WO2005027825A2 - Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus - Google Patents
Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus Download PDFInfo
- Publication number
- WO2005027825A2 WO2005027825A2 PCT/US2004/012723 US2004012723W WO2005027825A2 WO 2005027825 A2 WO2005027825 A2 WO 2005027825A2 US 2004012723 W US2004012723 W US 2004012723W WO 2005027825 A2 WO2005027825 A2 WO 2005027825A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- seq
- viras
- gene
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/155—Paramyxoviridae, e.g. parainfluenza virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5254—Virus avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/543—Mucosal route intranasal
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/544—Mucosal route to the airways
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18311—Metapneumovirus, e.g. avian pneumovirus
- C12N2760/18322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18311—Metapneumovirus, e.g. avian pneumovirus
- C12N2760/18334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18511—Pneumovirus, e.g. human respiratory syncytial virus
- C12N2760/18534—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18611—Respirovirus, e.g. Bovine, human parainfluenza 1,3
- C12N2760/18622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18611—Respirovirus, e.g. Bovine, human parainfluenza 1,3
- C12N2760/18634—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18611—Respirovirus, e.g. Bovine, human parainfluenza 1,3
- C12N2760/18641—Use of virus, viral particle or viral elements as a vector
- C12N2760/18643—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
- C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
Definitions
- the present invention relates to recombinant parainfluenza virus (PIN) cD ⁇ A or R ⁇ A that may be used to express heterologous gene products in appropriate host cell systems and/or to rescue negative strand R ⁇ A recombinant viruses that express, package, and/or present the heterologous gene product.
- the present invention encompasses vaccine preparations comprising chimeric PIN expressing a heterologous gene product, wherein the heterologous gene product is preferably an antigenic peptide or polypeptide.
- the PIN vector of the invention expresses one, two, or three heterologous gene products that may be encoded by the same or different viruses.
- the heterologous sequence encodes a heterologous gene product that is an antigenic polypeptide from another species of PIN or from another negative strand R ⁇ A virus, including but not limited to, influenza virus, respiratory syncytial virus (RSV), mammalian metapneumovirus, and avian pneumovirus.
- the vaccine preparations of the invention encompass multivalent vaccines, including bivalent and trivalent vaccine preparations.
- the multivalent vaccines of the invention may be administered in the form of one PIN vector expressing each heterologous antigenic sequence or two or more PIV vectors each encoding different heterologous antigenic sequences.
- the vaccine preparations of the invention can be administered alone or in combination with other vaccines, prophylactic agents, or therapeutic agents.
- PIN is a member of the genus respirovirus (PIN1, PIV3) or rubulavirus (PIV2, PIV4) of the paramyxoviridae family.
- PIN is made up of two structural modules: (1) an internal ribonucleoprotein core, or nucleocapsid, containing the viral genome, and (2) an outer, roughly spherical lipoprotein envelope.
- Its genome consists of a single strand of negative sense RNA, that is approximately 15,456 nucleotides in length and encodes at least eight polypeptides.
- These proteins include the nucleocapsid structural protein (NP, NC, or N depending on the genera), the phosphoprotein (P), the matrix protein (M), the fusion glycoprotein (F), the hemagglutinin-neuraminidase glycoprotein (HN), the large polymerase protein (L), and the C and D proteins of unknown function. Id.
- the parainfluenza nucleocapsid protein contains two domains within each protein unit. These domains include: an amino-terminal domain, that comprises nearly two-thirds of the molecule and interacts directly with the RNA, and a carboxyl-terminal domain, that lies on the surface of the assembled nucleocapsid. A hinge is thought to exist at the junction of these two domains, thereby imparting some flexibility on this protein (see Fields et al. (ed.), 1991, FUNDAMENTAL VIROLOGY, 2 nd ed, Raven Press, New York, inco ⁇ orated by reference herein in its entirety).
- the matrix protein (M) is apparently involved in viral assembly, and it interacts with both the viral membrane and the nucleocapsid proteins.
- the phosphoprotein (P) is subject to phosphorylation and has been implicated in transcription regulation, methylation, phosphorylation and polyadenylation.
- the fusion glycoprotein (F) is cleaved upon translation to produce two disulfide linked polypeptides.
- the active F protein interacts with the viral membrane where it facilitates penetration of the parainfluenza virion into host cells by promoting the fusion of the viral envelope with the host cell plasma membrane. Id.
- HN hemagglutinin-neuraminidase
- Human and bovine PrV3 share neutralizing epitopes but show distinct antigenic properties. Significant differences exist between the human and bovine viral strains in the HN protein. In fact, a bovine strain induces some neutralizing antibodies to hPiV infection while a human strain seems to induce a wider spectrum of neutralizing antibodies against human PIV3 (Van Wyke Coelingh et al, 1990, J. Virol. 64:3833-3843). The replication of all negative-strand RNA viruses, including PIN, is complicated by the absence of the cellular machinery that is required to replicate R ⁇ A.
- the negative-strand genome must be transcribed into a positive-strand (mR ⁇ A) copy before translation can occur. Consequently, the genomic R ⁇ A alone cannot synthesize the required R ⁇ A-dependent R ⁇ A polymerase upon entry into the cell.
- the L, P and ⁇ proteins must enter the host cell along with the genomic R ⁇ A. It is hypothesized that most or all of the viral proteins that transcribe PIN mR ⁇ A also carry out the replication of the genome.
- the mechanism that regulates the alternative uses (i.e., transcription or replication) of the same complement of proteins has not been clearly identified, but the process appears to involve the abundance of free forms of one or more of the nucleocapsid proteins.
- transcription is initiated by the L protein using the negative-sense R ⁇ A in the nucleocapsid as a template.
- Viral R ⁇ A synthesis is regulated such that it produces monocistronic mR ⁇ As during transcription.
- virus genome replication is the second essential event in infection by negative-strand R ⁇ A viruses.
- virus genome replication in PIV is mediated by virus-specified proteins.
- the first products of rephcative R ⁇ A synthesis are complementary copies (i.e., plus-polarity) of the PIN genomic R ⁇ A (cR ⁇ A).
- anti-genomes differ from the plus-stranded mR ⁇ A transcripts in the structure of their termini.
- the anti- genomic cR ⁇ As are not capped or methylated at the 5' termini, and they are not truncated nor polyadenylated at the 3' termini.
- the cR ⁇ As are coterminal with their negative strand templates and contain all the genetic information in the complementary form.
- the cR ⁇ As serve as templates for the synthesis of PIV negative-strand viral genomes (vR ⁇ As).
- vR ⁇ As The bPIV negative strand genomes (vR ⁇ As) and antigenomes (cR ⁇ As) are encapsidated by nucleocapsid proteins; the only unencapsidated R ⁇ A species are viral mR ⁇ As. Replication and transcription of bPIV R ⁇ A occurs in the cytoplasm of the host cell. Assembly of the viral components appears to take place at the host cell plasma membrane where the mature virus is released by budding. 2.1. PARAMYXOVIRUS Classically, as devastating agents of disease, paramyxoviruses account for many animal and human deaths worldwide each year.
- the Paramyxoviridae form a family within the order of Mononegavirales (negative-sense single stranded RNA viruses), consisting of the sub-families Paramyxovirinae and Pneumovirinae.
- the latter sub-family is at present taxonomically divided in the genera Pneumo virus and Metapneumo virus (Pringle, 1999, Arch. Virol. 144/2, 2065-2070).
- Human respiratory syncytial virus (hRSV) a species of the Pneumoviras genus, is the single most important cause of lower respiratory tract infections during infancy and early childhood worldwide (Domachowske, & Rosenberg, 1999, Clin. Microbio. Rev. 12(2): 298-309).
- RTI respiratory tract illnesses
- RSV INFECTIONS Respiratory syncytial virus (RSV) is the leading cause of serious lower respiratory tract disease in infants and children (Feigen et al, eds., 1987, In: Textbook of Pediatric Infectious Diseases, WB Saunders, Philadelphia at pages 1653-1675; New Vaccine Development, Establishing Priorities, Vol. 1, 1985, National Academy Press, Washington DC at pages 397-409; and Ruuskanen et al, 1993, Curr. Probl. Pediatr. 23:50-79). The yearly epidemic nature of RSV infection is evident worldwide, but the incidence and severity of RSV disease in a given season vary by region (Hall, 1993, Contemp. Pediatr. 10:92-110).
- RSV infection occurs most often in children from 6 weeks to 2 years of age and uncommonly in the first 4 weeks of life during nosocomial epidemics (Hall et al, 1979, New Engl. J. Med. 300:393-396).
- Children at increased risk for RSV infection include, but are not limited to, preterm infants (Hall et al., 1979, New Engl. J. Med. 300:393-396) and children with bronchopulmonary dysplasia (Groothuis et al., 1988, Pediatrics 82:199-203), congenital heart disease (MacDonald et al., New Engl. J. Med.
- RSV may cause serious disease in immunosuppressed persons, particularly bone marrow transplant patients (Hertz et al., 1989, Medicine 68:269-281). Treatment options for established RSV disease are limited. Severe RSV disease of the lower respiratory tract often requires considerable supportive care, including administration of humidified oxygen and respiratory assistance (Fields et al, eds, 1990, Fields Virology, 2nd ed., Vol. 1, Raven Press, New York at pages 1045-1072). While a vaccine might prevent RSV infection, and/or RSV-related disease, no vaccine is yet licensed for this indication. A major obstacle to vaccine development is safety.
