batches of 1 ml with 100 mM Tris-HCl (pH 8.0), 10 mM MgCl 2, 600 mM hydroxylamine HCl (pH 73.0 with 10 N KOH), 4 mM ATP, 200 mM aspartate (sodium salt) and H 2 O 1 ml were incubated at 30 ° C. for 10 min. The test was started by adding the respective protein lysate and incubated at 30 ° C. for 30 min.
  • the ATCC13032, ATCC13032 lysC * 'and ATCC13032 Psod lysC ftr strains were used on CM plates (10.0 g / L D-glucose, 2.5 g / L NaCI, 2.0 g / L urea, 10.0 g / L Bacto Peptone (Difco), 5.0 g / L Yeast Extract (Difco), 5.0 g / L Beef Extract (Difco), 22.0 g / L Agar (Difco), autoclaved (20 min. 121 ° C)) for 2 days at 30 ° C.
  • the cells were then scraped off the plate and resuspended in saline.
  • 10 ml of medium I and 0.5 g of autoclaved CaCO 3 (Riedel de Haen) were inoculated with the cell suspension in a 100 ml Erienmeyer flask to an OD 6 oo of 1.5 and for 39 h on an Infors type AJ118 (Infors, Bottmingen, Switzerland) incubated at 220 rpm. The concentration of the lysine excreted in the medium was then determined.
  • the amino acid concentration was determined by means of high-pressure liquid chromatography according to Agilent on an Agilent 1100 Series LC System HPLC. A pre-column derivatization with ortho-pthalaldehyde allows the quantification of the amino acids formed, the separation of the amino acid mixture takes place on a Hypersil AA column (Agilent). The result of the investigation is shown in Table 2a0 Table 2a
  • ampicillin resistance and origin of replication of the vector pBR322 were amplified with the oligonucleotide primers SEQ ID NO: 23 and SEQ ID NO: 24 using the polymerase chain reaction (PCR) 24 5'-TCTAGACTCGAGCGGCCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTC G-3 '
  • the oligonucleotide primer SEQ ID NO: 23 in the 5'-3 'direction contains the interfaces for the restriction endonucleases Smal, BamHI, Nhel and Ascl and the oligonucleotide primer SEQ ID NO: 24 in the 5'-3' direction Interfaces for the restriction endonucleases Xbal, Xhol, Notl and Dral.
  • the PCR reaction was carried out according to standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA).
  • the resulting DNA fragment with a size of approximately 2.1 kb was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the blunt ends of the DNA fragment were ligated together using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was carried out according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing ampicillin (50 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is named pCLiKI.
  • a cassamycin resistance cassette was amplified with the oligonucleotide primers SEQ ID NO: 25 and SEQ ID NO: 26.
  • SEQ ID NO: 25 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-3 '
  • the oligonucleotide primer SEQ ID NO: 25 in the 5'-3 'direction contains the interfaces for the restriction endonucleases Xbal, Smal, BamHI, Nhel and the oligonucleotide primer SEQ ID NO: 26 in the 5'-3' direction Interfaces for the restriction endonucleases Ascl and Nhel.
  • the PCR reaction was carried out according to standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA).
  • the resulting DNA fragment with a size of approximately 1.3 kb was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment was cut with the restriction endonucleases Xbal and Ascl (New England Biolabs, Beverly, USA) and then again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer cleaned.
  • the vector pCLiKI was also cut with the restriction endonucleases Xbal and Ascl and dephosphorylated with alkaline phosphatase (I (Röche Diagnostics, Mannheim)) according to the manufacturer.
  • the linearized vector (approx. 2.1 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation approach according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA).
  • a selection for plasmid-carrying cells was achieved by plating on LB agar containing ampicillin (50 ⁇ g / ml) and kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is named pCLiK2.
  • the vector pCLiK2 was cut with the restriction endonuclease Dral (New England Biolabs, Beverly, USA). After electrophoresis in a 0.8% agarose gel, an approximately 2.3 kb vector fragment was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was religated using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was performed according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is named pCLiK3.
  • the origin of replication pHM1519 was amplified with the oligonucleotide primers SEQ ID NO: 27 and SEQ ID NO: 28.
  • SEQ ID NO: 28 5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-3 '
  • the oligonucleotide primers SEQ ID NO: 27 and SEQ ID NO: 28 contain interfaces for the restriction endonuclease Notl.
  • the PCR reaction was carried out according to standard methods such as Innis et al. (PCR Protocols. A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo Polymerase (Stratagene, La Jolla, USA).
  • the resulting DNA fragment with a size of approximately 2.7 kb was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment was cut with the restriction endonuclease Notl (New England Biolabs, Beverly, USA) and then purified again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the vector pCLiK3 was also cut with the restriction endonuclease Not1 and dephosphorylated with alkaline phosphatase (I (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 2.3 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation approach according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), in competent E.coli XL-1Blue (Stratagene, La Jolla,
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is given the name pCLiK5.
  • the vector pCLiK ⁇ was cut with the restriction endonucleases Xhol and BamHI (New England Biolabs, Beverly, USA) and dephosphorylated with alkaline phosphatase (I (Röche Diagnostics, Mannheim)) according to the manufacturer. After electrophoresis in a 0.8% agarose gel, the linearized vector (approx. 5.0 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • This vector fragment was ligated with the help of the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer with the synthetic double-stranded DNA fragment and the ligation approach according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA of an individual clone was isolated using the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer's instructions and checked by restriction digestion.
