WO2005052151A1 - Improved protein expression systems - Google Patents

Improved protein expression systems Download PDF

Info

Publication number
WO2005052151A1
WO2005052151A1 PCT/US2004/038884 US2004038884W WO2005052151A1 WO 2005052151 A1 WO2005052151 A1 WO 2005052151A1 US 2004038884 W US2004038884 W US 2004038884W WO 2005052151 A1 WO2005052151 A1 WO 2005052151A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
gene
seq
nucleic acid
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/038884
Other languages
English (en)
French (fr)
Inventor
Jane C. Schneider
Lawrence C. Chew
Anne Kathryn Badgley
Thomas Martin Ramseier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dow Global Technologies LLC
Original Assignee
Dow Global Technologies LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dow Global Technologies LLC filed Critical Dow Global Technologies LLC
Priority to EP04811581A priority Critical patent/EP1692282B1/en
Priority to CN2004800407027A priority patent/CN1906294B/zh
Priority to KR1020067009838A priority patent/KR101237651B1/ko
Priority to AU2004293810A priority patent/AU2004293810B2/en
Priority to MXPA06005634A priority patent/MXPA06005634A/es
Priority to BRPI0416744-9A priority patent/BRPI0416744A/pt
Priority to JP2006541422A priority patent/JP5087741B2/ja
Priority to CA2545610A priority patent/CA2545610C/en
Publication of WO2005052151A1 publication Critical patent/WO2005052151A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0012Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0026Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5)
    • C12N9/0028Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5) with NAD or NADP as acceptor (1.5.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/78Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Pseudomonas
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/05Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in nitriles (3.5.5)
    • C12Y305/05001Nitrilase (3.5.5.1)

