WO2005034853A2 - Uses of interferons with altered spatial structure - Google Patents

Uses of interferons with altered spatial structure Download PDF

Info

Publication number
WO2005034853A2
WO2005034853A2 PCT/US2004/028067 US2004028067W WO2005034853A2 WO 2005034853 A2 WO2005034853 A2 WO 2005034853A2 US 2004028067 W US2004028067 W US 2004028067W WO 2005034853 A2 WO2005034853 A2 WO 2005034853A2
Authority
WO
WIPO (PCT)
Prior art keywords
interferon
super
virus
rsifn
compound interferon
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/028067
Other languages
English (en)
French (fr)
Other versions
WO2005034853A3 (en
Inventor
Guangwen Wei
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
HUIYANGTECH (USA) Inc
Original Assignee
HUIYANGTECH (USA) Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=34280101&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2005034853(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to CA2535982A priority Critical patent/CA2535982C/en
Priority to HK06113460.8A priority patent/HK1091756B/en
Priority to KR1020127029545A priority patent/KR101431172B1/ko
Priority to EP04809634.1A priority patent/EP1663110B1/en
Priority to SI200432135T priority patent/SI1663110T1/sl
Priority to AU2004279350A priority patent/AU2004279350B2/en
Priority to DK04809634.1T priority patent/DK1663110T3/en
Application filed by HUIYANGTECH (USA) Inc filed Critical HUIYANGTECH (USA) Inc
Priority to ES04809634.1T priority patent/ES2473622T3/es
Priority to KR1020147010659A priority patent/KR20140059302A/ko
Priority to PL04809634T priority patent/PL1663110T3/pl
Priority to KR1020157023278A priority patent/KR20150103335A/ko
Priority to JP2006524916A priority patent/JP5663768B2/ja
Priority to CN2005100511050A priority patent/CN1740197B/zh
Publication of WO2005034853A2 publication Critical patent/WO2005034853A2/en
Anticipated expiration legal-status Critical
Publication of WO2005034853A3 publication Critical patent/WO2005034853A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K1/00General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/16Antivirals for RNA viruses for influenza or rhinoviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/56IFN-alpha
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2299/00Coordinates from 3D structures of peptides, e.g. proteins or enzymes