  • the plasmid obtained in this way is called pCLiK5MCS.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was developed according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. With the oligonucleotide primers SEQ ID NO 32 and SEQ ID NO 33, the chromosomal DNA as template and Pfu Turbo Polymerase (from Stratagene), the polymerase chain reaction (PCR) was carried out according to standard methods, as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, which amplifies the metA gene including the non-coding 5 'region.
  • the DNA fragment of approximately 1.3 kb in size was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. It was then cleaved with the restriction enzymes Asp718 and Spei (Röche Diagnostics, Mannheim) and the DNA fragment was purified using GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector pClik ⁇ MCS SEQ ID NO: 31 was cut with the restriction enzymes Asp718 and Spei and a 5 kb fragment was isolated after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector fragment was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was carried out according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA was prepared using methods and materials from
  • the resulting plasmid pCLiK5MCS PmetA metA is listed as SEQ ID NO 34 :.
  • Chromosomal DNA from C. glutamicum ATCC 13032 was developed according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. With the oligonucleotide primers SEQ ID NO 35 and SEQ ID NO 36, the chromosomal DNA as template and Pfu Turbo Polymerase (from Stratagene), the polymerase chain reaction (PCR) was used according to standard methods such as Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press amplified a DNA fragment of approx. 200 base pairs from the 5 'non-coding region (region of the expression unit) of superoxide dismutase (Psod).
  • the DNA fragment obtained was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
  • the DNA fragment of approximately 470 base pairs obtained was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions. In a further PCR reaction, the two fragments obtained above were used together as templates. As a result of the sequences homologous to metA introduced with the oligonucleotide primer SEQ ID NO: 36, in the course of the PCR reaction there is an attachment of both fragments to one another and an extension to a continuous DNA strand by the polymerase used. The standard method was modified in such a way that the oligonucleotide primers SEQ ID NO: 35 and SEQ ID NO: 38 used were only added to the reaction mixture at the beginning of the second cycle.
  • the amplified DNA fragment of approximately 675 base pairs was purified using the GFX TM PCR, DNA and Gel Band Purification Kit according to the manufacturer's instructions. Subsequently, it was cleaved with the restriction enzymes Xhol and Ncol (Röche Diagnostics, Mannheim) and separated by gel electrophoresis. The approximately 620 base pair DNA fragment was then purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg). The plasmid PmetA metA SEQ ID NO 34: was cleaved with the restriction enzymes Ncol and Spei (Röche Diagnostics, Mannheim). After gel electrophoretic separation, an approximately 0.7 kb metA fragment was purified from the agarose using GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector pClik ⁇ MCS SEQ ID NO: 31 was cut with the restriction enzymes Xhol and Spei (Röche Diagnostics, Mannheim) and a ⁇ kb fragment was isolated after electrophoretic separation with GFX TM PCR, DNA and Gel Band Purification Kit.
  • the vector fragment was ligated together with the PCR fragment and the metA fragment using the Rapid DNA Ligation Kit (Röche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation approach was carried out according to standard methods as described in Sambrook et al. (Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, described (1989)), transformed into competent E.coli XL-1 Blue (Stratagene, La Jolla, USA). Selection for plasmid-bearing cells was achieved by plating on LB agar containing kanamycin (20 ⁇ g / ml) (Lennox, 1955, Virology, 1: 190).
  • the plasmid DNA was prepared using methods and materials from Quiagen. Sequencing reactions were carried out according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-6467. The sequencing reactions were separated and evaluated using ABI Prism 377 (PE Applied Biosystems, Rothstadt). The resulting plasmid pCLiK ⁇ MCS PSODmetA is listed as SEQ ID NO 39 :.
  • Example 9 MetA Activities The strain Corynebacterium glutamicum ATCC13032 was in each case with the plasmids pClik ⁇ MCS, pClik MCS PmetA metA, pCLiK ⁇ MCS Psod metA, according to the method described (Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303) transformed. The transformation mixture was plated on CM plates which additionally contained 20 mg / l kanamycin in order to achieve a selection for plasmid-containing cells. Obtained Kan-resistant clones were picked and isolated.
  • C. glutamicum strains containing one of these plasmid constructs were grown in MMA medium ((40 g / l sucrose, 20 g / l (NH 4 ) 2 SO 4 , 1 g / l KH 2 PO 4 , 1 g / l K 2 HPO 4, 5 0,2 ⁇ g / l MgSO 4 x 7H 2 O, ⁇ 4 g Aces, 1 ml CaCl 2 (10 g / l), 1 ml Protocatechoat (300 mg / 10 ml), 1 ml trace element solution (10 g / l FeSO 4 x / H 2 O, 10 g / l MnSO 4 x H 2 O, 2 g / l ZnSO 4 x 7 H 2 O, 0.2 g / l CuSO 4 , 0.02 g / l NiCI 2 x 6 H 2 O), 100 ⁇ g / l vitamin B 12 , 0.3 mg / l
  • the measurement of the enzymatic activity of MetA was carried out as follows.
  • the 0 ml reaction batches contained 100 mM potassium phosphate buffer (pH 7.5), ⁇ mM MgCl 2, 100 ⁇ M acetyl CoA, ⁇ mM L-homoserine, ⁇ OO ⁇ M DTNB (Ellman's reagent) and cell extract.
  • the test was started by adding the respective protein lysate and incubated at room temperature. Kinetics were then recorded at 412 nm for 10 min. ⁇ The results are shown in Table 3a. Table 3a