Definitions

  • the present invention provides an improved expression system for the production of recombinant polypeptides utilizing auxotrophic selectable markers.
  • the present invention provides improved recombinant protein production in host cells through the improved regulation of expression.
  • Selection markers are a gene whose product is required for survival during the fermentation process. Host cells lacking the selection marker, such as revertants, are unable to survive.
  • the use of selection markers during the fermentation process is intended to ensure that only bacteria containing the expression vector survive, eliminating competition between the revertants and transformants and reducing the efficiency of fermentation.
  • the most commonly used selection markers are antibiotic resistance genes.
  • Host cells are grown in a medium supplemented with an antibiotic capable of being degraded by the selected antibiotic resistance gene product. Cells that do not contain the expression vector with the antibiotic resistance gene are killed by the antibiotic.
  • Typical antibiotic resistance genes include tetracycline, neomycin, kanamycin, and ampicillin.
  • the presence of antibiotic resistance genes in a bacterial host cell presents environmental, regulatory, and commercial problems.
  • antibiotic resistance gene-containing products and products produced by the use of antibiotic resistance gene
  • auxotrophic selection markers have been utilized as an alternative to antibiotic selection in some systems.
  • auxotrophic markers have been widely utilized in yeast, due largely to the inefficiency of antibiotic resistance selection markers in these host cells. See, for example, JT Prorik, (2002) "Auxotrophic yeast strains in fundamental and applied research," App. & Envirn. Micro. 68(5): 2095-2100; Boeke et al., (1984) "A positive selection for mutants lacking orotodine-5 '-phosphate decarboxylase activity in yeast; 5- fluoro-orotic acid resistance," Mol. Gen. Genet.
  • yeast expression systems due not provide the potential speed and efficiency for producing target proteins that bacterial systems do. Auxotrophic marker selection in bacteria has also previously been described.
  • cross feeding refers to the ability of a first cell, auxotrophic for a particular metabolite, to survive in the absence of the metabolite by obtaining its supply of that metabolite from its environment, and typically, from the medium for which the cell is auxotrophic by utilizing excreted intermediates of the metabolite, the metabolite itself, or a prototrophic enabling molecule produced by a second cell, prototrophic for the metabolite absent from the medium.
  • GR Barker et al. Biochem. J. 157(l):221-27 (1976) (cross feeding of thymine in E. coli): TJ Kerr & GJ Tritz, J. Bact.
  • an object of the present invention to provide an improved expression system for the production of target proteins, wherein the production is efficient, regulatable, and performed in a medium that minimizes of regulatory and environmental concerns. It is another object of the present invention to provide organisms for use as host cells in an improved expression system for the production of target proteins. It is still another object of the present invention to provide processes for the improved production of target proteins. It is yet another object of the present invention to provide novel constructs and nucleic acids for use in an improved expression system for the production of target proteins.
  • bacterial protein production can be improved by selecting as a host cell a Pseudomonad organism that is capable of non-antibiotic resistant, auxotrophic selection, and/or contains a chromosomal insert of a laclgene or derivative.
  • Pseudomonad organism Pseudomonas fluorescens is particularly well suited for this purpose.
  • Pseudomonas fluorescens does not exhibit adverse cross feeding inhibition under auxotrophic selection during the high-cell density fermentation of recombinant polypeptides.
  • auxotrophic Pseudomonas fluorescens as host cells in the efficient production of high levels of recombinant polypeptides, overcoming the drawbacks inherent with the use of antibiotic resistance selection markers and the problems of auxotrophic cross feeding present in other bacterial expression systems.
  • This lad insertion is as effective in repressing Plac-Ptac family promoter-controlled transgenes as a multi-copy plasmid encoding a Lad repressor protein in Pseudomonas fluorescens, thereby eliminating the need to maintain a separate plasmid encoding a Lad repressor protein in the cell and reducing potential production inefficiencies caused by such maintenance.
  • Pseudomonad organisms are provided for use as host cells in the improved production of proteins.
  • the Pseudomonad organisms have been genetically modified to induce an auxotrophy.
  • the Pseudomonad organism is Pseudomonas fluorescens.
  • the auxotrophy is a result of genetic modifications to at least one nitrogenous base compound biosynthesis gene, or at least one amino acid biosynthesis gene.
  • the genetic modification is to a gene encoding an enzyme active in the uracil biosynthetic pathway, the thymidine biosynthetic pathway, or the proline biosynthetic pathway.
  • the genetic modification is to the pyrF gene encoding orotidine-5 '-phosphate decarboxylase, the thy A gene encoding thymidylate synthase, or the proC gene encoding ⁇ '-pyrroline-S-carboxylate reductase.
  • the present invention provides Pseudomonad organisms that have been genetically modified to provide at least one copy of a Lacl-encoding gene inserted into the genome, other than as part of the whole or truncated Vlac-lacI-lacZYA operon.
  • the Pseudomonad host cell is Pseudomonas fluorescens.
  • the Pseudomonad contains a native E. coli lad gene encoding the Lad repressor protein.
  • the Pseudomonad cell contains the lacfi gene.
  • the Pseudomonad cell contains the lacfi 1 gene.
  • a Pseudomonad organism comprising a nucleic acid construct containing a nucleic acid comprising at least one lacO sequence involved in the repression of transgene expression.
  • the Pseudomonad host cell is Pseudomonas fluorescens.
  • the nucleic acid construct comprises more than one lacO sequence.
  • the nucleic acid construct comprises at least one, and preferably more than one, lacOid sequence.
  • the nucleic acid construct comprises a lacO sequence, or derivative thereof, located 3' of a Plac family promoter, and a lacO sequence, or derivative thereof, located 5' of a Plac family promoter.
  • the lacO derivative is a lacOid sequence.
  • the present invention provides Pseudomonad organisms that have been genetically modified to induce an auxotrophy and further modified to contain a chromosomal insertion of a native E.coli lad gene, lacfi gene, or lacfi 1 gene other than as part of a whole or truncated V ⁇ &c-lacI-lacZYA operon.
  • the Pseudomonad organism is further modified to contain a nucleic acid construct comprising at least one lacO sequence involved in the repression of transgene expression.
  • the Pseudomonad organism is a Pseudomonas fluorescens.
  • nucleic acid sequences are provided for use in the improved production of proteins.
  • nucleic acid sequences encoding prototrophy-restoring enzymes for use in an auxotrophic Pseudomonad host cells are provided.
  • nucleic acid sequences encoding nitrogenous base compound biosynthesis enzymes purified from the organism Pseudomonas fluorescens are provided.
  • nucleic acid sequences encoding the pyrF gene in Pseudomonas fluorescens is provided (SEQ. ID No.s 1 and 3).
  • nucleic acid sequence encoding the thyA gene in Pseudomonas fluorescens is provided (SEQ. ID. No. 4).
  • nucleic acid sequences encoding an amino acid biosynthetic compound purified from the organism Pseudomonas fluorescens are provided.
  • a nucleic acid sequence encoding the proC gene in Pseudomonas fluorescens is provided (SEQ. ID No.s 6 and 8).
  • the present invention produces novel amino acid sequences which are the products of the novel nucleic acid expression.
  • nucleic acid constructs are provided for use in the improved production of peptides.
  • a nucleic acid construct for use in transforming a Pseudomonad host cell comprising a) a nucleic acid sequence encoding a recombinant polypeptide, and b) a nucleic acid sequence encoding a prototrophy-enabling enzyme is provided.
  • the nucleic acid construct further comprises c) a Plac-Ptac family promoter.
  • nucleic acid construct further comprises d) at least one lacO sequence, or derivative, 3' of a lac or tac family promoter.
  • the nucleic acid construct further comprises e) at least one lacO sequence, or derivative, 5' of a lac or tac family promoter.
  • the derivative lacO sequence can be a lacOid sequence.
  • the Pseudomonad organism is Pseudomonas fluorescens.
  • nucleic acid constructs for use as expression vectors in Pseudomonad organisms comprising a) a nucleic acid sequence encoding a recombinant polypeptide, b) a Plac-Ptac family promoter, c) at least one lacO sequence, or derivative, 3' of a lac or tac family promoter, d) at least one lacO sequence, or derivative, 5' of a lac or tac family promoter.
  • the derivative lacO sequence can be a lacOid sequence.
  • the nucleic acid construct further comprises e) a prototrophy-enabling selection marker for use in an auxotrophic Pseudomonad cell.
  • the Pseudomonad organism is Pseudomonas fluorescens.
  • modified cells are provided for use in the improved production of proteins.
  • an auxotrophic Pseudomonad cell is provided that has a nucleic acid construct comprising i) a recombinant polypeptide, and ii) a prototrophy-enabling nucleic acid.
  • the nucleic acid construct further comprises iii) a Plac- Ptac family promoter.
  • the nucleic acid construct further comprises iv) more than one lacO sequence.
  • the Pseudomonad is an auxotrophic Pseudomonas fluorescens cell.
  • the invention further comprises auxotrophic Pseudomonad organisms, including Pseudomonas fluorescens, that have been further genetically modified to contain a chromosomal insertion of a native E.coli lad gene, lacfi gene, or lacfi 1 gene other than as part of a whole or truncated Plac-/ ⁇ c/- lacZYA operon.
  • a Pseudomonad cell comprises a lad transgene, or derivative thereof, other than as part of a whole or truncated Plac-/ c/-/ ⁇ cZL4 operon, inserted into the chromosome, and b) a nucleic acid construct comprising i) a recombinant polypeptide, and ii) a Plac-Ptac family promoter.
  • the nucleic acid construct further comprises iii) at least one lacO sequence, and preferably, more than one lacO sequence.
  • the lacO sequence is a lacOid sequence.
  • the Pseudomonad has been further modified to induce auxotrophy.
  • the Pseudomonad cell is a Pseudomonas fluorescens.
  • processes of expressing recombinant polypeptides for use in improved protein production are provided.
  • the process provides expression of a nucleic acid construct comprising nucleic acids encoding a) a recombinant polypeptide, and b) a prototrophy- restoring enzyme in a Pseudomonad that is auxotrophic for at least one metabolite.
  • the Pseudomonad is auxotrophic for more than one metabolite.
  • the Pseudomonad is a Pseudomonas fluorescens cell.
  • a recombinant polypeptide is expressed in a Pseudomonad that is auxotrophic for a metabolite, or combination of metabolites, selected from the group consisting of a nitrogenous base compound and an amino acid.
  • recombinant polypeptides are expressed in a Pseudomonad that is auxotrophic for a metabolite selected from the group consisting of uracil, proline, and thymidine.
  • the auxotrophy can be generated by the knock-out of the host pyrF, proC, or thyA gene, respectively.
  • recombinant polypeptides are expressed in an auxotrophic Pseudomonad cell that has been genetically modified through the insertion of a native E.coli lad gene, lacfi gene, or lacfi 1 gene, other than as part of the PlacI-t ⁇ cZ- lacZYA operon, into the host cell's chromosome.
  • the vector containing the recombinant polypeptide expressed in the auxotroph comprises at least one lacOid operator sequences.
  • the vector containing the recombinant polypeptide expressed in the auxotrophic host cell comprises at least two lac operator sequences, or derivatives thereof.
  • the recombinant polypeptide is driven by a Plac family promoter.
  • the process involves the use of Pseudomonad host cells that have been genetically modified to provide at least one copy of a Lad encoding gene inserted into the Pseudomonad host cell's genome, wherein the la encoding gene is other than as part of the Vlac ⁇ -lacI-lacZYA operon.
  • the gene encoding the Lac repressor protein is identical to that of native E. coli lad gene.
  • the gene encoding the Lac repressor protein is the lacfi gene. In still another embodiment, the gene encoding the Lac repressor protein is the lacfi 1 gene.
  • the Pseudomonad host cell is Pseudomonas fluorescens. In another embodiment, the Pseudomonad is further genetically modified to produce an auxotrophic cell. In another embodiment, the process produces recombinant polypeptide levels of at least about 3 g/L, 4 g/L, 5 g/L 6 g/L, 7 g/L, 8 g/L, 9 g/L or at least about 10 g/L. In another embodiment, the recombinant polypeptide is expressed in levels of between 3 g/L and 100 g/L.
  • FIGURES Figure 1 represents a comparison of the performance of P. fluorescens dual-plasmid expression systems using a pyrF marker ( ⁇ and D ) against the performance of P. fluorescens dual-plasmid expression systems using only antibiotic resistance markers ( ⁇ ). All data shown are averages of 9-multiple, representative 20-L fermentations, with IPTG being added to induce target enzyme expression during mid-exponential phase.
  • the upper set of three curves presents relative cell density data, which is read with reference to the left vertical axis.
  • the lower set of three curves presents relative enzyme activity data for the target enzyme produced in the corresponding fermentations, and is read with reference to the right vertical axis.
  • ⁇ - P presents relative cell density data, which is read with reference to the left vertical axis.
  • the lower set of three curves presents relative enzyme activity data for the target enzyme produced in the corresponding fermentations, and is read with reference to the right vertical axis.
  • Figure 2 represents a map of the plasmid pDOW 1249-2.
  • Figure 3 represents a map of the plasmid pDO W 1269-2.
  • Figure 4 represents a schematic of lac operator constructs.
  • LacZ represents the positions of the native E.coli lacO sequences
  • tac DC239, DC240 represents the position of the native E.coli lac operator on a construct comprising a tac promoter and a nitrilase encoding nucleic acid.
  • Opt lacO DC281 represents the position of the lacOid operator sequence on a construct comprising a tac promoter and a nitrilase encoding nucleic acid.
  • Dual lacO DC262 represents the position of a lacOid operator sequence 5', and wild type lac operator sequence 3' of a tac promoter on a construct further comprising a nitrilase encoding nucleic acid.
  • Figure 5 represents a Western Blot analysis (UnBlot) of Lad protein accumulation in the lad integrant strains grown in a shake flask gene expression medium. Broth samples were normalized to OD ⁇ oo, combined with LDS NuPAGE sample buffer (Invitrogen), 50mM DTT and heated at 95°C for 40 min, then centrifuged briefly. Aliquots of 20 uL were loaded on a 10%, 1 mm NuPAGE Bis-Tris gel run in MOPS with antioxidant in the inner chamber. Detection of the La protein was accomplished with an in-gel hybridization method ("UnBlot", Pierce), using a polyclonal rabbit antibody to Lad (Stratagene cat. no.
  • the Pseudomonad organisms have been genetically modified to induce an auxotrophy.
  • the Pseudomonad organism is Pseudomonas fluorescens.
  • the auxotrophy is a result of genetic modifications to at least one nitrogenous base compound biosynthesis gene, or at least one amino acid biosynthesis gene.
  • the genetic modification is to a gene encoding an enzyme active in the uracil biosynthetic pathway, the thymidine biosynthetic pathway, or the proline biosynthetic pathway.
  • the genetic modification is to the pyrF gene encoding orotidine-5 '-phosphate decarboxylase, the thyA gene encoding thymidilate synthase, or the proC gene encoding ⁇ '-pyrroline-S-cafboxylate reductase.
  • the present invention provides Pseudomonad organisms that have been genetically modified to provide at least one copy of a Lad-encoding gene inserted into the genome, other than as part of the PlacI-/ c/-/ ⁇ cZK4 operon.
  • the Pseudomonad host cell is Pseudomonas fluorescens.
  • the Pseudomonad contains a native E. coli lad gene encoding the Lad repressor protein.
  • the Pseudomonad cell contains the lacfi gene.
  • the Pseudomonad cell contains the lacfi gene.
  • a Pseudomonad organism comprising a nucleic acid construct containing a nucleic acid comprising at least one lacO sequence involved in the repression of transgene expression.
  • the Pseudomonad host cell is Pseudomonad fluorescens.
  • the nucleic acid construct comprises more than one lacO sequence.
  • the nucleic acid construct comprises at least one, and preferably more than one, lacOid sequence.
  • the nucleic acid construct comprises a lacO sequence, or derivative thereof, located 3' of a Plac family promoter, and a lacO sequence, or derivative thereof, located 5' of a Plac family promoter.
  • the lacO derivative is a lacOid sequence.
  • the present invention provides Pseudomonad organisms that have been genetically modified to induce an auxotrophy and further modified to contain a chromosomal insertion of a native E.coli la gene, la Q gene, or lacIQl gene other than as part of a whole or truncated Plac-/ ⁇ c/-/ ⁇ cZK4 operon.
  • the Pseudomonad organism is further modified to contain a nucleic acid construct comprising at least one lacO sequence involved in the repression of transgene expression.
  • the Pseudomonad organism is a Pseudomonas fluorescens.
  • the host cell provided by the present invention for use in an expression system producing recombinant polypeptides can be selected from the "Pseudomonads and closely related bacteria" or from a Subgroup thereof, as defined below.
  • the host cell is selected from the genus Pseudomonas.
  • the particular species of Pseudomonas is P. fluorescens.
  • the host cell is Pseudomonas fluorescens biotype A or biovar I.
  • isolated refers to nucleic acid, protein, or peptide that is substantially or essentially free from other material components, for example, which can be cellular components.
  • fragment means a portion or partial sequence of a nucleotide, protein, or peptide sequence.
  • percent total cell protein means the amount of protein or peptide in the host cell as a percentage of aggregate cellular protein.
  • operably attached refers to any configuration in which the transcriptional and any translational regulatory elements are covalently attached to the encoding sequence in such disposition(s), relative to the coding sequence, that in and by action of the host cell, the regulatory elements can direct the expression of the coding sequence
  • auxotrophic refers to a cell which has been modified to eliminate or reduce its ability to produce a specific substance required for growth and metabolism.
  • percent total cell protein means a measure of the fraction of total cell protein that represents the relative amount of a given protein expressed by the cell.
  • prototrophy refers to a cell that is capable of producing a specific substance required for growth and metabolism.
  • homologous or means either i) a protein or peptide that has an amino acid sequence that is substantially similar (i.e., at least 70, 75, 80, 85, 90, 95, or 98%) to the sequence of a given original protein or peptide and that retains a desired function of the original protein or peptide or ii) a nucleic acid that has a sequence that is substantially similar (i.e., at least 70, 75, 80, 5, 90, 95, or 98%) to the sequence of a given nucleic acid and that retains a desired function of the original nucleic acid sequence.
  • any disclosed protein, peptide or nucleic acid can be substituted with a homologous or substantially homologous protein, peptide or nucleic acid that retains a desired function.
  • any nucleic acid when any nucleic acid is disclosed, it should be assumed that the invention also includes all nucleic acids that hybridize to the disclosed nucleic acid.
  • the non-identical amino acid sequence of the homologous polypeptide can be amino acids that are members of any one of the 15 conservative or semi-conservative groups shown in Table 1.
  • the present invention provides the use of Pseudomonads and related bacteria as host cells in the improved production of proteins.
  • auxotrophic selection markers for the maintenance of protein expressing plasmids without the drawbacks typically associated with other systems, such as plasmid instability and cross-feeding.
  • auxotrophic markers in other host cell systems, are not always sufficient to maintain plasmids in every cell, especially during fermentations where loss of the plasmid may give plasmid-less cells a selective advantage, resulting in the accumulation of a large fraction of nonproductive cells, reducing product formation.
  • Such revertant strains are especially troublesome if they have the ability to cross-feed the auxotrophic metabolite from prototrophic enabled bacteria.
  • trp operon on a plasmid in an E. coli tryptophan auxotroph was not sufficient to prevent a large proportion of plasmid-less cells from accumulating, until combined with the valS gene (encoding valyl t-RNA synthetase) in a v ⁇ /S ts host ( Skogman, S. G.; Nilsson, J., Temperature-dependent retention of a tryptophan- operon-bearing plasmid in Escherichia coli.
  • the cells containing the trp operon on a plasmid secreted enough tryptophan or related molecules to allow growth of plasmid-less cells.
  • the LEU2 gene on a xylitol-reductase production plasmid in leu2 mutant yeast resulted in plasmid loss; up to 80% of a fed-batch culture was made up of cells without a production plasmid, because leucine was secreted by plasmid-containing cells into the broth (Mschreib, N.
  • auxotrophic Pseudomonas fluorescens is a particularly suitable organism for use as a host cell because of the observed inability of a auxotrophic cell to out compete a auxotrophic cell containing a prototrophic-enabling plasmid on a supplemented medium that contains the auxotrophic metabolite, indicating an innate difficulty of an Pf auxotroph to import the required metabolite. Because of this, Pf auxotrophic cells that lose the selection marker plasmid do not gain a selective advantage over Pf auxotrophic cells containing the selection marker, even in the presence of a supplemental metabolite, greatly reducing any potential effects of cross-feeding. Because of the reduced effects of cross-feeding, production yields of the recombinant polypeptide in a fermentation run are not reduced due to the presence of non-recombinant polypeptide producing cells.
  • LacIInsert It has been discovered that Pseudomonads are able to use a single-copy lad transgene, other than as part of a whole or truncated V ⁇ &c-lacI-lacZYA operon, chromosomal insert to effectively repress protein expression until induction. Transcription initiation from regulated promoters by RNA polymerase is activated or deactivated by the binding or releasing of a regulatory protein.
  • regulated promoters include those that participate in negative control (i.e. repressible promoters), wherein the gene encoding the target polypeptide of interest is expressed only when the promoter is free of the regulator protein (i.e.
  • repressor protein
  • those that participate in positive control wherein the gene is expressed only when the promoter is bound by the regulator protein (i.e. an "activator” protein).
  • regulator protein i.e. an "activator” protein.
  • One of the most common classes of repressible promoters used in bacterial expression systems is the family of Plac-based promoters.
  • the family of Plac-based promoters originates with the native E. coli lactose operon, referred to as the "lac” operon, also symbolized as "lacZYA,” the expression of which is regulated by the expression product of the lad gene.
  • lacZYA the native E. coli structure of the operon is "PlacI-/ ⁇ c/-PlacZ-/ cZK4," wherein the native E.
  • PlacZ also called “PlacZYA”
  • Placl represents the native promoter for the lad gene
  • lacF represents the gene encoding the lac repressor, i.e. the Lad protein
  • lacZYA represents the operon encoding the lactose utilization pathway.
  • the Lad-regulated promoters include, among others, the native E. coli lactose operon promoter ("Plac").
  • improved mutants have also been discovered, as have intra promoter hybrids of Plac, such as the "Ptac” promoter, "Ptrc” promoter, and the "PtacII” promoters.
  • E. coli for example, is 3-fold stronger than the Plac promoter when fully derepressed. Therefore, it is frequently used for promoting high level regulated gene expression in E. coli.
  • the Plac promoter is 1, 000-fold repressed by Lad
  • the Ptac promoter is only 50-fold repressed under similar conditions (Lanzer, M. & H. Bujard. 1988. Proc. Natl. Acad. Sci. USA. 85:8973).
  • Repression of the E. coli Ptac promoter or other lac related promoters depends upon the concentration of the repressor, Lad. (De Boer, et al., 1983. Proc. Natl. Acad. Sci. USA. 78:21-25).
  • release from repression can occur through the addition of an inducer which reduces the affinity of the repressor for its specific DNA binding site, in this case, the lac operator (lacO).
  • lacO lac operator
  • a reduction in the concentration of the repressor relative to the molar concentration of specific DNA binding sites on the plasmid can also derepress the promoter.
  • the lad gene is located on a high copy number cloning plasmid, then a large amount of inducer is required to initiate expression because of the large amount of repressor produced in such a system.
  • the lac repressor is typically encoded by a gene whose expression is constitutive, i.e.
  • the desired transgene encoding the desired target protein
  • a quantity of a small molecule known as an inducer whose presence is effective to dissociate the repressor from the transgene, is added to the cell culture and taken up by the host cell, thereby permitting transcription of the transgene.
  • the inducer can be lactose or a non-metabolized, gratuitous inducer such as isopropyl-beta-D-thio- galactoside ("IPTG").
  • lac repressor genes have been identified as useful for the repression of Plac family promoters present on recombinant polypeptide expression vectors. These include the native E. coli lad gene and/or by variants thereof, including the lacfi and lacfi 1 genes that encode the same Lad protein, but at a higher expression level.
  • the lacfi mutation is a single CG to TA change at -35 of the promoter region of la (Calos, M. 1978. Nature 274:762) which causes a 10-fold increase in Lad expression in E. coli (Mueller-Hill, B., et al. 1968. Proc.
  • Wild-type E. coli cells have a concentration of Lad of 10 "8 M or about 10 molecules per cell, with 99% of the protein present as a tetramer (Fickert, R. & B. Mueller-Hill 1992. J. Mol. Biol. 226:59).
  • Cells containing the lacfi mutation contain about 100 molecules per cell or 10 "7 M La .
  • Plac family promoter controlled transgenes resident in plasmids, are maintained in host cells expressing Lad proteins at different levels, thereby repressing the desired transgene until a chosen "induction phase" of cell growth.
  • repression of expression of the target protein during cell growth can be imperfect, resulting in a significant amount of expression prior to the particular induction phase.
  • This "leaky" repression results in host cell stress, inefficient utilization of carbon source due to metabolic energy being diverted from normal cell growth to transgene, and a delay in reaching optimal cell density induction points, resulting in a more lengthy and costly fermentation run, and often, a reduced yield of the target protein.
  • One common strategy for improving repression of Plac-family promoter-driven transgenes has been to place a lad or a lacfi gene on the plasmid bearing the Plac-family promoter-driven target gene (e.g.
  • the selection marker gene for the second plasmid in turn requires the use of either: 1) a separate antibiotic in the case of an antibiotic-resistance selection marker gene, which is costly and disadvantageous from a health/safety regulatory perspective; or 2) a separate metabolic deficiency in the host cell genome, in the case of an auxotrophic selection marker gene, which requires the additional work of mutating the host cell.
  • a lad insertion other than as part of a whole or truncated ' Plac-lad-lacZYA operon, is as effective in repressing Plac-Ptac family promoter- controlled transgenes as a multi-copy plasmid encoding a Lad repressor protein in Pseudomonas fluorescens.
  • This surprising discovery eliminates the need to maintain a separate plasmid encoding a Lad repressor protein in the cell, or eliminates the need to define an additional auxotrophic selection marker, and further reduces the potential production inefficiencies caused by such maintenance of a lad containing plasmid.
  • an E.coli V ⁇ &cl-lacI-lacZYA operon that has been deleted of the lacZ promoter region, but that retains the constitutive Placl promoter, was chromosomally inserted (See U.S. Pat. No. 5,169,760). The deletion allows for constitutive expression of the gene products of the lac operon.
  • the inserted operon contains the E.coli lacY gene, which encodes for the lactose transporter protein lactose permease. Lactose permease is capable of transporting lactose, or similar derivatives, into the host cell from the medium.
  • lactose permease may lead to increased importation of lactose-like contaminants from the medium, ultimately resulting in derepression of the Plac family promoter prior to induction.
  • expression of the lac operon lacZ, lacY, and lacA gene products may result in the inefficient dedication of carbon utilization resources to these products, resulting in increased metabolic stress on the cells, and delaying the establishment of a high cell density for induction.
  • the larger lad-lacZYA fusion operon may produce increased message instability compared to a lad insert alone in a host cell.
  • Lad-encoding gene other than as part of a whole or truncated VlacI-lacI-lacZYA operon in Pseudomonads surprisingly resulted in substantially improved repression of pre-induction recombinant protein expression, higher cell densities in commercial-scale fermentation, and higher yields of the desired product in comparison with previously taught lad-lacZYA Pseudomonad chromosomal insertion (U.S. Pat. No. 5,169,760).
  • Additional attempts to utilize derivative lad genes, such as lacfi and lacfi 1 which are expressed at greater levels than lad due to promoter modifications, have also been described.
  • CG Glascock & MJ Weickert describe E. coli strains in which a separate Lad protein-encoding gene was present in the chromosome of the host cell in an attempt to assess the level of control of a plasmid-borne Ptac-driven target gene. See CG Glascock & MJ Weickert, "Using chromosomal lacfi 1 to control expression of genes on high-copy number plasmids in Escherichia coli" Gene 223(1 -2):221-31(1998); See also WO 97/04110. Among the Lad protein-encoding genes tested were lad, lacfi, and lacfi 1 .
  • Gram(-) Proteobacteria Subgroup 1 is more specifically defined as the group of Proteobacteria belonging to the families and or genera described as falling within that taxonomic "Part” named "Gram- Negative Aerobic Rods and Cocci” by R.E. Buchanan and N.E. Gibbons (eds.), Bergey's Manual of Determinative Bacteriology, pp. 217-289 (8th ed., 1974) (The Williams & Wilkins Co., Baltimore, MD, USA) (hereinafter "Bergey (1974)"). Table 4 presents the families and genera of organisms listed in this taxonomic "Part.”
  • Gram(-) Proteobacteria Subgroup 1 contains all Proteobacteria classified there under, as well as all Proteobacteria that would be classified according to the criteria used in forming that taxonomic "Part.”
  • "Gram(-) Proteobacteria Subgroup 1” excludes, e.g.: all Gram-positive bacteria; those Gram-negative bacteria, such as the Enterobacteriaceae, which fall under others of the 19 “Parts” of this Bergey (1974) taxonomy; the entire "Family V.
  • Halobacteriaceae of this Bergey (1974) "Part,” which family has since been recognized as being a non-bacterial family of Archaea; and the genus, Tliermus, listed within this Bergey (1974) "Part,” which genus which has since been recognized as being a non-Proteobacterial genus of bacteria.
  • "Gram(-) Proteobacteria Subgroup 1" further includes those Proteobacteria belonging to (and previously called species of) the genera and families defined in this Bergey (1974) "Part,” and which have since been given other Proteobacterial taxonomic names. In some cases, these re-namings resulted in the creation of entirely new Proteobacterial genera.
  • the genera Acidovorax, Brevundimonas, Burkholderia, Hydrogenophaga, Oceanimonas, Ralstonia, and Stenotrophomonas were created by regrouping organisms belonging to (and previously called species of) the genus Pseudomonas as defined in Bergey (1974).
  • the genus Sphingomonas (and the genus Blastomonas, derived therefrom) was created by regrouping organisms belonging to (and previously called species of) the genus Xanthomonas as defined in Bergey (1974).
  • the genus Acidomonas was created by regrouping organisms belonging to (and previously called species of) the genus Acetobacter as defined in Bergey (1974). Such subsequently reassigned species are also included within "Gram(-) Proteobacteria Subgroup 1" as defined herein. In other cases, Proteobacterial species falling within the genera and families defined in this Bergey (1974) "Part” were simply reclassified under other, existing genera of Proteobacteria.
  • Pseudomonas enalia ATCC 14393
  • Pseudomonas nigrifaciens ATCC 19375