- a formalin-inactivated vaccine though immunogenic, unexpectedly caused a higher and more severe incidence of lower respiratory tract disease due to RSV in immunized infants than in infants immunized with a similarly prepared trivalent parainfluenza vaccine (Kim et al., 1969, Am. J. Epidemiol. 89:422-434; and Kapikian et al, 1969, Am. J. Epidemiol.
- RSV IVIG passively administered RSV hyperimmune globulin
- SYNAGIS® humanized antibody directed to an epitope in the A antigenic site of the F protein of RSV, SYNAGIS®, is approved for intramuscular administration to pediatric patients for prevention of serious lower respiratory tract disease caused by RSV at recommended monthly doses of 15 mg/kg of body weight throughout the RSV season (March through April in the northern hemisphere).
- SYNAGIS® is a composite of human (95%) and murine (5%) antibody sequences. See, Johnson et al., 1997, J. Infect. Diseases 176:1215-1224 and U.S. Patent No.
- the human heavy chain sequence was derived from the constant domains of human IgGl and the variable framework regions of the VH genes of Cor (Press et al, 1970, Biochem. J. 117:641-660) and Cess (Takashi et al., 1984, Proc. Natl. Acad. Sci. USA 81:194-198).
- the human light chain sequence was derived from the constant domain of C and the variable framework regions of the VL gene K104 with J -4 (Bentley et al., 1980, Nature 288:5194-5198).
- the murine sequences derived from a murine monoclonal antibody, Mab 1129 (Beeler et al., 1989, J. Virology 63:2941-2950), in a process which involved the grafting of the murine complementarity determining regions into the human antibody frameworks.
- Avian pneumovirus also known as turkey rhinotracheitis virus (TRTV), the aetiological agent of avian rhinotracheitis, an upper respiratory tract infection of turkeys (Giraud et al., 1986, Vet. Res. 119:606-607), is the sole member of the recently assigned Metapneumovirus genus, which, as said was until now not associated with infections, or what is more, with disease of mammals.
- Sero logical subgroups of APV can be differentiated on the basis of nucleotide or amino acid sequences of the G glycoprotein and neutralization tests using monoclonal antibodies that also recognize the G glycoprotein. However, other differences in the nucleotide and amino acid sequences can be used to distinguish serological subgroups of APV.
- the G protein shows 98.5 to 99.7% aa sequence identity within subgroups while between the subgroups only 31.2- 38% aa identity is observed. See for example Collins et al, 1993, Avian Pathology, 22: p.
- the Colorado isolate was tested against monospecific polyclonal antisera to recognized TRT isolates.
- the Colorado isolate was not neutralized by monospecific antisera to any of the TRT strains. It was, however, neutralized by a hyperimmune antisemm raised against a subgroup A strain. This antiserum neutralized the homologous virus to a titre of 1 :400 and the Colorado isolate to a titer of 1 : 80.
- the Colorado isolate was then tested against TRT monoclonal antibodies. In each case, the reciprocal neutralization titer was ⁇ 10. Monospecific antiserum raised to the Colorado isolate was also tested against TRT strains of both subgroups.
- the avian pneumovirus is a single stranded, non-segmented RNA virus that belongs to the sub-family Pneumovirinae of the family Paramyxoviridae, genus metapneumovirus (Cavanagh and Banett, 1988, Virus Res. 11 :241-256; Ling et al., 1992, J. Gen. Virol.
- the Paramyxoviridae family is divided into two sub-families: the Paramyxovirinae and Pneumovirinae.
- the subfamily Paramyxovirinae includes, but is not limited to, the genera: Paramyxovirus, Rubulavirus, and Morbilli virus.
- the sub-family Pneumovirinae was divided into two genera based on gene order, and sequence homology, i.e. pneumovirus and metapneumovirus (Naylor et al., 1998, J. Gen. Virol, 79:1393-1398; Pringle, 1998, Arch.
- the pneumovirus genus includes, but is not limited to, human respiratory syncytial virus (hRSV), bovine respiratory syncytial virus (bRSV), ovine respiratory syncytial virus, and mouse pneumovirus.
- the metapneumovirus genus includes, but is not limited to, European avian pneumovirus (subgroups A and B), which is distinguished from hRSV, the type species for the genus pneumovirus (Naylor et al., 1998, J. Gen. Virol., 79:1393-1398; Pringle, 1998, Arch. Virol. 143:1449-1159).
- the US isolate of APV represents a third subgroup (subgroup C) within metapneumovirus genus because it has been found to be antigenically and genetically different from European isolates (Seal, 1998, Virus Res. 58:45-52; Senne et al, 1998, In: Proc. 47th WPDC, California, pp. 67-68). Electron microscopic examination of negatively stained APV reveals pleomorphic, sometimes spherical, virions ranging from 80 to 200 nm in diameter with long filaments ranging from 1000 to 2000 mn in length (Collins and Gough, 1988, J. Gen. Virol.
- the envelope is made of a membrane studded with spikes 13 to 15 nm in length.
- the nucleocapsid is helical, 14 nm in diameter and has 7 nm pitch.
- the nucleocapsid diameter is smaller than that of the genera Paramyxovirus and Morbillivirus, which usually have diameters of about 18 nm.
- Avian pneumovirus infection is an emerging disease in the USA despite its presence elsewhere in the world in poultry for many years. In May 1996, a highly contagious respiratory disease of turkeys appeared in Colorado, and an APV was subsequently isolated at the National Veterinary Services Laboratory (NVSL) in Ames, Iowa (Senne et al., 1997, Proc. 134th Ann.
- NVSL National Veterinary Services Laboratory
- Morbidity in infected birds can be as high as 100%.
- the mortality can range from 1 to 90% and is highest in six to twelve week old poults.
- Avian pneumovirus is transmitted by contact. Nasal discharge, movement of affected birds, contaminated water, contaminated equipment; contaminated feed trucks and load-out activities can contribute to the transmission of the virus.
- Recovered turkeys are thought to be carriers. Because the virus is shown to infect the epithelium of the oviduct of laying turkeys and because APV has been detected in young poults, egg transmission is considered a possibility.
- the present invention relates to recombinant parainfluenza virus cDNA and RNA that may be engineered to express heterologous or non-native gene products, in particular, to express antigenic polypeptides and peptides.
- the present invention relates to recombinant bovine or human parainfluenza viruses which are engineered to express heterologous antigens or immunogenic and/or antigenic fragments of heterologous antigens.
- the recombinant bovine or human parainfluenza viruses are engineered to express sequences that are non-native to the PIV genome, including mutated PIV nucleotide sequences.
- the invention relates to recombinant Kansas-strain bovine parainfluenza type 3 virus as well as cDNA and RNA molecules coding for the same.
- the present invention also relates to recombinant PIV that contain modifications that result in chimeric viruses with phenotypes more suitable for use in vaccine formulations.
- the present invention provides for the first time a chimeric PIV formulated as a vaccine that is able to confer protection against various viral infections, in particular, viruses that result in respiratory tract infections.
- the present invention provides a vaccine that is able to confer protection against parainfluenza, influenza, or respiratory syncytial viral infection.
- a recombinant virus is one derived from a bovine parainfluenza virus or a human parainfluenza virus that is encoded by endogenous or native genomic sequences or non-native genomic sequences.
- a non-native sequence is one that is different from the native or endogenous genomic sequence due to one or more mutations, including, but not limited to, point mutations, reanangements, insertions, deletions, etc. to the genomic sequence that may or may not result in a phenotypic change.
- a chimeric virus of the invention is a recombinant bPIV or bPIV which further comprises one or more heterologous nucleotide sequences.
- a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome or in which nucleotide sequences have been replaced with heterologous nucleotide sequences.
- the present invention also relates to engineered recombinant parainfluenza viruses and viral vectors that encode combinations of heterologous sequences which encode gene products, including but not limited to, genes from different strains of PIN, influenza virus, respiratory syncytial virus, mammalian metapneumovirus (e.g., human metapneumovirus), avian pneumovirus, measles, mumps, other viruses, pathogens, cellular genes, tumor antigens, or combinations thereof.
- mammalian metapneumovirus e.g., human metapneumovirus
- avian pneumovirus measles, mumps, other viruses, pathogens, cellular genes, tumor antigens, or combinations thereof.
- the invention relates to engineered recombinant parainfluenza viruses that contain a nucleotide sequence derived from a metapneumovirus in combination with a nucleotide sequence derived from a respiratory syncytial virus, and further in combination with a nucleotide sequence derived from a human parainfluenza virus.
- the invention also encompasses recombinant parainfluenza vectors and viruses that are engineered to encode genes from different species and strains of the parainfluenza virus, including the F and H ⁇ genes of human PIN3.
- the PIN vector of the invention is engineered to express one or more heterologous sequences, wherein the heterologous sequences encode gene products that are preferably antigenic gene products.
- the PIN vector of the invention expresses one, two or three heterologous sequences that encode antigenic polypeptides and peptides.
- the heterologous sequences are derived from the same virus or from different viruses.
- the heterologous sequences encode heterologous gene products that are antigenic polypeptides from another species of PIN, such as a human PIN, a mutant strain of PIN, or from another negative strand R ⁇ A virus, including but not limited to, influenza virus, respiratory syncytial virus (RSN), mammalian metapneumovirus (e.g., human metapneumovirus (hMPN)), and avian pneumovirus.