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/EP2004/014337 2003-12-18 2004-12-16 Psod-expressionseinheiten Ceased WO2005059144A1 (de)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA002549171A CA2549171A1 (en) 2003-12-18 2004-12-16 Psod expression units
DE502004011835T DE502004011835D1 (de) 2003-12-18 2004-12-16 Psod-expressionseinheiten
AT04803950T ATE486131T1 (de) 2003-12-18 2004-12-16 Psod-expressionseinheiten
US10/583,191 US20080274516A1 (en) 2003-12-18 2004-12-16 Psod Expression Units
JP2006544337A JP2007514426A (ja) 2003-12-18 2004-12-16 Psod発現ユニット
BRPI0417728-2A BRPI0417728A (pt) 2003-12-18 2004-12-16 uso de um ácido nucleico e de uma unidade de expressão, ácido nucleico, unidade de expressão, método para alterar ou induzir a taxa de transcrição de genes em microorganismos, cassete de expressão, vetor de expressão, microorganismo geneticamente modificado, método para preparar produtos biossintéticos e uso de uma seqüência de ácido nucleico
EP04803950A EP1697526B1 (de) 2003-12-18 2004-12-16 Psod-expressionseinheiten
ZA2006/05857A ZA200605857B (en) 2003-12-18 2006-07-17 PSOD expression units
US12/030,575 US8071365B2 (en) 2003-12-18 2008-02-13 Psod expression units
US12/546,651 US20100062535A1 (en) 2003-12-18 2009-08-24 Psod expression units