  • Pseudomonas putrefaciens ATCC 8071
  • Alteromonas haloplanktis Alteromonas nigrifaciens
  • Alteromonas putrefaciens ATCC 8071
  • Pseudomonas acidovorans (ATCC 15668) and Pseudomonas testosteroni (ATCC 11996) have since been reclassified as Comamonas acidovorans and Comamonas testosteroni, respectively; and Pseudomonas nigrifaciens (ATCC 19375) and Pseudomonas piscicida (ATCC 15057) have since been reclassified respectively as Pseudoalter-omonas nigrifaciens and Pseudoalteromonas piscicida.
  • Such subsequently reassigned Proteobacterial species are also included within "Gram(-) Proteobacteria Subgroup 1" as defined herein.
  • "Gram(-) Proteobacteria Subgroup 1” also includes Proteobacterial species that have since been discovered, or that have since been reclassified as belonging, within the Proteobacterial families and/or genera of this Bergey (1974) "Part.”
  • "Gram(-) Proteobacteria Subgroup 1” also includes Proteobacteria classified as belonging to any of the families: Pseudomonadaceae, Azotobacteraceae (now often called by the synonym, the "Azotobacter group” of Pseudomonadaceae), Rhizobiaceae, and Methylomonadaceae (now often called by the synonym, "Methylococcaceae”).
  • Proteobacterial genera falling within "Gram(-) Proteobacteria Subgroup 1" include: 1) Azotobacter group bacteria of the genus Azorhizophilus; 2) Pseudomonadaceae family bacteria of the genera Cellvibrio, Oligella, and Teredinibacter, 3) Rhizobiaceae family bacteria of the genera Chelatobacter, Ensifer, L ⁇ ber ⁇ bacter (also called “Candidatus Liberibacter"), and Sinorhizobium; and 4) Methylococcaceae family bacteria of the genera Methylobacter, Methylocaldum, Methylomicrobium, Methylosarcina, and Methylosphaera.
  • the host cell is selected from "Gram(-) Proteobacteria Subgroup 1," as defined above. In another embodiment, the host cell is selected from "Gram(-) Proteobacteria Subgroup 2.”
  • "Gram(-) Proteobacteria Subgroup 2" is defined as the group of Proteobacteria of the following genera (with the total numbers of catalog-listed, publicly-available, deposited strains thereof indicated in parenthesis, all deposited at ATCC, except as otherwise indicated): Acidomonas (2); Acetobacter (93); Gluconobacter (37); Brevundimonas (23); Beijerincl ⁇ a (13); Derxia (2); Brucella (4); Agrobacterium (79); Chelatobacter (2); Ensifer (3); Rhizobium (144); Sinorhizobium (24); Blastomonas (1); Sphingomonas (27); Alcaligenes (88); Bordetella (43); Burkholderia (73
  • Exemplary host cell species of "Gram(-) Proteobacteria Subgroup 2" include, but are not limited to the following bacteria (with the ATCC or other deposit numbers of exemplary strain(s) thereof shown in parenthesis): Acidomonas methanolica (ATCC 43581); Acetobacter aceti (ATCC 15973); Gluconobacter oxydans (ATCC 19357); Brevundimonas diminuta (ATCC 11568); Beijerinckia indica (ATCC 9039 and ATCC 19361); Derxia gummosa (ATCC 15994); Brucella melitensis (ATCC 23456), Brucella abortus (ATCC
  • Agrobacterium tumefaciens ATCC 23308
  • Agrobacterium radiobacter ATCC
  • Agrobacterium rhizogenes ATCC 11325
  • Chelatobacter heintzii ATCC 29600
  • Ensifer adhaerens (ATCC 33212); Rhizobium leguminosarum (ATCC 10004); Sinorhizobium fredii (ATCC 35423); Blastomonas natatoria (ATCC 35951); Sphingomonas paucimobilis (ATCC 29837); Alcaligenes faecalis (ATCC 8750); Bordetella pertussis (ATCC 9797);
  • Burkholderia cepacia (ATCC 25416); Ralstonia pickettii (ATCC 27511); Acidovorax facilis
  • Methylobacter luteus ATCC 49878
  • Methylocaldum gracile NCIMB 11912
  • Methylococcus capsulatus ATCC 19069
  • Methylomicrobium agile ATCC 35068
  • Methylomonas methanica ATCC 35067
  • Methylosarcina fibrata ATCC 700909
  • Methylosphaera hansonii (ACAM 549); Azomonas agilis (ATCC 7494); Azorhizophilus paspali (ATCC 23833); Azotobacter chroococcum (ATCC 9043); Cellvibrio mixtus (UQM).
  • Oligella urethralis ATCC 17960
  • Pseudomonas aeruginosa ATCC 10145
  • Pseudomonas fluorescens ATCC 35858
  • Francisella tularensis ATCC 6223
  • the host cell is selected from "Gram(-) Proteobacteria
  • Gram(-) Proteobacteria Subgroup 3 is defined as the group of Proteobacteria of the following genera: Brevundimonas; Agrobacterium; Rhizobium; Sinorhizobium;
  • Methylomonas Methylosarcina; Methylosphaera; Azomonas; Azorhizophilus; Azotobacter;
  • the host cell is selected from "Gram(-) Proteobacteria
  • Gram(-) Proteobacteria Subgroup 4 is defined as the group of Proteobacteria of the following genera: Brevundimonas; Blastomonas; Sphingomonas; Burkholderia;
  • Azorhizophilus Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter;
  • the host cell is selected from "Gram(-) Proteobacteria Subgroup
  • Gram(-) Proteobacteria Subgroup 5" is defined as the group of Proteobacteria of the following genera: Methylobacter; Methylocaldum; Methylococcus; Methylomicrobium;
  • Methylomonas Methylosarcina; Methylosphaera; Azomonas; Azorhizophilus; Azotobacter;
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 6.” "Gram(-)
  • Proteobacteria Subgroup 6 is defined as the group of Proteobacteria of the following genera:
  • Hydrogenophaga Azomonas; Azorhizophilus; Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter; Stenotrophomonas; Xanthomonas; and Oceanimonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 7."
  • "Gram(-) Proteobacteria Subgroup 7” is defined as the group of Proteobacteria of the following genera: Azomonas; Azorhizophilus; Azotobacter; Cellvibrio; Oligella; Pseudomonas; Teredinibacter; Stenotrophomonas; Xanthomonas; and Oceanimonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 8.” "Gram(-)
  • Proteobacteria Subgroup 8 is defined as the group of Proteobacteria of the following genera: Brevundimonas; Blastomonas; Sphingomonas; Burkholderia; Ralstonia; Acidovorax; Hydrogenophaga; Pseudomonas; Stenotrophomonas; Xanthomonas; and Oceanimonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 9."
  • "Gram(-) Proteobacteria Subgroup 9" is defined as the group of Proteobacteria of the following genera: Brevundimonas; Burkholderia; Ralstonia; Acidovorax; Hydrogenophaga; Pseudomonas; Stenotrophomonas; and Oceanimonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 10."
  • "Gram(-) Proteobacteria Subgroup 10" is defined as the group of Proteobacteria of the following genera: Burkholderia; Ralstonia; Pseudomonas; Stenotrophomonas; and Xanthomonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 11.”
  • "Gram(-) Proteobacteria Subgroup 11” is defined as the group of Proteobacteria of the genera: Pseudomonas; Stenotrophomonas; and Xanthomonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 12."
  • "Gram(-) Proteobacteria Subgroup 12" is defined as the group of Proteobacteria of the following genera: Burkholderia; Ralstonia; Pseudomonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 13.”
  • "Gram(-) Proteobacteria Subgroup 13" is defined as the group of Proteobacteria of the following genera: Burkholderia; Ralstonia; Pseudomonas; and Xanthomonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 14.” "Gram(-)
  • Proteobacteria Subgroup 14 is defined as the group of Proteobacteria of the following genera: Pseudomonas and Xanthomonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 15.”
  • "Gram(-) Proteobacteria Subgroup 15” is defined as the group of Proteobacteria of the genus Pseudomonas.
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 16.”
  • "Gram(-) Proteobacteria Subgroup 16” is defined as the group of Proteobacteria of the following Pseudomonas species (with the ATCC or other deposit numbers of exemplary strain(s) shown in parenthesis): Pseudomonas abietaniphila (ATCC 700689); Pseudomonas aeruginosa (ATCC 10145); Pseudomonas alcaligenes (ATCC 14909); Pseudomonas angu ⁇ liseptica (ATCC 33660); Pseudomonas citronellolis (ATCC 13674); Pseudomonas flavescens (ATCC 51555); Pseudomonas mendocina (ATCC 25411); Pseudomonas nitroreducens (ATCC 33634);
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 17."
  • "Gram(-) Proteobacteria Subgroup 17” is defined as the group of Proteobacteria known in the art as the "fluorescent Pseudomonads" including those belonging, e.g., to the following Pseudomonas species: Pseudomonas azotoformans; Pseudomonas brenneri; Pseudomonas cedrella; Pseudomonas corrugata; Pseudomonas extremorientalis; Pseudomonas fluorescens; Pseudomonas gessardii; Pseudomonas libanensis; Pseudomonas mandelii; Pseudomonas marginalis; Pseudomonas migulae; Pseudomonas
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 18."
  • "Gram(-) Proteobacteria Subgroup 18” is defined as the group of all subspecies, varieties, strains, and other sub-special units of the species Pseudomonas fluorescens, including those belonging, e.g., to the following (with the ATCC or other deposit numbers of exemplary strain(s) shown in parenthesis): Pseudomonas fluorescens biotype A, also called biovar 1 or biovar I (ATCC 13525); Pseudomonas fluorescens biotype B, also called biovar 2 or biovar II (ATCC 17816) Pseudomonas fluorescens biotype C, also called biovar 3 or biovar III (ATCC 17400) Pseudomonas fluorescens biotype F, also called biovar 4 or biovar IV (ATCC 12983) Pseudomon
  • the host cell can be selected from "Gram(-) Proteobacteria Subgroup 19."
  • "Gram(-) Proteobacteria Subgroup 19” is defined as the group of all strains of Pseudomonas fluorescens biotype A. A particularly particular strain of this biotype is P. fluorescens strain MB101 (see US Patent No. 5,169,760 to Wilcox), and derivatives thereof.
  • the host cell is any of the Proteobacteria of the order
  • the host cell is any of the Proteobacteria of the family Pseudomonadaceae. In a particular embodiment, the host cell is selected from "Gram(-) Proteobacteria Subgroup 1.” In a particular embodiment, the host cell is selected from “Gram(-) Proteobacteria Subgroup 2.” In a particular embodiment, the host cell is selected from "Gram(-) Proteobacteria Subgroup 3.” In a particular embodiment, the host cell is selected from "Gram(-) Proteobacteria Subgroup 5.” In a particular embodiment, the host cell is selected from "Gram(-) Proteobacteria Subgroup 7.” In a particular embodiment, the host cell is selected from "Gram(-) Proteobacteria Subgroup 12.” In a particular embodiment, the host cell is selected from "Gram(-) Proteobacteria Subgroup 15.” In a particular embodiment, the host cell is selected from "Gram(-) Proteobacteri
  • fluorescens strains that can be used in the present invention include Pseudomonas fluorescens Migula and Pseudomonas fluorescens Loitokitok, having the following ATCC designations: [NCIB 8286]; NRRL B-1244; NCIB 8865 strain CO1; NCIB 8866 strain CO2; 1291 [ATCC 17458; IFO 15837; NCIB 8917; LA; NRRL B-1864; py ⁇ olidine; PW2 [ICMP 3966; NCPPB 967; NRRL B-899]; 13475; NCTC 10038; NRRL B- 1603 [6; IFO 15840]; 52-1C; CCEB 488-A [BU 140]; CCEB 553 [IEM 15/47]; IAM 1008 [AHH-27]; IAM 1055 [AHH-23]; 1 [IFO 15842]; 12 [ATCC 25323; NIH 11
  • the present invention provides Pseudomonads and related cells that have been genetically modified to induce auxotrophy for at least one metabolite.
  • the genetic modification can be to a gene or genes encoding an enzyme that is operative in a metabolic pathway, such as an anabolic biosynthetic pathway or catabolic utilization pathway.
  • the host cell has all operative genes encoding a given biocatalytic activity deleted or inactivated in order to ensure removal of the biocatalytic activity.
  • the Pseudomonad is a Pseudomonas fluorescens cell.
  • One or more than one metabolic activity may be selected for knock-out or replacement.
  • auxotrophy-restoring selection markers can be of a biosynthetic-type (anabolic), of a utilization-type (catabolic), or may be chosen from both types.
  • one or more than one activity in a given biosynthetic pathway for the selected compound may be knocked-out; or more than one activity, each from different biosynthetic pathways, may be knocked-out.
  • the corresponding activity or activities are then provided by at least one recombinant vector which, upon transformation into the cell, restores prototrophy to the cell.
  • lipids including, for example, fatty acids; mono- and disaccharides and substituted derivatives thereof, including, for example, glucose, fructose, sucrose, glucose-6-phosphate, and glucuronic acid, as well as Entner-Doudoroff and Pentose Phosphate pathway intermediates and products; nucleosides, nucleotides, dinucleotides, including, for example, ATP, dCTP, FMN, FAD, NAD, NADP, nitrogenous bases, including, for example, pyridines, purines, pyrimidines, pterins, and hydro-, dehydro-, and/or substituted nitrogenous base derivatives, such as cofactors, for example, biotin, cobamamide, riboflavine, thiamine; organic acids and glycolysis and citric acid cycle intermediates and products, including, for example, hydroxyacids and amino acids
  • the biocatalytic activity(ies) knocked out to produce the auxotrophic host cell is selected from the group consisting of: the lipids; the nucleosides, nucleotides, dinucleotides, nitrogenous bases, and nitrogenous base derivatives; and the organic acids and glycolysis and citric acid cycle intermediates and products.
  • the biocatalytic activity(ies) knocked out is selected from the group consisting of: the nucleosides, nucleotides, dinucleotides, nitrogenous bases, and nitrogenous base derivatives; and the organic acids and glycolysis and citric acid cycle intermediates and products.
  • the biocatalytic activity(ies) knocked out is selected from the group consisting of: the pyrimidine nucleosides, nucleotides, dinucleotides, nitrogenous bases, and nitrogenous base derivatives; and the amino acids.
  • a given transgenic host cell may use one or more than one selection marker or selection marker system.
  • one or more biosynthesis selection marker(s) or selection marker system(s) according to the present invention may be used together with each other, and/or may be used in combination with a utilization-type selection marker or selection marker system according to the present invention.
  • the host cell may also contain one or more non-auxotrophic selection marker(s) or selection marker system(s).
  • non-auxotrophic selection marker(s) and system(s) include, for example: toxin-resistance marker genes such as antibiotic- resistance genes that encode an enzymatic activity that degrades an antibiotic; toxin-resistant marker genes, such as, for example, imidazolinone-resistant mutants of acetolactate synthase ("ALS;" EC 2.2.1.6) in which mutation(s) are expressed that make the enzyme insensitive to toxin-inhibition exhibited by versions of the enzyme that do not contain such mutation(s).
  • toxin-resistance marker genes such as antibiotic- resistance genes that encode an enzymatic activity that degrades an antibiotic
  • toxin-resistant marker genes such as, for example, imidazolinone-resistant mutants of acetolactate synthase ("ALS;" EC 2.2.1.6) in which mutation(s) are expressed that make the enzyme insensitive to toxin-inhibition exhibited by versions of the enzyme that do not contain such mutation(s).
  • the compound(s) may exert this effect directly; or the compound(s) may exert this effect indirectly, for example, as a result of metabolic action of the cell that converts the compound(s) into toxin form or as a result of combination of the compound(s) with at least one further compound(s).
  • Bacterial-host-operative genes encoding such marker enzymes can be obtained from the bacterial host cell strain chosen for construction of the knock-out cell, from other bacteria, or from other organisms, and may be used in native form or modified (e.g., mutated or sequence recombined) form.
  • a DNA coding sequence for an enzyme exhibiting the knocked out biocatalytic activity may be obtained from one or more organisms and then operatively attached to DNA regulatory elements operative within the host cell.
  • all of the chosen host's intracellular genes that encode a selected enzymatic activity are knocked-out; the bacterial knock-out host is then transformed with a vector containing at least one operative copy of a native or non-native gene encoding an enzyme exhibiting the activity lost by the bacterial knockout.
  • Bacterial and other genes encoding such enzymes can be selected and obtained through various resources available to one of ordinary skill in the art. These include the nucleotide sequences of enzyme coding sequences and species-operative DNA regulatory elements.
  • Useful on-line InterNet resources include, e.g.,: (1) the ExPASy proteomics facility (see the ENZYME and BIOCHEMICAL PATHWAYS MAPS features) of the Swiss Institute of Biomformatics (Batiment Ed Pharmacie, Room 3041; Universite de Lausanne; 1015 Lausanne-Dorigny; Switzerland) available at, e.g., http://us.expasy.org/; and (2) the GenBank facility and other Entiez resources (see the PUBMED, PROTEIN, NUCLEOTIDE, STRUCTURE, GENOME, et al. features) offered by the National Center for Biotechnology Information (NCBI, National Library of Medicine, National Institutes of Health, U.S. Dept.
  • NCBI National Center for Biotechnology Information
  • the selected coding sequence may be modified by altering the genetic code thereof to match that employed by the bacterial host cell, and the codon sequence thereof may be enhanced to better approximate that employed by the host. Genetic code selection and codon frequency enhancement may be performed according to any of the various methods known to one of ordinary skill in the art, e.g., oligonucleotide-directed mutagenesis.
  • Pseudomonas species are reported as utilizing Genetic Code Translation Table 11 of the NCBI Taxonomy site, and at the Kazusa site as exhibiting the codon usage frequency of the table shown at http://www.kazusa.or.ip/codon/cgibin/.
  • Pseudomonas fluorescens can be used as the host cell.
  • Pseudomonas fluorescens provides at least one auxotrophic selection marker gene.
  • Pseudomonas fluorescens provides all auxotrophic selection marker genes.
  • Pseudomonas fluorescens can both be the host cell and provide at least one, and preferably all, auxotrophic selection marker genes.
  • a biosynthetic enzyme involved in anabolic metabolism can be chosen as the auxotrophic selection marker.
  • the biosynthetic enzyme can be selected from those involved in biosynthesis of the nucleosides, nucleotides, dinucleotides, nitrogenous bases, and nitrogenous base derivatives.
  • at least one purine-type biosynthetic enzyme can be chosen as an auxotrophic selection marker.
  • Such purine biosynthetic enzymes include, for example, adenine phosphoribosyltransferases, adenylosuccinate lyases, adenylosuccinate synthases, GMP synthases, IMP cyclohydrolases, IMP dehydrogenases, phosphoribosylamine-glycine ligases, phosphoribosyl-aminoimidazolecarboxamide formyltransferases, phosphoribosylaminoimidazole carboxylases, phosphoribosyl aminoimidazolesuccinocarboxamide synthases, phosphoribosyl-formylglycinamidine cyclo ligases, phosphoribosyl-formylglycinamidine synthases, phosphoribosyl-glycinamide formyltransferases, ribose-phosphate diphosphokinases, and ribose-5 -phosphate-ammonia ligases.
  • a pyrimidine-type biosynthetic enzyme can be chosen as an auxotrophic selection marker.
  • Such pyrimidine-type biosynthetic include enzymes involved in biosynthesis of UMP, such as carbamate kinase (EC 2.7.2.2), carbamoyl-phosphate synthase (EC 6.3.5.5), aspartate carbamoyltransferase (EC 2.1.3.2), dihydroorotase (EC 3.5.2.3), dihydroorotate dehydrogenase (EC 1.3.3.1), orotate phosphoribosyltransferase ("OPRT;” EC 2.4.2.10), and orotidine-5'-phosphate decarboxylase ("ODCase;" EC 4.1.1.23).
  • genes encoding pyrimidine-type biosynthetic enzymes are well known.
  • useful genes include: arcC genes, encoding carbamate kinases; carA and carB genes, collectively encoding carbamoyl- phosphate synthases; pyrB genes, encoding aspartate carbamoytransferases; pyrC genes, encoding dihydroorotases; pyrD genes, singly or collectively encoding dihydroorotate dehydrogenases; pyrE genes encoding orotate phosphoribosyltransferases; and pyrF genes, encoding orotidine-5'-phosphate decarboxylases.
  • an expression system will utilize a pyrF auxotrophic selection marker gene.
  • pyrF genes encode ODCase, an enzyme required for the bacterial pyrimidine nucleotide biosynthesis pathway, by which the cell performs de novo synthesis of pyrimidine nucleotides proper (UTP, CTP), as well as pyrimidine deoxynucleotides (dTTP, dCTP).
  • the pathway's initial reactants are ATP, an amino group source (i.e. ammonium ion or L-glutamine), and a carboxyl group source (i.e.
  • the pathway's ultimate product is dTTP, with dCTP, UTP, and CTP also being formed in the process.
  • the bacterial de novo pyrimidine nucleotide biosynthesis pathway begins with the formation of carbamoyl phosphate.
  • Carbamoyl phosphate is synthesized either: (a) by action of carbamate kinase (EC 2.7.2.2), encoded by the arcC gene; or, more commonly, (b) by action of the glutamine-hydrolyzing, carbamoyl-phosphate synthase (EC 6.3.5.5), whose small and large subunits are encoded by the carA and carB genes, respectively.
  • Carbamoyl phosphate is then converted to UDP by the following six-step route: 1) conversion of carbamoyl phosphate to N-carbamoyl-L- aspartate, by aspartate carbamoyltransferase (EC 2.1.3.2), encoded by pyrB; then 2) conversion thereof to (S)-dihydroorotate, by dihydroorotase (EC 3.5.2.3), encoded by pyrC; then 3) conversion thereof to orotate, by dihydroorotate dehydrogenase (EC 1.3.3.1), encoded by pyrD gene(s); then 4) conversion thereof to orotidine-5'-monophosphate ("OMP"), by orotate phosphoribosyltransferase ("OPRT;” EC 2.4.2.10), encoded by pyrE; and then 5) conversion thereof to uridine-5'-monophosphate ("UMP”), by orotidine-5 '-phosphate decarboxylase ("OD
  • the UMP is then utilized by a variety of pathways for synthesis of pyrimidine nucleotides (UTP, CTP, dTTP, dCTP), nucleic acids, nucleoproteins, and other cellular metabolites.
  • UTP pyrimidine nucleotides
  • CTP CTP
  • dTTP dTTP
  • dCTP pyrimidine nucleotide
  • nucleic acids nucleoproteins
  • nucleoproteins and other cellular metabolites.
  • uracil salvage pathway the cell imports and converts exogenous uracil into UMP, to synthesize the required pyrimidine nucleotides.
  • uracil is reacted with 5-phosphoribosyl-l-pyrophosphate to form UMP, by the action of either uracil phosphoribosyltransferase (EC 2.4.2.9), encoded by the upp gene, or by the bifunctional, pyrimidine operon regulatory protein (“pyrR bifunctional protein”), encoded by pyrR.
  • pyrR bifunctional protein pyrimidine operon regulatory protein
  • a pyrF(-) Pseudomonad or related cell can be maintained on uracil- containing medium.
  • a pyrF gene-containing DNA construct is transfected into the pyrF( ⁇ ) cell and expressed to form a functioning ODCase enzyme, the resulting combined pyrF(+) plasmid-host cell system can be maintained in a medium lacking uracil.
  • the coding sequence of the pyrF gene for use in a Pseudomonad or related host cell can be provided by any gene encoding an orotidine-5 '-phosphate decarboxylase enzyme ("ODCase"), provided that the coding sequence can be transcribed, translated, and otherwise processed by the selected Pseudomonad or related host cell to form a functioning ODCase.
  • ODCase orotidine-5 '-phosphate decarboxylase enzyme
  • the pyrF coding sequence may be a native sequence, or it may be an engineered sequence resulting from, for example, application of one or more sequence-altering, sequence- combining, and/or sequence-generating techniques known in the art.
  • the selected coding sequence Before use as part of a pyrF selection marker gene, the selected coding sequence may first be improved or optimized in accordance with the genetic code and/or the codon usage frequency of a selected Pseudomonad or related host cell. Expressible coding sequences will be operatively attached to a transcription promoter capable of functioning in the chosen host cell, as well as all other required transcription and translation regulatory elements.
  • a native coding sequence for a pyrF gene as described above may be obtained from a bacterium or from any other organism, provided that it meets the above-described requirements.
  • the pyrF coding sequence is isolated from the Pseudomonad or related host cell in which it is intended to be used as a selection marker.
  • a bacterium providing the pyrF gene or coding sequence will be selected from the group consisting of a member of the order Pseudomonadales, a member of the suborder Pseudomonadineae, a member of the family Pseudomonadaceae, a member of the tribe Pseudomonadeae, a member of the genus Pseudomonas, and a member of the Pseudomonas fluorescens species group (i.e. the "fluorescent pseudomonads").
  • the bacterium will belong to the species, Pseudomonas fluorescens.
  • the pyrF gene contains the nucleic acid sequence of SEQ ID NO. 1 (Table 2), or a variant thereof.
  • the ODCase encoded by the pyrF gene contains the amino acid sequence of SEQ ID NO. 2 (Table 3), a variant thereof, or a variant having a codon sequence redundant therewith, in accordance with the genetic code used by a given host cell according to the present invention.
  • the pyrF gene contains a nucleic acid sequence encoding an ODCase enzyme selected from the group consisting of a nucleic acid sequence at least 70%, 75%, 80%, 85%, 88%, 90%, and 95% homologous to SEQ ID No. 1.
  • the ⁇ rE gene encodes an ODCase selected from the group consisting of an amino acid sequence at least 70%, 75%, 80%, 85%, 88%, 90%, and 95% homologous to SEQ ID No. 2.
  • the pyrF gene can contain a coding sequence having a nucleotide sequence at least 90%, 93%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence of nucleotides 974-1669 of SEQ ID NO:l.
  • the pyrF gene can contain a coding sequence having a codon sequence that hybridizes to the anti-codon sequence of SEQ ID NO: 3 (Table 4), when hybridization has been performed under highly stringent hybridization conditions, or can have a codon sequence redundant therewith.
  • the pyrF gene will contain the nucleotide sequence of SEQ ID No. 3
  • an expression system according to the present invention will utilize a thyA auxotrophic selection marker gene.
  • thyA genes encode thymidylate synthase (EC 2.1.1.45), an enzyme required for the bacterial pyrimidine nucleotide biosynthesis pathway. Since DNA contains thymine (5-methyluracil) as a major base instead of uracil, the synthesis of thymidine monophospate (dTMP or thymidylate) is essential to provide dTTP (thymidine triphosphate) needed for DNA replication together with dATP, dGTP, and dCTP.
  • dTMP or thymidylate thymidine monophospate
  • Thymidylate synthesis can be interrupted, and consequently the synthesis of DNA arrested, by the removal, inhibition, or disruption of thymidylate synthase.
  • the thyA gene has become inactivated or lost, or mutated to encode a non-functional enzyme, the cell can still thrive if exogenous thymidine is added to the medium.
  • a plasmid comprising a tdk gene can be used to transform thyA(-) P. fluorescens host cells, generating a thyA(-)lntdk cell, allowing survival on a thymidine containing medium.
  • a tdk gene producing a functional thymidylate synthase enzyme capable of utilizing exogenous thymidine in Pseudomonas fluorescens can be inserted into the genome, producing a thyA(-)/tdk(+) host cell.
  • a thyA gene-containing DNA construct is transfected into the thyA(-)/ptdk cell and expressed to form a functioning thymidylate synthase enzyme, the resulting combined thyA(+) plasmid-host cell system can be maintained in a medium lacking thymidine.
  • the coding sequence of the thyA gene for use in a Pseudomonad or related host cell can be provided by any gene encoding a thymidylate synthase enzyme ("TS"), provided that the coding sequence can be transcribed, translated, and otherwise processed by the selected Pseudomonad or related host cell to form a functioning TS.
  • TS thymidylate synthase enzyme
  • the thyA coding sequence may be a native sequence, or it may be an engineered sequence resulting from, for example, application of one or more sequence-altering, sequence-combining, and/or sequence- generating techniques known in the art.
  • the selected coding sequence Before use as part of a thyA selection marker gene, the selected coding sequence may first be improved or optimized in accordance with the genetic code and/or the codon usage frequency of a selected Pseudomonad or related host cell. Expressible coding sequences will be operatively attached to a transcription promoter capable of functioning in the chosen host cell, as well as all other required transcription and translation regulatory elements.
  • a native coding sequence for a thyA gene as described above may be obtained from a bacterium or from any other organism, provided that it meets the above-described requirements.
  • the thyA coding sequence is isolated from the Pseudomonad or related host cell in which it is intended to be used as a selection marker.
  • thyA gene (including the coding sequence and surrounding regulatory regions) can be isolated there from.
  • a bacterium providing the thyA gene or coding sequence will be selected from the group consisting of a member of the order Pseudomonadales, a member of the suborder Pseudomonadineae, a member of the family Pseudomonadaceae, a member of the tribe Pseudomonadeae, a member of the genus Pseudomonas, and a member of the Pseudomonas fluorescens species group (i.e. the "fluorescent pseudomonads").
  • the bacterium will belong to the species, Pseudomonas fluorescens.
  • the thyA gene contains the nucleic acid sequence of SEQ
  • the TS encoded by the thyA gene contains the amino acid sequence of SEQ ID NO. 5 (Table 6), a variant thereof, or a variant having a codon sequence redundant therewith, in accordance with the genetic code used by a given host cell according to the present invention.
  • the biosynthetic enzyme involved in anabolic metabolism chosen as the auxotrophic selection marker can be selected from those involved in the biosynthesis of amino acids.
  • the biosynthetic amino acid enzymes are selected from the group consisting of enzymes active in the biosynthesis of: the Glutamate Family (Glu; Gin, Pro, and Arg); the Aspartate Family (Asp; Asn, Met, Thr, Lys, and He); the Serine Family (Ser; Gly and Cys); the Pyruvate Family (Ala, Val, and Leu); the Aromatic Family (Trp, Phe, and Tyr); and the Histidine Family (His).
  • genes and enzymes involved in these biosynthetic pathways include: the Glutamate Family member arg, gdh, gin, and, pro genes, including, for example, argA-argH, gdhA, glnA, proA, proC; the Aspartate Family member asd, asn, asp, dap, lys, met, and thr genes, including, for example, asnA, asnB, aspC, dapA, dapB, dapD-dapF, lysA, lysC, metA-metC, metE, metH, metL, thrA- thrC; the Serine Family member cys, gly, and ser genes, including, for example, cysE, cysK, glyA, serA-serC; the Aromatic Family member aro, phe, trp, and tyr genes, including, for example, aroA-aroH, aro
  • the auxotrophic selection marker can be selected from enzymes involved in the biosynthesis of members of the Glutamate Family.
  • useful Glutamate Family auxotrophic selection markers include the following, listed with representative examples of their encoding genes: argA, encoding N-acetylglutamate synthases, amino acid acetyltransferases; argB, encoding acetylglutamate kinases; argC, encoding N-acetyl-gammaglutamylphosphate reductases; argD, encoding acetylornithine delta-aminotransferases; argE, encoding acetylornithine deacetylases; argF and argl, encoding ornithine carbamoyltransferases; argG, encoding argininosuccinate synthetases; argH, encoding argininosuccinate lyases;
  • an amino acid biosynthesis selection marker gene can be at least one member of the proline biosynthesis family, in particular proA, proB, or proC.
  • the proline biosynthesis selection marker gene can comprise a proC gene.
  • proC genes encode an enzyme catalyzing the final step of the proline biosynthesis pathway.
  • the proline (i.e. L-proline) biosynthesis pathway comprises a three- enzyme process, beginning with L-glutamic acid.
  • the steps of this process are: 1) conversion of L-glutamic acid to L-glutamyl-5-phosphate, by glutamate-5 -kinase ("GK;" EC 2.7.2.11), encoded by proB; then 2a) conversion thereof to L-glutamate-5-semialdehyde, by glutamate- 5-semialdehyde dehydrogenase (EC 1.2.1.41), also known as glutamyl-5-phosphate reductase
  • GPR GPR-linked pyrroline-S- carboxylate reductase
  • proC encodes the P5CR subunit, with the active P5CR enzyme being a homo-multimer thereof.
  • the cell can still thrive if proline is added to the medium.
  • aproC(-) Pseudomonad or related cell can be maintained on a proline-containing medium.
  • a proC gene-containing DNA construct is transfected into the proC(-) cell and expressed to form a functioning P5CR enzyme, the resulting combined proC(+) plasmid-host cell system can be maintained in a medium lacking proline.
  • the coding sequence of the pro C gene for use in a Pseudomonad or related host cell can be provided by any gene encoding an ⁇ -pyrroline-5-carboxylate reductase enzyme (P5CR), provided that the coding sequence can be transcribed, translated, and otherwise processed by the selected Pseudomonad or related host cell to form a functioning P5CR.
  • P5CR ⁇ -pyrroline-5-carboxylate reductase enzyme
  • the proC coding sequence may be a native sequence, or it may be an engineered sequence resulting from, for example, application of one or more sequence-altering, sequence- combining, and/or sequence-generating techniques known in the art.
  • the selected coding sequence Before use as part of a proC selection marker gene, the selected coding sequence may first be improved or optimized in accordance with the genetic code and/or the codon usage frequency of a selected Pseudomonad or related host cell. Expressible coding sequences will be operatively attached to a transcription promoter capable of functioning in the chosen host cell, as well as all other required transcription and translation regulatory elements.
  • a native coding sequence for a proC gene as described above may be obtained from a bacterium or from any other organism, provided that it meets the above-described requirements.