- RSN respiratory syncytial virus
- hMPN mammalian metapneumovirus
- avian pneumovirus avian pneumovirus
- the heterologous sequence encodes an immunogenic and/or antigenic fragment of a heterologous gene product.
- the recombinant PIN is a bovine PIN type 3, or an attenuated human PIV type 3.
- the sequences encoding fusion (F) protein, hemagglutinin (H ⁇ ) glycoprotein, or other non-essential genes of the PIN genome are deleted and are substituted by heterologous antigenic sequences.
- the PIV genome contains mutations or modifications, in addition to the heterologous nucleotide sequences, that result in a chimeric virus having a phenotype that is more suitable for use in vaccine formulations, e.g., an attenuated phenotype or a phenotype with enhanced antigenicity.
- the heterologous nucleotide sequence to be inserted into the PIV genome is derived from the nucleotide sequences encoding a F protein, a G protein or an HN protein.
- the nucleotide sequence to be inserted encodes a chimeric F protein, a chimeric G protein or a chimeric HN protein.
- the F protein comprises an ectodomain of a F protein of a metapneumovirus, a transmembrane domain of a F protein of a parainfluenza virus, and a luminal domain of a F protein of a parainfluenza virus.
- the nucleotide sequence to be inserted encodes a F protein, wherein the transmembrane domain of the F protein is deleted so that a soluble F protein is expressed.
- the invention provides a chimeric virus comprising a PIN genome comprising a heterologous nucleotide sequence derived from a metapneumovirus.
- the PIN virus is a Kansas-strain bovine parainfluenza type 3 virus.
- the PIV virus is a human parainfluenza virus with an attenuated phenotype.
- the invention provides a chimeric bovine parainfluenza virus type 3/human parainfluenza virus engineered to contain human parainfluenza F and H ⁇ genes in a bovine parainfluenza backbone.
- the chimeric virus may further comprise a heterologous nucleotide sequence derived from a metapneumovirus, and/or further comprise a heterologous nucleotide sequence derived from a respiratory syncytial virus.
- the virus of the invention comprises heterologous nucleotide sequences derived from at least two different genes of a metapneumovirus.
- the heterologous sequence is derived from a metapneumovirus, e.g., avian pneumovirus and human metapneumovirus. More specifically, the heterologous sequence is derived from an avian pneumovirus, including avian pneumovirus type A, B, C or D, preferably C.
- the present invention also provides vaccine preparations and immunogenic compositions comprising chimeric PIV expressing one or more heterologous antigenic sequences, h a specific embodiment, the present invention provides multivalent vaccines, including bivalent and trivalent vaccines.
- the multivalent vaccines of the invention may be administered in the form of one PIV vector expressing each heterologous antigenic sequence or two or more PIV vectors each encoding different heterologous antigenic sequences.
- the vaccine preparation of the invention comprises chimeric PIV expressing one, two or three heterologous polypeptides, wherein the heterologous polypeptides can be encoded by sequences derived from one strain of the same virus, different strains of the same virus, or different viruses.
- the heterologous antigenic sequences are derived from a negative strand RNA virus, including but not limited to, influenza virus, parainfluenza virus, respiratory syncytial virus (RSV), mammalian metapneumovirus (e.g., human metapneumovirus (hMPV)), and avian pneumovirus (APV).
- the heterologous antigenic sequences include, but are not limited to, sequences that encode human parainfluenza virus F or HN protein, F protein of RSV, HA protein of influenza virus type A, B, and C, and F protein of human MPV and avian pneumovirus.
- the vaccine preparation of the invention comprises attenuated chimeric viruses that are viable and infectious.
- the recombinant PIV is a bovine PIV type 3, or an attenuated strain of human PIV.
- the vaccine preparation comprises the chimeric virus of the present invention, wherein the F, HN, or some other nonessential genes of the PIV genome have been substituted or deleted.
- the vaccine preparation of the present invention is prepared by engineering a strain of PIV with an attenuated phenotype in an intended host.
- the vaccine preparation of the present invention is prepared by engineering an attenuated strain of PIV.
- the heterologous nucleotide sequence is added to the complete PIV genome.
- the PIV genome is engineered so that the heterologous sequences are inserted at position one, two, three, four, five or six, so that the heterologous sequences are expressed as the first, second, third, fourth, fifth, or sixth gene of the viral genome.
- the heterologous sequence is inserted at position one, two, or three of the viral genome.
- the intergenic region between the end of the coding sequence of an inserted heterologous gene and the start of the coding sequence of the downstream gene is altered to a desirable length, resulting in enhanced expression of the heterologous sequence or enhanced growth of the chimeric virus.
- the intergenic region is altered to a desirable length, with a potential to alter the expression of the heterologous sequence or growth of the recombinant or chimeric virus, e.g., attenuated phenotype.
- both the position of the insertion and the length of the intergenic region flanking a heterologous nucleotide sequence are engineered to select a recombinant or chimeric virus with desirable levels of expression of the heterologous sequence and desirable viral growth characteristics.
- the invention provides a vaccine formulation comprising the recombinant or chimeric virus of the invention and a pharmaceutically acceptable excipient.
- the vaccine formulation of the invention is used to modulate the immune response of a subject, such as a human, a primate, a horse, a cow, a sheep, a pig, a goat, a dog, a cat, a rodent or a subject of avian species.
- a subject such as a human, a primate, a horse, a cow, a sheep, a pig, a goat, a dog, a cat, a rodent or a subject of avian species.
- the vaccine is used to modulate the immune response of a human infant or a child.
- the present invention relates to vaccine formulations for veterinary uses.
- the vaccine preparation of the invention can be administered alone or in combination with other vaccines or other prophylactic or therapeutic agents.
- FIGURES Figure 1 Pairwise alignments of the amino acid sequence of the F protein of the human metapneumovirus with different F proteins from different avian pneumoviruses. Identical amino acids between the two sequences are indicated by the one-letter-symbol for the amino acid. conserveed amino acid exchanges between the two amino acid sequences are indicated by a "+" sign, and a space indicates a non-conserved amino acid exchange.
- Lanes 1 and 8 show a D ⁇ A size marker.
- Figure 3 PCR fragments from nt 9075 to nt 10469 derived from three different isolates of the b/h PIV3 chimeric virus were amplified. The resulting 1.4kb D ⁇ A fragments were digested with enzymes specific for the L gene of bovine PIN3. These enzymes do not cut in the conesponding fragment of human PIV3. The 1% > agarose gel shows the undigested 1.4 kb fragment (lanes 2, 5, and 8).
- Lane 1 shows a DNA size marker.
- Figure 4 Six constructs, including the bPrV3/hPIV3 vector and b/h PF/3 vectored RSV F or G cDNA, are demonstrated. The bovine PIV3 F gene and HN gene are deleted and replaced with human PIV3 F and HN gene respectively. The RSV F or G genes are cloned into either position 1 or position 2. All RSV genes are linked to the bPIV3 N-P intergenic region with the exception of RSV FI* (N-N), which is followed by the shorter bPIV3 N gene stop/N gene start sequences.
- Figure S. b/h PIN3 vectored RSN F or G gene displayed a positional effect.
- (A) is a
- FIG. 5 A Equal amounts of total RNA were separated on 1% agarose gels containing 1% formaldehyde and transfened to nylon membranes. The blots were hybridized with digoxigenin (DIG)-UTP-labeled riboprobes synthesized by in vitro transcription using a DIG RNA labeling kit.
- DIG digoxigenin
- (C) - (D) are growth curves of chimeric viruses comprising b/h PIV3 vectored RSV F or G protein in Vero cells. Vero cells were grown to 90% confluence and infected at an MOI of 0.01 or 0.1. The infected monolayers were incubated at 37°C.
- Virus titers for each time point harvest were determined by TCID 5 Q assays, which were performed by inspecting visually for CPE following incubation at 37°C for 6 days.
- Figure 6 The b/h PIN3 vectored enhanced green fluorescence protein (eGFP) constructs.
- the eGFP gene is introduced into the b/h PIV3 vector sequentially between all genes of PIV3 (only position 1, 2, 3, and 4 are shown here).
- the eGFP gene was linked to the bPTV3 ⁇ -P intergenic region.
- the b/h GFP 1 construct harbors the eGFP gene cassette in the 3' most proximal position of the b/h PIV3 genome.
- the b/h GFP 2 construct contains the eGFP gene cassette between the N and P genes.
- the b/h GFP 3 construct contains the eGFP gene cassette between the P and M gene, and the b/h GFP4 construct contains the eGFP gene between M and F of b/h PTV3.
- Figure 7. Positional effect of enhanced green fluorescence protein (eGFP) insertions in the b/h PIV3 genome.
- A shows the amount of green cells produced upon infecting Vero cells with b/h PIV3 vectored eGFP 1, 2, and 3 at MOI 0.1 and MOI 0.01 for 20 hours. The green cells were visualized by using a fluorescent microscope.
- (B) is a Western blot analysis of infected cell lysates.
- (C) is growth curves of b/h PIV3 vectored GFP constructs (at position 1, 2, and 3) in Vero cells.
- Figure 8. Constructs of b/h PIV3 vectored RSV F gene with different intergenic regions. The three constructs, RSV FI* N-N, RSV F2 N-P, and RSV FI N-P are the same as the RSV F* (N-N), RSV F2, and RSV FI in Figure 4 respectively.
- RSV FI* N-N The distance between the N gene start sequence and the N gene translation start codon in RSV FI* N-N is only 10 nucleotides (nts) long. In contrast, this distance is 86 nts long in RSV F2 construct.