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10359660.7 2003-12-18
DE10359660A DE10359660A1 (de) 2003-12-18 2003-12-18 Psod-Expressionseinheiten

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US10/583,191 A-371-Of-International US20080274516A1 (en) 2003-12-18 2004-12-16 Psod Expression Units
US12/030,575 Division US8071365B2 (en) 2003-12-18 2008-02-13 Psod expression units
US12/546,651 Division US20100062535A1 (en) 2003-12-18 2009-08-24 Psod expression units

Publications (1)

Publication Number Publication Date
WO2005059144A1 true WO2005059144A1 (de) 2005-06-30

Family

ID=34683563

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/014337 Ceased WO2005059144A1 (de) 2003-12-18 2004-12-16 Psod-expressionseinheiten

Country Status (15)

Country Link
US (3) US20080274516A1 (enExample)
EP (2) EP1697526B1 (enExample)
JP (2) JP2007514426A (enExample)
KR (1) KR20070004580A (enExample)
CN (2) CN101230351B (enExample)
AR (1) AR047152A1 (enExample)
AT (1) ATE486131T1 (enExample)
BR (1) BRPI0417728A (enExample)
CA (1) CA2549171A1 (enExample)
DE (2) DE10359660A1 (enExample)
IN (2) IN2006CH02599A (enExample)
RU (1) RU2006125502A (enExample)
TW (1) TW200602489A (enExample)
WO (1) WO2005059144A1 (enExample)
ZA (1) ZA200605857B (enExample)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006069711A1 (de) * 2004-12-22 2006-07-06 Basf Aktiengesellschaft Mehrfachpromotoren und deren verwendung zur genexpression
WO2007060233A1 (de) * 2005-11-28 2007-05-31 Basf Se Fermentative herstellung organischer verbindungen
EP1881076A1 (en) * 2006-07-17 2008-01-23 Evonik Degussa GmbH Method for producing L-amino acids
EP1942198A3 (de) * 2004-07-20 2008-10-01 Basf Se Pef-ts expressionseinheiten bei corynebacterium glutamicum
US7785779B2 (en) 2003-12-18 2010-08-31 Paik Kwang Industrial Co., Ltd. P EF-TU expression units
WO2011073278A1 (en) 2009-12-17 2011-06-23 Basf Se Processes and recombinant microorganisms for the production of cadaverine
EP2386650A1 (en) * 2006-04-07 2011-11-16 Evonik Degussa GmbH Method for producing L-amino acids using the gap promoter
WO2012114256A1 (en) 2011-02-22 2012-08-30 Basf Se Processes and recombinant microorganisms for the production of cadaverine
WO2013000827A1 (de) 2011-06-28 2013-01-03 Evonik Degussa Gmbh Varianten des promotors des für die glyzerinaldehyd-3-phosphat-dehydrogenase kodierenden gap-gens
EP2787082A4 (en) * 2011-12-01 2015-07-08 Cj Cheiljedang Corp MICRO-ORGANISMS FOR THE SIMULTANEOUS PREPARATION OF L-AMINO ACID AND RIBOFLAVIN AND METHOD FOR THE PREPARATION OF L-AMINO ACID AND RIBOFLAVIN THEREWITH
EP0811682B2 (en) 1996-06-05 2017-04-19 Ajinomoto Co., Inc. Method of producing L-lysine
EP3415623A1 (en) 2017-06-14 2018-12-19 Evonik Degussa GmbH Method for production of fine chemicals using a corynebacterium secreting modified alpha-1,6-glucosidases
US10301588B2 (en) 2014-12-10 2019-05-28 Basf Se Method of removing DNA from biotechnological products

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8647642B2 (en) 2008-09-18 2014-02-11 Aviex Technologies, Llc Live bacterial vaccines resistant to carbon dioxide (CO2), acidic PH and/or osmolarity for viral infection prophylaxis or treatment
DE102009030342A1 (de) 2009-06-25 2010-12-30 Evonik Degussa Gmbh Verfahren zur fermentativen Herstellung von organisch chemischen Verbindungen
DE102010003419B4 (de) 2010-03-30 2019-09-12 Evonik Degussa Gmbh Verfahren zur fermentativen Herstellung von L-Ornithin
US9968030B2 (en) 2010-06-22 2018-05-15 Cnh Industrial Canada, Ltd. Down pressure adjustment device and method for use with a disc opener assembly of an agricultural implement
DE102011006716A1 (de) 2011-04-04 2012-10-04 Evonik Degussa Gmbh Mikroorganismus und Verfahren zur fermentativen Herstellung einer organisch-chemischen Verbindung
EP2762571A1 (de) 2013-01-30 2014-08-06 Evonik Industries AG Mikroorganismus und Verfahren zur fermentativen Herstellung von Aminosäuren
WO2016068656A2 (ko) * 2014-10-30 2016-05-06 주식회사 삼양사 사이코스 에퍼머화 효소의 발현 시스템 및 이를 이용한 사이코스의 생산
US10676723B2 (en) 2015-05-11 2020-06-09 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
CN109536465B (zh) * 2017-09-21 2020-11-13 中国医学科学院医药生物技术研究所 筛选抗结核药物的组合物、筛选模型和筛选方法
CN109182235B (zh) * 2018-08-29 2021-03-30 江南大学 一种n端序列元件在调控枯草芽孢杆菌表达蛋白中的应用
CN111549027A (zh) * 2020-04-28 2020-08-18 天津大学 一种谷氨酸棒杆菌高强度启动子Psod-sx及应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001000804A2 (en) * 1999-06-25 2001-01-04 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding stress, resistance and tolerance proteins
EP1108790A2 (en) * 1999-12-16 2001-06-20 Kyowa Hakko Kogyo Co., Ltd. Novel polynucleotides