  • the proC coding sequence is isolated from the Pseudomonad or related host cell in which it is intended to be used as a selection marker.
  • a bacterium providing the proC gene or coding sequence will be selected from the group consisting of a member of the order Pseudomonadales, a member of the suborder Pseudomonadineae, a member of the family Pseudomonadaceae, a member of the tribe Pseudomonadeae, a member of the genus Pseudomonas, and a member of the Pseudomonas fluorescens species group (i.e. the "fluorescent pseudomonads").
  • the bacterium will belong to the species, Pseudomonas fluorescens.
  • the proC gene contains the nucleic acid sequence of SEQ ID NO. 6 (Table 7), or a variant thereof.
  • the P5CR encoded by the proC gene contains the amino acid sequence of SEQ ID NO. 7 (Table 8), a variant thereof, or a variant having a codon sequence redundant therewith, in accordance with the genetic code used by a given host cell according to the present invention.
  • the proC gene contains a nucleic acid sequence encoding an P5CR enzyme that is at least 70%, 75%, 80%, 85%, 88%, 90%, and 95% homologous to SEQ ID No. 6.
  • the proC gene encodes an ODCase that is at least 70%, 75%, 80%, 85%, 88%, 90%, and 95% homologous to SEQ ID No. 7.
  • the proC gene can contain a coding sequence at least 90%, 93%, 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence of SEQ. ID NO. 8 (Table 9).
  • the proC gene can contain a coding sequence having a codon sequence that hybridizes to the anti-codon sequence of SEQ ID NO. 8, when hybridization has been performed under stringent hybridization conditions, or can have a codon sequence redundant therewith.
  • the proC gene will contain the nucleotide sequence of SEQ ID NO. 8.
  • an enzyme involved in the catabolic utilization of metabolites can be chosen as the auxotrophic selection marker.
  • the enzymes can be selected from those involved in the utilization of a carbon source. Examples of such enzymes include, for example, sucrases, lactases, maltases, starch catabolic enzymes, glycogen catabolic enzymes, cellulases, and poly(hydroxyalkanoate) depolymerases. If the bacterial host cell exhibits native catabolic activity of the selected type, it can be knocked-out before transformation with the prototrophy-restoring vector. Bacteria exhibiting native auxotrophy for these compounds can also be used in their native state for such transformation.
  • the prototrophy restoring or prototrophy-enabling enzyme(s) can be secreted for use.
  • the secreted enzyme(s) can degrade the compound extracellularly to produce smaller compounds, for example glucose, that are diffusible or importable into the cell, by selecting or designing the coding sequence of the enzyme(s) to include a coding sequence for a secretion signal peptide operative within the chosen host cell.
  • the prototrophy-restorative gene can be selected or be engineered to include a coding sequence for a secretion signal peptide operative within the chosen host cell to obtaining transport of the enzyme across the cytoplasmic membrane.
  • the cell will be grown in medium supplying no other carbon source apart from the selected compound.
  • every prototrophy-restorative or prototrophy-enabling carbon-source utilization enzyme can be involved in utilization of only one carbon source.
  • two genes from the same catabolic pathway may be expressed together on one vector or may be co-expressed separately on different vectors in order to provide the prototrophy.
  • multi-gene carbon-source- utilization-based marker systems include, for example, the use of glycogen as the sole carbon source with transgenic expression of both a glycogen phosphorylase and an (alpha- 1,4) glucantransferase; and the use of starch as the sole carbon source with transgenic expression of both an alpha-amylase, and an alpha(l ->6) glucosidase.
  • the selected single- or multi-gene carbon-source marker system can be used simultaneously with other types of marker system(s) in the same host cell, provided that the only carbon source provided to the cell is the compound selected for use in the carbon-source catabolic selection marker system.
  • useful enzymes for biochemical-utilization-type activities are well known in the art, and can include racemases and epimerases that are capable of converting a non-utilizable D-carbon source, supplied to the cell, to a nutritive L-carbon source.
  • racemases and epimerases that are capable of converting a non-utilizable D-carbon source, supplied to the cell, to a nutritive L-carbon source.
  • these systems include, for example: a D-acid or a D-acyl compound used with trangenic expression of the corresponding racemase; and lactate used with transgenically expressed lactate racemase.
  • the auxotrophy may also be overcome by supplying the cell with both a non- utilizable R-amino acid and an R-amino acid racemase or epimerase (EC 5.1.1) that converts the R-amino acid into the corresponding L-amino acid for which the cell is auxotrophic.
  • Trait Stacking A plurality of phenotypic changes can also be made to a host cell, before or after insertion of an auxotrophic selection marker gene, for target gene expression, according to the present invention.
  • the cell can be genetically engineered, either simultaneously or sequentially, to exhibit a variety of enhancing phenotypic traits.
  • a pyrF gene according to the present invention, can be used on a suicide vector as both a selectable marker and a counterselectable marker (in the presence of 5'-fluoroorotic acid) in order to effect a cross-in/cross-out allele exchange of other desirable traits,
  • a pyrF gene according to the present invention may be used in a process for "trait stacking" a host cell.
  • a suicide vector containing such a pyrF gene can be transformed into the host cell strain in a plurality of separate transformations; in each such procedure the re-establishment of the pyrF phenotype can be used to create, ad infinitum, subsequent genetically-enhancing phenotypic change.
  • the pyrF gene itself provide a trait, it can be used to obtain additional phenotypic traits in a process of trait-stacking.
  • the present invention provides auxotrophic Pseudomonads and related bacteria that have been further genetically modified to induce additional auxotrophies.
  • a pyrF(-) auxotroph can be further modified to inactivate another biosynthetic enzyme present in an anabolic or catabolic pathway, such as through the inactivation of a proC gene or a thyA gene.
  • another biosynthetic enzyme present in an anabolic or catabolic pathway, such as through the inactivation of a proC gene or a thyA gene.
  • genetic alterations can be made to the host cell in order to improve the expression of recombinant polypeptides in the host cell. Further modifications can include genetic alterations that allow for a more efficient utilization of a particular carbon source, thereby optimizing the overall efficiency of the entire fermentation.
  • auxotrophic host cells are further modified by the insertion of a l ⁇ cl containing transgene into the host chromosome.
  • the l ⁇ cl transgene, or derivate thereof is other than part of a whole or truncated structural gene containing Vlac ⁇ -l ⁇ cI-l ⁇ cZ
  • a Pseudomonad or related host cell selected for use in an expression system according to the present invention can be deficient in its ability to express any functional biocatalyst exhibiting the selected auxotrophic activity.
  • the host cell can be deficient in its ability to express a) any pyrF gene product (i.e. any functional ODCase enzyme), and b) any effective replacement therefore (i.e. any other biocatalyst having ODCase activity).
  • the host cell will be made biocatalytically-deficient for the selected activity by altering its genomic gene(s) so that the cell cannot express, from its genome, a functional enzyme involved in the targeted auxotrophy (i.e. ODCase).
  • ODCase a functional enzyme involved in the targeted auxotrophy
  • the prototrophic cell activity(H-) cell
  • the prototrophic cell will become auxotrophic through the "knock-out" of a functional enzymatic encoding gene involved in the targeted prototrophic pathway (i.e. an activity(-) cell).
  • This alteration can be done by altering the cell's genomic coding sequence(s) of the gene(s) encoding the selected activty(ies).
  • the coding sequence alteration(s) will be accomplished by introducing: insertion or deletion mutation(s) that change the coding sequence reading frame(s); substitution or inversion mutations that alter a sufficient number of codons; and/or deletion mutations that delete a sufficiently large group of contiguous codons there from capable of producing a non-functional enzyme.
  • the host cell strain has also provided the auxotrophic gene(s) for use as selection marker(s) therein
  • each of the selected gene's transcription promoter and/or transcription terminator element(s) can also be inactivated by introduction of mutation(s), including deletion mutations.
  • the transcription element inactivation can be optionally performed in addition to the coding sequence alteration(s) described above.
  • all of the selected gene(s)'s DNA can be deleted from the host cell genome.
  • knock-out strains can be prepared according to any of the various methods known in the art as effective. For example, homologous recombination vectors containing homologous targeted gene sequences 5' and 3' of the desired nucleic acid deletion sequence can be transformed into the host cell. Ideally, upon homologous recombination, a desired targeted enzymatic gene knock-out can be produced.
  • gene knock-out methodologies include, for example: Gene inactivation by insertion of a polynucleotide has been previously described.
  • transposon mutagenesis and selection for desired phenotype can be used to isolate bacterial strains in which target genes have been insertionally inactivated. See, e.g., K Nida & PP Cleary, Insertional inactivation of streptolysin S expression in Streptococcus pyogenes, J Bacteriol.
  • both the organism from which the selection marker gene(s) is obtained and the host cell in which a selection marker gene(s) is utilized can be selected from a bacteria.
  • both the bacteria from which the selection marker gene(s) is obtained and the bacterial host cell in which a selection marker gene(s) is utilized will be selected from the Proteobacteria.
  • both the bacteria from which the selection marker gene(s) is obtained and the bacterial host cells in which a selection marker gene(s) is utilized can be selected from the Pseudomonads and closely related bacteria or from a Subgroup thereof, as defined below.
  • both the selection marker gene(s) source organism and the host cell can be selected from the same species.
  • both the selection marker gene(s) source organism and the host cell can be selected from the same species in a genus selected from the Pseudomonads and closely related bacteria or from a Subgroup thereof, as defined below.
  • both the selection marker gene(s) source organism and the host cell can be selected from a species of the genus Pseudomonas, particularly the species Pseudomonas fluorescens, and preferably the species Pseudomonas fluorescens biotype A.
  • the present invention provides Pseudomonads and related cells that have been genetically modified to contain a chromosomally insert lad transgene or derivative, other than as part of a whole or truncated Vlacl-lad-lacZYA operon.
  • the la insert provides stringent expression vector control through the expression of the LacI repressor protein which binds to the lacO sequence or derivative on the vector, and inhibits a Plac-Ptac family promoter on the vector. The result is reduced basal levels of recombinant polypeptide expression prior to induction.
  • Pseudomonad host cells containing a chromosomal insertion of a native E.coli lad gene, or lad gene derivative such as lacfi or lacfi 1 are provided wherein the l ⁇ cl insert is other than part of a whole or truncated, structural gene-containing PlacI-t ⁇ cZ- lacZYA construct.
  • Other derivative lad transgenes useful in the present invention include: lad derivatives that have altered codon sequences different from a native lad gene (for example, the native E.
  • coli lad gene contains a 'gtg' initiation codon, and this may be replaced by an alternative initiation codon effective for translation initiation in the selected expression host cell, e.g., 'atg'); lad derivatives that encode LacI proteins having mutated amino acid sequences, including temperature-sensitive lad mutants, such as that encoded by lacf 5 (or "lad(Ts)"), which respond to a shift in temperature in order to achieve target gene induction, e.g., a shift up to 42° C (see, e.g., Bukrinsky et al, Gene 70:415-17 (1989); N Hasan & W Szybalski, Gene 163(l):35-40 (1995); H Adari et al, DNA Cell Biol.
  • LacI mutants that respond to the presence of alternative sugars other than lactose in order to achieve induction, e.g., arabinose, ribose, or galactose (see, e.g., WO 99/27108 for Lac Repressor Proteins with Altered Responsivity); and LacI mutants that exhibit at least wild-type binding to lac operators, but enhanced sensitivity to an inducer (e.g., IPTG), or that exhibit enhanced binding to lac operators, but at least wild-type de-repressibility (see, e.g., L Swint-Kruse et al, Biochemistry 42(47): 14004-16 (2003)).
  • the gene encoding the Lac repressor protein inserted into the chromosome is identical to that of native E. coli lad gene, and has the nucleic acid sequence of SEQ ID NO. 9 (Table 10).
  • the gene inserted into the host chromosome encodes the Lac repressor protein having the amino acid sequence of SEQ ID NO. 10 (Table 11).
  • the inserted lad transgene is a derivative of the native E.coli lad gene.
  • the lad derivative gene is the lacfi gene having the nucleic acid sequence of SEQ ID NO. 11 (Table 12).
  • the lacfi variant is identical to the native E.coli lad gene except that it has a single point mutation in the -35 region of the promoter which increases the level of lad repressor by 10-fold in E.coli. See, for example, MP Calos, Nature 274 (5673): 762-65 (1978).
  • the lacfi 1 variant has a rearrangement which substitutes a -35 region whose nucleotide sequence exactly matches that of the E.coli - 35 region consensus sequence, resulting in expression that is 100-fold higher than the native promoter in E. coli. See, for example, MP Colas & JH Miller, Mol. & Gen. Genet. 183(3): 559-60(1980).
  • the host cell chromosome can be modified by insertion of at least one nucleic acid sequence containing at least one copy of a gene encoding a LacI protein, the gene being capable of use by the cell to, preferably, constitutively express the encoded LacI protein, and the polynucleotide containing the gene being other than a Vlacl-lacI-lacZYA nucleic acid sequence (i.e. a Plac(-) version of the PlacI-/ c/-/ ⁇ cZK4 operon) or a Placl-/ ⁇ c/- lacZ polynucleotide (i.e.
  • a structural lac utilization operon gene-containing portion of such a Plac(-) operon such as an at least partially truncated version of a Vlac ⁇ -lad-lacZYA nucleic acid sequence.
  • the gene encoding the chosen LacI protein is preferably constitutively expressed. This may be accomplished by use of any promoter that is constitutively expressed in the selected expression host cell. For example, a native E. coli Placl may be operably attached to the selected LacI coding sequence, or a different constitutively expressed promoter may be operably attached thereto. In some cases, a regulated promoter may be used, provided that the regulated promoter is maintained throughout fermentation in a state wherein the LacI protein is continually expressed there from.
  • a lac or tac family promoter is utilized in the present invention, including Plac, Ptac, Ptrc, PtacII, PlacUV5, lpp-PlacUV5, lpp-lac, nprM-lac, T71ac, T51ac, T31ac, and Pmac.
  • Chromosomal insertion may be performed according to any technique known in the art. For example, see: DS Toder, “Gene replacement in Pseudomonas aeruginosa,” Methods in Enzymology 235:466-74 (1994); and J Stant & MF Hynes, “Versatile suicide vectors which allow direct selection for gene replacement in Gram negative bacteria,” Gene 127(1): 15-21 (1993). Transposon-type insertion techniques such as are known in the art, followed by selection, may also be used; see, e.g., IY Goryshin & WS Reznikoff, "Tn5 in vitro transposition," Journal of Biological Chemistry 21?>( ⁇ ):1361-l (1998).
  • gene transfection by (non-lytic) phage transduction may also be used for chromosomal insertion; see, e.g., JH Miller, Experiments in Molecular Genetics (1972) (Cold Spring Harbor Lab., NY).
  • Sites within the bacterial expression host cell chromosome that are useful places in which to insert the lad gene(s), or derivative thereof, include any location that is are not required for cell function under the fermentation conditions used, for example within any gene whose presence, transcription, or expression is important for the healthy functioning of the cell under the fermentation conditions used.
  • sucrose import and metabolism genes e.g., sacB
  • fructose import and catabolism genes e.g., fructokinase genes, 1-phosphofructokinase genes
  • aromatic carbon source import and utilization genes e.g., anthranilate operon genes, such as antABC genes, benzoate operon genes, as benABCD genes
  • beta-lactamase genes e.g., ampC, bill, blc genes, bio genes, blp genes
  • alkaline phosphatase genes e.g., phoA
  • nucleobase or nucleotide biosynthetic genes e.g.,pyrBCDEF genes
  • amino acid biosynthetic genes e.g., proABC genes
  • aspartate semi-aldehyde dehydrogenase genes e.g., asd
  • 3- isopropylmalate dehydrogenase genes e.
  • the host cell will be grown in media supplying an effective replacement metabolite to the cell to overcome (and avoid) the lethal effect, or a replacement gene will be provided in the host cell that expresses a biocatalyst effective to restore the corresponding prototrophy, e.g., as a selection marker gene.
  • the gene or genes selected for deletion or inactivation (i.e. "knock-out") in constructing a metabolic auxotroph can be any gene encoding an enzyme that is operative in a metabolic pathway.
  • the enzyme can be one that is involved in the anabolic biosynthesis of molecules that are necessary for cell survival.
  • the enzyme can be one that is involved in the catabolic utilization of molecules that are necessary for cell survival.
  • all operative genes encoding a given biocatalytic activity are deleted or inactivated in order to ensure removal of the targeted enzymatic activity from the host cell in constructing the auxotrophic host cell.
  • the host cell can exhibit a pre-existing auxotrophy (i.e. native auxotrophy), wherein no further genetic modification via deletion or inactivation (knock-out) need be performed.
  • an amino acid biosynthetic gene e.g., aproA,proB, o ⁇ proC gene
  • a nucleobase or nucleotide biosynthetic gene e.g., pyrB, pyrC, pyrD, pyrE, or pyrF
  • a necessary biosynthetic activity is normally disrupted, thus producing an auxotrophy.
  • the medium is supplemented to avoid metabolic reliance on the biosynthetic pathway, as with a proline or uracil supplement; or 2) the auxotrophic host cell is transformed with a further gene that is expressed and thus replaces the biocatalyst(s) missing from the biosynthetic pathway, thereby restoring prototrophy to the cell, as with a metabolic selection marker gene such as proC, pyrF, or thyA.
  • a metabolic selection marker gene such as proC, pyrF, or thyA.
  • the l ⁇ cl transgene, or variant thereof is inserted into a cell that is concomitantly or subsequently auxotrophically induced through the knock- out of a gene, or combination of genes, selected from the group consisting of pyrF, thyA, and proC.
  • a native E.coli l ⁇ cl, l ⁇ cfi, or l ⁇ cfi 1 transgene is inserted into a cell that is concomitantly or subsequently rendered auxotrophic through the knock-out of pyrF.
  • a native E.coli l ⁇ cl, l ⁇ cfi, or l ⁇ cfi 1 transgene is inserted into a cell that is concomitantly of subsequently rendered auxotrophic through the knock-out of proC.
  • a native E.coli l ⁇ cl, l ⁇ cfi, or l ⁇ cfi 1 transgene is inserted into a cell that is concomitantly or subsequently rendered auxotrophic through the knock-out of pyrF and proC.
  • a native E.coli l ⁇ cl, l ⁇ cfi, or l ⁇ cfi 1 transgene, or derivative thereof can be inserted into the Levansucrase locus of the host cell.
  • a native E.coli lad, lacfi, or lacfi 1 transgene, or derivative thereof can be inserted in the Levansucrase gene locus of Pseudomonas fluorescens.
  • a native E.coli lad, lacfi, or lacfi transgene, or derivative thereof can be inserted into the Levansucrase gene locus of Pseudomonas fluorescens having the nucleic acid sequence of SEQ ID. NO. 13 (Table 14).
  • LACO SEQUENCES Attempts to repress the leakiness of a promoter must be balanced by the potential concomitant reduction in target recombinant polypeptide expression.
  • One approach to further repress a promoter and reduce the leakiness of the promoters is to modify regulatory elements known as operator sequences, to increase the capacity of the associated repressor protein to bind to the operator sequence without reducing the potential expression of the target recombinant polypeptide upon induction. It has been discovered that the use of a dual lac operator in Pseudomonas fluorescens offers superior repression of pre-induction recombinant protein expression without concomitant reductions in induced protein yields.
  • a Pseudomonad organism comprising a nucleic acid construct containing a nucleic acid comprising at least one lacO sequence involved in the repression of transgene expression.
  • the Pseudomonad host cell is Pseudomonad fluorescens .
  • the nucleic acid construct comprises more than one lacO sequence.
  • the nucleic acid construct comprises at least one, and preferably more than one, lacOid sequence.
  • the nucleic acid construct comprises a lacO sequence, or derivative thereof, located 3' of a promoter, and a lacO sequence, or derivative thereof, located 5' of a promoter.
  • the lacO derivative is a lacOid sequence.
  • nucleic acid constructs comprising more than one lac operator sequence, or derivative thereof for use in a Pseudomonad host cell is provided.
  • at least one lac operator sequence may be a lacOi d sequence.
  • the native E.coli lac operator acts to down regulate expression of the lac operon in the absence of an inducer.
  • the lac operator is bound by the LacI repressor protein, inhibiting transcription of the operon. It has been determined that the LacI protein can bind simultaneously to two lac operators on the same DNA molecule. See, for example,
  • the lacO sequence or derivative can be positioned in the E. coli native Oi position with respect to a promoter. Alternatively, the lacO sequence or derivative can be positioned in the E.coli O 3 position with respect to a promoter. In another embodiment, the lacO sequence or derivative can be located in the E.coli native ⁇ ! position, the native O 3 position, or both with respect to a promoter. In one embodiment, the nucleic acid construct contains at least one lacOid sequence either 5' to the promoter sequence or 3' to the promoter sequence.
  • the nucleic acid construct contains a lacOid sequence 3' of a promoter, and at least one lacO sequence, or derivative, 5' of a promoter.
  • the nucleic acid construct contains a lacOid sequence 5' of a promoter, and at least one lacO sequence, or derivative, 3' of a promoter.
  • the nucleic acid construct contains a lacOid sequence both 5' and 3' of a promoter.
  • the lacO sequence is lacOid represented by SEQ ID NO. 14, or a sequence substantially homologous.
  • a lacOid sequence of SEQ. ID. NO. 59, or a sequence substantially homologous to SEQ ID NO. 59 is employed.
  • nucleic acid sequences are provided for use in the improved production of proteins.
  • nucleic acid sequences encoding prototrophy-restoring enzymes for use in an auxotrophic Pseudomonad host cells are provided.
  • nucleic acid sequences encoding nitrogenous base compound biosynthesis enzymes purified from the organism Pseudomonas fluorescens are provided.
  • nucleic acid sequences encoding the pyrF gene in Pseudomonas fluorescens is provided (SEQ. ID No.s 1 and 3).
  • nucleic acid sequence encoding the thyA gene in Pseudomonas fluorescens is provided (SEQ. ID. No. 4).
  • nucleic acid sequences encoding an amino acid biosynthetic compound purified from the organism Pseudomonas fluorescens axe provided.
  • a nucleic acid sequence encoding the ⁇ r ⁇ gene in Pseudomonas fluorescens is provided (SEQ. ID No.s 6 and 8).
  • the present invention provides novel amino acid sequences for use in the improved production of proteins.
  • amino acid sequences of nitrogenous base compound biosynthesis enzymes purified from the organism Pseudomonas fluorescens are provided.
  • the amino acid sequence containing SEQ. ID No. 2 is provided.
  • an amino acid sequence containing SEQ. ID. No. 5 is provided.
  • amino acid sequences of an amino acid biosynthetic compound purified from the organism Pseudomonas fluorescens is provided.
  • an amino acid sequence containing SEQ. ID No. 7 is provided.
  • One embodiment of the present invention is novel isolated nucleic acid sequences of the Pseudomonas fluorescens pyrF gene (Table 2, Seq. ID No. 1; Table 4, Seq.
  • Another aspect of the present invention provides isolated peptide sequences of the Pseudomonas fluorescens pyrF gene (Table 3, Seq. ID No. 2). Nucleic and amino acid sequences containing at least 90, 95, 98 or 99% homologous to Seq. ID Nos. 1, 2, or 3 are provided. In addition, nucleotide and peptide sequences that contain at least 10, 15, 17, 20 or 25, 30, 40, 50, 75, 100, 150, 250, 350, 500, or 1000 contiguous nucleic or amino acids of Seq ID Nos 1, 2, or 3 are also provided. Further provided are fragments, derivatives and analogs of Seq. ID Nos. 1, 2, or 3. Fragments of Seq. ID Nos.
  • 1, 2, or 3 can include any contiguous nucleic acid or peptide sequence that includes at least about 10 bp, 15 bp, 17 bp, 20 bp, 50 bp, 100 bp, 500 bp, 1 kbp, 5 kbp or 10 kpb.
  • Another embodiment of the present invention is novel isolated nucleic acid sequences of the Pseudomonas fluorescens thyA gene (Table 5, Seq. ID No. 4).
  • Another aspect of the present invention provides isolated peptide sequences of the Pseudomonas fluorescens thyA gene (Table 6, Seq. ID No. 5).
  • Nucleic and amino acid sequences containing at least 90, 95, 98 or 99% homologous to Seq. ID Nos. 4 or 5 are provided.
  • nucleotide and peptide sequences that contain at least 10, 15, 17, 20 or 25, 30, 40, 50, 75, 100, 150, 250, 350, 500, or 1000 contiguous nucleic or amino acids of Seq ID Nos 4 or 5 are also provided.
  • 4 or 5 can include any contiguous nucleic acid or peptide sequence that includes at least about 10 bp, 15 bp, 17 bp, 20 bp, 50 bp, 100 bp, 500 bp, 1 kbp, 5 kbp or 10 kpb.
  • Another embodiment of the present invention is novel isolated nucleic acid sequences of the Pseudomonas fluorescens proC gene (Table 7, Seq. ID No. 6; Table 9, Seq. ID. No. 8).
  • Another aspect of the present invention provides isolated peptide sequences of the Pseudomonas fluorescens proC gene (Table 8, Seq. ID No. 7).
  • Nucleic and amino acid sequences containing at least 90, 95, 98 or 99% homologous to Seq. ID Nos. 6, 7, or 8 are provided.
  • nucleotide and peptide sequences that contain at least 10, 15, 17, 20 or 25, 30, 40, 50, 75, 100, 150, 250, 350, 500, or 1000 contiguous nucleic or amino acids of Seq ID Nos 6, 7, or 8 are also provided. Further provided are fragments, derivatives and analogs of Seq. ID Nos. 6, 7, or 8. Fragments of Seq. ID Nos.
  • 6, 7, or 8 can include any contiguous nucleic acid or peptide sequence that includes at least about 10 bp, 15 bp, 17 bp, 20 bp, 50 bp, 100 bp, 500 bp, 1 kbp, 5 kbp or 10 kpb.
  • Sequence Homology Sequence homology is determined according to any of various methods well known in the art. Examples of useful sequence alignment and homology determination methodologies include those described below. Alignments and searches for homologous sequences can be performed using the U.S.
  • NCBI National Center for Biotechnology Information
  • MegaBLAST (currently available at http://www.ncbi.nlm.nih.gov/BLAST/).
  • Use of this program with options for percent identity set at 70% for amino acid sequences, or set at 90% for nucleotide sequences, will identify those sequences with 70%, or 90%, or greater homology to the query sequence.
  • Other software known in the art is also available for aligning and/or searching for homologous sequences, e.g., sequences at least 70% or 90% homologous to an information string containing a promoter base sequence or activator-protein-encoding base sequence according to the present invention.
  • sequence alignments for comparison to identify sequences at least 70% or 90% homologous to a query sequence can be performed by use of, e.g, the GAP, BESTFIT, BLAST, FASTA, and TFASTA programs available in the GCG Sequence Analysis Software Package (available from the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705), with the default parameters as specified therein, plus a parameter for the extent of homology set at 70% or 90%.
  • the CLUSTAL program available in the PC/Gene software package from Intelhgenetics, Mountain View, Cal. may be used.
  • sequence alignment methods are well known in the art and may be conducted by manual alignment, by visual inspection, or by manual or automatic application of a sequence alignment algorithm, such as any of those embodied by the above-described programs.
  • Various useful algorithms include, e.g.: the similarity search method described in W.R. Pearson & DJ. Lipman, Proc. Nat'l Acad. Sci. USA 85:2444-48 (Apr 1988); the local homology method described in T.F. Smith & M.S. Waterman, in Adv. Appl. Math. 2:482-89 (1981) and in J. Molec. Biol. 147:195-97 (1981); the homology alignment method described in S.B. Needleman & CD. Wunsch, J.
  • nucleic acid constructs are provided for use in the improved production of peptides .
  • a nucleic acid construct for use in transforming a Pseudomonad host cell comprising a) a nucleic acid sequence encoding a recombinant polypeptide, and b) a nucleic acid sequence encoding a prototrophy-enabling enzyme is provided.
  • the nucleic acid construct further comprises c) a Plac-Ptac family promoter.
  • nucleic acid construct further comprises d) at least one lacO sequence, or derivative, 3' of a lac or tac family promoter.
  • the nucleic acid construct further comprises e) at least one lacO sequence, or derivative, 5' of a lac or tac family promoter.
  • the derivative lacO sequence can be a lacOid sequence.
  • the Pseudomonad organism is Pseudomonas fluorescens.
  • nucleic acid constructs for use as expression vectors in Pseudomonad organisms comprising a) a nucleic acid sequence encoding a recombinant polypeptide, b) a Plac-Ptac family promoter, c) at least one lacO sequence, or derivative, 3' of a lac or tac family promoter, d) at least one lacO sequence, or derivative, 5' of a lac or tac family promoter.
  • the derivative lacO sequence can be a lacOid sequence.
  • the nucleic acid construct further comprises e) a prototrophy-enabling selection marker for use in an auxotrophic Pseudomonad cell.
  • the Pseudomonad organism is Pseudomonas fluorescens.
  • a nucleic acid construct comprising nucleic acids that encode at least one biosynthetic enzyme capable of transforming an auxotrophic host cell to prototrophy.
  • the biosynthetic enzyme can be any enzyme capable of allowing an auxotrophic host cell to survive on a selection medium that, without the expression of the biosynthetic enzyme, the host cell would be incapable of survival due to the auxotrophic metabolic deficiency.
  • the biosynthetic enzyme can be an enzyme that complements the metabolic deficiency of the auxotrophic host by restoring prototrophic ability to grow on non-auxotrophic metabolite supplemented media.
  • the present invention provides a nucleic acid construct that encodes a functional orotodine-5 '-phosphate decarboxylase enzyme that complements an pyrF(-) auxotrophic host.
  • the nucleic acid construct contains the nucleic acid sequence of SEQ ID NO. 1 or 3.
  • the nucleic acid construct contains a nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO. 2.
  • the present invention provides a nucleic acid construct that encodes a functional thymidylate synthase enzyme that complements a thyA (-) auxotrophic host.
  • the nucleic acid construct contains the nucleic acid sequence of SEQ ID NO. 4.
  • the nucleic acid construct contains a nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO. 5.
  • the present invention provides a nucleic acid construct that encodes a functional ⁇ pyrroline-S-carboxylate reductase enzyme that complements a proC (-) auxotrophic host.
  • the nucleic acid construct contains the nucleic acid sequence of SEQ ID NO. 6 or 8. In an alternative embodiment, the nucleic acid construct contains the nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO. 7. In an alternative embodiment, the present invention provides a nucleic acid construct that encodes at least one biosynthetic enzyme capable of transforming an auxotrophic host cell to prototrophy and an additional non-auxotrophic selection marker.
  • non- auxotrophic selection markers are well known in the art, and can include markers that give rise to colorimetric/chromogenic or a luminescent reaction such as lacZ gene, the GUS gene, the CAT gene, the XuxAB gene, antibiotic resistance selection markers such as amphotericin B, bacitracin, carbapenem, cephalosporin, ethambutol, fluoroquinolones, isonizid, cephalosporin, mefhicillin, oxacillin, vanomycin, streptomycin, quinolines, rifampin, rifampicin, sulfonamides, ampicillin, tetracycline, neomycin, cephalothin, eiythromycin, streptomycin, kanamycin, gentamycin, penicillin, and chloramphenicol resistance genes, or other commonly used non-auxotrophic selection markers.
  • antibiotic resistance selection markers such as amphotericin B, bacitracin, carba
  • the expression vector can comprise more than one biosynthetic enzyme capable of transforming an auxotrophic host cell to prototrophy.