Definitions

  • This invention is related to a recombinant super-compound interferon (rSIFN-co) with changed spatial configuration.
  • rSIFN-co recombinant super-compound interferon
  • One characteristic of rSIFN-co in this invention is that it cannot only inhibit DNA (deoxyribonucleic acid) duplication of the hepatitis B virus but also the secretion of HBsAg and HBeAg.
  • rSIFN-co is a new interferon molecule constructed with the most popular conservative amino acid found in natural human ⁇ -IFN subtypes using genetic engineering methods .
  • United States Patent Nos. 4,695,623 and 4,897,471 have described it. rSIFN-co had been proven to have broad-spectrum IFN activity and virus- and tumor-inhibition and natural killer cell activity.
  • United States Patent No. 5,372,808 by Amgen, Inc. addresses treatment rSIFN-co .
  • Chinese Patent No. 97193506.8 by Amgen, Inc. addresses re-treatment of rSIFN- co on hepatitis C.
  • Chinese Patent No. 98114663.5 by Shenzhen Jiusheng Bio-engineering Ltd. addresses rSIFN-co treatment for hepatitis B and hepatitis C.
  • FDA United States Food and Drug Administration
  • Hepatitis B patients can be identified when detecting HBsAg and the HBeAg.
  • -IFN is commonly used in clinics to treat hepatitis B.
  • IFN binds superficial cell membrane receptors, inhibiting DNA and RNA (ribonucleic acid) duplication, including inducing some enzymes to prevent duplication of the virus in hepatitis-infected cells. All IFNs can inhibit only the DNA duplication of viruses, not the e and s antigen.
  • This disclosure describes recombinant super-compound interferon, method to produce the same and uses thereof.
  • SARS severe acute respiratory syndrome
  • H5N1 avian influenza virus
  • H5N1 is an infectious disease in birds caused by type A strains of the influenza virus.
  • Laboratories in the WHO global influenza network have been working to control the virus and prevent further human deaths.
  • antiviral drugs are only effective in treating or preventing influenza A virus strains against those who are of fair health. See http://www.who.int/csr/don/2004_01_15/en, January 15, 2004.
  • the super-compound interferon disclosed herein is capable of inhibiting, preventing and/or treating the hepatitis viruses, SARS virus, or virus-induced upper respiratory diseases, and the avian influenza virus.
  • This invention provides a method for inhibiting, preventing or treating viral diseases or tumors in a subject comprising administering to the subject an effective amount of the super-compound interferon or its equivalent .
  • This invention provides the above-described method wherein super-compound interferon is administered orally via vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal or mucosal administration, or by inhalation via an inspirator.
  • This invention provides the method to prevent or treat viral diseases wherein the viral diseases is hepatitis A, hepatitis B, hepatitis C, other types of hepatitis, infections of viruses caused by Epstein-Barr virus, Cytomegalovirus , herpes simplex viruses, or other types of herpes viruses, papovaviruses , poxviruses, picornaviruses, adenoviruses, rhinoviruses, human T-cell leukemia viruses I, or human T-cell leukemia viruses II, or human T-cell leukemia virus III .
  • the viral diseases is hepatitis A, hepatitis B, hepatitis C, other types of hepatitis, infections of viruses caused by Epstein-Barr virus, Cytomegalovirus , herpes simplex viruses, or other types of herpes viruses, papovaviruses , poxviruses, picornaviruses, adenoviruses, rhinoviruse
  • This invention provides a method for anti-hepatitis activities. It can inhibit HBV-DNA replication, HBsAg and HBeAg production.
  • This invention provides a method to prevent or treat upper respiratory infection diseases .
  • This invention provides a method to prevent or treat tumors or cancers wherein the tumor is skin cancer, basal cell carcinoma and malignant melanoma, renal cell carcinoma, liver cancer, thyroid cancer, rhinopharyngeal cancer, solid carcinoma, prostate cancer, stomach/abdominal cancer, esophageal cancer, rectal cancer, pancreatic cancer, breast cancer, ovarian cancer, and superficial bladder cancer, hemangioma, epidermoid carcinoma, cervical cancer, non-small-cell lung cancer, small-cell lung cancer, glioma, leucocythemia, acute leucocythemia and chronic leucocythemia, chronica myelocytic leukemia, hairy cell leukemia, lymphadenoma, multiple myeloma, polycythernia vera, or Kaposi's sarcoma.
  • This invention provides a method for preventing or treating Severe Acute Respiratory Syndrome (SARS) or virus-induced upper respiratory diseases in a subject comprising administering to the subject an effective amount of recombinant super-compound interferon or a functional equivalent thereof .
  • SARS Severe Acute Respiratory Syndrome
  • the super-compound interferon may be administered orally, via vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal or mucosal administration, or by inhalation via an inspirator.
  • This invention provides a method for inhibiting the causative agent of Severe Acute Respiratory Syndrome, or virus-induced upper respiratory diseases, comprising contacting the agent with an effective amount of super- compound interferon or its equivalent.
  • This invention also provides a method for inhibiting Severe Acute Respiratory Syndrome virus, Severe Acute Respiratory Syndrome virus-infected cells, or virus-induced upper respiratory diseases, comprising contacting an effective amount of the super-compound interferon with said virus or cells. This contact could be direct or indirect.
  • This invention provides a composition comprising an effective amount of the super-compound interferon capable of inhibiting, preventing or treating Severe Acute Respiratory Syndrome virus, Severe Acute Respiratory Syndrome virus-infected cells, or virus-induced upper respiratory diseases, and a suitable carrier.
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of the recombinant super- compound interferon capable of inhibiting, preventing or treating Severe Acute Respiratory Syndrome, Severe Acute Respiratory Syndrome virus-infected cells, or virus-induced upper respiratory diseases in a subject, and a pharmaceutically acceptable carrier.
  • Figure 6-A Circular Dichrois spectrum of Infergen ® (Tested by Analysis and Measurement Center of Sichuan
  • Samples contains 30 ⁇ g/ml IFN-conl, 5.9 mg/ml of NaCl and
  • Infergen ® (interferon alfacon-1) , made by Amgen Inc., also known as consensus interferon, is marketed for the treatment of adults with chronic hepatitis C virus (HCV) infections. It is currently the only FDA-approved, bio- optimized interferon developed through rational drug design and the only interferon with data on the label specifically for non-responding or refractory patients. InterMune's sales force re-launched Infergen ® in January 2002 with an active campaign to educate U.S. hepatologists about the safe and appropriate use of Infergen ® , which represents new hope for the more than 50 percent of HCV patients who fail other currently available therapies . See http: //www. intermune.com/wt/itmn/infergen, 8/27/2003 Figure 6-B. Circular Dichroism spectrum of Infergen ® From
  • Circular dichroism spectra of concensus interferon subforms Concensus interferon was fractionated using an anion exchange column. Samples were dialyzed into lOmM sodium phosphate, pH 7.4. Measurements were made on Jasco J-170 spectopolarimeter, in a cell thermostat at 15 a C. ( ), acylated form; ( — ) cis terminal form; ( ⁇ • • ), met terminal form.
  • Samples contains 0.5mg/ml rSIFN-co, 5.9 mg/ml of NaCl and
  • Samples contains 30 ⁇ g/ml rSIFN-co, 5.9 mg/ml of NaCl and
  • FIG. 7A-C Recombinant Super-Compound Interferon Spray Height: 90 mm Width: 25mm (bottom) , 6mm (top) Weight: 9g Volume delivery: 0.1 ml
  • Figure 7D Recombinant Super-Compound Interferon Spray
  • FIG. 9A-1 Curves of Changes of Body Temperature in Group A (5 patients) This figure is the record of body temperature changes of 5 patients in Group A.
  • This figure is the record of body temperature changes of the other 6 patients in Group A.
  • This figure is the record of body temperature changes of 5 patients in Group B.
  • This figure is the record of body temperature changes of the other 5 patients in Group B .
  • This invention provides a method for producing a recombinant super-compound interferon with changed spatial configuration and enhanced antiviral activity comprising steps of:
  • This invention provides the method for producing interferon, further comprising recovery of the expressed interferon.
  • This invention provides a recombinant super-compound interferon or an equivalent thereof with changed spatial configuration.
  • This invention reveals that proteins with the same primary sequence might have different biological activities. As illustrated in the following example, this invention discloses two proteins with identical amino acid sequences but with different activities. The efficacy of this activity may sometimes be improved and, sometimes, the protein with changed spatial configuration would reveal new function .
  • An equivalent is a molecule which is similar in function to the compound interferon.
  • An equivalent could be a deletion, substitution, or replacement mutant of the original sequence.