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6696561B1 (en) * 1909-07-09 2004-02-24 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding proteins involved in membrane synthesis and membrane transport
JPS5835197A (ja) * 1981-08-26 1983-03-01 Kyowa Hakko Kogyo Co Ltd プラスミドpcg2
US4601893A (en) 1984-02-08 1986-07-22 Pfizer Inc. Laminate device for controlled and prolonged release of substances to an ambient environment and method of use
GB2165546B (en) 1984-08-21 1989-05-17 Asahi Chemical Ind A plasmid containing a gene for tetracycline resistance and dna fragments derived therefrom
DE4027453A1 (de) 1990-08-30 1992-03-05 Degussa Neue plasmide aus corynebacterium glutamicum und davon abgeleitete plasmidvektoren
EP0693558B1 (en) 1994-07-19 2002-12-04 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Trehalose and its production and use
DE4440118C1 (de) * 1994-11-11 1995-11-09 Forschungszentrum Juelich Gmbh Die Genexpression in coryneformen Bakterien regulierende DNA
JPH10229891A (ja) 1997-02-20 1998-09-02 Mitsubishi Rayon Co Ltd マロン酸誘導体の製造法
US7270984B1 (en) * 1999-06-25 2007-09-18 Basf Aktiengesellschaft Polynucleotides encoding a 6-phosphogluconolactonase polypeptide from corynebacterium glutamicum
KR20070087090A (ko) * 1999-06-25 2007-08-27 바스프 악티엔게젤샤프트 탄소 대사 및 에너지 생산과 관련된 단백질을 코딩하는코리네박테리움 글루타미쿰 유전자
US6822084B1 (en) * 1999-06-25 2004-11-23 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding stress, resistance and tolerance proteins
CN1451047A (zh) * 1999-06-25 2003-10-22 Basf公司 编码胁迫、抗性和耐受性蛋白的谷氨酸棒杆菌基因
DE10046870A1 (de) 2000-09-20 2002-03-28 Basf Ag Verfahren zur Veränderung des Genoms von Corynebakterien
WO2002040679A2 (en) 2000-11-15 2002-05-23 Archer-Daniels-Midland Company Corynebacterium glutamicum promoters
EP1375664B1 (en) * 2001-03-30 2009-11-04 Ajinomoto Co., Inc. Method for the secretion and production of protein

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001000804A2 (en) * 1999-06-25 2001-01-04 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding stress, resistance and tolerance proteins
EP1108790A2 (en) * 1999-12-16 2001-06-20 Kyowa Hakko Kogyo Co., Ltd. Novel polynucleotides