  • the biosynthetic enzymes can be any enzymes capable of allowing an auxotrophic host cell to survive on a selection medium that, without the expression of the biosynthetic enzyme, the host cell would be incapable of survival due to the auxotrophic metabolic deficiency.
  • the biosynthetic enzymes can be enzymes that complement the metabolic deficiencies of the auxotrophic host by restoring prototrophic ability to grow on non-auxotrophic metabolite supplemented media.
  • an expression vector comprise a first and second prototrophy-enabling selection marker gene, allowing the host cell containing the construct to be maintained under either or both of the conditions in which host cell survival requires the presence of the selection marker gene(s).
  • the corresponding marker gene When only one of the marker-gene dependent survival conditions is present, the corresponding marker gene must be expressed, and the other marker gene(s) may then be either active or inactive, though all necessary nutrients for which the cell remains auxotrophic will still be supplied by the medium.
  • the nucleic acid vector comprises a nucleic acid construct that encodes a functional orotodine-5 '-phosphate decarboxylase enzyme and a functional ⁇ 1 - pyrroline-5-carboxylate reductase enzyme that can complement a pyrF(-) auxotrophic host cell, a proC(-) auxotrophic host cell, or a pyrF(-)lproC(-) dual-auxotrophic host cell.
  • the nucleic acid construct comprises the nucleic acid sequences of SEQ ID NO. 1 or 3, and SEQ ID.
  • the nucleic acid construct contains a nucleic acid sequence that encodes the amino acid sequences of SEQ ID NO. 2 and 7.
  • the nucleic acid vector comprises a nucleic acid construct that encodes a functional orotodine-5 '-phosphate decarboxylase enzyme and a functional thymidylate synthase enzyme that can complement a pyrF(-) auxotrophic host cell, a thyA(-) auxotrophic host cell, or apyrF(-)lthyA(-) dual-auxotiophic host cell.
  • the nucleic acid construct comprises the nucleic acid sequences of SEQ ID NO.
  • the nucleic acid construct contains a nucleic acid sequence that encodes the amino acid sequences of SEQ ID NO. 2 and 5.
  • the nucleic acid vector comprises a nucleic acid construct that encodes a functional ⁇ pyrroline-S-carboxylate reductase enzyme and a thymidylate synthase enzyme that can complement aproC(-) auxotrophic host cell, a thyA(-) auxotrophic host cell, or a proC(-)lthyA(-) dual-auxotiophic host cell.
  • the nucleic acid construct comprises the nucleic acid sequences of SEQ ID NO. 4, and SEQ ID. NO. 6 or 8.
  • the nucleic acid construct contains a nucleic acid sequence that encodes the amino acid sequences of SEQ ID NO. 5 and 7.
  • Promoters In a fermentation process, once expression of the target recombinant polypeptide is induced, it is ideal to have a high level of production in order to maximize efficiency of the expression system.
  • the promoter initiates transcription and is generally positioned 10-100 nucleotides upstream of the ribosome binding site. Ideally, a promoter will be strong enough to allow for recombinant polypeptide accumulation of around 50% of the total cellular protein of the host cell, subject to tight regulation, and easily (and inexpensively) induced.
  • the promoters used in accordance with the present invention may be constitutive promoters or regulated promoters.
  • Examples of commonly used inducible promoters and their subsequent inducers include lac (IPTG), lacUV5 (IPTG), tac (IPTG), trc (IPTG), P syn (IPTG), tip (tryptophan starvation), araBAD (1-arabinose), lpp a (IPTG), lpp-lac (IPTG), phoA (phosphate starvation), recA (nalidixic acid), proU (osmolarity), cst-1 (glucose starvation), tetA (tretracylin), cadA (pH), nar (anaerobic conditions), PL (thermal shift to 42° C), cspA (thermal shift to 20° C), T7 (thermal induction), T7-lac operator (IPTG), T3-lac operator (IPTG), T5-lac operator (IPTG), T4 gene32 (T4 infection), nprM-lac operator (IPTG), Pm (alkyl- or halo-benzo
  • a promoter having the nucleotide sequence of a promoter native to the selected bacterial host cell can also be used to control expression of the transgene encoding the target polypeptide, e.g, a Pseudomonas anthranilate or benzoate operon promoter (Pant, Pben).
  • Tandem promoters may also be used in which more than one promoter is covalently attached to another, whether the same or different in sequence, e.g., a Pant-Pben tandem promoter (interpromoter hybrid) or a Plac-Plac tandem promoter.
  • Regulated promoters utilize promoter regulatory proteins in order to control transcription of the gene of which the promoter is a part. Where a regulated promoter is used herein, a corresponding promoter regulatory protein will also be part of an expression system according to the present invention. Examples of promoter regulatory proteins include: activator proteins, e.g., E. coli catabolite activator protein, MalT protein; AraC family transcriptional activators ; repressor proteins, e.g., E.
  • Promoter regulatory proteins interact with an effector compound, i.e. a compound that reversibly or irreversibly associates with the regulatory protein so as to enable the protein to either release or bind to at least one DNA transcription regulatory region of the gene that is under the control of the promoter, thereby permitting or blocking the action of a transcriptase enzyme in initiating transcription of the gene.
  • Effector compounds are classified as either inducers or co-repressors, and these compounds include native effector compounds and gratuitous inducer compounds.
  • regulated-promoter/promoter-regulatory- protein effector-compound trios are known in the art.
  • an effector compound can be used throughout the cell culture or fermentation, in a particular embodiment in which a regulated promoter is used, after growth of a desired quantity or density of host cell biomass, an appropriate effector compound is added to the culture in order to directly or indirectly result in expression of the desired target gene(s).
  • a lac family promoter is utilized, a la gene, or derivative thereof such as a lacfi or lacfi 1 gene, can also be present in the system.
  • the lad gene which is (normally) a constitutively expressed gene, encodes the Lac repressor protein (LacI protein) which binds to the lac operator of these promoters.
  • the la gene can also be included and expressed in the expression system.
  • the effector compound is an inducer, preferably a gratuitous inducer such as IPTG (isopropyl- ⁇ -D-1- thiogalactopyranoside, also called “isopropylfhiogalactoside").
  • a lac or tac family promoter is utilized in the present invention, including Plac, Ptac, Ptrc, Ptac ⁇ , PlacUV5, lpp-PlacUV5, lpp-lac, nprM-lac, T71ac, T51ac, T31ac, and Pmac.
  • regulatory elements can be included in an expression construct, including lacO sequences and derivatives, as discussed above.
  • Such elements include, but are not limited to, for example, transcriptional enhancer sequences, translational enhancer sequences, other promoters, activators, translational start and stop signals, transcription terminators, cistronic regulators, polycistronic regulators, tag sequences, such as nucleotide sequence "tags" and "tag" peptide coding sequences, which facilitates identification, separation, purification, or isolation of an expressed polypeptide, including His-tag, Flag-tag, T7-tag, S-tag, HSV-tag, B- tag, Strep-tag, polyarginine, polycysteine, polyphenylalanine, polyaspartic acid, (Ala-Trp- Trp-Pro)n, thioredoxin, beta-galactosidase, chloramphenicol acetyltransferase, cyclomaltodextrin gluconotrans
  • a protein-encoding gene according to the present invention can include, in addition to the protein coding sequence, the following regulatory elements operably linked thereto: a promoter, a ribosome binding site (RBS), a transcription terminator, translational start and stop signals.
  • Useful RBSs can be obtained from any of the species useful as host cells in expression systems according to the present invention, preferably from the selected host cell. Many specific and a variety of consensus RBSs are known, e.g., those described in and referenced by D. Frishman et al., Starts of bacterial genes: estimating the reliability of computer predictions, Gene 234(2):257-65 (8 Jul 1999); and B.E.
  • RBSs nitrile hydratase deduced from the nucleotide sequence of a Rhodococcus species and its expression in Escherichia coli, Eur. J. Biochem. 181(3):563-70 (1989) (native RBS sequence of AAGGAAG).
  • Vectors Transcription of the DNA encoding the enzymes of the present invention by a Pseudomonad host can further be increased by inserting an enhancer sequence into the vector or plasmid.
  • enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp in size that act on the promoter to increase its transcription.
  • the recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the Pseudomonad host cell, e.g., the prototrophy restoring genes of the present invention, and a promoter derived from a highly- expressed gene to direct transcription of a downstream structural sequence. Such promoters have been described above.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and in certain embodiments, a leader sequence capable of directing secretion of the translated polypeptide.
  • the heterologous sequence can encode a fusion polypeptide including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for use with P. fluorescens in expressing enzymes are constructed by inserting a structural DNA sequence encoding a desired target polypeptide together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable hosts for transformation in accordance with the present disclosure include various species within the genera Pseudomonas, and particularly particular is the host cell strain of Pseudomonas fluorescens.
  • Vectors are known in the art as useful for expressing recombinant proteins in host cells, and any of these may be modified and used for expressing the genes according to the present invention.
  • Such vectors include, e.g., plasmids, cosmids, and phage expression vectors.
  • Examples of useful plasmid vectors that can be modified for use on the present invention include, but are not limited to, the expression plasmids pBBRlMCS, pDSK519, ⁇ KT240, pML122, pPSlO, RK2, RK6, pRO1600, and RSF1010.
  • Further examples can include pALTER-Exl, pALTER-Ex2, pBAD/His, pBAD/Myc-His, pBAD/glll, pCal-n, pCal- n-EK, pCal-c, pCal-Kc, pcDNA 2.1, pDUAL, pET-3a-c, pET 9a-d, pET-l la-d, pET-12a-c, pET-14b, pET15b, pET-16b, pET-17b, pET-19b, pET-20b(+), pET-21a-d(+), pET-22b(+), pET-23a-d(+), pET24a-d(+), pET-25b(+), pET-26b(+), pET-27b(+), pET28a-c(+), pET-29a- c(+), pET-30a-c(
  • RSF1010 The expression plasmid, RSF1010, is described, e.g., by F. Heffron et al., in Proc.
  • Plasmid RSF1010 and derivatives thereof are particularly useful vectors in the present invention.
  • Exemplary, useful derivatives of RSF1010 which are known in the art, include, e.g., pKT212, pKT214, pKT231 and related plasmids, and pMYC1050 and related plasmids (see, e.g., US Patent Nos. 5,527,883 and 5,840,554 to
  • Plasmid pMYC1803 is derived from the
  • RSFlOlO-based plasmid pTJS260 (see US Patent No. 5,169,760 to Wilcox), which carries a regulated tetracycline resistance marker and the replication and mobilization loci from the
  • RSF1010 plasmid RSF1010 plasmid.
  • Other exemplary useful vectors include those described in US Patent No.
  • an expression plasmid is used as the expression vector.
  • RSF1010 or a derivative thereof is used as the expression vector.
  • pMYC1050 or a derivative thereof, or pMYC1803 or a derivative thereof is used as the expression vector.
  • the process provides expression of a nucleic acid construct comprising nucleic acids encoding a) a recombinant polypeptide, and b) a prototrophy- restoring enzyme in a Pseudomonad that is auxotrophic for at least one metabolite.
  • the Pseudomonad is auxotrophic for more than one metabolite.
  • the Pseudomonad is a Pseudomonas fluorescens cell.
  • a recombinant polypeptide is expressed in a Pseudomonad that is auxotrophic for a metabolite, or combination of metabolites, selected from the group consisting of a nitrogenous base compound and an amino acid.
  • recombinant polypeptides are expressed in a Pseudomonad that is auxotrophic for a metabolite selected from the group consisting of uracil, proline, and thymidine.
  • the auxotrophy can be generated by the knock-out of the host pyrF, proC, or thyA gene, respectively.
  • recombinant polypeptides are expressed in an auxotrophic Pseudomonad cell that has been genetically modified through the insertion of a native E.coli lad gene, lacfi gene, or lacfi 1 gene, other than as part of the Placl-/ ⁇ c7- lacZYA operon, into the host cell's chromosome.
  • the vector containing the recombinant polypeptide expressed in the auxotrophic host cell comprises at least two lac operator sequences, or derivatives thereof.
  • the recombinant polypeptide is driven by a Plac family promoter.
  • the process involves the use of Pseudomonad host cells that have been genetically modified to provide at least one copy of a LacI encoding gene inserted into the Pseudomonad host cell's genome, wherein the lad encoding gene is other than as part of the PlacI-/ ⁇ c/-/ ⁇ cZZ4 operon.
  • the gene encoding the Lac repressor protein is identical to that of native E. coli lad gene.
  • the gene encoding the Lac repressor protein is the lacfi gene.
  • the gene encoding the Lac repressor protein is the lacfi 1 gene.
  • the Pseudomonad host cell is Pseudomonas fluorescens.
  • the Pseudomonad is further genetically modified to produce an auxotrophic cell.
  • the process produces recombinant polypeptide levels of at least about 3 g/L, 4 g/L, 5 g/L 6 g/L, 7 g/L, 8 g/L, 9 g/L or at least about 10 g/L.
  • the recombinant polypeptide is expressed in levels of between 3 g/L and 100 g/L.
  • the method generally includes: a) providing a Pseudomonad host cell, preferably a Pseudomonas fluorescens, as described in the present invention, b) transfecting the host cell with at least one nucleic acid expression vector comprising i) a target recombinant polypeptide of interest, and, in the case of the utilization of an auxotrophic host, ii) a gene encoding a prototrophy enabling enzyme that, when expressed, overcomes the auxotrophy of the host cell; c) growing the host cell in a growth medium that provides a selection pressure effective for maintaining the nucleic acid expression vector containing the recombinant polypeptide of interest in the host cell; and d) expressing the target recombinant polypeptide of interest.
  • the method can further comprise transfecting the host cell with at least once nucleic acid expression vector further comprising iii) a Plac family promoter, and optionally iv) more than one lac operator sequences.
  • at least one lac operator sequence may be a lacOi d sequence.
  • the expression system is capable of expressing the target polypeptide at a total productivity of polypeptide of at least 1 g/L to at least 80 g/L.
  • the recombinant polypeptide is expressed at a level of at least 3 g/L, 4g/L, 5g/L, 6 g/L, 7 g/L, 8 g/L, 9 g/L, 10 g/L, 12 g/L, 15 g/L, 20 g/L, 25 g/L, 30 g/L, 35 g/L, 40 g/L, 45 g/L, 50 g/L, 60 g/L, 70 g/L, or at least 80 g/L.
  • a lac or tac family promoter is utilized in the present invention, including Plac, Ptac, Ptrc, PtacII, PlacUV5, lpp-PlacUV5, lpp-lac, nprM-lac, T71ac, T51ac, T31ac, and Pmac.
  • at least one recombinant polypeptide can be expressed in a
  • Pseudomonad cell that is auxotrophic for one metabolite, wherein the auxotrophy serves as a selection marker for the maintenance of the nucleic acid expression vector encoding the polypeptide of interest and the prototrophy-enabling enzyme.
  • more than one recombinant polypeptide can be expressed in a Pseudomonad cell that is auxotrophic for one metabolite, wherein the nucleic acids encoding the recombinant polypeptides can be contained on the same vector, or alternatively, on multiple vectors.
  • more than one expression vector encoding different target polypeptides can be maintained in a Pseudomonad host cell auxotrophic for at least one metabolite, wherein one expression vector contains a nucleic acid encoding a prototrophic- enabling enzyme and a first target polypeptide of interest, and a second expression vector contains a nucleic acid encoding an alternative, non-auxotrophic selection marker and a second polypeptide of interest.
  • at least one recombinant polypeptide can be expressed in a Pseudomonad cell that is auxotrophic for more than one metabolite, wherein the multiple auxotrophies serve as selection markers for the maintenance of nucleic acid expression vectors.
  • an expression vector may be utilized in which a first and second prototrophy-enabling selection marker gene are present. If both marker genes are located on the same DNA construct, the host cell containing the construct may be maintained under either or both of the conditions in which host cell survival requires the presence of the selection marker gene(s). When only one of the marker-gene dependent survival conditions is present, the corresponding marker gene must be expressed, and the other marker gene(s) can then be either active or inactive, though all necessary nutrients for which the cell remains auxotrophic will still be supplied by the medium.
  • each of the two selection marker genes is located on a different DNA construct, then, in order to maintain both of the DNA constructs in the host cell, both of the marker-gene dependent survival conditions are present, and both of the corresponding marker gene must be expressed. This permits more than one non-covalently linked target gene or set of target gene(s) to be separately maintained in the host cell.
  • the coding sequence of each of the chosen selection marker genes independently can be operatively attached to either a constitutive or a regulated promoter.
  • Dual-target-gene examples of such a multi-target-gene system include, but are not limited to: (1) systems in which the expression product of one of the target genes interacts with the other target gene itself; (2) systems in which the expression product of one of the target genes interacts with the other target gene's expression product, e.g., a protein and its binding protein or the ⁇ - and ⁇ - polypeptides of an ⁇ n- ⁇ n protein; (3) systems in which the two expression products of the two genes both interact with a third component, e.g., a third component present in the host cell; (4) systems in which the two expression products of the two genes both participate in a common biocatalytic pathway; and (5) systems in which the two expression products of the two genes function independently of one another, e.g., a bi- clonal antibody expression system.
  • a first target gene can encode a desired target protein, wherein the first target gene is under the control of a regulated promoter; the second target gene may then encode a protein involved in regulating the promoter of the first target gene, e.g., the second target gene may encode the first target gene's promoter activator or repressor protein.
  • the second gene encodes a promoter regulatory protein for the first gene
  • the coding sequence of the second gene can be under the control of a constitutive promoter.
  • the second gene will be part of a separate DNA construct that is a maintained in the cell as a high-copy- number construct with a copy number of at least 10, 20, 30, 40, 50, or more than 50 copies being maintained in the host cell.
  • the present invention provides the use of more than one lacO sequence on an expression vector in the production of recombinant polypeptides in Pseudomonads, particularly in Pseudomonas fluorescens
  • the present invention provides a method of producing a recombinant polypeptide comprising transforming a bacterial host cell that is a member of the Pseudomonads and closely related bacteria having at least one chromosomally inserted copy of a Lac repressor protein encoding a lad transgene, or derivative thereof such as lacfi or lacfi 1 , which transgene is other than part of a whole or truncated structural gene containing PlacI-/ ⁇ ci-/ ⁇ c
  • the nucleic acid encoding at least one target recombinant polypeptide can be operably linked to a Plac family promoter, in which all of the Plac family promoters present in the host cell are regulated by Lac repressor proteins expressed solely from the lad transgene inserted in the chromosome.
  • the expression system is capable of expressing the target polypeptide at a total productivity of at least 3 g/L to at least 10 g/L.
  • the expression system is capable of expressing the target polypeptide at a total productivity of polypeptide of at least 3 g/L, 4g/L, 5g/L, 6 g/L, 7 g/L, 8 g/L, 9 g/L, or at least 10 g/L.
  • the present invention provides a method of expressing recombinant polypeptides in an expression system utilizing auxotrophic Pseudomonads or related bacteria that have been further genetically modified to provide at least one copy of a LacI encoding gene inserted into the cell's genome, other than as part of the Vlacl-lacl- lacZYA operon.
  • a recombinant polypeptide is expressed in an auxotrophic Pseudomonas fluorescens host cell containing a lad transgene insert.
  • a recombinant polypeptide is expressed in an auxotrophic Pseudomonas fluorescens host cell containing a lacfi transgene insert.
  • a recombinant polypeptide is expressed in an auxotrophic Pseudomonas fluorescens host cell containing a lacfi transgene insert.
  • the Pseudomonas fluorescens host can be auxotrophic for a biochemical required by the cell for survival.
  • the Pseudomonas fluorescens cell is auxotrophic for a nitrogenous base.
  • the Pseudomonas fluorescens is auxotrophic for a nitrogenous base selected from the group consisting of thymine and uracil.
  • the Pseudomonas fluorescens host cell's auxotrophy is induced by a genetic modification to a pyrF or thyA gene rendering the associated encoded product nonfunctional.
  • the Pseudomonas fluorescens cell is auxotrophic for an amino acid.
  • the Pseudomonas fluorescens is auxotrophic for the amino acid proline.
  • the Pseudomonas fluorescens host cell's auxotrophy is induced by a genetic modification to a proC gene rendering the associated encoded product non-functional.
  • Transformation Transformation of the Pseudomonad host cells with the vector(s) may be performed using any transformation methodology known in the art, and the bacterial host cells may be transformed as intact cells or as protoplasts (i.e. including cytoplasts).
  • Exemplary transformation methodologies include poration methodologies, e.g., electroporation, protoplast fusion, bacterial conjugation, and divalent cation treatment, e.g., calcium chloride treatment or CaCl/Mg2+ treatment, or other well known methods in the art. See, e.g., Morrison, J.
  • the selection marker can be an auxotrophic selection marker or a traditional antibiotic selection marker.
  • the auxotrophic cell can be grown on medium supplemented with all of those nutrient compounds until transformed with the prototrophy- restoring vector.
  • the prototrophy-restorative marker system(s) can be selected to restore one or more or all of the biosynthetic activities, with the remainder being compensated for by continuing to provide, in the medium, the still-lacking nutrients.
  • the plurality of selection marker genes may be expressed together on one vector or may be co- expressed separately on different vectors. Even where a single metabolite is the target of the selection marker system, multiple biosynthetic activities may be involved in the selection marker system. For example, two or more genes encoding activities from the same anabolic pathway may be expressed together on one vector or may be co-expressed separately on different vectors, in order to restore prototrophy in regard to biosynthesis of the compound that is the product of the pathway. Where the selection marker is an antibiotic resistance gene, the associated antibiotic can be added to the medium to select against non transformed and revertant cells, as well known in the art.
  • the term "fermentation” includes both embodiments in which literal fermentation is employed and embodiments in which other, non-fermentative culture modes are employed. Fermentation may be performed at any scale.
  • the fermentation medium may be selected from among rich media, minimal media, a mineral salts media; a rich medium may be used, but is preferably avoided.
  • a minimal medium or a mineral salts medium is selected.
  • a minimal medium is selected.
  • a mineral salts medium is selected. Mineral salts media are particularly particular.
  • the host cell Prior to transformation of the host cell with a nucleic acid construct encoding a prototrophic enabling enzyme, the host cell can be maintained in a media comprising a supplemental metabolite, or analogue thereof, that complements the auxotrophy. Following transformation, the host cell can be grown in a media that is lacking the complementary metabolite that the host cell is auxotrophic for. In this way, host cells that do not contain the selection marker enabling prototrophy are selected against. Likewise cells expressing recombinant proteins from expression vectors containing an antibiotic resistance selection marker gene can be maintained prior to transformation on a medium lacking the associated antibiotic used for selection.
  • Mineral salts media consists of mineral salts and a carbon source such as, e.g., glucose, sucrose, or glycerol.
  • Examples of mineral salts media include, e.g., M9 medium, Pseudomonas medium (ATCC 179), Davis and Mingioli medium (see, BD Davis & ES Mingioli, in J. Bact. 60:17-28 (1950)).
  • the mineral salts used to make mineral salts media include those selected from among, e.g., potassium phosphates, ammonium sulfate or chloride, magnesium sulfate or chloride, and trace minerals such as calcium chloride, borate, and sulfates of iron, copper, manganese, and zinc.
  • No organic nitrogen source such as peptone, tryptone, amino acids, or a yeast extract, is included in a mineral salts medium.
  • an inorganic nitrogen source is used and this may be selected from among, e.g., ammonium salts, aqueous ammonia, and gaseous ammonia.
  • a particular mineral salts medium will contain glucose as the carbon source.
  • minimal media can also contain mineral salts and a carbon source, but can be supplemented with, e.g., low levels of amino acids, vitamins, peptones, or other ingredients, though these are added at very minimal levels.
  • media can be prepared using the components listed in Table 16 below. The components can be added in the following order: first (NH 4 )HPO 4 , KH 2 PO 4 and citric acid can be dissolved in approximately 30 liters of distilled water; then a solution of trace elements can be added, followed by the addition of an antifoam agent, such as Ucolub N 115.
  • HCDC high cell density cultivation
  • the expression systems according to the present invention are useful for transgene expression at any scale (i.e. volume) of fermentation.
  • any scale i.e. volume
  • the fermentation volume will be at or above 1 Liter.
  • the fermentation volume will be at or above 5 Liters, 10 Liters, 15 Liters, 20 Liters, 25 Liters, 50 Liters, 75 Liters, 100 Liters, 200 Liters, 500 Liters, 1,000 Liters, 2,000 Liters, 5,000 Liters, 10,000Liters or 50,000 Liters.
  • growth, culturing, and/or fermentation of the transformed host cells is performed within a temperature range permitting survival of the host cells, preferably a temperature within the range of about 4°C to about 55°C, inclusive.
  • Pseudomonas fluorescens expressions systems according to the present invention can provide a cell density of about 20 g/L or more.
  • the Pseudomonas fluorescens expressions systems according to the present invention can likewise provide a cell density of at least about 70 g/L, as stated in terms of biomass per volume, the biomass being measured as dry cell weight. In one embodiment, the cell density will be at least 20 g/L.
  • the cell density will be at least 25 g/L, 30 g/L, 35 g/L, 40 g/L, 45 g/L, 50 g/L, 60 g/L, 70 g/L, 80 g/L, 90 g/L., 100 g/L, 110 g/L, 120 g/L, 130 g/L, 140 g/L, or at least 150 g/L.
  • the cell density at induction will be between 20 g/L and 150 g/L;, 20 g/L and 120 g/L; 20 g/L and 80 g/L; 25 g/L and 80 g/L; 30 g/L and 80 g/L; 35 g/L and 80 g/L; 40 g/L and 80 g/L; 45 g/L and 80 g/L; 50 g/L and 80 g/L; 50 g/L and 75 g/L; 50 g/L and 70 g/L; 40 g/L and 80 g/L.
  • the expression systems according to the present invention can express transgenic polypeptides at a level at between 5% and 80% total cell protein (%tcp). In one embodiment, the expression level will be at or above 5%, 8%, 10%, 12%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% tcp.
  • the recombinant proteins produced according to this invention may be isolated and purified to substantial purity by standard techniques well known in the art, including, but not limited to, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, nickel chromatography, hydroxylapatite chromatography, reverse phase chromatography, lectin chromatography, preparative electrophoresis, detergent solubilization, selective precipitation with such substances as column chromatography, immunopurification methods, and others.
  • proteins having established molecular adhesion properties can be reversibly fused a ligand..
  • the protein can be selectively adsorbed to a purification column and then freed from the column in a relatively pure form. The fused protein is then removed by enzymatic activity.
  • protein can be purified using immunoaffmity columns or Ni- NTA columns.
  • General techniques are further described in, for example, R. Scopes, Protein Purification: Principles and Practice, Springer- Verlag: N.Y. (1982); Deutscher, Guide to Protein Purification, Academic Press (1990); U.S. Pat. No. 4,511,503; S. Roe, Protein Purification Techniques: A Practical Approach (Practical Approach Series), Oxford Press (2001); D. Bollag, et al., Protein Methods, Wiley-Lisa, Inc.
  • Combination with recombinant techniques allow fusion to appropriate segments, e.g., to a FLAG sequence or an equivalent which can be fused via a protease-removable sequence.
  • appropriate segments e.g., to a FLAG sequence or an equivalent which can be fused via a protease-removable sequence.
  • Detection of the expressed protein is achieved by methods known in the art and includes, for example, radioimmunoassays, Western blotting techniques or immunoprecipitation.
  • the recombinantly produced and expressed enzyme can be recovered and purified from the recombinant cell cultures by numerous methods, for example, high performance liquid chromatography (HPLC) can be employed for final purification steps, as necessary.
  • HPLC high performance liquid chromatography
  • inclusion bodies typically involves the extraction, separation and/or purification of inclusion bodies by disruption of the host cells, e.g., by incubation in a buffer of 50 mM TRIS/HCL pH 7.5, 50 mM NaCl, 5 mM MgCl.sub.2, 1 mM DTT, 0.1 mM ATP, and 1 mM PMSF.
  • the cell suspension is typically lysed using 2-3 passages through a French Press.
  • the cell suspension can also be homogenized using a Polytron (Brinknan Instruments) or sonicated on ice.
  • the inclusion bodies can be solubilized, and the lysed cell suspension typically can be centrifuged to remove unwanted insoluble matter. Proteins that formed the inclusion bodies may be renatured by dilution or dialysis with a compatible buffer. Suitable solvents include, but are not limited to urea (from about 4 M to about 8 M), formamide (at least about 80%, volume/volume basis), and guanidine hydrochloride (from about 4 M to about 8 M).
  • guanidine hydrochloride and similar agents are denaturants, this denaturation is not irreversible and renaturation may occur upon removal (by dialysis, for example) or dilution of the denaturant, allowing re-formation of immunologically and/or biologically active protein.
  • Other suitable buffers are known to those skilled in the art.
  • the bacterial cells can be centrifuged to form a pellet.
  • the pellet can be resuspended in a buffer containing 20% sucrose.
  • the bacteria can be centrifuged and the pellet can be resuspended in ice-cold 5 mM MgSO.sub.4 and kept in an ice bath for approximately 10 minutes.
  • the cell suspension can be centrifuged and the supernatant decanted and saved.
  • the recombinant proteins present in the supernatant can be separated from the host proteins by standard separation techniques well known to those of skill in the art.
  • An initial salt fractionation can separate many of the unwanted host cell proteins (or proteins derived from the cell culture media) from the recombinant protein of interest.
  • One such example can be ammonium sulfate.
  • Ammonium sulfate precipitates proteins by effectively reducing the amount of water in the protein mixture. Proteins then precipitate on the basis of their solubility. The more hydrophobic a protein is, the more likely it is to precipitate at lower ammonium sulfate concentrations.
  • a typical protocol includes adding saturated ammonium sulfate to a protein solution so that the resultant ammonium sulfate concentration is between 20-30%. This concentration will precipitate the most hydrophobic of proteins.
  • the precipitate is then discarded (unless the protein of interest is hydrophobic) and ammonium sulfate is added to the supernatant to a concentration known to precipitate the protein of interest.
  • the precipitate is then solubilized in buffer and the excess salt removed if necessary, either through dialysis or diafiltration.
  • Other methods that rely on solubility of proteins, such as cold ethanol precipitation, are well known to those of skill in the art and can be used to fractionate complex protein mixtures.
  • the molecular weight of a recombinant protein can be used to isolated it from proteins of greater and lesser size using ultrafiltration through membranes of different pore size (for example, Amicon or Millipore membranes).
  • the protein mixture can be ultrafiltered through a membrane with a pore size that has a lower molecular weight cutoff than the molecular weight of the protein of interest.