  • Mimics could be a peptide, polypeptide or a small chemical entity.
  • the interferon described herein includes but is not limited to interferon , ⁇ , or ⁇ . In an embodiment, it is IFN-la, IFN-2b or other mutants .
  • the super-compound interferon disclosed has higher efficacy than the interferon described in U.S. Patent Nos. 4,695,623 or 4,897,471.
  • This super-compound interferon is believed to have unique secondary or tertiary structure. (See e.g. Figure 6.)
  • the super-compound interferon described herein has spatial structure change (s) resulting from the changes of its production process.
  • the above-described super-compound interferon may be produced by a high-efficiency expression system which uses a special promoter.
  • the promoter is P BAD -
  • Other inducible promoters such as heat shock promoters or heavy metal inducible promoters, may be used in this invention.
  • the super-compound interferon may also be produced with its gene as artificially synthesized cDNA with adjustment of its sequence from the wild-type according to codon preference of E. Coli . Extensive discussion of said codon usage (preference) may be found in U.S. Patent No. 4,695,623. See e.g. column 6, line 41 - column 7, line 35.
  • the above-described super-compound interferon possesses anti-viral or anti-tumor activity, and; therefore, is useful in inhibiting, preventing and treating viral diseases, tumors, or cancers.
  • viral diseases include, but are not limited to, hepatitis A, hepatitis B, hepatitis C, other types of hepatitis, infections caused by Epstein-Barr virus, Cytomegalovirus, herpes simplex viruses, other herpes viruses, papovaviruses, poxviruses, picornaviruses, adenoviruses, rhinoviruses, human T-cell leukemia virus I, human T-cell leukemia virus II, or human T-cell leukemia virus III.
  • Viral upper respiratory infection alternative names common cold, colds. This is a contagious viral infection of the upper respiratory tract characterized by inflammation of the mucous membranes, sneezing, and a sore throat . It is usually caused by over 200 different viruses, known as rhinoviruses . Colds are not caused by the same viruses responsible for influenza. Colds are spread through droplets from the coughing or sneezing of others with a cold or by hand contact with objects contaminated by someone with a cold. The incidence of colds is highest among children, and the incidence decreases with age because immunity to the virus causing the cold occurs after the illness. Gradually, immunity to a wide variety of viruses that cause colds is developed in adults. Children may have 10 colds a year, and adults may have 3 colds a year .
  • URIs upper respiratory tract infections
  • the common cold is most often caused by one of several hundred rhinoviruses (52%), but coronaviruses (8%) or the respiratory syncytial virus (7%) may also lead to infection.
  • Other viruses such as influenza (6%) , parainfluenza, and adenoviruses, may produce respiratory symptoms, but these are often associated with pneumonia, fever, or chills.
  • the common cold is quite contagious and can be transmitted by either person-to-person contact or airborne droplets .
  • Upper respiratory symptoms usually begin 1 to 2 days after exposure and generally last 1 to 2 weeks, even though viral shedding and contagion can continue for 2 to 3 more weeks .
  • Symptoms may persist with the occurrence of complications such as sinusitis or lower respiratory involvement such as bronchitis or pneumonia.
  • the common cold has a variety of overt symptoms, including malaise, nasal stuffiness, rhinorrhea, nonproductive cough, mild sore throat, and, in some cases, a low-grade fever. Because of the similarity of symptoms, a cold may be mistaken for perennial allergic rhinitis, but allergies can usually be ruled out because of the differences in chronicity.
  • URI Super-compound Interferon to Prevent or Treat URI
  • viruses such as respiratory Syncytical virus, adenovirus, rhinovirous, cox-sackie virus, corona virus and its variant, influenza A virus and its variant, influenza B virus and its variant, parainfluenza virus and its variant, or enterovirus and its variant.
  • a main cause of URI in adults is from rhinovirous.
  • respiratory syncytical virus and parainfluenza virus are two leading causes of URI.
  • Super-compound interferon plays an important role in the fight against virus that causes URI .
  • Super-compound interferon gains its anti-virus affects mainly via two mechanisms : 1. Attach to surface of sensitive cells and induce them to produce anti-virus protein, then block the duplication and reproduction of viruses in vivo . 2.
  • Super-compound interferon can adjust immune response, including T-cell immune response, activity of NK cell, the phagocytosis function of monokaryon, and even formation of some antibodies in vivo .
  • Super-compound interferon can be directly applied to the affected area via a spray inspiration. This method of treatment allows the interferon to reach the target cells first hand. Consequently, marketing the supply as a spray, rather than via oral or injection, would be safer and more effective for administrating the interferon.
  • this invention provides a method for inhibiting, preventing or treating virus replication or virus-infected cells by contacting said virus or infected cells with an effective amount of the super-compound interferon or its equivalent ,
  • This super-compound interferon is useful in inhibiting, preventing or treating the following cancers or tumors:
  • Basal Cell Carcinoma Skin Cancer Malignant Melanoma Renal cell carcinoma Liver Cancer Thyroid Cancer Rhinopharyngeal Cancer Prostate Cancer Stomach/Abdominal Cancer Solid Carcinoma Esophageal Cancer Cancer Rectal Cancer Pancreatic Cancer Breast Cancer Ovarian Cancer & Superficial Bladder Cancer Hemangioma Cervical Cancer Epidermoid Carcinoma Non-small Cell Lung Cancer Small Cell Lung Cancer Glioma Malignant Acute Leucocythemia Leucocythemia Hemal Chronic Leucocythemia Disease Chronic Myelocytic Leukemia Hairy Cell Leukemia Lymphadenoma Multiple Myeloma Patient #1. A female patient with ovarian cancer started receiving injections.
  • Patient #2 A kidney cancer patient was treated in the following manner. In a half-month period, the patient was given 3 injections of 9 ⁇ g of rSIFN-co and 3 injections of 15 ⁇ g of rSIFN-co. In the one full month following these injections, he received 9 ⁇ g and 15/xg injections of rSIFN-co every other day. A kidney biopsy showed no metastasis after this course of treatment . The patient showed a full recovery. Every half year after recovery, the patient received 15 ⁇ g injections of rSIFN-co 15 times over a one- month period.
  • this invention provides a method for inhibiting tumor or cancer cell growth by contacting the super-compound interferon or its equivalent with said tumor or cancer cells .
  • the super-compound interferon inhibits the DNA duplication and secretion of HBsAg and HBeAg of Hepatitis B Virus.
  • This invention also provides artificial gene codes for the super-compound interferon or its equivalent. It is within the ordinary skill to design an artificial gene. Many methods for generating nucleotide sequence and other molecular biology techniques have been described previously. See for example, Joseph Sambrook and David W. Russell, Molecular Cloning: A laboratory Manual, December 2000, published by Cold Spring Harbor Laboratory Press.
  • This invention provides a vector comprising the gene which codes for the super-compound interferon or its equivalent .
  • This invention provides an expression system comprising the vector comprising the gene which codes for the super- compound interferon or its equivalent.
  • the cells include, but are not limited to, prokaryotic or eukaryotic cells.
  • This invention also provides a host cell comprising the vector comprising the gene which codes for the super- compound interferon or its equivalent .
  • This invention provides a process for production of recombinant super-compound interferon comprising introducing an artificial gene with selected codon preference into an appropriate host, culturing said introduced host in an appropriate condition for the expression of said compound interferon and harvesting the expressed compound interferon.
  • the process may comprise extraction of super-compound interferon from fermentation broth, collection of inclusion body, denaturation and renaturation of the harvested protein.
  • the process may maintain the high efficacy even when the super-compound interferon is used with an agent and in a particular concentration.
  • the process also comprises separation and purification of the super-compound interferon.
  • the process further comprises lyophilization of the purified super-compound interferon.
  • the process comprises production of liquid injection of super-compound interferon.
  • This invention also provides the produced super-compound interferon by the above processes.
  • This invention provides a composition comprising the recombinant super-compound interferon or its equivalent and a suitable carrier.
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the recombinant super-compound interferon or its equivalent and a pharmaceutically acceptable carrier.