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"Methods in Plant Molecular Biology and Biotechnology", 1993, CRC PRESS
DATABASE EMBL [online] 2 August 2001 (2001-08-02), "Corynebacterium glutamicum gene for superoxide dismutase, complete cds.", XP002320459, retrieved from EBI accession no. EM_PRO:AB055218 Database accession no. AB055218 *
DATABASE EMBL [online] 7 February 2001 (2001-02-07), "Corynebacterium melassecola peptide methionine sulfoxide reductase A (msrA) and manganese superoxide dismutase (sodA) genes, complete cds.", XP002320456, retrieved from EBI accession no. EM_PRO:AF236111 Database accession no. AF236111 *
DATABASE Geneseq [online] 26 September 2001 (2001-09-26), "C glutamicum coding sequence fragment SEQ ID NO: 7069.", XP002320458, retrieved from EBI accession no. GSN:AAH68534 Database accession no. AAH68534 *
DATABASE Geneseq [online] 30 April 2001 (2001-04-30), "C. glutamicum SRT protein nucleotide sequence SEQ ID NO:15.", XP002320457, retrieved from EBI accession no. GSN:AAF70991 Database accession no. AAF70991 *
HASSETT DANIEL J ET AL: "Cloning and characterization of the Pseudomonas aeruginosa sodA and sodB genes encoding manganese- and iron-cofactored superoxide dismutase: Demonstration of increased manganese superoxide dismutase activity in alginate-producing bacteria", JOURNAL OF BACTERIOLOGY, vol. 175, no. 23, 1993, pages 7658 - 7665, XP002320455, ISSN: 0021-9193 *
HIGGINS DG; SHARP PM.: "Fast and sensitive multiple sequence alignments on a microcomputer", COMPUT APPL. BIOSCI., vol. 5, no. 2, April 1989 (1989-04-01), pages 151 - 1
J. SAMBROOK; E.F. FRITSCH; T. MANIATIS: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS, COLD SPRING HARBOR
MERKAMM MURIEL ET AL: "Cloning of the sodA gene from Corynebacterium melassecola and role of superoxide dismutase in cellular viability", JOURNAL OF BACTERIOLOGY, vol. 183, no. 4, February 2001 (2001-02-01), pages 1284 - 1295, XP002320454, ISSN: 0021-9193 *
P.B. KAUFMANN ET AL.: "Handbook of Molcular and Cellular Methods in Biology and Medicine", 1995, CRC PRESS
P.F. SMITH-KEARY: "Molecular Genetics of Escherichia coli", 1989, THE GUILFORD PRESS
PATEK M ET AL: "PROMOTERS FROM CORYNEBACTERIUM GLUTAMICUM: CLONING, MOLECULAR ANALYSIS AND SEARCH FOR A CONSENSUS MOTIF", MICROBIOLOGY, SOCIETY FOR GENERAL MICROBIOLOGY, READING, GB, vol. 142, no. 5, 1996, pages 1297 - 1309, XP008006983, ISSN: 1350-0872 *
REINSCHEID DIETER J ET AL: "Cloning, sequence analysis, expression and inactivation of the Corynebacterium glutamicum pta-ack operon encoding phosphotransacetylase and acetate kinase", MICROBIOLOGY, SOCIETY FOR GENERAL MICROBIOLOGY, READING, GB, vol. 145, no. 2, February 1999 (1999-02-01), pages 503 - 513, XP002211213, ISSN: 1350-0872 *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0811682B2 (en) 1996-06-05 2017-04-19 Ajinomoto Co., Inc. Method of producing L-lysine
US8044191B2 (en) 2003-12-18 2011-10-25 Basf Se P EF-TU expression units
US7785779B2 (en) 2003-12-18 2010-08-31 Paik Kwang Industrial Co., Ltd. P EF-TU expression units
EP1942198A3 (de) * 2004-07-20 2008-10-01 Basf Se Pef-ts expressionseinheiten bei corynebacterium glutamicum
US8735159B2 (en) 2004-07-20 2014-05-27 Basf Se PEF-TS expression units
WO2006069711A1 (de) * 2004-12-22 2006-07-06 Basf Aktiengesellschaft Mehrfachpromotoren und deren verwendung zur genexpression
EP1908841A1 (de) * 2004-12-22 2008-04-09 Basf Se Mehrfachpromotoren und deren Verwendung zur Genexpression
US7968699B2 (en) 2004-12-22 2011-06-28 Basf Aktiengesellschaft Multiple promoters and the use thereof for gene expression
US8741599B2 (en) 2005-11-28 2014-06-03 Basf Se Fermentative production of organic compounds
WO2007060233A1 (de) * 2005-11-28 2007-05-31 Basf Se Fermentative herstellung organischer verbindungen
EP2386650A1 (en) * 2006-04-07 2011-11-16 Evonik Degussa GmbH Method for producing L-amino acids using the gap promoter
EP1881076A1 (en) * 2006-07-17 2008-01-23 Evonik Degussa GmbH Method for producing L-amino acids
DE112010004851T5 (de) 2009-12-17 2012-09-20 Basf Se Verfahren und rekombinante Mikroorganismen für die Herstellung von Cadaverin
WO2011073278A1 (en) 2009-12-17 2011-06-23 Basf Se Processes and recombinant microorganisms for the production of cadaverine
WO2012114256A1 (en) 2011-02-22 2012-08-30 Basf Se Processes and recombinant microorganisms for the production of cadaverine
WO2013000827A1 (de) 2011-06-28 2013-01-03 Evonik Degussa Gmbh Varianten des promotors des für die glyzerinaldehyd-3-phosphat-dehydrogenase kodierenden gap-gens
DE102011118019A1 (de) 2011-06-28 2013-01-03 Evonik Degussa Gmbh Varianten des Promotors des für die Glyzerinaldehyd-3-phosphat-Dehydrogenase kodierenden gap-Gens
EP2787082A4 (en) * 2011-12-01 2015-07-08 Cj Cheiljedang Corp MICRO-ORGANISMS FOR THE SIMULTANEOUS PREPARATION OF L-AMINO ACID AND RIBOFLAVIN AND METHOD FOR THE PREPARATION OF L-AMINO ACID AND RIBOFLAVIN THEREWITH
US10590446B2 (en) 2011-12-01 2020-03-17 Cj Cheiljedang Corporation Microorganism for simultaneously producing L-amino acid and riboflavin, and method for producing L-amino acid and riboflavin using same
US10301588B2 (en) 2014-12-10 2019-05-28 Basf Se Method of removing DNA from biotechnological products
EP3415623A1 (en) 2017-06-14 2018-12-19 Evonik Degussa GmbH Method for production of fine chemicals using a corynebacterium secreting modified alpha-1,6-glucosidases
EP3415622A1 (en) 2017-06-14 2018-12-19 Evonik Degussa GmbH Method for production of fine chemicals using a corynebacterium secreting modified alpha-1,6-glucosidases