- RSV FI* N-N also uses the N gene start sequence rather than the P gene start sequence as is done in RSV F2 construct.
- Figure 9 The length and/or nature of the intergenic region downstream of the inserted RSV gene has an effect on virus replication.
- A Western blot analysis of RSV F protein expression in chimeric viruses. Blots were probed with monoclonal antibodies against the RSV F protein.
- FI protein levels expressed by RSV FI construct and measured at 24 and 48 hours post-infection were close to the levels observed for RSV F2 construct, but much higher than those of RSV FI* N-N construct.
- (B) is multicycle growth curves comparing the kinetics of virus replication of RSV FI, RSV F1*N-N and RSV F2 constructs in Vero cells at an MOI of 0.1. Virus titers for each time point harvest were determined by plaque assays, which were performed by immunostaining with RSV polyclonal antisera for quantification after 5 days of incubation.
- Figure 10 Constructs of trivalent b/h PTV3 vectored RSV F and hMPV F.
- Two virus genomes each comprising a chimeric b/h PIV3 vector and a first heterologous sequences derived from a metapneumovirus F gene and a second heterologous sequence derived from respiratory syncytial virus F gene, are shown here.
- Virus with either of the constructs has been amplified in Vero cells.
- the engineered virus as described can be used as a trivalent vaccine against the parainfluenza virus infection, metapneumovirus infection and the respiratory syncytial virus infection.
- Figure 11. A construct harboring two RSV F genes. This construct can be used to determine virus growth kinetics, for RSV F protein production, and replication and immunogenicity in hamsters.
- the chimeric b/h PIN3 vectored hMPN F constructs The F gene of human metapneumovirus (hMPN) was inserted in position 1 or position 2 of the b/h PIN3 genome.
- the hMPV F gene cassette harbored the bPIV3 ⁇ -P intergenic region.
- Figure 13 Immunoprecipitation and replication assays of b/h PIV3 vectored hMPN F gene (at position 2 or position 1).
- (A) shows the immunoprecipitation of hMPN F protein using guinea pig or human anti-hMPN antiserum.
- FIG. 14 are growth curves that were performed to determine the kinetics of virus replication of b/h PIV3/hMPV FI and compare it to those observed for b/h PIN3/hMPV F2 and b/h PIV3 in Vero cells at an MOI of 0.01 or 0.1.
- Figure 14 A diagram of the viral R ⁇ A genomes of the b/h PIV3 vectored RSV F vaccine candidates, b/h PIV3/RSV F2 contained the native RSV F gene in PIV3 genome position two, while b/h PIV3/sol RSV F2 expressed a soluble RSV F lacking the trans-membrane and cytosolic domains.
- Infected cells were overlayed with optiMEM media containing gentamycin and incubated at 35°C for 5 days. Cells were fixed and immunostained with guinea pig anti-hMPV sera. Expression of hMPV F is visualized by specific color development in the presence of the AEC substrate system.
- the b/h P ⁇ V3/hMPV F2 virus were diluted and used to infect Vero cells. Infected cells were overlayed with 1% methyl cellulose in EMEM/L-15 medium (JRH Biosciences; Lenexa, KS). Cells were incubated, fixed and then immunostained with anti- hMPV guinea pig sera.
- the anti-hMPV guinea pig serum is specific for hMPV 001 protein.
- Figure 16 Virion fractionation of b/h PIV3 vectored RSV genes on sucrose gradients. These series experiments investigate whether the RSV proteins were incorporated into the b/h PTV3 virion.
- A shows control gradient of free RSV F (generated in baculovirus and C-tenninally truncated). Majority of free RSV F was present in fractions 3, 4, 5, and 6.
- (B) shows that the biggest concentration of RSV virions was observed in fractions 10, 11 and 12. The RSV fractions were probed with RSV polyclonal antiserum as well as RSV F MAb.
- Sucrose gradient fractions of b/h PIV3/RSV F2 were analyzed with both a PIV polyclonal antiserum and an RSV F MAb.
- the fractions containing most of the virions were fractions 11, 12, 13 and 14, as shown by Western using the PIV3 antiserum. Conespondingly, these were also the fractions that displayed the highest amounts of RSV F protein. Some free RSV F was also present in fractions 5 and 6.
- Fractions 11, 12, 13 and 14 displayed the peak virus titers.
- the fractions containing the most virions of b/h PIV3/RSV G2 (9, 10, 11 and 12) also showed the strongest signal for RSN G protein. Again, these were the fractions with the highest virus titers.
- FIG. 1 A schematic outline of the AGM primate study design from Day -14 to Day 56. Serum was collected at the indicated time points (anow). Initial vaccinations on Day 1 and RSN challenge administration on Day 28 are indicated.
- Figure 18. Effects of MOI on infectious virus titers. Cultures were incubated at 37 ⁇ 1°C and 5 ⁇ 1 % CO 2 post-infection.
- Figure 19. Effects of POI and post-infection temperature on infectious virus titers. Nero cultures were infected with the b/h PIV3/RSV F2 virus at MOI 0.01 at either (a) 3 days postseeding (1.1 X 10 7 cells/flask), or (b) 5 days post-seeding (3.3 x 10 7 cells/flask).
- Vero cells were cultured for 3 days pre-infection in one of the following conditions: (a) OPTI PRO SFM supplemented with 4mM glutamine, (b) OPTI PRO SFM supplemented with 4mM glutamine and 0.5% (v/v) serum, and (c) OPTI PRO SFM supplemented with 4mM glutamine and 2% (v/v) serum.
- Prior to infection the spent culture medium was removed and the cells were rinsed with DPBS.
- the cultures were infected with the b/h PIV3/RSV F2 virus at MOI 0.001 and incubated at 33 ⁇ 1°C, 5 ⁇ 1 % CO 2 post-infection.
- Figure 21 The cultures were infected with the b/h PIV3/RSV F2 virus at MOI 0.001 and incubated at 33 ⁇ 1°C, 5 ⁇ 1 % CO 2 post-infection.
- Vero cells were cultured in duplicate sets of Roller Bottles for 3 days pre-infection in one of the following conditions: (a) OPTI PRO SFM supplemented with 4mM glutamine, (b) OPTI PRO SFM supplemented with 4mM glutamine and 0.5% (v/v) serum, and (c) OPTI PRO SFM supplemented with 4mM glutamine and 2% (v/v) serum.
- the present invention relates to recombinant parainfluenza cDNA and RNA constructs, including but not limited to, recombinant bovine and human PIV cDNA and RNA constructs, that may be used to express heterologous or non-native sequences.
- a recombinant virus is one derived from a bovine parainfluenza virus or a human parainfluenza virus that is encoded by endogenous or native genomic sequences or non-native genomic sequences.
- a non-native sequence is one that is different from the native or endogenous genomic sequence due to one or more mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions, etc. to the genomic sequence that may or may not result in a phenotypic change.
- a chimeric virus of the invention is a recombinant bPIV or bPIV which further comprises one or more heterologous nucleotide sequences.
- a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome or in which nucleotide sequences have been replaced with heterologous nucleotide sequences.
- These recombinant and chimeric viruses and expression products may be used as vaccines suitable for administration to humans or animals.
- the chimeric viruses of the invention may be used in vaccine formulations to confer protection against pneumovirus, respiratory syncytial virus, parainfluenza virus, or influenza virus infection.
- the invention relates to PIV cDNA and RNA constructs that are derived from human or bovine PIV variants and are engineered to express one, two, or three heterologous sequences, preferably heterologous genes encoding foreign antigens and other products from a variety of pathogens, cellular genes, tumor antigens, and viruses, h particular, the heterologous sequences are derived from morbillivrus or a negative strand RNA virus, including but not limited to, influenza virus, respiratory syncytial virus (RSN), mammalian metapneumovirus (e.g., human metapneumovirus variants Al, A2, BI, and B2), and avian pneumovirus subgroups A, B, C and D.
- RSN respiratory syncytial virus
- mammalian metapneumovirus e.g., human metapneumovirus variants Al, A2, BI, and B2
- avian pneumovirus subgroups A, B, C and D
- the mammalian MPVs can be a variant Al , A2, BI or B2 mammalian MPV.
- the mammalian MPVs of the present invention may encompass additional variants of MPV yet to be identified, and are not limited to variants Al, A2, BI, or B2.
- the heterologous sequences are non-native PIV sequences, including mutated PIV sequences.
- the heterologous sequences are derived from the same or from different viruses.
- the virus of the invention is a recombinant PIV comprising heterologous nucleotide sequences derived from human metapneumovirus or avian pneumovirus.
- the heterologous sequences to be inserted into the PIV genome include, but are not limited to, the sequences encoding the F, G and H ⁇ genes of human metapneumovirus variants Al, A2, BI or B2, sequences encoding the F, G and H ⁇ genes of avian pneumovirus type A, B, C or D, and immunogenic and/or antigenic fragments thereof.
- the heterologous nucleotide sequence is added to the viral genome.
- the heterologous nucleotide sequence is exchanged for an endogenous nucleotide sequence.
- the heterologous nucleotide sequence may be added or inserted at various positions of the PIV genome, e.g., at position 1, 2, 3, 4, 5, or 6.
- the heterologous nucleotide sequence is added or inserted at position 1.
- the heterologous nucleotide sequence is added or inserted at position 2.