  • This invention provides a method for treating or preventing viral diseases or tumors in a subject comprising administering to the subject an effective amount of the super-compound interferon or its equivalent.
  • the viral diseases include, but are not limited to, hepatitis A, hepatitis B, hepatitis C, other types of hepatitis, infections of viruses caused by Epstein-Barr virus, Cytomegalovirus, herpes simplex viruses, or other type of herpes viruses, papovaviruses, poxviruses, picornaviruses, adenoviruses, rhinoviruses, human T-cell leukemia viruses I, or human T-cell leukemia viruses II, or human T-cell leukemia virus III.
  • This invention provides the above-described method wherein super-compound interferon was administered via orally via vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal or mucosal administration, or by inhalation via an inspirator.
  • This invention provides the above-described method wherein super-compound interferon was administered following the protocol of injections of 9 ⁇ g or 15 ⁇ g every two days, 3 times a week, for 24 weeks.
  • rSIFN-co the spatial structure of which has been changed, is not only a preparation to inhibit the DNA duplication of hepatitis B, but to inhibit the secretion of HBsAg and HBeAg on 2.2.15 cells .
  • One objective of this invention is to offer a preparation of rSIFN-co to directly inhibit the DNA duplication of hepatitis B viruses and the secretion of HBeAg and HBsAg of hepatitis B and decrease them to normal levels .
  • rSIFN-co was produced with recombinant techniques. On the condition of fixed amino acid sequence, the IFN DNA was redesigned according to the E. Coli . codon usage and then the rSIFN-co gene was artificially synthesized. rSIFN-co cDNA was cloned into the high- expression vector of E. Coli . by DNA recombinant techniques, and a high expression of rSIFN-co was gained by using of induce/activate-mechanism of L-arabinose to activate the transcription of P BAD promoter.
  • arabinose induction/activation system Compared with usual thermo-induction, pH induction and IPTG induction systems of genetic engineering, arabinose induction/activation system has some advantages: (1) Common systems relieve promoter function by creating a erepression" pattern. Promoters then induce downstream gene expression. Temperature and pH change and the addition of IPTG cannot activate promoters directly. In the system disclosed herein, L-arabinose not only deactivates and represses but also activates the transcription of P BAD promoter which induces a high expression of rSIFN-co. Therefore, the arabinose induction/activation system is a more effective expression system. (2) The relationship between Exogenous and L-arabinose dosage is linear. This means the concentration of arabinose can be changed to adjust the expression level of the exogenous gene.
  • This embodiment creates an effective and resistant rSIFN- co-expressing E. Coli . engineering strain with an L- arabinose induction/activation system.
  • the strain is cultivated and fermented under suitable conditions to harvest the bacterial bodies .
  • Inclusion bodies are then purified after destroying bacteria and washing repeatedly.
  • mass of high-purity, spatial-configuration- changed rSIFN-co protein for this invention and for clinical treatment was gained from denaturation and renaturation of inclusion bodies and a series of purification steps.
  • the medicine carrier could be any acceptable medicine carrier, including carbohydrates, cellulosum, adhesive, collapse, emollient, filling, add- dissolving agent, amortization, preservative, thickening agent, matching, etc.
  • This invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising the above composition and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carriers means any of the standard pharmaceutical carriers .
  • suitable carriers are well known in the art and may include, but are not limited to, any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution and various wetting agents .
  • Other carriers may include additives used in tablets, granules, capsules, etc.
  • Such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gum, glycols or other known excipients.
  • Such carriers may also include flavor and color additives or other ingredients. Compositions comprising such carriers are formulated by well-known conventional methods .
  • This invention provides a method for preventing or treating Severe Acute Respiratory Syndrome, or virus-induced upper respiratory diseases, of a subject comprising administering to the subject an effective amount of recombinant super- compound interferon or a functional equivalent thereof.
  • the interferon is a, ⁇ , or ⁇ .
  • the super-compound interferon may be administered orally, via vein injection, muscle injection, peritoneal injection, subcutaneous injection, nasal or mucosal administration, or by inhalation via an inspirator.
  • the interferon is delivered by a spray device .
  • the interferon is lyophilized.
  • This invention provides a method for inhibiting the causative agent of Severe Acute Respiratory Syndrome, or virus-induced upper respiratory diseases, comprising contacting the agent with an effective amount of super- compound interferon or its equivalent.
  • This invention also provides a method for inhibiting Severe Acute Respiratory Syndrome virus or Severe Acute Respiratory Syndrome virus-infected cells, or virus-induced upper respiratory diseases, or cells infected with viruses capable of inducing upper respiratory diseases, comprising contacting an effective amount of the super-compound interferon with said virus or cell. This contact could be direct or indirect.
  • This invention provides a composition comprising an effective amount of the super-compound interferon capable of inhibiting Severe Acute Respiratory Syndrome virus or Severe Acute Respiratory Syndrome virus-infected cells, or virus-induced upper respiratory diseases, or cells infected with viruses capable of inducing upper respiratory diseases, and a suitable carrier.
  • This invention provides a composition comprising an effective amount of the super-compound interferon capable of preventing or treating Severe Acute Respiratory Syndrome, or virus-induced upper respiratory diseases, of a subject and a suitable carrier.
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of the recombinant super- compound interferon capable of inhibiting Severe Acute Respiratory Syndrome virus or Severe Acute Respiratory Syndrome virus-infected cells, or virus-induced upper respiratory diseases, and a pharmaceutically acceptable carrier.
  • This invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of the recombinant super- compound interferon capable of preventing or treating Severe Acute Respiratory Syndrome, or virus-induced upper respiratory diseases, in a subject and a pharmaceutically acceptable carrier.
  • This invention provides a device to deliver the above- described pharmaceutical composition.
  • the subject is a human.
  • the super-compound interferon can be used in other animals or mammals .
  • This invention provides a method for preventing Severe Acute Respiratory Syndrome or virus-induced upper respiratory diseases, in humans comprising application of the super-compound interferon three times a day via a spray which contains twenty micrograms of interferon, equal to ten million units of activity in three milliliter.
  • rSIFN-co is a new interferon molecule constructed according to conservative amino acids in human IFN- ⁇ subtype using genetic engineering methods . It has been proven that rSIFN- co has broad-spectrum IFN activity, such as high antivirus and tumor inhibition activity, especially for effectively treating hepatitis C .
  • rSIFN-co cDNA was cloned into E. Coli. high-expression vector, and L- arabinose, which can activate strong P BAD promoter in vectors, was used to induce high expression of rSIFN-co gene .
  • Oligomer B 5 ' CTGAAAGACCGTCACGACTTCGGTTTCCCGCAGGAGAGGTTCGACGGTAACCAGTTCCAGA AGCTCAGGCTATCTCCGTTCTGCACGAAATGATCCAGCAGACCTTC3 ' Oligomer C: 5'GCTGCTGGTACAGTTCGGTGTAGAATTTTTCCAGCAGGGATTCGTCCCAAGCAGCGGAGGAG TCTTTGGTGGAGAACAGGTTGAAGGTCTGCTGGATCATTTC3 ' Oligomer D:
  • PCR I for Fragment I oligodeoxynucleotide B as template, oligodeoxynucleotide A and C as primers, synthesized 280 bp Fragment I .
  • PCR I mixture (units: ⁇ l) sterilized distilled water 39 lOxPfu buffer (Stratagen American Ltd.) 5 dNTP mixture (dNTP concentration 2.5 mmol/L) 2 Oligomer A primer (25 ⁇ mol/L) 1 Oligomer C primer (25 ⁇ mol/L) 1 Oligomer B template (1 ⁇ mol/L) 1 Pfu DNA polymerase (Stratagen American Ltd.) (25 U/ ⁇ l) 1 Total volume 50 ⁇ l PCR cycle: 95 I
  • PCR II for Fragment II oligodeoxynucleotide E as template, oligodeoxynucleotide D and F as primers, synthesized 268bp Fragment II.
  • PCR II mixture (units: ⁇ l) sterilized distilled water 39 lOxPfu buffer (Stratagen American Ltd.) 5 dNTP mixture (dNTP concentration 2.5mmol/L) 2 Oligomer D primer (25 ⁇ mol/L) 1 Oligomer F primer (25 ⁇ mol/L) 1 Oligomer E template (1 ⁇ mol/L) 1 Pfu DNA polymerase (Stratagen American Ltd.) (25U/ ⁇ l) 1 Total volume 50 ⁇ l PCR cycle: the same as PCR I
  • Fragment I and II were assembled together to get the complete cDNA molecular sequence of rSIFN-co using the, overlapping and extending PCR method. Restriction enzyme Nde I and Pst I were introduced to clone rSIFN-co cDNA sequence into plasmid.