  • the retentate of the ultrafiltration can then be ultrafiltered against a membrane with a molecular cut off greater than the molecular weight of the protein of interest.
  • the recombinant protein will pass through the membrane into the filtrate.
  • the filtrate can then be chromatographed as described below.
  • Recombinant proteins can also be separated from other proteins on the basis of its size, net surface charge, hydrophobicity, and affinity for ligands.
  • antibodies raised against proteins can be conjugated to column matrices and the proteins immunopurified. All of these methods are well known in the art. It will be apparent to one of skill that chromatographic techniques can be performed at any scale and using equipment from many different manufacturers (e.g., Pharmacia Biotech).
  • Renaturation and Refolding Insoluble protein can be renatured or refolded to generate secondary and tertiary protein structure conformation. Protein refolding steps can be used, as necessary, in completing configuration of the recombinant product. Refolding and renaturation can be accomplished using an agent that is known in the art to promote dissociation/association of proteins. For example, the protein can be incubated with dithiothreitol followed by incubation with oxidized glutathione disodium salt followed by incubation with a buffer containing a refolding agent such as urea.
  • a refolding agent such as urea.
  • Recombinant protein can also be renatured, for example, by dialyzing it agamst phosphate-buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCl.
  • PBS gamst phosphate-buffered saline
  • the protein can be refolded while immobilized on a column, such as the Ni NTA column by using a linear 6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH 7.4, containing protease inhibitors.
  • the renaturation can be performed over a period of 1.5 hours or more. After renaturation the proteins can be eluted by the addition of 250 mM immidazole.
  • Immidazole can be removed by a final dialyzing step against PBS or 50 mM sodium acetate pH 6 buffer plus 200 mM NaCl.
  • the purified protein can be stored at 4.degree. C. or frozen at -80.degree. C.
  • Other methods include, for example, those that may be described in MH Lee et al., Protein Expr. Purif., 25(1): p. 166-73 (2002), W.K. Cho et al., J. Biotechnology, 77(2-3): p. 169-78 (2000), Ausubel, et al. (1987 and periodic supplements), Incre (1990) "Guide to Protein Purification," Methods in Enzymology vol.
  • the present invention provides improved protein production in bacterial expression systems.
  • recombinant polypeptides that can be used in the present invention include polypeptides derived from prokaryotic and eukaryotic organisms. Such organisms include organisms from the domain Archea, Bacteria, Eukarya, including organisms from the
  • enzymes which are responsible for catalyzing the thousands of chemical reactions of the living cell
  • keratin, elastin, and collagen which are important types of structural, or support, proteins
  • hemoglobin and other gas transport proteins proteins
  • ovalbumin casein, and other nutrient molecules
  • antibodies which are molecules of the immune system
  • protein hormones which regulate metabolism
  • proteins that perform mechanical work such as actin and myosin, the contractile muscle proteins.
  • polypeptides include molecules such as, e.g., renin, a growth hormone, including human growth hormone; bovine growth hormone; growth hormone releasing factor; parathyroid hormone; thyroid stimulating hormone; lipoproteins; .alpha.1-antitrypsin; insulin A-chain; insulin B-chain; proinsulin; thrombopoietm; follicle stimulating hormone; calcitonin; luteinizing hormone; glucagon; clotting factors such as factor VIIIC, factor IX, tissue factor, and von WiUebrands factor; anti-clotting factors such as Protein C; atrial naturietic factor; lung surfactant; a plasminogen activator, such as urokinase or human urine or tissue-type plasminogen activator (t-PA); bombesin; thrombin; hemopoietic growth factor; tumor necrosis factor-alpha and -beta; enkephalinase; a serum albumin such as human
  • the recombinant peptides to be expressed by according to the present invention can be expressed from polynucleotides in which the target polypeptide coding sequence is operably attached to transcription and translation regulatory elements to form a functional gene from which the host cell can express the protein or peptide.
  • the coding sequence can be a native coding sequence for the target polypeptide, if available, but will more preferably be a coding sequence that has been selected, improved, or optimized for use in the selected expression host cell: for example, by synthesizing the gene to reflect the codon use bias of a Pseudomonas species such as Pseudomonas fluorescens.
  • Nucleic acid or a polynucleotide said to be provided in an "expressible form” means nucleic acid or a polynucleotide that contains at least one gene that can be expressed by the selected bacterial expression host cell. Extensive sequence information required for molecular genetics and genetic engineering techniques is widely publicly available. Access to complete nucleotide sequences of mammalian, as well as human, genes, cDNA sequences, amino acid sequences and genomes can be obtained from GenBank at the URL address http://www.ncbi.nlm.nih.gov/Entrez.
  • nucleotide sequence information can be also obtained from the EMBL Nucleotide Sequence Database ( http://www.ebi.ac.uk/embl/) or the DNA Databank or Japan (DDBJ, http://www.ddbi .nig.ac.ip/; additional sites for information on amino acid sequences include Georgetown's protein information resource website (http ://www-nbrf . georgetown. edu/pir and Swiss-Prot (http://au.expasv.org/sprot/sprot-top.html).
  • LB 10 g/L tryptone, 5 g/L yeast extiact and 5 g/L NaCl in a gelatin capsule (BIO 101).
  • uracil from BIO101, Carlsbad CA
  • L-proline was added to a final concentiation of 250 ug/mL
  • tetracycline was added to 15 ug/mL.
  • LB/5-FOA plates contain LB with 250 mM uracil and 0.5 mg/mL 5-fluoroorotic acid (5-FOA).
  • M9 media consists of 6 g/L Na 2 HPO 4 , 3 g/L KH 2 PO 4 , 1 g/L NH 4 C1, 0.5 g/L NaCl, 10 mM MgSO 4 , lx HoLe Trace Element Solution, pH7. Glucose was added to a final concentration of 1%.
  • the lOOOx HoLe Trace Element Solution is 2.85 g/L H 3 BO 3 , 1.8 g/L MnCl 2 ' 4H2O, 1.77 g/L sodium tartiate, 1.36 g/L FeSO 4 ⁇ 7H2O, 0.04 g/L CoCl 2 • 6H 2 O, 0.027 g/L CuCl 2 ⁇ 2H 2 O, 0.025 g/L Na 2 MoO ' 2H 2 O, 0.02 g/L ZnCl 2 . Oligonucleotides Used Herein
  • MB214pyrFl (Notl site in bold) 5'-GCGGCCGCTTTGGCGCTTCGTTTACAGG-3' (SEQ ID NO: 14) MB214pyrRl (Pvul site in bold; Kpnl site in underlined bold) 5 '-CGATCGGGTACCTGTCGAAGGGCTGGAGACAT-3 ' (SEQ ID NO: 15) pyrFPstF (Pstl site in bold) 5'-AACTGCAGGATCAGTTGCGGAGCCTTGG-3' (SEQ ID NO: 16) pyrFoverlap 5'-TGCTCACTCTAAAAATCTGGAATGGGCTCTCAGGC-3' (SEQ ID NO: 17) pyrFXbaR2 (Xbal site in bold) 5'-GCTCTAGATGCGTGGCTGGATGAATGAA-3' (SEQ ID NO: 18) pyranalF 5'-GGCGTCGAACAGGTAGCCTT-3' (SEQ IDNO:19) pyranalR 5 '-CTCG
  • the pyrF gene was cloned from P. fluorescens by polymerase chain reaction (PCR) amplification, using primers MB214pyrFl and MB214pyrRl that bind 297 bp upstream from the pyrF gene start codon and 212 bp downstream of its stop codon, respectively. Restriction sites were included at the 5' ends of the primers to facilitate further clomng reactions.
  • the amplified region upstream of the pyrF open reading frame (ORF) was estimated as long enough to include the native promoter upstream of pyrF.
  • the high-fidelity PROOFSTART DNA polymerase was mixed in a 50 uL reaction volume containing buffer provided by the manufacturer (Qiagen, Valencia CA) 0.3 M dNTPs (Promega, Madison, WI), 1 uM each of MB214pyrFl and MB214pyrRl primers, and about 0.3 ⁇ g of genomic DNA from P. fluorescens MB214.
  • the amplification conditions were 5 min at 95°C, followed by 35 cycles of a 30 sec denaturation at 94°C, 30 sec annealing at 57°C, and a 2 min extension at 72°C, followed by a final step at 72°C for 10 min.
  • the reaction was separated on a 1% gel of SEAKEM GTG agarose (from BioWhittaker Molecular Applications , Rockland ME).
  • SEAKEM GTG agarose from BioWhittaker Molecular Applications , Rockland ME.
  • the expected 1.2 kb band was excised from the gel and purified by extraction on a ULTRAFREE-DA centrifugal gel nebulizer from Millipore (Bedford MA ) column and de-salted into Tris-HCl buffer with a MICROBIOSPIN 6 P-6 polyacrylamide spin column (from Bio-Rad, Hercules CA ).
  • the cloned gene contained a single ORF, encoding orotidine 5 'phosphate decarboxylase.
  • the identity of the gene was further confirmed as pyrF by its high similarity (P-value of 3.3 xlO "78 ) along the entire length of the gene (209 out of 232 residues) to the pyrF gene from P. aeruginosa, which had been previously reported (Strych et al, 1994).
  • P. fluorescens strain used was found to contain no other copies of any pyrF genes.
  • the cell's genomic pyrF gene was altered by deleting of the ORF between and including the gene's start and stop codons.
  • the deletion was made by fusing in vitro the upstream and downstream regions flanking the pyrF region on a nonreplicating plasmid, then using allele exchange, i.e. homologous recombination, to replace the endogenous pyrF gene in MB 101 with the deletion allele.
  • the "Megaprimer” method (Barik 1997) was used, whereby the region upstream and then downstream of the desired deletion were subsequently amplified by PCR using an overlapping primer with homology on both sides of the desired deletion, so that the flanking regions become linked, leaving out the pyrF ORF.
  • the upstream region was amplified from MB214 genomic DNA using the Proofstart polymerase (Qiagen) as described above, with the primers pyrFPstF and pyrFoverlap, and an extension time of 1 minute.
  • the 1 kB product was used as the "Megaprimer" for the second amplification. Because there was difficulty amplifying the desired product in this second step, a template containing the genomic pyrF region was made by PCR amplification in order to increase the template quantity.
  • HOTSTARTAQ DNA polymerase from Qiagen, Valencia CA ) was used with P. fluorescens genomic DNA and the pyrFPstF and pyrFXbaR2 primers.
  • the Megaprimer and the pyrFXbaR2 primer were then used with this template and HOTSTARTAQ polymerase, to amplify the deletion product by PCR, using amplification conditions of 15 min at 95°C, followed by 30 cycles of a 30 sec denaturation at 94°C, 30 sec annealing at 59°C, and a 2 min extension at 72°C, followed by a final step at 72°C for 3 min.
  • the expected 2 kB band was separated from a number of other products by gel electrophoresis, and then gel purified as above and cloned into plasmid pCR2.1Topo (from Invitrogen, Carlsbad CA) according to instructions from the manufacturer, to form pDOW1215-7
  • pDOW1215-7 Sequencing the PCR-amplif ⁇ ed region of pDOW1215-7 showed that there were 3 mutations introduced by the amplification process; all three changes were within 112 bp downstream of the stop codon for pyrF. Sequencing through this area was difficult, because the process of the reaction stopped in this area.
  • pDOW1215-7 was used to delete the chromosomal pyrF gene in MB101. To do this, first, electrocompetent .yZ worn ⁇ cewi' cells made according to the procedure of Artiguenave et al. (1997), were transformed with 0.5 ⁇ g of the purified plasmid. Transformants were selected by plating on LB medium with kanamycin at 50 ⁇ g/mL.
  • This plasmid cannot replicate in P. fluorescens, therefore kanamycin resistant colonies result from the plasmid integrating into the chromosome.
  • the site of integration of the plasmid was analyzed by PCR using the HOTSTARTAQ polymerase and primers pryanalF and M13F(-40), annealing at 57°C and with an extension time of 4 min.
  • One out of the 10 isolates (MB101::pDOW1215-7#2) contained an insertion of pDOW1215-7 into the downstream region (2.8 kB analytical product) and in the other nine were in the upstream region (2.1 kb analytical product).
  • MB101::pDOW1215-7#2 was inoculated from a single colony into LB supplemented with 250 mM uracil, grown overnight, and then plated onto LB-uracil and 500 ⁇ g/mL 5- fluoroorotic acid (5-FOA - Zymo Research, Orange CA). Eight colonies were analyzed by PCR with HOTSTARTAQ and primers pyranalF and pyranalR, annealing at 57°C and extending for 4 min.
  • the expected size of the amplified product from the parent MB 101 was 3.2 kB, or if the pyrF gene was deleted, then 2.5 kB. Each of the colonies gave rise to the 2.5 kB band expected from a deletion of pyrF.
  • the first three isolates were purified and named PFG116, PFG117, and PFG118 (also known as DC36). The three isolates exhibit the phenotype expected from a pyrF deletion, i.e. they are sensitive to kanamycin, uracil is required for growth, and they are resistant to 5-FOA.
  • the DNA sequence of PFG118 was identical to that of the amplified regions in pDOW1215-7; i.e. the three mutations in the stem-loop structure immediately downstream from pyrF were incorporated into the PFG118 genome, along with ike pyrF deletion.
  • the ability of the pyrF gene to act as a selectable marker was tested by cloning it into a pMYC expression plasmid containing both an existing tetracycline resistance marker and the target enzyme coding sequence under the control of the tac promoter.
  • the plasmid pMYC5088 was digested at 37°C for 2 hr with SnaBI in a 50 uL reaction using NEB Buffer 4 and 0.1 mg/mL of bovine serum albumen (BSA) (from New England Biolabs, Beverly MA ). The reaction mixture was then treated at 70°C for 20 min to inactivate the enzyme, then gel-purified as described above.
  • BSA bovine serum albumen
  • Plasmid DNA was prepared from 12 isolates using the QiaPrep Spin Miniprep Kit (Qiagen, Valencia CA) and screened with Notl and EcoRI, which indicated that one isolate contained the desired clone, pDOW1249-2 ( Figure 2).
  • the plasmid pDOW1249-2 was transformed into pyrF(-) P. fluorescens containing a pCN plasmid containing a lad repressor expression cassette and a kanamycin resistance marker gene. Isolates were tested in shake flasks and in 20-L fermentors.
  • Isolates were grown in minimal salts medium and kanamycin, but no tetracycline, so that the only selective pressure for the pDOW 1249-2 plasmid was provided by the ability of the pyrF gene on the plasmid to complement the pyrF deletion in the chromosome.
  • the amount of target protein produced by the new strain in the shake flask test was similar to that of the control strain, a genomically pyrF(+) P. fluorescens control system containing the same two plasmids, but for the absence of the pyrF gene in pDOW 1249-2, and grown on the same medium but further supplemented with tetracycline in order to maintain the plasmid (data not shown).
  • proCl 5'-ATATGAGCTCCGACCTTGAGTCGGCCATTG-3' (SEQ IDNO:22)
  • proC2 5'-ATATGAGCTCGGATCCAGTACGATCAGCAGGTACAG-3' (SEQIDNO:23)
  • proC3 5'-AGCAACACGCGTATTGCCTT-3' (SEQ ID NO:24)
  • proC5 5'-GCCCTTGAGTTGGCACTTCATCG-3' proC6 5'-GATAAACGCGAAGATCGGCGAGATA-3'
  • proC7 5'-CCGAGCATGTTTGATTAGACAGGTCCTTATTTCGA-3' (SEQ ID NO:27)
  • proC8 5 '-TGCAACGTGACGCAAGCAGCATCCA-3 ' (SEQ ID NO:28) proC9 5'-GGAACGATCAGCACAAGCCATGCTA-3' (SEQ ID NO: 29) genF2 5'-ATA
  • This plasmid was tested in the proC(-) mutant strain PFG932 for its ability to regulate amylase synthesis from pDOW1249-2. Expressed target enzyme production levels at the 20-L scale was similar to that of the dual-antibiotic- resistance marker control strain DC88 (data not shown).
  • the genR antibiotic marker gene was then removed from the pDOW 1264-2 ( Figure 3) to create an antibiotic-marker-free plasmid with proC and lad. Removing the genR gene was accomplished by restriction digestion of pDOW1264-2 with BamHI, purification of the 6.1 kB fragment, ligation to itself, and electroporation into the proC(-) P. fluorescens host PFG1016.
  • pDOW1306-6 The resulting plasmid was named pDOW1306-6. Analytical restriction digests with EcoRI and sequencing across the BamHI junction verified the identity of the plasmid and the proper orientations of the genes therein. Sequencing was performed by The Dow Chemical Company. The proC sequence is presented within SEQ ID NO:4. Construction of Target Enzyme Expression Plasmid Containing a pyrF Marker in Place of an Antibiotic Resistance Marker The antibiotic-marker-free production plasmid, pDOW 1269-2, containing a target enzyme-encoding gene under control of a tac promoter, was constructed by restriction digestion of pDOWl 249-2 with Pvul to remove the tetR/tetA genes.
  • pDOW1249-2 was prepared as described in Example 1.
  • the 10.6 kB Pvul fragment was gel-purified, ligated to itself, transformed into PFG118/pCN57/ ⁇ c/by electroporation and spread on M9 glucose medium containing kanamycin (to retain the pCN5i/ ⁇ cI).
  • Plasmid DNA was isolated and analytical restriction digests with Ncol were carried out; two isolates showed a restriction digest that was consistent with the expected bands. Both isolates were sequenced across the Pvul junction, which verified the identity of the plasmids and the proper orientations of the genes therein.
  • the vector pDOW1261-2 was designed to create clean deletions of genomic DNA, using marker exchange by the cross-in/cross-out method (Toder 1994; Davison 2002), by combining the following properties:
  • a counterselectable marker that allows for selection for loss of the inserted plasmid (as long as the host strain is pyrF-); cells that lose the pyrF gene are resistant to 5-FOA; and
  • the efficiency of insertion can be increased by adding Srfl (Stiatagene, La Jolla CA) to the ligation reaction to re-cleave vectors that ligate without an insert.
  • Srfl Stiatagene, La Jolla CA
  • pCRScriptCAM Stiatagene, La Jolla CA
  • proC a deletion of proC
  • the proC7 primer which bridges the proC ORF, was designed to delete the entire coding sequence from the ATG start codon to the TAG stop codon. An additional 16 bp downstream of the stop codon was also included in the deletion.
  • the Megaprimer method of PCR amplification was used (Barik 1997).
  • the 0.5 kB region directly upstream of the proC open reading frame was amplified by PCR from MB214 genomic DNA, using primers proC5 and proC7.
  • Primer proC7 overlaps the regions upstream and downstream of the proC ORF.
  • the polymerase chain reaction was carried out with 1 uM of primers, 200 uM each of the four dNTPs, and Herculase high- fidelity polymerase (Stratagene, La Jolla CA) in the buffer recommended by the vendor.
  • Herculase is a high-fidelity enzyme that consists mostly of Pfu polymerase, which leaves blunt ends.
  • the amplification program was 95°C for 2 min, 30 cycles of 95°C for 30 sec, 50°C for 30 sec, and 72°C for 1 min per kB, followed by 10 min at 72°C.
  • the amplified products were separated by 1% agarose gel electrophoresis in TBE and visualized using ethidium bromide.
  • a gel slice containing the DNA was cut from the gel and purified as above
  • the 1.3 kB region downstream from the proC gene was amplified using primers proC3 and proC6, to serve as a template for subsequent reactions.
  • the same amplification protocol was used, except for an annealing temperature of 60°C.
  • the reaction was checked on an agarose gel, and then purified using the StiataPrep PCR Purification Kit (Stratagene, La Jolla CA).
  • the megaprimer was used as one of the primers in a PCR reaction along with primer proC6, and with the proC3-proC6 PCR reaction as the template.
  • An annealing temperature of 61°C and extension time of 2 min was used.
  • the 1 kB PCR product was purified and blunt-end ligated into the suicide vector pDOW1261-2 that had been digested with Srfl .
  • Srfl was included in the ligation in order to decrease background caused by re-ligation of the vector, as according to instructions from the manufacturer (pCRScriptCam Cloning Kit - Stratagene, La Jolla CA).
  • the ligation was transformed into DH10 ⁇ (Gibco BRL Life Technologies, now Invitrogen, Carlsbad CA) by electroporation (2 mM gap cuvette, 25 ⁇ F, 2.25 kV, 200 Ohms) (Artiguenave et al. 1997), and isolates were screened using the Dr ⁇ lll restriction enzyme.
  • the PCR amplified region of each isolate was sequenced by The Dow Chemical Company; isolate pDOWl 305-6 was verified as containing the correct genomic DNA sequence. Formation of the P. fluorescens pyrF-proC Double Deletion
  • PFG118 was transformed with pDOWl 305-6 by electroporation as described above.
  • the three isolates PFG118::1305-6.1, -6.8, -6.10 have an insertion in the region upstream, and the three isolates PFG118::1305-6.2, -6.3, -6.9 have an insertion in the region downstream.
  • PFG118:: 1305-6.1 and -6.2 were grown to stationary phase in 50 mL of LB with uracil and proline supplementation and then plated on LB-5-FOA with uracil and proline supplementation.
  • the genomic region of PFG118 (wild type proC) and PFG1016 (proC deletion) was amplified by PCR (primers proC8 and proC9, HotStarTaq polymerase, 63°C annealing and 3 min extension) and sequenced.
  • the region between proC5 and proC6 of strain PFG1016 was identical to the parent, except for the expected 835 bp deletion.
  • the pDOW 1269-2 was partially purified from the pCN5i/ ⁇ ci by agarose gel electrophoresis and then electroporated into PFG1016 pDOW1306-6 . Transformants were selected on M9/glucose without supplementation. Because there was a possibility that some of the pCN5H ⁇ c/ contaminating the pDOW1269-2 preparation would also be cotransformed into the cells, three isolates from each transformation were tested for sensitivity to kanamycin, the antibiotic marker carried on pCN51/ ⁇ d; all six were found sensitive. All six strains were found to express the target enzyme, in a test of target enzyme activity.
  • Strains 1046 and 1048 were subsequently tested in 20-L bioreactors. Induction of target enzyme expression was initiated at 26 hours by addition of IPTG. Both strains achieved performance levels within the normal range for the DC88 control strain, for both OD 575 and target enzyme activity. The performance averages of these two strains are shown in Figure 1. Restriction digests of plasmids prepared from samples taken at the seed stage and at a time just before the 26-hour start of induction showed a pattern consistent with that expected. Analytical PCR of genomic DNA carried out on the same samples demonstrated the retention of the proC deletion and the pyrF deletion.
  • the three strains exhibit differing amounts of LacI repressor accumulation.
  • Each strain carries a single copy of its lad gene at the levansucrase locus (SEQ ID NO:13) of P.
  • fluorescens DC36 which is an MB101 derivative (see TD Landry et al, "Safety evaluation of an ⁇ -amylase enzyme preparation derived from the archaeal order Thermococcales as expressed in Pseudomonas fluorescens biovar I," Regulatory Toxicology and Pharmacology 37(1): 149-168(2003)) formed by deleting the pyrF gene thereof, as described above. No vector or other foreign DNA sequences remain in the strains.
  • the strains are antibiotic-resistance-gene free and also contain a pyrF deletion, permitting maintenance, during growth in uracil un-supplemented media, of an expression plasmid carrying a pyrF+ gene.
  • MB214 contains the lad-lacZYA chromosomal insert described in U.S. Pat. 5,169,760. MB214 also contains a duplication in the C-terminus of the LacI protein, adding about 10 kDa to the molecular weight of the LacI repressor.
  • Plasmid pDOW1266-l was constructed by PCR amplification of the region upstream of and within the P. fluorescens gene for levansucrase (SEQ ID NO: 13), replacing the start codon with anXbal site, using the Megaprimer method, see A Barik, "Mutagenesis and Gene
  • PCR was performed using HERCULASE polymerase (Stratagene, Madison WI,
  • SEQ ID NO:35 contains the sequence that inserts an Xba ⁇ site. The reaction was carried out at 95°C for 2 min, 35 cycles of [95°C for 30 sec, 58°C for 30 sec, 72°C for 1 minj,followed by
  • the 1 kB product was gel purified and used as one of the primers in the next reaction, along with LEV3 (SEQ ID NO:36), using MB214 genomic DNA as a template and the same conditions except that extension time was 2 min.
  • the 2 kB product was gel purified and re-amplified with LEV2 (SEQ ID NO: 35) and LEV3 (SEQ ID NO. 36) in order to increase the quantity.
  • LEV2 (SEQ ID NO:35) 5'-CGCAAGGTCAGGTACAACAC
  • ZEF8 (SEQ ID NO:38) 5 '-GACTCAACTCAATGGTGCAGG
  • BglXbaLacF (SEQ ID NO:39) 5'-AGATCTCTAGAGAAGGCGAAGCGGCATGCATTTACG
  • Lacpro9 (SEQ ID NO:41) 5'-ATATTCTAGAATGGTGCAAAACCTTTCGCGGTATGGCATGA
  • LacIQF (SEQ ID NO:42) 5'-GCTCTAGAAGCGGCATGCATTTACGTTGACACC
  • LacINXR (SEQ ID NO:43) 5'-AGCTAGCTCTAGAAAGTTGGGTAACGCCAGGGT
  • lacIQl (SEQ ID NO:44) 5'-AGTAAGCGGCCGCAGCGGCATGCATTTACGTTGACACCACCTT TCGCGGTATGGCATG
  • lacIFl (SEQ ID NO:45) 5 '-ACAATCTTCTCGCGCAACGC
  • lacIF2 (SEQ ID NO:46) 5 '-ATGTTATATCCCGCCGTTAA
  • lacIRl (SEQ ID NO:47) 5 '-CCGCTATCGGCTGAATTTGA lacIR2 (SEQ ID NO:48) 5 '-TGTAATTCAGCTCCGCCATC
  • SeqLevSAS (SEQ ID NO:49) 5 '-TATCGAGATGCTGCAGCCTC
  • SeqLev3S (SEQ ID NO:50) 5 '-ACACCTTCACCTACGCCGAC
  • the LEV2 - LEV3 amplification product was cloned into the Srfl site of pDOW1261-2, a suicide vector that contains P. fluorescens pyrF+ gene as a selection marker to facilitate selection for cross-outs.
  • the new plasmid was named pDOW 1266-1.
  • the amplified region was sequenced.
  • the E.coli lad gene was amplified from pCN511ad with primers BglXbaLacF (SEQ ID 10 NO:39) and lacIR4 (SEQ ID NO. 40), using HERCULASE polymerase (annealing at 62°C and extension time of 2 min). After gel purification and digestion with Xbal, the lad gene was cloned into the Xbal site of pDOW1266-l, to make pDOW1310.
  • the lacfi gene was created by PCR amplification using pCN511ad as a template with 15 primers lacpro9 (SEQ ID NO. 41) and lacIR4 (SEQ ID NO.
  • the lacfi 1 gene was created by amplifying the lad gene from E. coli K12 (ATCC47076) using primers lacIQl (SEQ ID NO. 44) and lacINXR (SEQ ID NO. 43) and cloned into pCR2.1Topo (Invitrogen, Carlsbad, CA, USA), to make pCR2-lacIQl.
  • the lacfi 1 gene was reamplified from pCR2-lacIQl using primers lacIQF (SEQ ID NO. 42) and lacINXR (SEQ ID NO. 43) with Herculase polymerase (61°C annealing, 3 min extension time, 35 cycles). After gel purification and digestion with Xbal, the PCR product was cloned into the Xbal site of pDOW1266-l, to make pDOW1309. The PCR amplified inserts in pCR2-lacIQl, pDOW1310, pDOW1311, and pDOW1309 were sequenced (using primers lacIFl (SEQ ID NO:45), lacIF2 (SEQ ID NO.
  • the vectors pDOW1309, pDOW1310, and pDOW1311 were introduced into DC36 by electroporation, first selecting for integration of the vector into the genome with tetracycline resistance. Colonies were screened to determine that the vector had integrated at the levansucrase locus by PCR with primers LEV7 (SEQ ID NO. 37) and M13R (from New England Biolabs, Gloucester MA, USA). To select for the second cross-over which would leave the lad gene in the genome, the isolates were grown in the presence of 5'-fluoroorotic acid and in the absence of tetracycline.
  • UnBlot is a method analogous to Western analysis, in which proteins are detected in the gel without the need for transfer to a filter. The technique was carried out following the directions from Pierce Biotechnology (Rockford, IL, USA), the manufacturer. Analysis using UnBlot showed that the amount of LacI in each of the new integrant strains was higher than in MB214. MB214 contains the lad-lacZYA insert described in U.S. Pat. 5,169,760. The relative concentration of LacI in the lacfi and lacfi 1 integrants was about the same as in strains carrying pCN51 lad, the multi-copy plasmid containing lad. See Figure 5.
  • a dilution series was carried out in order to assess more precisely the relative difference in LacI concentration in MB214, DC202 (lad integrated) and DC206 (lacfi 1 integrated).
  • MB101pCN511ad, DC204 and DC206 have about 100 times more LacI than MB214, whereas DC202 has about 5 times more.
  • Strain DC 140 was constructed by introducing into P. fluorescens MB214 a tetracycline- resistant broad-host-range plasmid, pMYC1803 (WO 2003/068926), into which a nitrilase gene (G DeSanthis et al, J. Amer. Chem. Soc. 125:11476-77 (2003)), under the control of the Ptac promoter, had been inserted.
  • a nitrilase gene G DeSanthis et al, J. Amer. Chem. Soc. 125:11476-77 (2003)
  • the same nitrilase gene was cloned onto a pMYC1803 derivative where the tetracycline-resistance gene has been replaced by a pyrF selection marker.
  • the new plasmid, pDOW2415 was then electroporated into DC202 and DC204, resulting in DC239 and DC240, respectively.
  • DC140, DC239 and DC240 were cultured in 20 L fermentors by growth in a mineral salts medium fed with glucose or glycerol, ultimately to cell densities providing biomasses within the range of about 20 g/L to more than 70 g/L dry cell weight (See WO 2003/068926).
  • the gratuitous inducer of the Ptac promoter, IPTG was added to induce expression.
  • the ratio of pre-induction nitrilase activities of DC140 to DC239 toDC240 was 6:2:1.
  • RNA analysis by Northern blots of the same samples revealed the same ranking of de- repression. Based on densitometric measurements, the ratio of un-induced transcript levels of DC140:DC239:DC240 was 2.4:1.4:1.0. Shortly after induction (30 min) with 0.3mM IPTG, the levels of transcript of all the strains were the same. Post-induction nitrilase productivity rates were also comparable. This indicated that the concentration of inducer used was sufficient to fully induce the Ptac promoter in these three strains despite their different LacI protein levels. However, fermentations of the most derepressed strain, DC 140, suffered significant cell lysis accompanied with loss of nitrilase activity after approximately 24 hours post-induction. Induction of the improved, more tightly regulated strains, DC239 and DC240, could be extended to more than 48 hours post induction, while maintaining high nitrilase productivity, with the ultimate result of a doubling of nitrilase yields. See Figure 6.
  • the native tac promoter only has a single native lac operator, AATTGTGAGCGGATAACAATT, at the OI position ( Figure 4).
  • the native operator was replaced by the more symmetrical lacOid operator sequence 5'-AATTGTGAGC GCTCACAATT - 3' (SEQ. ID. NO. 14) (JR. Sadler, H. Sasmor and JL. Betz. PNAS. 1983 Nov; 80 (22): 6785-9).
  • a 289 bp Hindlll/ Spel fragment containing the tac promoter and the native lacO sequence was removed from a pMYC1803 derivative, pDOW2118, and replaced by a Hindlll/Spel fragment isolated from an SOE PCR amplification product containing the symmetrical lacOid sequence.
  • the SOE PCR primers (RC-3 and RC-9) incorporated 4 nucleotide changes that produced the optimized/symmetrical lacO sequence (three base pair substitutions and one base pair deletion).
  • the Hindlll/Spel promoter fragment of the resulting plasmid, pDOW2201 was cloned into the nitrilase expression plasmid based on pMYC1803, to replace the native tac promoter, resulting in pDOW1414.
  • This expression cassette was then transfe ⁇ ed onto the pyrF(+) plasmid pDOW1269, resulting in pDOW1418 by exchanging Dral/Xhol fragments. Plasmid pDOW1418 was then transformed into host strain DC206, resulting in strain DC281 (See Figure 4).
  • GCTCACAATT-3' (SEQ ID. No. 14), was inserted 52 nucleotides up-stream (5') of the existing native lacOl by PCR.
  • PCR amplification of the promoter region using the Megaprimer method was performed using a pMYC1803 derivative, pMYC5088, and the following primers AKB-1 and AKB-2 as a first step.
  • the resulting PCR product was combined with primer AKB-3 in a second round of PCR amplification using the same template.
  • the promoter fragment containing the dual operators was cloned into the Hindlll and Spel sites of plasmid pMYC5088 resulting in pDOW1411.
  • AKB-1 (SEQ ID NO:56) 5'- ACGGTTCTGGCAAACAATTGTGAGCGCTCACAATTTATTCTGAAATGAGC
  • AKB-2 (SEQ ID NO:57) 5'- GCGTGGGCGGTGTTTATCATGTTC
  • AKB-3 (SEQ ID NO:58) 5'- TACTGCACGCACAAGCCTGAACA
  • MB214, DC202, and DC206 were transformed with a nitrilase expression vector containing the wild type lacO sequence in the Oi position 3' of the tac promoter, creating MB214 wtO DC202wtO ⁇ (DC239), and DC206wtO 1 (DC240), as described above.
  • DC206 was transformed with a nitrilase expression vector containing a lacOid sequence in place of the wild type lacO sequence at the ⁇ position 3' of the tac promoter as described above, creating DC206Oid (DC281).
  • DC206 was also transformed with a nitrilase expression vector containing a wild type lacO sequence at the ⁇ position 3' of the tac promoter and a lacOid sequence at the O 3 position 5' of the tac promoter, creating the dual lacO containing DC206wtO 1 0 3 id (DC263).
  • Northern blot analysis indicated a greater repression by the strain containing the Dual lacO sequence (DC206wtO ⁇ O 3 id (DC263)) cassette prior to induction.
  • the greater repression of pre-induction expression is especially useful when producing toxic proteins, since basal levels of pre-induction toxic proteins result in the delayed entry of the cell into the growth phase, and, potentially, lower overall yields of the product.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
PCT/US2004/038884 2003-11-19 2004-11-19 Improved protein expression systems Ceased WO2005052151A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP04811581A EP1692282B1 (en) 2003-11-19 2004-11-19 Improved protein expression systems in auxotrophic Pseudomonas fluorescens
CN2004800407027A CN1906294B (zh) 2003-11-19 2004-11-19 改良的蛋白表达系统
KR1020067009838A KR101237651B1 (ko) 2003-11-19 2004-11-19 개선된 단백질 발현 시스템
AU2004293810A AU2004293810B2 (en) 2003-11-19 2004-11-19 Improved protein expression systems
MXPA06005634A MXPA06005634A (es) 2003-11-19 2004-11-19 Sistemas mejorados de expresion de proteinas.
BRPI0416744-9A BRPI0416744A (pt) 2003-11-19 2004-11-19 sistemas de expressão de proteìna aperfeiçoados
JP2006541422A JP5087741B2 (ja) 2003-11-19 2004-11-19 改良タンパク質発現系
CA2545610A CA2545610C (en) 2003-11-19 2004-11-19 Auxotrophic pseudomonas fluorescens bacteria for recombinant protein expression