- the heterologous nucleotide sequence is added or inserted at position 3. Inserting or adding heterologous nucleotide sequences at the lower-numbered positions of the virus generally results in stronger expression of the heterologous nucleotide sequence compared to insertion at higher- numbered positions. This is due to a transcriptional gradient that occurs across the genome of the virus. However, virus replication efficiency must also be considered.
- insertion of a heterologous gene at position 1 delays replication kinetics in vitro and to a lesser degree also in vivo (see section 8, example 3 and Figure 5 as well as section 26, example 21). Therefore, inserting heterologous nucleotide sequences at lower-numbered positions is the prefened embodiment of the invention if strong expression of the heterologous nucleotide sequence is desired. Most preferably, a heterologous sequence is inserted at position 2 of a b/h PTV3 genome if strong expression of the heterologous sequence is desired. (See section 5.1.2. infra and section 8, example 3).
- the recombinant or chimeric PIV genome is engineered such that the intergenic region between the end of the coding sequence of the heterologous gene and the start of the coding sequence of the downstream gene is altered.
- the virus of the invention comprises a recombinant or chimeric PIV genome engineered such that the heterologous nucleotide sequence is inserted at a position selected from the group consisting of positions 1, 2, 3, 4, 5, and 6, and the intergenic region between the heterologous nucleotide sequence and the next downstream gene is altered. Appropriate assays may be used to determine the best mode of insertion (i. e.
- the chimeric virus of the invention contains two different heterologous nucleotide sequences.
- the different heterologous nucleotide sequences may be inserted at various positions of the PIV genome.
- one heterologous nucleotide sequence is inserted at position 1 and another heterologous nucleotide sequence is added or inserted at position 2 or 3.
- additional heterologous nucleotide sequences are inserted at higher-numbered positions of the PIV genome.
- the position of the heterologous sequence refers to the order in which the sequences are transcribed from the viral genome, e.g., a heterologous sequence at position 1 is the first gene sequence to be transcribed from the genome.
- the heterologous nucleotide sequence to be inserted into the genome of the virus of the invention is derived from a negative strand RNA virus, including but not limited to, influenza virus, parainfluenza virus, respiratory syncytial virus, mammalian metapneumovirus, and avian pneumovirus.
- the heterologous nucleotide sequence is derived from a human metapneumovirus.
- the heterologous nucleotide sequence is derived from an avian pneumovirus. More specifically, the heterologous nucleotide sequence of the invention encodes a F, G or SH gene or a portion thereof of a human or avian metapneumovirus.
- a heterologous nucleotide sequences can be any one of SEQ ID NO:l through SEQ LD NO:5, SEQ ID NO: 14, and SEQ ID NO: 15 (see Table 16).
- the nucleotide sequence encodes a protein of any one of SEQ ID NO:6 through SEQ ID NO:13, SEQ ID NO:16, and SEQ ID NO:17 (see Table 16).
- the nucleotide sequence encodes a protein of any one of SEQ ID NO: 314 through 389.
- a heterologous nucleotide sequence of the invention is derived from a type A avian pneumovirus.
- a heterologous nucleotide sequence of the invention is derived from a type B avian pneumovirus.
- a heterologous nucleotide sequence of the invention is derived from a type C avian pneumovirus.
- the heterologous nucleotide sequence encodes a chimeric polypeptide, wherein the ectodomain contains antigenic sequences derived from a virus other than the strain of PIV from which the vector backbone is derived, and the trans membrane and luminal domains are derived from PIV sequences.
- the resulting chimeric virus would impart antigenicity of the negative strand RNA virus of choice and would have an attenuated phenotype.
- the heterologous nucleotide sequence encodes a chimeric F protein.
- the ectodomain of the chimeric F protein is the ectodomain of a metapneumovirus, so that a human metapneumovirus or avian pneumovirus, and the transmembrane domain as well as the luminal domain are the transmembrane and luminal domains of a parainfluenza vims, such as a human or a bovine parainfluenza virus.
- insertion of a chimeric F protein may further attenuate the virus in an intended host but retain the antigenicity of the F protein attributed by its ectodomain.
- the chimeric viruses of the invention may be used in vaccine formulations to confer protection against various infections, including but not limited to, pneumovirus infection, respiratory syncytial virus infection, parainfluenza virus infection, influenza virus infection, or a combination thereof.
- the present invention provides vaccine preparations comprising chimeric PIV expressing one or more heterologous antigenic sequences, including bivalent and trivalent vaccines.
- the bivalent and trivalent vaccines of the invention may be administered in the form of one PIV vector expressing each heterologous antigenic sequences or two or more PIV vectors each encoding different heterologous antigenic sequences.
- the heterologous antigenic sequences are derived from a negative strand RNA virus, including but not limited to, influenza virus, parainfluenza virus, respiratory syncytial virus (RSV), mammalian metapneumovirus (e.g., human metapneumovirus) and avian pneumovirus.
- a negative strand RNA virus including but not limited to, influenza virus, parainfluenza virus, respiratory syncytial virus (RSV), mammalian metapneumovirus (e.g., human metapneumovirus) and avian pneumovirus.
- the chimeric virions of the present invention may be engineered to create, e.g., anti-human influenza vaccine, anti-human parainfluenza vaccine, anti-human RSV vaccine, and anti-human metapneumovirus vaccine.
- the vaccine preparation of the invention comprises attenuated chimeric viruses that are viable and infectious.
- the vaccine preparation of the invention can be administered alone or in combination with other vaccines or other prophylactic or therapeutic agents.
- the present invention also relates to the use of viral vectors and chimeric viruses to formulate vaccines against a broad range of viruses and/or antigens including tumor antigens.
- the viral vectors and chimeric viruses of the present invention may be used to modulate a subject's immune system by stimulating a humoral immune response, a cellular immune response or by stimulating tolerance to an antigen.
- a subject refers to a human, a primate, a horse, a cow, a sheep, a pig, a goat, a dog, a cat, a rodent and a member of avian species.
- the invention may be used to treat subjects having disease amenable to immune response mediated rejection, such as non-solid tumors or solid tumors of small size. It is also contemplated that delivery of tumor antigens by the viral vectors and chimeric viruses described herein will be useful for treatment subsequent to removal of large solid tumors.
- the invention may also be used to treat subjects who are suspected of having cancer.
- the invention may be divided into the following stages solely for the purpose of description and not by way of limitation: (a) construction of recombinant cDNA and RNA templates; (b) expression of heterologous gene products using recombinant cDNA and RNA templates; and (c) rescue of the heterologous genes in recombinant vims particles.
- the present invention encompasses recombinant or chimeric vimses encoded by viral vectors derived from the genomes of parainfluenza virus, including both bovine parainfluenza vims and mammalian parainfluenza virus.
- a recombinant virus is one derived from a bovine parainfluenza virus or a mammalian parainfluenza virus that is encoded by endogenous or native genomic sequences or non-native genomic sequences.
- a non-native sequence is one that is different from the native or endogenous genomic sequence due to one or more mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions etc. to the genomic sequence that may or may not result a phenotypic change.
- the recombinant viruses of the invention encompass those viruses encoded by viral vectors derived from the genomes of parainfluenza virus, including both bovine and mammalian parainfluenza virus, and may or may not, include nucleic acids that are non-native to the viral genome.
- a viral vector which is derived from the genome of a parainfluenza virus is one that contains a nucleic acid sequence that encodes at least a part of one ORF of a parainfluenza vims.
- the present invention also encompasses recombinant viruses comprising a viral vector derived from a bovine and/or mammalian PTV genome which contains sequences which result in a virus having a phenotype more suitable for use in vaccine formulations, e.g., attenuated phenotype or enhanced antigenicity.
- the mutations and modifications can be in coding regions, in intergenic regions and in the leader and trailer sequences of the virus.
- the viral vectors of the invention are derived from the genome of a mammalian parainfluenza virus, in particular a human parainfluenza vims (hPIV).
- the viral vector is derived from the genome of a human parainfluenza vims type 3.
- these viral vectors may or may not include nucleic acids that are non-native to the viral genome.
- the viral vectors of the inventions are derived from the genome of a bovine parainfluenza vims (bPTV).
- the viral vector is derived from the genome of bovine parainfluenza virus type 3.
- these viral vectors may or may include nucleic acids that are non-native to the viral genome.
- a chimeric virus is a recombinant bPIV or hPIV which further comprises a heterologous nucleotide sequence.
- a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequence have been added to the genome or in which endogenous or native nucleotide sequence have been replaced with heterologous nucleotide sequence.
- the chimeric vimses are encoded by the viral vectors of the invention which further comprise a heterologous nucleotide sequence.
- a chimeric vims is encoded by a viral vector that may or may not include nucleic acids that are non-native to the viral genome.
- a chimeric virus is encoded by a viral vector to which heterologous nucleotide sequences have been added, inserted or substituted for native or non-native sequences.
- a chimeric virus may be of particular use for the generation of recombinant vaccines protecting against two or more vimses (Tao et al., J. Virol. 72, 2955-2961; Durbin et al., 2000, J.Virol. 74, 6821-6831; Skiadopoulos et al., 1998, J.
- a hPIV or bPIV vims vector expressing one or more proteins of another negative strand R ⁇ A virus, e.g., MPV, or a RSV vector expressing one or more proteins of MPV will protect individuals vaccinated with such vector against both vims infections.
- a similar approach can be envisaged for other paramyxoviruses.