  • the pHY-4 plasmid is double digested with Nde I-Xba I. Run 1% agarose gel electrophoresis and purify the 715bp fragment. Ligate the rSIFN-co and pHY-4 fragments with T4 DNA ligase to construct the recombinant plasmid (See Figure 4) . Transform DH 5 ⁇ competent cells with the recombinant plasmid. Spread the transformed cells on LB plate with Amp, 37° C culture overnight.
  • rSIFN-co gene is under the control of strong promoter P BAD - This promoter is positively and negatively regulated by the product of the gene araC.
  • AraC is a transcriptional regulator that forms a complex with arabinose. In the absence of arabinose, the AraC dimer binds 0 2 and Ii, forming a 210bp loop. This conformation leads to a complete inhibition of transcription. In the presence of arabinose, the dimer is released from 0 2 and binds Ii and I 2 leading to transcription. Arabinose binding deactivates, represses, and even activates the transcription of P B AD promoter, which stimulates P BAD inducing high expression of rSIFN-co. rSIFN-co expression level in PVTII is more than 50% of the total E. Coli . protein. Summary
  • RSIFN-CO is a new interferon molecule artificially built according to the conservative amino acid of human interferons . It has been proven as an effective anti- hepatitis drug. In order to get enough pure rSIFN-co protein, a stable recombinant E. Coli . strain which highly expresses rSIFN-co protein was constructed.
  • the rSIFN-co cDNA was cloned into E. Coli . high-expression vector pHY-4 plasmid to construct the recombinant plasmid pHY-5.
  • E. Coli . LMG194 strain was further transformed with pHY-4 plasmid to get stable rSIFN-co high-expression transformant .
  • This transformant was cultured for 30 generations.
  • the heredity of pHY-5 recombinant plasmid in E. Coli . LMG194 was normal and stable, and the expression of rSIFN-co was high and steady.
  • E. Coli . LMG194 which contains recombinant pHY-5 plasmid, is actually an ideal high-expression engineering strain.
  • Pfeffer LM Biologic activity of natural and synthetic type 1 interferons. Seminars in Oncology, 1997/24 (3 suppl 9) :S9-63--S9-69.
  • Chelating sepharoseTM fast flow Add PB buffer of 0.2 mol/L (pH 6.6) and NaCl of 4 mol/L in the solution from HS to adjust solution pH to pH 6.0 and NaCl concentration to 1 mol/L.
  • Sometimes a purification by sephacryl S-100 step can be added to meet stricter purity requirements.
  • Buffer A 100 mmol/L Tris-HCl, pH 7.5-10 mmol/L EDTA-100 mmol/L NaCl
  • Buffer B 50 mmol/L Tris-HCl, pH 7.5-1 mol/L Urea-10 mmol/L EDTA-0.5% Triton X-100
  • Buffer C 50 mmol/L Tris-HCl, pH 7.5-2 mol/L Urea-10 mmol/L EDTA-0.5% Triton X-100
  • Buffer D 1 mol/L NaCl 50 mmol/L Na 2 HP0 4 (pH 5.5)
  • Buffer E 1 mol/L NaCl 50 mmol/L Na 2 HP0 4 (pH 5.0)
  • Buffer F 1 mol/L NaCl 50 mmol/L Na 2 HP0 4 (pH 4.0)
  • Buffer G 1 mol/L NaCl 50 mmol/L Na 2 HP0 4 (pH 3.6)
  • Renaturation buffer 0.5 mol/L Arginine—150 mmol/L Tris- HCl, pH 7.5-0.2 mmol/L EDTA
  • Sample Source Samples were supplied by Sichuan Huiyang Life-engineering Ltd., Sichuan province. Lot: 990101-03, 990101-05, 990102- 03, 990102-05, 990103-03, 990103-05
  • Test samples at 25°C The test samples were put into a thermostat at 25 ⁇ 0, then the above items of these samples were respectively tested in the 1 st ' , 3 rd , 6 th , 9 th , 12 th , 18 th , 24 th , 30 th month. The results were recorded.
  • Test samples at 37°C The test samples were put into a thermostat at 37 ⁇ , then the above items of these samples were respectively tested in the 1 st ' , 3 rd , 6 th , 9 th , 12 th , 18 th , 24 th month. The results were recorded.
  • the purity of the product (rSIFN-co) from this production procedure is shown to 95% under the test of SDS-PAGE where molecular weight is 14.5 Kda .
  • the reverse phase HPLC shows a single peak and the purity is up to 97%. Its specific activity is up to lxlO 9 IU/mg protein.
  • 2% human serum albumin, 1% sucrose and 1% glucose are added to the rSIFN- co. It is then separated and lyophilized into injection sample. When tested under the Wish-WS inspection system, the result was 4.5xl0 8 IU. When tested with aseptic inspection and pyrogen inspection under the standard requirement of China, the results were negative. This result complies with the requirements for IV injection.
  • Interferon expression (cultivated in an agitating platform) matches the amount of expression in original input bacteria. (2) When tested with anti-interferon serum, a reaction is shown. (3) Plasmid inspection: Restriction digest matched with the original plasmid.
  • Bacteria strain product denotes the specimen from the original bacteria strain that was produced from the procedures shown in 1.2.
  • the bacteria strain product should be inspected as follows to make sure there is no derivation: Use LB to plate 2-3 pieces and cultivate. Separate and take 5-10 bacteria groups for the test of interferon expression. Repeat the test at least two (2) times. Only use the one which shows the highest % to be the bacteria strain product .
  • the innoculum denotes the chosen bacter strain product after fermentation.
  • the amount, cultivation time and most appropriate OD value of innoculum can be decided according to bacteria strain. An anti-polluted bacteria procedure should apply for whatever innoculum would be produced .
  • 2.5 Growing of bacteria strain Growing of bacteria strain would be done in a Bacteria Free room environment where no more than one bacterium is growing in the same room. Same culturing medium will be used for both bacteria strain and innoculum.
  • the one used in rSIFN-co is LB.
  • Fermentation only takes place in a clean fermentation room with a single bacteria fermentation environment.
  • Cleaning of fermentation container and tube is done twice, before and after the insertion of culturing medium. Then, the container should be frozen to reach the appropriate temperature for innoculum.
  • Fermentation parameters like temperature, pH value, dissolved oxygen and time required could be varied according to different types of bacterial strains .
  • Bacteria collection (1) Centrifuge the bacteria solution to collect bacteria or use another method. All apparatus should be cleaned before and after the operation. The waste solution should be drained after the cleaning procedure. (2) The bacteria should be kept under 4-8°C if they are going to be split within 24 hours. Otherwise, they should be kept under -30°C. Those are kept under such conditions can be used within 6 months .
  • Bacteria cell lysis (1) Use appropriate buffer solution to balance the bacteria strain. Cell lysis can be done by physical, chemical or biological methods. Use centrifuge to precipitate the bacteria and apply cleaning solutions . (2) If the chemical method is used to split cells, no solutions harmful to human beings should be used.
  • intermediate products include purified interferon, albumin intermediate product, and bacteria free albumin intermediate product .
  • Final product from the injection type will denote only lyophilized product.
  • the intermediate product in the topical type denotes only purified interferon.
  • the final product from the topical type denotes only separated packed liquid formed lyophilized products .
  • 2.13 Packaging There is different packaging for the injection type and the topical type .
  • 2.14 Storage The product should be kept at 4°C.
  • the purification solution should not be stored in a frozen state.
  • the expiration period is two (2) years after the lyophilization procedure for lyophilized products .
  • the expiration period is 6 months after individual packing for liquidated products .
  • Solvent and Dispensing Method Add 1ml saline into each vial, dissolve, and mix with MEM culture medium at different concentrations. Mix on the spot.
  • Control drugs IFN- ⁇ 2b (Intron A) as lyophilized powder, purchased from Schering Plough. 3xl0 6 U each, mix to 3xl0 6 IU/ml with culture medium; Infergen ® (liquid solution) , purchased from Amgen, 9 ⁇ g, 0.3ml each, equal to 9X10 6 IU, and mix with 9X10 5 IU/ml culture medium preserve at 4°C; 2.2.15 cell: 2.2.15 cell line of hepatoma (Hep G2) cloned and transfected by HBV DNA, constructed by Mount Sinai Medical Center .
  • MEM powder Gibco American Ltd. cattle fetal blood serum, HycloneLab American Ltd. G-418 (Geneticin) ; MEM dispensing, Gibco American Ltd.; L-Glutamyl, imported and packaged by JING KE Chemical Ltd. ; HBsAg and HBeAg solid- phase radioimmunoass y box, Northward Reagent Institute of Chinese Isotope Ltd.; Biograncetina, Northern China Medicine; And Lipofectin, Gibco American Ltd.
  • 2.2.15 cell culture Added 0.25% pancreatic enzyme into culture box with full of 2.2.15 cell, digest at 37°C for 3 minutes, and add culture medium to stop digest and disturb it to disperse the cells, reproduce with ratio of 1:3. They will reach full growth in 10 days.
  • Toxicity test Set groups of different concentrations and a control group in which cells are not acted on with medicine. Digest cells, and dispense to a 100,000 cell/ml solution. Inoculate to 96-well culture board, 200 ⁇ l each well, culture at 37°C for 24h with 5% C0 2 . Test when simple cell layer grows .