Also Published As

Publication number Publication date
CN101230351B (zh) 2013-02-20
BRPI0417728A (pt) 2007-04-03
US8071365B2 (en) 2011-12-06
DE502004011835D1 (de) 2010-12-09
IN2008CH00416A (enExample) 2008-09-19
JP4800341B2 (ja) 2011-10-26
IN2006CH02599A (enExample) 2007-06-08
ZA200605857B (en) 2008-01-08
TW200602489A (en) 2006-01-16
AR047152A1 (es) 2006-01-11
US20080274516A1 (en) 2008-11-06
EP1697526B1 (de) 2010-10-27
CA2549171A1 (en) 2005-06-30
CN101230351A (zh) 2008-07-30
JP2007514426A (ja) 2007-06-07
JP2008212154A (ja) 2008-09-18
ATE486131T1 (de) 2010-11-15
DE10359660A1 (de) 2005-07-28
US20090004705A1 (en) 2009-01-01
KR20070004580A (ko) 2007-01-09
EP1697526A1 (de) 2006-09-06
US20100062535A1 (en) 2010-03-11
CN1894411A (zh) 2007-01-10
EP1918378A1 (de) 2008-05-07
RU2006125502A (ru) 2008-01-27

Similar Documents

Publication Publication Date Title
EP1908842B1 (de) PEF-TU Expressionseinheiten
EP1697526B1 (de) Psod-expressionseinheiten
EP1908841B1 (de) Mehrfachpromotoren und deren Verwendung zur Genexpression
EP1942198B1 (de) Pef-ts expressionseinheiten bei corynebacterium glutamicum
JP4808742B2 (ja) Pgro発現ユニット
DE102004035070A1 (de) P-180-Expressionseinheiten
DE102004035069A1 (de) P19-Expressionseinheiten
DE102004035076A1 (de) P2-10-Expressionseinheiten
DE102004035074A1 (de) P1-34-Expressionseinheiten
DE102004035067A1 (de) P1-35-Expressionseinheiten

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480037881.9

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2004803950

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2549171

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 10583191

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2006544337

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Ref document number: DE

WWE Wipo information: entry into national phase

Ref document number: 2006/05857

Country of ref document: ZA

Ref document number: 2599/CHENP/2006

Country of ref document: IN

Ref document number: 200605857

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 1020067014366

Country of ref document: KR

Ref document number: 2006125502

Country of ref document: RU

WWP Wipo information: published in national office

Ref document number: 2004803950

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020067014366

Country of ref document: KR

ENP Entry into the national phase

Ref document number: PI0417728

Country of ref document: BR