- Attenuated and replication-defective vimses may be of use for vaccination purposes with live vaccines as has been suggested for other vimses. (See, PCT WO 02/057302, at pp.
- the heterologous to be inco ⁇ orated into the viral vectors encoding the recombinant or chimeric vimses of the invention include sequences obtained or derived from different strains of metapneumovirus, strains of avian pneumovirus, and other negative strand RNA viruses, including, but not limited to, RSV, PIV, influenza virus and other viruses, including morbillivirus.
- the chimeric or recombinant viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more sequences, intergenic regions, termini sequences, or portions or entire ORF have been substituted with a heterologous or non-native sequence.
- the chimeric vimses of the invention are encoded by viral vectors derived from viral genomes wherein one or more heterologous sequences have been added to the vector.
- a specific embodiment of the present invention is a chimeric virus comprising a backbone encoded by nucleotide sequences derived from a parainfluenza virus genome.
- the PTV genome is derived from bovine PIV, such as the Kansas strain of bPTV3, or from human PIV.
- the PIV genome is derived from the Kansas strain of bPIV3, in which bovine parainfluenza vims nucleotide sequences have been substituted with heterologous sequences or in which heterologous sequences have been added to the complete bPIV genome.
- a further specific embodiment of the present invention is a chimeric vims comprising a backbone encoded by nucleotide sequences derived from human parainfluenza virus type 3 genome, in which human parainfluenza virus nucleotide sequences have been substituted with heterologous sequences or in which heterologous sequences have been added to the complete hPIV genome.
- An additional specific embodiment of the present invention is a chimeric virus comprising a backbone encoded by nucleotide sequences derived from bovine parainfluenza vims genome, such as the Kansas strain of bPIN3, in which (a) the bovine parainfluenza virus F gene and H ⁇ gene have been substituted with the F gene and the H ⁇ gene of the human parainfluenza virus (bPrV/hPIV), and in which (b) heterologous sequences have been added to the complete bPIV genome.
- the present invention also encompasses chimeric viruses comprising a backbone encoded by nucleotide sequences derived from the bPTV, the hPIV, or the bPIV/hPIV genome containing mutations or modifications, in addition to heterologous sequences, that result in a chimeric virus having a phenotype more suitable for use in vaccine formulations, e.g., attenuated phenotype or enhanced antigenicity.
- a heterologous sequence in the context of a bovine PIV3 backbone may be any sequence heterologous to bPIV3.
- Another specific embodiment of the present invention is a chimeric virus comprising a backbone encoded by nucleotide sequences derived from human PIN 1, 2, or 3 in which hPIV nucleotide sequences have been substituted with heterologous sequences or in which heterologous sequences have been added to the complete hPIV genome, with the proviso that the resulting chimeric virus is not a chimeric hPIV3 in which the hemagglutinin- neuraminidase and fusion glycoproteins have been replaced by those of hPIVl.
- the present invention also encompasses chimeric vimses, comprising a backbone encoded by nucleotide sequences derived from a hPIV genome, containing mutations or modifications, in addition to heterologous sequences, that result in a chimeric vims having a phenotype more suitable for use in vaccine formulations, e.g., attenuated phenotype or enhanced antigenicity.
- Heterologous gene coding sequences flanked by the complement of the viral polymerase binding site/promoter, e.g., the complement of 3'-PIN virus terminus of the present invention, or the complements of both the 3'- and 5 '-PTV virus termini maybe constructed using techniques known in the art.
- the resulting R ⁇ A templates may be of the negative-polarity and can contain appropriate terminal sequences that enable the viral R ⁇ A- synthesizing apparatus to recognize the template.
- positive-polarity R ⁇ A templates that contain appropriate terminal sequences which enable the viral R ⁇ A- synthesizing apparatus to recognize the template, may also be used.
- Recombinant D ⁇ A molecules containing these hybrid sequences can be cloned and transcribed by a D ⁇ A- directed R ⁇ A polymerase, such as bacteriophage T7 polymerase, T3 polymerase, the SP6 polymerase or a eukaryotic polymerase such as polymerase I and the like, for the in vitro or in vivo production of recombinant R ⁇ A templates that possess the appropriate viral sequences and that allow for viral polymerase recognition and activity.
- the PIV vector of the invention expresses one, two, or three heterologous sequences, encoding antigenic polypeptides and peptides.
- the heterologous sequences are derived from the same virus or from different viruses.
- more than one copy of the same heterologous nucleotide sequences are inserted in the genome of a bovine parainfluenza vims, human parainfluenza virus, or bPIV/hPIV chimeric vector.
- two copies of the same heterologous nucleotide sequences are inserted to the genome of the virus of the invention.
- the heterologous nucleotide sequence is derived from a metapneumovirus, such as human metapneumovirus or an avian pneumovirus.
- the heterologous nucleotide sequence derived from a metapneumovirus is a F gene of the metapneumovirus.
- the heterologous nucleotide sequence derived from a metapneumovirus is a G gene of the metapneumovirus.
- the heterologous nucleotide sequence is derived from a respiratory syncytial virus
- the heterologous nucleotide sequence derived from respiratory syncytial virus is a F gene of the respiratory syncytial vims.
- the heterologous nucleotide sequence derived from respiratory syncytial virus is a G gene of the respiratory syncytial virus.
- RNA templates of the present invention are prepared by transcription of appropriate DNA sequences with a DNA-directed RNA polymerase.
- RNA templates of the present invention may be prepared either in vitro or in vivo by transcription of appropriate DNA sequences using a DNA-directed RNA polymerase such as bacteriophage T7 polymerase, T3 polymerase, the SP6 polymerase, or a eukaryotic polymerase such as polymerase I.
- a DNA-directed RNA polymerase such as bacteriophage T7 polymerase, T3 polymerase, the SP6 polymerase, or a eukaryotic polymerase such as polymerase I.
- the RNA templates of the present invention may be prepared either in vitro or in vivo by transcription of appropriate DNA sequences using a plasmid-based expression system as described in Hoffmann et al, 2000, Proc. Natl. Acad. Sci. USA 97:6108-6113 or the unidirectional RNA polymerase I- polymerase II transcription system as described in Hoffmann and Webster, 2000, J. Gen.
- RNA templates of negative-polarity would contain appropriate terminal sequences that would enable the viral RNA-synthesizing apparatus to recognize the template.
- positive-polarity RNA templates that contain appropriate terminal sequences and enable the viral RNA-synthesizing apparatus to recognize the template may also be used.
- Expression from positive polarity RNA templates may be achieved by transfection of plasmids having promoters that are recognized by the DNA- dependent RNA polymerase.
- plasmid DNA, encoding positive RNA templates under the control of a T7 promoter can be used in combination with the vaccinia virus or fowlpox T7 system.
- Bicistronic mRNAs can be constructed to permit internal initiation of translation of viral sequences and to allow for the expression of foreign protein coding sequences from the regular terminal initiation site, or vice versa.
- a foreign protein may be expressed from an internal transcriptional unit in which the transcriptional unit has an initiation site and polyadenylation site, h another embodiment, the foreign gene is inserted into a PTV gene such that the resulting expressed protein is a fusion protein.
- the invention relates to trivalent vaccines comprising a vims of the invention
- the virus used for a trivalent vaccine is a chimeric bovine parainfluenza type 3/human parainfluenza type3 virus containing a first heterologous nucleotide sequence derived from respiratory syncytial virus, and a second heterologous nucleotide sequence derived from a metapneumovirus, such as human metapneumovirus or avian pneumovirus.
- such a trivalent vaccine would be specific to (a) the gene products of the F gene and the HN gene of the human parainfluenza virus; (b) the protein encoded by the heterologous nucleotide sequence derived from a respiratory syncytial vims; and (c) the protein encoded by the heterologous nucleotide sequence derived from a metapneumovirus.
- the first heterologous nucleotide sequence is the F gene of the respiratory syncytial virus and is inserted in position 1
- the second heterologous nucleotide sequence is the F gene of the human metapneumovirus and is inserted in position 3.
- the intergenic region between a heterologous sequence and the start of the coding sequence of the downstream gene can be altered.
- each gene listed on Table 1 may have a desirable length of the intergenic region.
- a trivalent vaccine comprises a b/h PIV3 vector with a F gene of respiratory syncytial virus inserted at position 1, an altered intergenic region of 177 nucleotides (originally 75 nucleotides to the downstream N gene start codon AUG), and a F gene of human metapneumovirus inserted at position 3 with its natural intergenic region.
- each insertion of a heterologous nucleotide sequence may be manipulated according to section 5.1.2., infra.
- the expression products and chimeric virions of the present invention may be engineered to create vaccines against a broad range of pathogens, including viral antigens, tumor antigens and auto antigens involved in autoimmune disorders.
- pathogens including viral antigens, tumor antigens and auto antigens involved in autoimmune disorders.
- One way to achieve this goal involves modifying existing PIV genes to contain foreign sequences in their respective external domains.
- these chimeric viruses may be used to induce a protective immune response against the disease agent from which these determinants are derived.
- One approach for constructing these hybrid molecules is to insert the heterologous nucleotide sequence into a DNA complement of a PTV genome, e.g. , a l PIV, a bPTV, or a bPrV/hPrV, so that the heterologous sequence is flanked by the viral sequences required for viral polymerase activity; i.e., the viral polymerase binding site/promoter, hereinafter refened to as the viral polymerase binding site, and a polyadenylation site.