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US52342003P 2003-11-19 2003-11-19
US60/523,420 2003-11-19
US53714704P 2004-01-16 2004-01-16
US60/537,147 2004-01-16

Publications (1)

Publication Number Publication Date
WO2005052151A1 true WO2005052151A1 (en) 2005-06-09

Family

ID=34636466

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/038884 Ceased WO2005052151A1 (en) 2003-11-19 2004-11-19 Improved protein expression systems

Country Status (10)

Country Link
US (2) US20050186666A1 (https=)
EP (1) EP1692282B1 (https=)
JP (2) JP5087741B2 (https=)
KR (1) KR101237651B1 (https=)
CN (1) CN1906294B (https=)
AU (1) AU2004293810B2 (https=)
BR (1) BRPI0416744A (https=)
CA (1) CA2545610C (https=)
MX (1) MXPA06005634A (https=)
WO (1) WO2005052151A1 (https=)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009068554A1 (en) * 2007-11-29 2009-06-04 Novozymes A/S Synthase inhibitor screening method
WO2010008764A1 (en) * 2008-06-23 2010-01-21 Dow Global Technologies Inc. Pseudomonas fluorescens strains for production of extracellular recombinant protein
US20100255561A1 (en) * 2009-04-06 2010-10-07 Eric Steinmetz Host-vector system for cloning and expressing genes
EP2227553A4 (en) * 2007-11-30 2011-01-19 Scarab Genomics Llc Lac expression system
US8288127B2 (en) 2003-11-19 2012-10-16 Pfenex, Inc Protein expression systems
EP2430164A4 (en) * 2009-05-11 2012-10-31 Pfenex Inc PREPARATION OF RECOMBINANT PROTEINS DUE TO NON-ANTIBIOTIC SELECTION PROCEDURES AND INSTALLATION OF NON-NATURAL AMINO ACIDS
WO2013022358A1 (en) * 2011-08-11 2013-02-14 Instytut Biotechnologii I Antybiotykow Expression cassette, use of the expression cassette, expression vector, prokaryotic host cell comprising expression vector, bacterial strain and a method for producing a polypeptide
US8906636B2 (en) 2010-03-30 2014-12-09 Pfenex Inc. High level expression of recombinant toxin proteins
US9109229B2 (en) 2004-07-26 2015-08-18 Pfenex Inc. Process for improved protein expression by strain engineering
US9169304B2 (en) 2012-05-01 2015-10-27 Pfenex Inc. Process for purifying recombinant Plasmodium falciparum circumsporozoite protein
US9187543B2 (en) 2010-03-04 2015-11-17 Pfenex Inc. Method for producing soluble recombinant interferon protein without denaturing
US9394571B2 (en) 2007-04-27 2016-07-19 Pfenex Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US9453251B2 (en) 2002-10-08 2016-09-27 Pfenex Inc. Expression of mammalian proteins in Pseudomonas fluorescens
US9580719B2 (en) 2007-04-27 2017-02-28 Pfenex, Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
CN113025601A (zh) * 2019-12-25 2021-06-25 上海奥博生物医药技术有限公司 腈水解酶启动子优化表达及应用