  • Dispense rSIFN-co to 1.8xl0 7 IU/ml solution then prepare a series of solutions diluted at two-fold gradients. Add into 96-well culture board, 3 wells per concentration. Change the solution every 4 days . Test cytopathic effect by microscope after 8 days. Fully destroy as 4, 75% as 3, 50% as 2, 25% as 1, zero as 0. Calculate average cell lesion and inhibition rate of different concentrations. Calculate TC50 and TC0 according to the Reed Muench method.
  • HBeAg and HBsAg Separate into positive and negative HBeAg and HBsAg contrast groups, cell contrast group and medicine concentration groups. Inoculate 700,000 cells/ml of 2.2.15 cell into 6-well culture board, 3 ml each well, culture at 37°C for 24h with 5% C0 2 , then prepare 5 gradiently diluted solutions with 3-fold as the grade (Prepare 5 solutions, each with a different protein concentration.
  • the concentration of Solution 2 is 3 times lower than that of Solution 1, the concentration of Solution 3 is 3 times lower than that of Solution 2, etc.) 4.5xl0 6 IU/ml, 1.5xl0 6 IU/ml, 0.5xl0 6 IU/ml, 0.17xl0 6 lU/ml, and 0.056xl0 6 lU/ml, 1 well per concentration, culture at 37°C for 24h with 5% C0 2 . Change solutions every 4 days using the same solution. Collect all culture medium on the 8 th day. Preserve at -20 °C Repeat test 3 times to estimate HBsAg and HBeAg with solid-phase radioimmunoassay box (Northward Reagent Institute of Chinese Isotope Ltd.). Estimate cpm value of each well with a ⁇ accounting machine.
  • A log>50% medicine concentration
  • B log ⁇ 50% medicine concentration
  • C log dilution power
  • Southern blot (1) HBV-DNA extract in 2.2.15 cell: Culture cell 8 days. Exsuction culture medium (Separate cells from culture medium by means of draining the culture medium. ) . Add lysis buffer to break cells, then extract 2 times with a mixture of phenol, chloroform and isoamyl alcohol (1:1:1), 10,000g centrifuge. Collect the supernatant adding anhydrous alcohol to deposit nucleic acid. Vacuum draw, re- dissolve into 20 ⁇ lTE buffer. (2) Electrophoresis: Add 6XDNA loading buffer, electrophoresis on 1.5% agarose gel, IV/cm, at fixed pressure for 14-18h.
  • Denaturation and hybridization respectively dip gel into HCl, denaturaion buffer and neutralization buffer.
  • Transmembrane Make an orderly transfer of DNA to Hybond-N membrane. Bake, hybridize and expose with dot blot hybridization. Scan and analyze relative density with gel-pro software. Calculate inhibition rate and IC50.
  • rSIFN-co to HBeAg is 46.0+5.25% (P ⁇ 0. 001)
  • IC50 is 4.54 ⁇ 1.32Xl0 5 IU/ml
  • SI is 3.96
  • rate to HBsAg is 44.8 ⁇ 6.6%
  • IC50 is 6.49 ⁇ 0.42xlO ⁇ IU/ml
  • SI is 2.77.
  • HBeAg Average IC50: 450.2434 SD: 132.315479
  • HBsAg Average IC50: 649.1894 SD: 42.29580
  • HBeAg Average IC50: 0 SD: HBsAg: Average IC50: 0 SD:
  • Preparation technique Weigh materials according to recipe.
  • Preparation Weigh materials according to recipe. Add to desired level with sterile and pyrogen-free water. Filter through 0.22 ⁇ m membrane to de-bacterialize, preserve at 6- 10°C. Fill in airtight vial after affirming it is sterile and non-pyrogen at 0.3 ml /vial or 0.5 ml/vial. Store at 2- 10°C, and protect from light.
  • mice with large dose 150 ⁇ g/kg, equal to 1000 times of the normal dose per kilo used in treatment of adult patients. Then observe and record their deaths and toxic reactions. Results show that: 24 hours after injection, no abnormal reaction had been recorded.
  • the organs of the animals which had been selected to be killed also had no signs of abnormal changes. Those remaining mice were all kept alive and were normal after two weeks.
  • the weights of mice in the experimental group and control group all increased, and the ratio of increase showed no obvious difference between the two groups (P>0.05) according to their weights on the fourteenth day. No abnormal changes were seen from the main organs of those mice after two weeks .
  • mice 40 healthy adult mice, weighing 18-22g, half male and half female, qualified by Sichuan experiment animal control center .
  • mice Separate the 40 mice into two groups randomly, one for experimental medicine, another for control. Inject medicines or saline at the same ratio (0.1 ml/10 g) through muscle to each mouse according to which group they belong. (150 ⁇ g/kg of rSIFN-co for experimental group; and saline for control group) . After injection, observe and record acute toxicity shown in mice. Kill half of the mice (male and female each half) to check whether there were any abnormal pathologic changes in their main organs, such as heart, spleen, liver, lung, kidney, adrenal gland, stomach, duodenum, etc. after 24 hours. Those that remain are kept and observed until the fourteenth day. Weigh all mice, kill them, and then observe the appearance of the organs listed above to see if there are any abnormalities. Take pathological tissue and examine it, using the examination to assess the difference in weight increases in the two groups .
  • mice were treated with i.m. rSIFN-co with 150 ⁇ g/kg at a time, equal to 1000 times the normal dose per kilo used in treatment of adult patients .
  • all mice lived well. They ate, drank, exercised, and excreted normally and showed normal hair conditions. None of them died.
  • the observation of the main organs of the randomly selected mice shows no abnormal changes 24 hours after injection. 14 days after injection, all remaining mice were killed. Autopsies also showed no changes. The weights of mice in the two groups all increased, but no obvious difference was shown when accessed with statistic method (p > 0.05). See Table 6.1:
  • mice Under conditions of this experiment, there were no toxic reactions in all mice after injection of rSIFN-co with 150 ⁇ g/kg. The conclusion can be reached that the maximum tolerable dose of i.m. in mice is 150 ⁇ g/kg, which is equal to 1000 times the normal dose per kilo used in treatment of adult patients .
  • the recombinant super-compound interferon (rSIFN-co) is an invention for viral disease therapy, especially for hepatitis. Meanwhile, it can inhibit the activity of EB viruses, VSV, Herpes simplex viruses, cornaviruses, measles viruses, et al .
  • the results showed that: the other rIFN, was 0.9xl0 8 IU/mg, Intron A was 2.0xl0 8 IU/mg and rSIFN-co was 9xl0 8 IU/mg.
  • the anti-viral activity of rSIFN- co is much higher than those of the former two.
  • Standard of patients selection Standards 1-4 are effective for both treatment with rSIFN-co (9 ⁇ g) and IFN- ⁇ lb (5MU, 50 ⁇ g) , and Standard 1-5 are for rSIFN-co (15 ⁇ g) treatment . 1) . Age: 18-65
  • ALT normal level
  • HBV-DNA negative HBeAg negative
  • Partial response ALT normal level
  • Non response ALT, HBV-DNA and HBeAg unchanged
  • the response and partial response groups were considered e fective cases . 3.
  • Group A treatment with rSIFN-co (9 ⁇ g)
  • Group B treatment with IFN- ⁇ lb (5MU, 50 ⁇ g) HBsAg HBeAg HBV-DNA Heptal er Effective Transfer Transf Transfer Period group Medicine to to to function Rate Recovery negative negative negative rate rate rate rate
  • Group C the cases were prior treatment of chronic active hepatitis B with other IFNs (3MU or 5MU) that failed or relapsed and then were treated with rSIFN-co (15 ⁇ g) , subcutaneous injection, every one day, for 24 weeks. The total cases were 13. After 12 weeks treatment, 7 of 13 (53.85%) were effective. 3 of 13 (23.08%) HBeAg transferred to negative; 7 of 13(53.85%) HBV-DNA transferred to negative; 11 of 13 (84.62%) heptal functions recovered to normal .
  • the side effects of IFN include fever, nausea, myalgia, anorexia, hair loss, leucopenia and thrombocytopenia, etc.
  • the maximum dose of IFN- ⁇ lb is 5MIU per time; the routine dose is 3 MIU.
  • 90% patients have I- II degree (WHO standard) side effects. They had fever lower than 38°C, nausea, myalgia, anorexia, etc.
  • the maximum dose of rSIFN- co is 24 ⁇ g, subcutaneous injection, every one day for 3 months.
  • the routine dose is 9 ⁇ g.
  • I-II degree WHO standard
  • side effects including fever below 38°C, nausea, myalgia, anorexia, leucopenia and slight thrombocytopenia.
  • maximum dosage about 50% patients suffered from leucopenia and thrombocytopenia after using rSIFN-co one month, but those side effects disappeared after stopping treatment for one week. It is safe for continued use.
  • the observations of rSIFN-co treat hepatitis C
  • Recombinant Super Compound Interferon Characteristic Liquid, no insoluble material
  • Pharmacology Recombinant Super-Compound Interferon has a wide spectrum of anti-virus activity. Its effects are 5-20 times higher than those interferons (IFNs) which are available on the market . It can inhibit coronavirus growth in cell culture . The mechanism is interruption of the combination reaction between the IFN and the correspondent receptor, and inducement of the expression of 2 ' 5 ' -A synthesizenzyme, protein kinase R in the target cell, therefore inhibiting expression of the viral protein. IFN can induce expression of various anti-virus proteins to inhibit the reproduce of viral proteins, enhance the function of Natural Killer (NK) cell and other Immune regulative functions, and inhibit the invasion of viruses. Acute toxicity: All mice are alive after the maximum dose
  • Dosage and Administration Spray to both nasal cavity and throat, three times a day.
  • Precautions Before first use, spray twice to expel the air. If there is any cloudy precipitation material, if the product is expired, or there is material on the vial, do not use it.