- the heterologous coding sequence is flanked by the viral sequences that comprise the replication promoters of the 5' and 3' termini, the gene start and gene end sequences, and the packaging signals that are found in the 5' and/or the 3' termini.
- oligonucleotides encoding the viral polymerase binding site e.g., the complement of the 3 '-terminus or both termini of the virus genomic segment can be ligated to the heterologous coding sequence to construct the hybrid molecule.
- the placement of a foreign gene or segment of a foreign gene within a target sequence was formerly dictated by the presence of appropriate restriction enzyme sites within the target sequence. However, recent advances in molecular biology have lessened this problem greatly.
- Restriction enzyme sites can readily be placed anywhere within a target sequence through the use of site-directed mutagenesis (e.g., see, for example, the techniques described by Kunkel, 1985, Proc. Natl. Acad. Sci. U.S.A. 82;488). Variations in polymerase chain reaction (PCR) technology, described infra, also allow for the specific insertion of sequences (i.e., restriction enzyme sites) and also allow for the facile construction of hybrid molecules. Alternatively, PCR reactions could be used to prepare recombinant templates without the need of cloning.
- PCR polymerase chain reaction
- PCR reactions could be used to prepare double-stranded DNA molecules containing a DNA-directed RNA polymerase promoter (e.g., bacteriophage T3, T7 or SP6) and the hybrid sequence containing the heterologous gene and the PIV polymerase binding site.
- RNA templates could then be transcribed directly from this recombinant DNA.
- the recombinant RNA templates may be prepared by ligating RNAs specifying the negative polarity of the heterologous gene and the viral polymerase binding site using an RNA ligase.
- nucleotides can be added at the 3' end of the HN gene in the untranslated region to adhere to the "Rule of Six" which may be important in successful virus rescue.
- the "Rule of Six” applies to many paramyxoviruses and requires that the number of nucleotides of an RNA genome be a factor of six to be functional.
- the addition of nucleotides can be accomplished by techniques known in the art such as using a commercial mutagenesis kits like the QuikChange mutagenesis kit (Stratagene). After addition of the appropriate number of nucleotides, the conect DNA fragment, for example, a DNA fragment of the hPIV3 F and HN gene, can then be isolated upon digestion with the appropriate restriction enzyme and gel purification.
- the sequence(s) of the leader and/or trailer are mutated relative to the wild type virus.
- the production of a recombinant virus of the invention relies on the replication of a partial or full-length copy of the negative sense viral RNA (vRNA) genome or a complementary copy thereof (cRNA).
- vRNA negative sense viral RNA
- cRNA complementary copy thereof
- This vRNA or cRNA can be isolated from infectious virus, produced upon in-vitro transcription, or produced in cells upon transfection of nucleic acids.
- the production of recombinant negative strand virus relies on a functional polymerase complex.
- the polymerase complex of pneumo viruses consists of N, P, L and possibly M2 proteins, but is not necessarily limited thereto.
- Polymerase complexes or components thereof can be isolated from virus particles, isolated from cells expressing one or more of the components, or produced upon transfection of specific expression vectors. Infectious copies of MPV can be obtained when the above mentioned vRNA, cRNA, or vectors expressing these RNAs are replicated by the above mentioned polymerase complex 16 (Schnell et al, 1994, EMBO J 13: 4195-4203; Collins et al, 1995, PNAS 92:
- the invention provides a host cell comprising a nucleic acid or a vector according to the invention.
- Plasmid or viral vectors containing the polymerase components of PIV are generated in prokaryotic cells for the expression of the components in relevant cell types (bacteria, insect cells, eukaryotic cells). Plasmid or viral vectors containing full-length or partial copies of the PIV genome will be generated in prokaryotic cells for the expression of viral nucleic acids in vitro or in vivo.
- the latter vectors may contain other viral sequences for the generation of chimeric viruses or chimeric virus proteins, may lack parts of the viral genome for the generation of replication defective virus, and may contain mutations, deletions or insertions for the generation of attenuated viruses .
- Infectious copies of PIN can be produced upon co-expression of the polymerase components according to the state-of-the-art technologies described above.
- eukaryotic cells transiently or stably expressing one or more full-length or partial PTV proteins can be used.
- Such cells can be made by transfection (proteins or nucleic acid vectors), infection (viral vectors) or transduction (viral vectors) and may be useful for complementation of mentioned wild type, attenuated, replication-defective or chimeric viruses.
- the present invention encompass engineering recombinant bovine or human parainfluenza viruses to express one or more heterologous sequences, wherein the heterologous sequences encode gene products or fragments of gene products that are preferably antigenic and/or immunogenic.
- antigenic refers to the ability of a molecule to bind antibody or MHC molecules.
- immunogenic refers to the ability of a molecule to generate immune response in a host.
- the heterologous nucleotide sequence to be inserted is derived from a negative strand RNA virus, including but not limited to, influenza vims, parainfluenza virus, respiratory syncytial virus, mammalian metapneumovirus (e.g., human metapneumovirus) and avian pneumovirus.
- a negative strand RNA virus including but not limited to, influenza vims, parainfluenza virus, respiratory syncytial virus, mammalian metapneumovirus (e.g., human metapneumovirus) and avian pneumovirus.
- the heterologous sequence to be inserted includes, but is not limited to, a sequence that encodes a F or HN gene of human PIN, a F gene of RSN, a HA gene of influenza vims type A, B, or C, a F gene of human MPN, a F gene of avian pneumovirus, or an immunogenic and/or antigenic fragment thereof.
- the heterologous nucleotide sequence to be inserted is derived from a human metapneumovirus and/or an avian pneumovirus.
- the heterologous nucleotide sequence to be inserted is derived from (a) a human metapneumovirus and a respiratory syncytial virus; and/or (b) an avian pneumovirus and a respiratory syncytial virus.
- the heterologous nucleotide sequence to be inserted is derived from a F gene from a human metapneumovirus and/or an avian pneumovims.
- the F gene is derived from (a) a human metapneumovirus and a respiratory syncytial virus; and/or (b) an avian pneumovirus and a respiratory syncytial virus.
- the heterologous nucleotide sequence to be inserted is a G gene derived from a human metapneumovirus and/or an avian pneumovims.
- the G gene is derived from (a) a human metapneumovirus and a respiratory syncytial vims; and/or (b) an avian pneumovirus and a respiratory syncytial virus.
- any combination of different F genes and/or different G genes derived from human metapneumovirus, avian pneumovirus, and respiratory syncytial virus can be inserted into the virus of the invention with the proviso that in all embodiments at least one heterologous sequence derived from either human metapneumovims or avian pneumovirus is present in the recombinant parainfluenza vims of the invention.
- the nucleotide sequence to be inserted is a nucleotide sequence encoding a F protein derived from a human metapneumovirus.
- the nucleotide sequence to be inserted is a nucleotide sequence encoding a G protein derived from a human metapneumovirus. In yet other embodiments, the nucleotide sequence to be inserted is a nucleotide sequence encoding a F protein derived from an avian pneumovims. In yet other embodiments, the nucleotide sequence to be inserted is a nucleotide sequence encoding a G protein derived from an avian pneumovirus.
- the heterologous nucleotide sequence to be inserted encodes a F protein or a G protein of a respiratory syncytial virus.
- the nucleotide sequence to be inserted encodes a chimeric F protein or a chimeric G protein.
- a chimeric F protein comprises parts of F proteins from different vimses, such as a human metapneumovirus, avian pneumovims and/or respiratory syncytial vims.
- a chimeric G protein comprises parts of G proteins from different vimses, such as a human metapneumovims, avian pneumovims and/or respiratory syncytial vims.
- the F protein comprises an ectodomain of a F protein of a metapneumovims, a transmembrane domain of a F protein of a parainfluenza vims, and luminal domain of a F protein of a parainfluenza virus.
- the nucleic acid to be inserted encodes a F protein, wherein the transmembrane domain of the F protein is deleted so that a soluble F protein is expressed.
- the heterologous nucleotide sequence of the invention is any one of SEQ ID NO: 1 through SEQ LD NO:5, SEQ ID NO: 14, and SEQ ID NO:15 (see Table 16).
- the nucleotide sequence encodes a protein of any one of SEQ ID NO:6 through SEQ ID NO:13, SEQ ID NO:16, and SEQ ID NO:17 (see Table 16).
- the nucleotide sequence encodes a protein of any one of SEQ ID NO. 314 to 389.
- heterologous gene sequences that can be expressed into the chimeric vimses of the invention include but are not limited to those encoding antigenic epitopes and glycoproteins of vimses, such as influenza glycoproteins, in particular hemagglutinin H5, H7, respiratory syncytial vims epitopes, New Castle Disease vims epitopes, Sendai vims and infectious Laryngotracheitis virus (ILV), that result in respiratory disease.
- influenza glycoproteins in particular hemagglutinin H5, H7, respiratory syncytial vims epitopes, New Castle Disease vims epitopes, Sendai vims and infectious Laryngotracheitis virus (ILV), that result in respiratory disease.
- IMV infectious Laryngotracheitis virus
- heterologous nucleotide sequences are derived from a metapneumovims, such as human metapneumovims and/or avian pneumovirus.
- heterologous gene sequences that can be engineered into the chimeric vimses of the invention include, but are not limited to, those encoding viral epitopes and glycoproteins of vimses, such as hepatitis B virus surface antigen, hepatitis A or C vims surface glycoproteins of Epstein Ban virus, glycoproteins of human papilloma virus, simian vims 5 or mumps vims, West Nile vims, Dengue virus, glycoproteins of herpesviruses, VPI of polioviras, and sequences derived from a human immunodeficiency vims (HIV), preferably type 1 or type 2.