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5415763B2 (ja) * 2005-10-06 2014-02-12 ドムペ・ファ.ル.マ・ソチエタ・ペル・アツィオーニ 新規選択系
WO2007055789A2 (en) * 2005-10-31 2007-05-18 Neose Technologies, Inc. Expression of soluble therapeutic proteins
GB0602173D0 (en) 2006-02-03 2006-03-15 Avecia Ltd Expression system
EP2013357A4 (en) 2006-04-19 2012-02-22 Biogenerix Ag EXPRESSION OF O-GLYCOSYLATED THERAPEUTIC PROTEINS IN PROKARYOTIC MICROORGANISMS
EP2021489A2 (en) * 2006-05-30 2009-02-11 Dow Global Technologies Inc. Codon optimization method
KR100824541B1 (ko) * 2007-02-26 2008-04-24 고려대학교 산학협력단 항산화 효소의 과발현을 통해 환경오염물질 분해능이향상된 균주
JP2010017131A (ja) * 2008-07-10 2010-01-28 Mitsui Eng & Shipbuild Co Ltd モーレラ属細菌及びプライマー
US8153391B2 (en) 2008-08-29 2012-04-10 Bunge Oils, Inc. Hydrolases, nucleic acids encoding them and methods for making and using them
US8357503B2 (en) 2008-08-29 2013-01-22 Bunge Oils, Inc. Hydrolases, nucleic acids encoding them and methods for making and using them
US8198062B2 (en) 2008-08-29 2012-06-12 Dsm Ip Assets B.V. Hydrolases, nucleic acids encoding them and methods for making and using them
UA109884C2 (uk) 2009-10-16 2015-10-26 Поліпептид, що має активність ферменту фосфатидилінозитол-специфічної фосфоліпази с, нуклеїнова кислота, що його кодує, та спосіб його виробництва і застосування
UA111708C2 (uk) 2009-10-16 2016-06-10 Бандж Ойлз, Інк. Спосіб рафінування олії
NZ603033A (en) 2010-04-01 2014-06-27 Pfenex Inc Methods for g-csf production in a pseudomonas host cell
SG186836A1 (en) * 2010-07-12 2013-02-28 Univ Gent Metabolically engineered organisms for the production of added value bio-products
CA2807774C (en) 2010-08-10 2020-10-27 The Governing Council Of The University Of Toronto Specific active site inhibitors of enzymes or substrate binding partners and methods of producing same
BR112014024220A2 (pt) 2012-03-30 2017-07-25 Verenium Corp genes que codificam celulase
EP2897638A1 (en) 2012-09-24 2015-07-29 Montana State University-Bozeman Recombinant lactococcus lactis expressing escherichia coli colonization factor antigen i (cfa/i) fimbriae and their methods of use
JP6448909B2 (ja) * 2013-03-01 2019-01-09 学校法人関西学院 目的遺伝子を欠損した酢酸菌の製造方法及びその利用
GB201308853D0 (en) 2013-03-12 2013-07-03 Verenium Corp Genes encoding xylanase
GB201308828D0 (en) 2013-03-12 2013-07-03 Verenium Corp Phytase
GB201308843D0 (en) 2013-03-14 2013-07-03 Verenium Corp Phytase formulation
JP2016525354A (ja) 2013-07-25 2016-08-25 ビーエーエスエフ エンザイムズ エルエルシー フィターゼ
EP3152303B1 (en) 2014-06-06 2021-11-24 The Hospital For Sick Children Soluble bacterial and fungal proteins and methods and uses thereof in inhibiting and dispersing biofilm
CN104004760B (zh) * 2014-06-12 2017-11-28 华东理工大学 一种用于在米曲霉细胞分泌表达外源蛋白的表达设备及其米曲霉基因工程菌
CN107075523B (zh) 2014-06-27 2022-04-19 加拿大国家研究委员会 来自大麻的大麻环萜酚酸合酶
US10316322B2 (en) 2014-07-02 2019-06-11 Sutro Biopharma, Inc. High growth capacity auxotrophic Escherichia coli and methods of use
JP6817939B2 (ja) 2014-12-01 2021-01-20 フェネックス インク. ペプチド産生のための融合パートナー
RS65152B1 (sr) 2015-02-05 2024-02-29 Canem Holdings Llc Preparati za lečenje granulomatoze sa poliangiitisom
KR20170068304A (ko) * 2015-12-09 2017-06-19 삼성전자주식회사 대장균 및 코마가타에이박터 속 세포에서 복제가능한 벡터, 그를 포함한 세포, 및 그를 이용하는 방법
WO2019063614A1 (en) 2017-09-26 2019-04-04 Bunge Global Innovation, Llc. ENZYMATIC REMOVAL OF CHLOROPHYLLIC SUBSTRATES FROM TRIACYLGLYCEROL OILS
JP7784804B2 (ja) 2017-10-27 2025-12-12 フェネックス インク. 組み換えerwiniaアスパラギナーゼの製造のための方法
AU2018354069A1 (en) 2017-10-27 2020-06-11 Pelican Technology Holdings, Inc. Bacterial leader sequences for periplasmic protein expression
WO2019083794A1 (en) 2017-10-27 2019-05-02 Pfenex Inc. PROCESS FOR PRODUCING EAR ASPARAGINASE. RECOMBINED COLI
CN108504677B (zh) * 2018-03-06 2020-05-12 上海晶诺生物科技有限公司 一个用于构建谷氨酸基因家族缺失结核分枝杆菌的重组tm4噬菌体文库及其应用
US11098265B2 (en) 2019-03-27 2021-08-24 Bunge Global Innovation, Llc Silica adsorbent treatment for removal of chlorophyll derivatives from triacylglycerol-based oils
WO2020243642A2 (en) * 2019-05-31 2020-12-03 The Trustees Of Columbia University In The City Of New York Multiply auxotrophic cell line for the production of recombinant proteins and methods thereof
TW202122582A (zh) * 2019-08-26 2021-06-16 美商航海家醫療公司 病毒蛋白之控制表現
CN111041029B (zh) * 2019-12-23 2022-05-10 中国科学院天津工业生物技术研究所 一种强启动子及其在产维生素b12菌株中的应用
US11746352B2 (en) 2019-12-30 2023-09-05 Eligo Bioscience Microbiome modulation of a host by delivery of DNA payloads with minimized spread
US12098372B2 (en) 2019-12-30 2024-09-24 Eligo Bioscience Microbiome modulation of a host by delivery of DNA payloads with minimized spread
CN112080451A (zh) * 2020-07-13 2020-12-15 宁波大学 一种嗜酸乳杆菌的食品级基因表达体系及其制备方法和应用
WO2022144381A1 (en) 2020-12-30 2022-07-07 Eligo Bioscience Microbiome modulation of a host by delivery of dna payloads with minimized spread
WO2022211829A1 (en) 2021-03-30 2022-10-06 Jazz Pharmaceuticals Ireland Ltd. Dosing of recombinant l-asparaginase
JP2024520940A (ja) 2021-05-12 2024-05-27 エリゴ・バイオサイエンス 産生細菌細胞及び産生方法におけるその使用
EP4689147A2 (en) 2023-04-05 2026-02-11 Primrose Bio, Inc. Methods and compositions for nucleic acid synthesis

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4680264A (en) 1983-07-01 1987-07-14 Lubrizol Genetics, Inc. Class II mobilizable gram-negative plasmid
US4695455A (en) 1985-01-22 1987-09-22 Mycogen Corporation Cellular encapsulation of pesticides produced by expression of heterologous genes
US4755465A (en) 1983-04-25 1988-07-05 Genentech, Inc. Secretion of correctly processed human growth hormone in E. coli and Pseudomonas
US4861595A (en) 1985-06-28 1989-08-29 Mycogen Corporation Cellular encapsulation of biologicals for animal and human use
US5055294A (en) 1988-03-03 1991-10-08 Mycogen Corporation Chimeric bacillus thuringiensis crystal protein gene comprising hd-73 and berliner 1715 toxin genes, transformed and expressed in pseudomonas fluorescens
US5128130A (en) 1988-01-22 1992-07-07 Mycogen Corporation Hybrid Bacillus thuringiensis gene, plasmid and transformed Pseudomonas fluorescens
US5169760A (en) 1989-07-27 1992-12-08 Mycogen Corporation Method, vectors, and host cells for the control of expression of heterologous genes from lac operated promoters
US5281532A (en) 1983-07-27 1994-01-25 Mycogen Corporation Pseudomas hosts transformed with bacillus endotoxin genes
US5527883A (en) 1994-05-06 1996-06-18 Mycogen Corporation Delta-endotoxin expression in pseudomonas fluorescens
WO1997004110A1 (en) 1995-07-14 1997-02-06 Somatogen, Inc. Methods for increasing protein expression

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4511503A (en) 1982-12-22 1985-04-16 Genentech, Inc. Purification and activity assurance of precipitated heterologous proteins
DK594084A (da) * 1984-12-12 1986-06-13 Novo Industri As Fremgangsmaade til stabilisering af extra-chromosomale elementer i bakterier under dyrkning
GB8517071D0 (en) 1985-07-05 1985-08-14 Hoffmann La Roche Gram-positive expression control sequence
US5232840A (en) * 1986-03-27 1993-08-03 Monsanto Company Enhanced protein production in bacteria by employing a novel ribosome binding site
JP2600090B2 (ja) 1991-04-19 1997-04-16 農林水産省農業環境技術研究所長 宿主ベクター系
US6566121B1 (en) * 1991-06-13 2003-05-20 Albert Einstein College Of Medicine Of Yeshiva University Insertional mutations in mycobacteria
US5691185A (en) * 1993-10-08 1997-11-25 Chr. Hansen A/S Lactic acid bacterial suppressor mutants and their use as selective markers and as means of containment in lactic acid bacteria
AU1467399A (en) 1997-11-20 1999-06-15 William Marsh Rice University Lactose repressor proteins with altered ligand responsivity
US7390645B2 (en) * 1997-11-20 2008-06-24 William Marsh Rice University Lactose repressor proteins with increased operator DNA binding affinity
DE19801120A1 (de) * 1998-01-15 1999-07-22 Basf Ag Orotidin-5'-Phosphatdecarboxylase-Gen, Genkonstrukt enthaltend dieses Gen und seine Verwendung
JP4320689B2 (ja) 1998-06-16 2009-08-26 株式会社力王 履物用先芯
US6291245B1 (en) * 1998-07-15 2001-09-18 Roche Diagnostics Gmbh Host-vector system
EP0972838B1 (en) * 1998-07-15 2004-09-15 Roche Diagnostics GmbH Escherichia coli host/vector system based on antibiotic-free selection by complementation of an auxotrophy
US6413768B1 (en) * 1998-12-02 2002-07-02 University Of Maryland Expression plasmids
AU2002311767A1 (en) * 2001-03-05 2002-11-05 University Of Virginia Patent Foundation A lac operator-repressor system
US20040005676A1 (en) * 2002-01-23 2004-01-08 Diversa Corporation Biocatalytic reduction of nitro groups
MXPA04007886A (es) * 2002-02-13 2004-10-15 Dow Global Technologies Inc Sobre-expresion de genes de extremozimo en pseudomonadas y bacterias estrechamente relacionadas.
DE10214406A1 (de) * 2002-03-30 2003-10-09 Nutrinova Gmbh Verfahren und Marker zur einfachen Transformation und Selektion von rekombinanten Protisten
ATE443767T1 (de) * 2002-04-22 2009-10-15 Dow Global Technologies Inc Kostengünstige herstellung von peptiden
CA2545610C (en) 2003-11-19 2014-03-25 Dow Global Technolgies Inc. Auxotrophic pseudomonas fluorescens bacteria for recombinant protein expression

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4755465A (en) 1983-04-25 1988-07-05 Genentech, Inc. Secretion of correctly processed human growth hormone in E. coli and Pseudomonas
US4680264A (en) 1983-07-01 1987-07-14 Lubrizol Genetics, Inc. Class II mobilizable gram-negative plasmid
US5281532A (en) 1983-07-27 1994-01-25 Mycogen Corporation Pseudomas hosts transformed with bacillus endotoxin genes
US4695455A (en) 1985-01-22 1987-09-22 Mycogen Corporation Cellular encapsulation of pesticides produced by expression of heterologous genes
US4861595A (en) 1985-06-28 1989-08-29 Mycogen Corporation Cellular encapsulation of biologicals for animal and human use
US5128130A (en) 1988-01-22 1992-07-07 Mycogen Corporation Hybrid Bacillus thuringiensis gene, plasmid and transformed Pseudomonas fluorescens
US5055294A (en) 1988-03-03 1991-10-08 Mycogen Corporation Chimeric bacillus thuringiensis crystal protein gene comprising hd-73 and berliner 1715 toxin genes, transformed and expressed in pseudomonas fluorescens
US5169760A (en) 1989-07-27 1992-12-08 Mycogen Corporation Method, vectors, and host cells for the control of expression of heterologous genes from lac operated promoters
US5527883A (en) 1994-05-06 1996-06-18 Mycogen Corporation Delta-endotoxin expression in pseudomonas fluorescens
US5840554A (en) 1994-05-06 1998-11-24 Mycogen Corporation β-Endotoxin expression in pseudomonas fluorescens
WO1997004110A1 (en) 1995-07-14 1997-02-06 Somatogen, Inc. Methods for increasing protein expression

Non-Patent Citations (35)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Molecular Biology", 1994
BAYSSE ET AL: "Impact of mutations in hemA and hemH genes on pyoverdine production by Pseudomonas Fluorescens ATCC17400", FEMS MICROBIOLOGY LETTERS, vol. 205, 2001, pages 57 - 63, XP002985900 *
CG GLASCOCK; M J WEICKERT: "Using chromosomal lacIQ1 to control expression of genes on high-copy number plasmids in Esrcberichia coli", GENE, vol. 223, no. 1-2, 1998, pages 221 - 31
CLARK-CURTISS; CURTISS ET AL.: "Methods in Enzymology", vol. 101, 1983, pages: 347 - 362
COLIGAN ET AL.: "Current Protocols in Protein Science", 1996, WILEY/GREENE
D. BOLLAG ET AL.: "Protein Methods", 1996, WILEY-LISA, INC.
D.G. HIGGINS; P.M. SHARP, COMP. APPL'NS IN BIOSCI., vol. 5, 1989, pages 151 - 53
DEUTSCHER: "Guide to Protein Purification", METHODS IN ENZYMOLOGY, vol. 182, 1990
ELLIS ET AL: "Novel Bacillus thuringiensis Binary Insecticidal Crystal Proteins Active on Western Corn Rootworm, Diabrotica virgifera vergifera LeConte", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 68, no. 3, March 2002 (2002-03-01), pages 1137 - 1145, XP002985898 *
EL-SAYED: "Quorum-sensing -dependent regulation of biosynthesis of the polyketide antibiotic mupirocin in Pseudomonas fluorescens NCIMB 10586", MICROBIOLOGY, vol. 147, no. 8, 2001, pages 2127 - 2139, XP002985897 *
EUR. J. BIOCHEM., vol. 181, no. 3, 1989, pages 563 - 70
F. HEFFRON ET AL., PROC. NAT'L ACAD. SCI. USA, vol. 72, no. 9, September 1975 (1975-09-01), pages 3623 - 27
FUKUMOTO ET AL: "Transformation of pBR322-Derived Plasmids in Phytopathogenic Pseudomonas avenae and Enhanced Transformation in Its Proline-Auxotrophic Mutant", CURRENT MICROBIOLOGY, vol. 34, 1997, pages 138 - 143, XP002985899 *
GA SPRENGER ET AL., FEMS MICROBIOL. LETT., vol. 37, no. 3, 1986, pages 299 - 304
GENE, vol. 73, no. 1, 15 December 1988 (1988-12-15), pages 237 - 44
GR BARKER ET AL., BIOCHEM. J., vol. 157, no. 1, 1976, pages 221 - 27
J. MOLEC. BIOL., vol. 147, 1981, pages 195 - 97
K. NAGAHARI; K. SAKAGUCHI, J. BACT., vol. 133, no. 3, March 1978 (1978-03-01), pages 1527 - 29
KRIEGLER: "Gene Transfer and Expression: A Laboratory Manual", 1990
METHODS MOLEC. BIOL., vol. 25, 1994, pages 365 - 89
MH LEE ET AL., PROTEIN EXPR. PURIF., vol. 25, no. 1, 2002, pages 166 - 73
MORRISON, J., BACT., vol. 132, 1977, pages 349 - 351
MULLER: "Repression of lac promoter as a function of distance, phase, and quality of an auxiliary lac operator", J.MOL.BIOL., vol. 257, 1996, pages 21 - 29
NEEDLEMAN; C.D. WUNSCH, J. MOLEC. BIOL., vol. 48, no. 3, March 1970 (1970-03-01), pages 443 - 53
RIESENBERG, D.; SCHULZ, V.; KNORRE, W. A.; POHL, H. D.; KORZ, D.; SANDERS, E. A.; ROSS, A.; DECKWER, W. D.: "High cell density cultivation of Escherichia coli at controlled specific growth rate", J BIOTECHNOL, vol. 20, no. 1, 1991, pages 17 - 27
S. ROE: "Protein Purification Techniques: A Practical Approach", 2001, OXFORD PRESS
SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989
See also references of EP1692282A4 *
SKOGMAN, S. G.; NILSSON, J.: "Temperature-dependent retention of a tryptophan operon- bearing plasmid in Escherichia coli", GENE, vol. 31, no. 1-3, 1984, pages 117 - 22
T.F. SMITH; M.S. WATERMAN, APPL. MATH., vol. 2, 1981, pages 482 - 89
TJ KERR; GJ TRITZ, J. BACT., vol. 115, no. 3, September 1973 (1973-09-01), pages 982 - 86
W.K. CHO ET AL., J. BIOTECHNOLOGY, vol. 77, no. 2-3, 2000, pages 169 - 78
W.R. PEARSON, GENOMICS, vol. 11, no. 3, November 1991 (1991-11-01), pages 635 - 50
W.R. PEARSON, METHODS MOLEC. BIOL., vol. 24, pages 307 - 31
W.R. PEARSON; D.J. LIPMAN, PROC. NAT'L ACAD. SCI. USA, vol. 85, April 1988 (1988-04-01), pages 2444 - 48

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10041102B2 (en) 2002-10-08 2018-08-07 Pfenex Inc. Expression of mammalian proteins in Pseudomonas fluorescens
US9458487B2 (en) 2002-10-08 2016-10-04 Pfenex, Inc. Expression of mammalian proteins in pseudomonas fluorescens
US9453251B2 (en) 2002-10-08 2016-09-27 Pfenex Inc. Expression of mammalian proteins in Pseudomonas fluorescens
US8288127B2 (en) 2003-11-19 2012-10-16 Pfenex, Inc Protein expression systems
US9109229B2 (en) 2004-07-26 2015-08-18 Pfenex Inc. Process for improved protein expression by strain engineering
US9394571B2 (en) 2007-04-27 2016-07-19 Pfenex Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US10689640B2 (en) 2007-04-27 2020-06-23 Pfenex Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
US9580719B2 (en) 2007-04-27 2017-02-28 Pfenex, Inc. Method for rapidly screening microbial hosts to identify certain strains with improved yield and/or quality in the expression of heterologous proteins
WO2009068554A1 (en) * 2007-11-29 2009-06-04 Novozymes A/S Synthase inhibitor screening method
EP2227553A4 (en) * 2007-11-30 2011-01-19 Scarab Genomics Llc Lac expression system
WO2010008764A1 (en) * 2008-06-23 2010-01-21 Dow Global Technologies Inc. Pseudomonas fluorescens strains for production of extracellular recombinant protein
US8623652B2 (en) * 2009-04-06 2014-01-07 Lucigen Corporation Host-vector system for cloning and expressing genes
US20100255561A1 (en) * 2009-04-06 2010-10-07 Eric Steinmetz Host-vector system for cloning and expressing genes
AU2016203224B2 (en) * 2009-05-11 2018-02-15 Pelican Technology Holdings, Inc. Production of recombinant proteins utilizing non-antibiotic selection methods and the incorporation of non-natural amino acids therein
AU2010247938B2 (en) * 2009-05-11 2016-02-18 Pelican Technology Holdings, Inc. Production of recombinant proteins utilizing non-antibiotic selection methods and the incorporation of non-natural amino acids therein
US9243253B2 (en) 2009-05-11 2016-01-26 Pfenex, Inc. Production of recombinant proteins utilizing non-antibiotic selection methods and the incorporation of non-natural amino acids therein
EP2430164A4 (en) * 2009-05-11 2012-10-31 Pfenex Inc PREPARATION OF RECOMBINANT PROTEINS DUE TO NON-ANTIBIOTIC SELECTION PROCEDURES AND INSTALLATION OF NON-NATURAL AMINO ACIDS
US9611499B2 (en) 2010-03-04 2017-04-04 Pfenex Inc. Method for producing soluble recombinant interferon protein without denaturing
US9187543B2 (en) 2010-03-04 2015-11-17 Pfenex Inc. Method for producing soluble recombinant interferon protein without denaturing
US8906636B2 (en) 2010-03-30 2014-12-09 Pfenex Inc. High level expression of recombinant toxin proteins
WO2013022358A1 (en) * 2011-08-11 2013-02-14 Instytut Biotechnologii I Antybiotykow Expression cassette, use of the expression cassette, expression vector, prokaryotic host cell comprising expression vector, bacterial strain and a method for producing a polypeptide
US9849177B2 (en) 2012-05-01 2017-12-26 Pfenex Inc. Process for purifying recombinant plasmodium falciparum circumsporozoite protein
US9169304B2 (en) 2012-05-01 2015-10-27 Pfenex Inc. Process for purifying recombinant Plasmodium falciparum circumsporozoite protein
CN113025601A (zh) * 2019-12-25 2021-06-25 上海奥博生物医药技术有限公司 腈水解酶启动子优化表达及应用

Also Published As

Publication number Publication date
KR101237651B1 (ko) 2013-02-27
JP5087741B2 (ja) 2012-12-05
US20050186666A1 (en) 2005-08-25
CN1906294A (zh) 2007-01-31
CA2545610C (en) 2014-03-25
EP1692282A1 (en) 2006-08-23
US8288127B2 (en) 2012-10-16
MXPA06005634A (es) 2006-08-23
KR20060132587A (ko) 2006-12-21
EP1692282B1 (en) 2012-08-08
CA2545610A1 (en) 2005-06-09
AU2004293810A1 (en) 2005-06-09
JP2007511238A (ja) 2007-05-10
BRPI0416744A (pt) 2007-01-16
AU2004293810B2 (en) 2010-07-01
JP2012100669A (ja) 2012-05-31
EP1692282A4 (en) 2008-04-02
US20090325230A1 (en) 2009-12-31
CN1906294B (zh) 2013-09-11

Similar Documents

Publication Publication Date Title
US8288127B2 (en) Protein expression systems
EP2430164B1 (en) Production of recombinant proteins utilizing non-antibiotic selection methods and the incorporation of non-natural amino acids therein
US8017355B2 (en) Mannitol induced promoter systems in bacterial host cells

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2545610

Country of ref document: CA

Ref document number: 2645/DELNP/2006

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2004293810

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: PA/a/2006/005634

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2004811581

Country of ref document: EP

Ref document number: 2006541422

Country of ref document: JP

Ref document number: 1020067009838

Country of ref document: KR

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Ref document number: DE

ENP Entry into the national phase

Ref document number: 2004293810

Country of ref document: AU

Date of ref document: 20041119

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004293810

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 200480040702.7

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2004811581

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020067009838

Country of ref document: KR

ENP Entry into the national phase

Ref document number: PI0416744

Country of ref document: BR