  • Virus SARS-associated coronavirus, BJ-01, supplied by Molecular Biology Department of Microorganism and Epidemiology Institute, Academy of Military Medical Science.
  • Cell medium DMEM supplemented with 10% FBS. 2.
  • Condition Virus was measured in grade 3 rd laboratory of biosafety
  • CPE (cytopathic effect) assay of TCID 50 lOO ⁇ l of Vero E 6 cells were plated in 96-well plates at 2xl0 4 cells per well. After 24 hr incubation at 37 ⁇ , Vero E6 monolayer cells were treated with 9 levels of SARS-associated coronavirus dilution by 10-fold dilution, 4 wells per dilution. The cells were incubated at 37°C and 5% C0 2 . CPE (cytopathic effect) was examined daily by microscopy. CPE less than 25% was determined as +, 26-50% as ++, 51-75% as +++, 76-100% as ++++ . CPE was recorded. Then TCID 5 0 was calculated by Reed-Muench method.
  • Cytotoxicity of medicine Vero E ⁇ cells were inoculated into 96-well plates at 2xl0 4 cells (lOOul) per well. After 24-hr incubation at 37''C, cells grew up to monolayer. The medicine was diluted into 36, 18, 9, 4.5, 2.25 ⁇ g /ml (final concentration) and added into wells each for 4 wells. The normal cells as control group were set. CPE of medicine group was daily observed during 5 -day period, and then the concentration of medicine exhibiting no toxicity was determined. CPE assay of the activity of the medicine against SARS- associated coronavirus: lOO ⁇ l of Vero E ⁇ cells were plated in 96-well plates at 2xl0 4 cells per well.
  • Toxicity of virus TCID50 of virus was IO -8 .
  • Cytotoxicity of medicine the concentration of Recombinant compound interferon exhibiting no cytotoxicity was 18 ⁇ g/ml, the cells shape was similar with the control group, and no cytopathic effect was exhibited.
  • Vero E 6 supplied by Molecular Biology Department of Microorganism and Epidemiology Institute, Academy of Military Medical Science.
  • Virus SARS-associated coronavirus, BJ-01, supplied by Molecular Biology Department of Microorganism and Epidemiology Institute, Academy of Military Medical Science. Condition: Viruses were measured in grade 3 rd laboratory of biosafety
  • TCID 50 was measured with CPE assay: Vero E ⁇ cells were inoculated in 96-well plates at 2xl0 4 cells (lOO ⁇ l) per well. After a 24-hr incubation at 37°C, Vero E6 monolayers were treated with 9 levels of SARS-associated coronavirus dilution by 10 times decreasing, each dilution per 4 wells. The cells were incubated at 37 ⁇ and 5% carbon dioxide. CPE was examined daily by phase-contrast microscopy. CPE less than 25% was determined as +, 26-50% as ++, 51-75% as +++, 76-100% as ++++. CPE was recorded. Then TCID 50 was calculated by Reed-Muench method.
  • TC 50 of IFNs were measured by MTT assay: Vero E 6 cells were inocuiated in 96-well plates at 2xl0 4 cells per well (lOO ⁇ l) . After 24-hr incubation at 37°C, the supernatant liquid was removed when cells grew up to monolayer, then Vero E 6 was treated with different concentration of IFNs, each dilution per 4 wells. Normal group was set. After 5- day observation, the cells were mixed with MTT for 4 hours. After that, remove the liquid, and then thereafter DMSO were added into cells for 0.5 hour . The OD 57 onm was measured by microplate reader. Finally, TC 50 was calculated by Reed- Muench method.
  • the activity of the INFs against SARS-associated coronavirus was measured with MTT assay: lOO ⁇ l of Vero E ⁇ cells were inoculated in 96-well plates at 2xl0 4 cells per well. After 24-hr incubation 37 ⁇ , cells became monolayer. The medicine dilution at the concentration of exhibiting no cytotoxicity was 5 times decreasing and there were 5 levels of dilution. Then each dilution was added to 4 wells, lOOul per well. After 24-hour incubation at 37°C and 5% C0 2 , IFN solution was removed, then different concentrations of virus dilution (10000, 1000, 100 TCID 50 ) were added into dishes, 4 wells per dilution.
  • the cells were divided into the normal group, the medicine control group, and the different dilution of virus control group (10000, 1000, 100 TCID 50 ) .
  • the cells were incubated at 37 ⁇ and 5% C0 2 for 48- 72hr, until cytopathic effect was exhibited in the virus control group, CPE was recorded (CPE less than 25% was determined as +, 26-50% as ++, 51-75% as +++, 76-100% as ++++, normal cell as -) .
  • the growth ability of cells was measured with MTT assay, and then the antivirus effect of the INFs was evaluated. The experiment was repeated 3 times .
  • IC 5 0 of the medicine was calculated by Reed-Muench method. 3 .
  • TCID 50 of virus was IO "7 .
  • TC 50 of IFNs The concentration of new-type recombinant compound interferon exhibiting no cytotoxicity was 5 lOO ⁇ g/ml, and that of recombinant IFN- ⁇ -2b was 12.5 ⁇ g/ml, the cells shape was identical with the normal group at that concentration.
  • TC50 of new-type recombinant compound interferon was 139.18 ⁇ g/ml, that of recombinant IFN- ⁇ -2b was 17.18 ⁇ g/ml. 10 Table 9-B.l TC 50 of IFNs
  • the anti-virus effect of the medicine The anti-virus effects of two IFNs were observed in vitro. The results of 15 the experiments are shown on the Table 9-B.2, and the results of TI are shown on the Table 9-B.3.
  • Hepatitis B virus (HBV) DNA contains consensus elements for transactivating proteins whose binding activity is regulated by interferons .
  • Treatment of HBV-infected hepatocytes with interferons leads to inhibition of HBV gene expression.
  • the aim of the present study was to characterize the effects of different interferons on HBV regulated transcription. Using transient transfection of human hepatoma cells with reporter plasmids containing the firefly luciferase gene under the control of HBV-Enhancer (EnH) I, Enh II and core promoter, Applicant studied the biological activities of three different interferons on transcription .
  • EnH HBV-Enhancer
  • Interferons IFN-conl (Jnfergen ® ), IFN-Hui-Yang ( ⁇ SIFN- co) and IFN-beta lb
  • Reporter plasmid The DNA fragments containing HBV- Enhancer (EnH) I, Enh II and core promoter were prepared using PCR and blunt-end cloned into the Smal I site of the promoter- and enhancer-less firefly luciferase reporter plasmid pGL3-Basic (Promega, Wl, USA) . The resulting reporter plasmid was named as pGL3-HBV-Luc .
  • HepG2 cells were cultured in DMEM medium supplemented with 10% FBS and 100 U/ml penicillin and 100 ug/ml streptomycin. The cells were kept in 30°C, 5% C02 incubator. The cells were transfected with pGL3-HBV-Luc reporter plasmid using Boehringer's Lipofectin transfection kit. After 18 hours, the medium containing transfection reagents was removed and fresh medium was added with or without interferons . The cells were kept in culture for another 48 hours.
  • Luciferase Assay Forty-eight hours after addition of interferon, the cells were harvested and cell lysis were prepared. The protein concentration of cell lysates were measured using Bio-Rad Protein Assay kit. The luciferase activity was measured using Promega's Luciferase Reporter Assay Systems according to the instructions of manufacturer .
  • the side effects includes: nausea, muscle soreness, loss of appetite, hair loss, hypoleucocytosis (hypoleukmia; hypoleukocytosis; hypoleukia) , and decrease in blood platelet, etc.
  • METHOD Sample patients are divided into two grou s. 11 patients in Group A were injected with 9 ⁇ g Infergen ® . 10 patients in Group B were injected with 9 ⁇ g ⁇ SIFN-co. Both groups were monitored for 48 hours after injections. First monitoring was recorded 1 hour after injection. After that, records were taken every 2 hours .
  • Table 11.1 is the comparison of side effects between patients being injected with 9 ⁇ g of Infergen ® and 9 ⁇ g of ⁇ SIFN-co .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Zoology (AREA)
  • Communicable Diseases (AREA)
  • Biotechnology (AREA)
  • Pulmonology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2004/028067 2003-08-28 2004-08-26 Uses of interferons with altered spatial structure Ceased WO2005034853A2 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
JP2006524916A JP5663768B2 (ja) 2003-08-28 2004-08-26 空間構造が変えられるインターフェロン及びその応用
ES04809634.1T ES2473622T3 (es) 2003-08-28 2004-08-26 Usos de interferones con estructura espacial alterada
KR1020127029545A KR101431172B1 (ko) 2003-08-28 2004-08-26 변경된 공간 구조를 갖는 인터페론의 용도
EP04809634.1A EP1663110B1 (en) 2003-08-28 2004-08-26 Uses of interferons with altered spatial structure
SI200432135T SI1663110T1 (sl) 2003-08-28 2004-08-26 Uporaba interferonov s spremenjeno prostorsko strukturo
AU2004279350A AU2004279350B2 (en) 2003-08-28 2004-08-26 Uses of interferons with altered spatial structure
DK04809634.1T DK1663110T3 (en) 2003-08-28 2004-08-26 APPLICATIONS OF INTERFERONES WITH CHANGED SPACIAL STRUCTURE
CA2535982A CA2535982C (en) 2003-08-28 2004-08-26 Uses of interferons with altered spatial structure
KR1020147010659A KR20140059302A (ko) 2003-08-28 2004-08-26 변경된 공간 구조를 갖는 인터페론의 용도
PL04809634T PL1663110T3 (pl) 2003-08-28 2004-08-26 Zastosowania interferonów o zmienionej strukturze przestrzennej
HK06113460.8A HK1091756B (en) 2003-08-28 2004-08-26 Uses of interferons with altered spatial structure
KR1020157023278A KR20150103335A (ko) 2003-08-28 2004-08-26 변경된 공간 구조를 갖는 인터페론의 용도
CN2005100511050A CN1740197B (zh) 2004-08-26 2005-02-28 具有全新空间构象且功效增强的重组干扰素、其制备方法及应用

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US49844903P 2003-08-28 2003-08-28
US49892303P 2003-08-28 2003-08-28
US49878503P 2003-08-28 2003-08-28
US60/498,923 2003-08-28
US60/498,449 2003-08-28
US60/498,785 2003-08-28
IN279/MUM/2004 2004-03-05
IN279MU2004 2004-03-05
IN280/MUM/2004 2004-03-05
IN280MU2004 2004-03-05

Publications (2)

Publication Number Publication Date
WO2005034853A2 true WO2005034853A2 (en) 2005-04-21
WO2005034853A3 WO2005034853A3 (en) 2006-04-27

Family

ID=34280101

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2004/028067 Ceased WO2005034853A2 (en) 2003-08-28 2004-08-26 Uses of interferons with altered spatial structure
PCT/US2004/028068 Ceased WO2005021777A2 (en) 2003-08-28 2004-08-26 Uses of spatial configuration to modulate protein function

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2004/028068 Ceased WO2005021777A2 (en) 2003-08-28 2004-08-26 Uses of spatial configuration to modulate protein function

Country Status (7)

Country Link
EP (3) EP2325202B1 (enExample)
JP (4) JP5663768B2 (enExample)
KR (2) KR20060133949A (enExample)
AU (2) AU2004279350B2 (enExample)
CA (2) CA2535902A1 (enExample)
PL (2) PL2325202T3 (enExample)
WO (2) WO2005034853A2 (enExample)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006076014A3 (en) * 2004-04-30 2007-01-25 Us Gov Health & Human Serv Interferon-alpha constructs for use in the treatment of sars
WO2006134497A3 (en) * 2005-03-09 2007-08-30 Guangwen Wei Uses of recombinant super-compound interferons
US7364724B2 (en) 2001-02-28 2008-04-29 Sichuan Biotechnology Research Center Recombinant super-compound interferon
US7585647B2 (en) 2003-08-28 2009-09-08 Guangwen Wei Nucleic acid encoding recombinant interferon
US8551469B2 (en) 2001-02-28 2013-10-08 Superlab Far East Limited Treatment of tumors and viral diseases with recombinant interferon alpha
US9273109B2 (en) 2009-12-18 2016-03-01 Superlab Far East Limited Crystal of recombinant interferon with altered spatial configuration, three-dimensional structure and uses thereof
US10874716B2 (en) 2013-01-07 2020-12-29 Superlab Far East Limited Methods and compositions for treatment of bone, skin, subcutaneous, mucosal and/or submucosal cancer by percutaneous and/or transmucosal administration of interferon

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5663768B2 (ja) * 2003-08-28 2015-02-04 スーパーラブ ファー イースト リミテッド 空間構造が変えられるインターフェロン及びその応用
CN111363726A (zh) * 2018-12-26 2020-07-03 上海元宋生物技术有限公司 表达干扰素的溶瘤病毒及其应用

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6936694B1 (en) * 1982-05-06 2005-08-30 Intermune, Inc. Manufacture and expression of large structural genes
US5372808A (en) 1990-10-17 1994-12-13 Amgen Inc. Methods and compositions for the treatment of diseases with consensus interferon while reducing side effect
EP0861321B1 (en) * 1995-10-13 2006-05-31 President And Fellows Of Harvard College Phosphopantetheinyl transferases and uses thereof
US5874304A (en) * 1996-01-18 1999-02-23 University Of Florida Research Foundation, Inc. Humanized green fluorescent protein genes and methods
US20020043262A1 (en) * 2000-08-22 2002-04-18 Alan Langford Spray device
WO2002036627A2 (en) * 2000-11-03 2002-05-10 Pbl Biomedical Laboratories Interferons, uses and compositions related thereto
CN1245215C (zh) * 2001-02-28 2006-03-15 四川省生物工程研究中心 重组高效复合干扰素用作乙型肝炎表面抗原和e抗原抑制剂
JP5663768B2 (ja) * 2003-08-28 2015-02-04 スーパーラブ ファー イースト リミテッド 空間構造が変えられるインターフェロン及びその応用

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1663110A4 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8425896B2 (en) 2001-02-28 2013-04-23 Sichuan Biotechnology Research Center Treatment of tumors with recombinant interferon alpha
US9944686B2 (en) 2001-02-28 2018-04-17 Superlab Far East Limited Treatment of tumors with recombinant interferon alpha
US7364724B2 (en) 2001-02-28 2008-04-29 Sichuan Biotechnology Research Center Recombinant super-compound interferon
US8551469B2 (en) 2001-02-28 2013-10-08 Superlab Far East Limited Treatment of tumors and viral diseases with recombinant interferon alpha
US8114395B2 (en) 2001-02-28 2012-02-14 Sichuan Biotechnology Research Center Treatment of viral diseases with recombinant interferon α
US7585647B2 (en) 2003-08-28 2009-09-08 Guangwen Wei Nucleic acid encoding recombinant interferon
US8287852B2 (en) 2003-08-28 2012-10-16 Superlab Far East Limited Treatment of viral diseases with recombinant interferon α
WO2006076014A3 (en) * 2004-04-30 2007-01-25 Us Gov Health & Human Serv Interferon-alpha constructs for use in the treatment of sars
EP2537527A2 (en) 2005-03-09 2012-12-26 Guangwen Wei Uses of recombinant super-compound interferons
AU2006257286B2 (en) * 2005-03-09 2012-08-16 Superlab Far East Limited Uses of recombinant super-compound interferons
EP2749290A2 (en) 2005-03-09 2014-07-02 Guangwen Wei Uses of recombinant super-compound interferons
WO2006134497A3 (en) * 2005-03-09 2007-08-30 Guangwen Wei Uses of recombinant super-compound interferons
US9273109B2 (en) 2009-12-18 2016-03-01 Superlab Far East Limited Crystal of recombinant interferon with altered spatial configuration, three-dimensional structure and uses thereof
US10874716B2 (en) 2013-01-07 2020-12-29 Superlab Far East Limited Methods and compositions for treatment of bone, skin, subcutaneous, mucosal and/or submucosal cancer by percutaneous and/or transmucosal administration of interferon

Also Published As

Publication number Publication date
AU2004279350A1 (en) 2005-04-21
EP1670817A4 (en) 2008-07-16
JP5709800B2 (ja) 2015-04-30
WO2005021777A2 (en) 2005-03-10
JP2012162567A (ja) 2012-08-30
EP1663110B1 (en) 2013-12-18
EP1663110A2 (en) 2006-06-07
JP2007516214A (ja) 2007-06-21
CA2535902A1 (en) 2005-03-10
EP1663110A4 (en) 2008-07-16
CA2535982A1 (en) 2005-04-21
HK1158231A1 (en) 2012-09-14
JP5663768B2 (ja) 2015-02-04
PL2325202T3 (pl) 2015-03-31
AU2004279350B2 (en) 2011-03-10
CA2535982C (en) 2016-11-29
WO2005034853A3 (en) 2006-04-27
KR20060130009A (ko) 2006-12-18
EP2325202B1 (en) 2014-10-22
PL1663110T3 (pl) 2014-07-31
HK1091756A1 (en) 2007-01-26
KR20060133949A (ko) 2006-12-27
JP2011083292A (ja) 2011-04-28
WO2005021777A3 (en) 2005-05-12
AU2004269390A1 (en) 2005-03-10
JP2007503812A (ja) 2007-03-01
EP2325202A1 (en) 2011-05-25
EP1670817A2 (en) 2006-06-21

Similar Documents

Publication Publication Date Title
US8114395B2 (en) Treatment of viral diseases with recombinant interferon α
JP5709800B2 (ja) 変えられた空間構造を備えるインターフェロン及びその応用
US8287852B2 (en) Treatment of viral diseases with recombinant interferon α
US20150174206A1 (en) Uses of interferons with altered spatial structure
US20180258151A1 (en) Recombinant super-compound interferon and uses thereof
CN101001644B (zh) 空间构象改变的干扰素及其应用
AU2011202683B2 (en) Uses of interferons with altered spatial structure
US20060035327A1 (en) Recombinant super-compound interferon and uses thereof
HK1158231B (en) Uses of interferons with altered spatial structure
HK1091756B (en) Uses of interferons with altered spatial structure
HK1165315A (en) Uses of interferons with altered spatial structure

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200480031910.0

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2535982

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1020067003699

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2006524916

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 311/MUMNP/2006

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2004809634

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2004279350

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2004279350

Country of ref document: AU

Date of ref document: 20040826

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004279350

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004809634

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020067003699

Country of ref document: KR