- HIV human immunodeficiency vims
- heterologous gene sequences that can be engineered into chimeric viruses of the invention include, but are not limited to, those encoding Marek's Disease vims (MDV) epitopes, epitopes of infectious Bursal Disease vims (IBDV), epitopes of Chicken Anemia virus, infectious laryngotracheitis vims (ILV), Avian Influenza vims (AIV), rabies, feline leukemia vims, canine distemper virus, vesicular stomatitis vims, and swinepox vims (see Fields et al.
- MDV Marek's Disease vims
- IBDV infectious Bursal Disease vims
- ILV infectious laryngotracheitis vims
- AIV Avian Influenza vims
- rabies feline leukemia vims
- canine distemper virus canine distemper virus
- vesicular stomatitis vims ve
- heterologous sequences of the present invention include those encoding antigens that are characteristic of autoimmune diseases. These antigens will typically be derived from the cell surface, cytoplasm, nucleus, mitochondria and the like of mammalian tissues, including antigens characteristic of diabetes mellitus, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, pernicious anemia, Addison's disease, scleroderma, autoimmune atrophic gastritis, juvenile diabetes, and discoid lupus erythromatosus.
- Antigens that are allergens generally include proteins or glycoproteins, including antigens derived from pollens, dust, molds, spores, dander, insects and foods.
- antigens that are characteristic of tumor antigens typically will be derived from the cell surface, cytoplasm, nucleus, organelles and the like of cells of tumor tissue. Examples include antigens characteristic of tumor proteins, including proteins encoded by mutated oncogenes; viral proteins associated with tumors; and glycoproteins.
- Tumors include, but are not limited to, those derived from the types of cancer: lip, nasopharynx, pharynx and oral cavity, esophagus, stomach, colon, rectum, liver, gall bladder, pancreas, larynx, lung and bronchus, melanoma of skin, breast, cervix, uterine, ovary, bladder, kidney, utems, brain and other parts of the nervous system, thyroid, prostate, testes, Hodg in's disease, non-Hodgkin's lymphoma, multiple myeloma and leukemia.
- the heterologous sequences are derived from the genome of human immunodeficiency vims (HIV), preferably human immunodeficiency vims- 1 or human immunodeficiency viras-2.
- the heterologous coding sequences may be inserted within a PIN gene coding sequence such that a chimeric gene product, that contains the heterologous peptide sequence within the PTV viral protein, is expressed.
- the heterologous sequences may also be derived from the genome of a human immunodeficiency vims, preferably of human immunodeficiency viras-1 or human immunodeficiency viras-2.
- such sequences may include, but are not limited to sequences derived from the env gene (i.e., sequences encoding all or part of gpl60, gpl20, and/or gp41), the pol gene (i.e., sequences encoding all or part of reverse transcriptase, endonuclease, protease, and/or integrase), the gag gene (i.e., sequences encoding all or part of p7, p6, p55, pl7/18, p24/25) tat, rev, nef, vif, vpu, vpr, and/or vpx.
- the env gene i.e., sequences encoding all or part of gpl60, gpl20, and/or gp41
- the pol gene i.e., sequences encoding all or part of reverse transcriptase, endonuclease, protease,
- heterologous gene sequences that can be engineered into the chimeric viruses include those that encode proteins with immunopotentiating activities.
- immunopotentiating proteins include, but are not limited to, cytokines, interferon type 1, gamma interferon, colony stimulating factors, and interleukin -1, -2, -4, -5, -6, -12.
- other heterologous gene sequences that may be engineered into the chimeric viruses include those encoding antigens derived from bacteria such as bacterial surface glycoproteins, antigens derived from fungi, and antigens derived from a variety of other pathogens and parasites.
- heterologous gene sequences derived from bacterial pathogens include, but are not limited to, those encoding antigens derived from species of the following genera: Salmonella, Shigella, Chlamydia, Helicobacter, Yersinia, Bordatella, Pseudomonas, Neisseria, Vibrio, Haemophilus, Mycoplasma, Streptomyces, Treponema, Coxiella, Ehrlichia, Brucella, Streptobacillus, Fusospirogina, Spirillum, Ureaplasma, Spirochaeta, Mycoplasma, Actinomycetes, Borrelia, Bacteroides, Trichomoras, Branhamella, Pasteurella, Clostridium, Corynebacterium, Liste ⁇ a, Bacillus, Erysipelothrix, Rhodococcus, Escherichia, Klebsiella, Pseudomanas, Enterobacter, Serratia
- Enterococcus Acinetobacter, Morganella, Moraxella, Citrobacter, Rickettsia, Rochlimeae, as well as bacterial species such as: P. aeruginosa; E. coli, P. cepacia, S. epidermis, E.faecalis, S. pneumonias, S. aureus, N. meningitidis, S. pyogenes, Pasteurella multocida, Treponema pallidum, and . mirabilis.
- bacterial species such as: P. aeruginosa; E. coli, P. cepacia, S. epidermis, E.faecalis, S. pneumonias, S. aureus, N. meningitidis, S. pyogenes, Pasteurella multocida, Treponema pallidum, and . mirabilis.
- heterologous gene sequences derived from pathogenic fungi include, but are not limited to, those encoding antigens derived from fungi such as Cryptococcus neoformans; Blastomyces dermatitidis; Aiellomyces dermatitidis; Histoplasma capsulatum; Coccidioides immitis; Candida species, including C. albicans, C. tropicalis, C. parapsilosis, C. guilliermondii and C. krusei, Aspergillus species, including A. fumigatus, A.flavus and A. niger, Rhizopus species; Rhizomucor species; Cunninghammella species; Apophysomyces species, including A.
- heterologous gene sequences derived from parasites include, but are not limited to, those encoding antigens derived from members of the Apicomplexa phylum such as, for example, Babesia, Toxoplasma, Plasmodium, Eimeria, Isospora,
- Atoxoplasma Cystoisospora, Hammondia, Besniotia, Sarcocystis, Frenkelia, Haemoproteus, Leucocytozoon, Theileria, Perkinsus and Gregarina spp.; Pneumocystis carinii; members of the Microspora phylum such as, for example, Nosema, Enterocytozoon, Encephalitozoon, Septata, Mrazekia, Amblyospora, Ameson, Glugea, Pleistophora and Microsporidium spp.; and members of the Ascetospora phylum such as, for example, Haplosporidium spp., as well as species including Plasmodium falciparum, P.
- the invention relates to nucleic acid sequences of a mammalian MPV, proteins of a mammalian MPV, and antibodies against proteins of a mammalian MPV.
- the invention further relates to homologs of nucleic acid sequences of a mammalian MPV and homologs of proteins of a mammalian MPV.
- the invention further relates to nucleic acid sequences encoding fusion proteins, wherein the fusion protein contains a protein of a mammalian MPV or a fragment thereof and one or more peptides or proteins that are not derived from mammalian MPV.
- a fusion protein of the invention contains a protein of a mammalian MPV or a fragment thereof and a peptide tag, such as, but not limited to a polyhistidine tag.
- the invention further relates to fusion proteins, wherein the fusion protein contains a protein of a mammalian MPV or a fragment thereof and one or more peptides or proteins that are not derived from mammalian MPV.
- the invention also relates to derivatives of nucleic acids encoding a protein of a mammlian MPV.
- the invention also relates to derivatives of proteins of a mammalian MPV.
- a derivative can be, but is not limited to, mutant forms of the protein, such as, but not limited to, additions, deletions, truncations, substitutions, and inversions.
- a derivative can further be a chimeric form of the protein of the mammalian MPV, wherein at least one domain of the protein is derived from a different protein.
- a derivative can also be a form of a protein of a mammalian MPV that is covalently or non-covalently linked to another molecule, such as, e.g., a drug.
- the viral isolate termed NL/1/00 (also 00-1) is a mammalian MPV of variant Al and its genomic sequence is shown in SEQ ID NO:95.
- the viral isolate termed NL/17/00 is a mammalian MPN of variant A2 and its genomic sequence is shown in SEQ ID ⁇ O:96.
- the viral isolate termed NL/1/99 (also 99-1) is a mammalian MPV of variant B 1 and its genomic sequence is shown in SEQ ID NO:94.
- the viral isolate termed NL/1/94 is a mammalian MPV of variant B2 and its genomic sequence is shown in SEQ ID NO:97.
- a list of sequences disclosed in the present application and the conesponding SEQ ID Nos is set forth in Table 16.
- the protein of a mammalian MPV can be a an N protein, a P protein, a M protein, a F protein, a M2-1 protein or a M2-2 protein or a fragment thereof.
- a fragment of a protein of a mammlian MPV can be can be at least 25 amino acids, at least 50 amino acids, at least 75 amino acids, at least 100 amino acids, at least 125 amino acids, at least 150 amino acids, at least 175 amino acids, at least 200 amino acids, at least 225 amino acids, at least 250 amino acids, at least 275 amino acids, at least 300 amino acids, at least 325 amino acids, at least 350 amino acids, at least 375 amino acids, at least 400 amino acids, at least 425 amino acids, at least 450 amino acids, at least 475 amino acids, at least 500 amino acids, at least 750 amino acids, at least 1OO0 amino acids, at least 1250 amino acids, at least 1500 amino acids, at least 1750 amino acids, at least 2000 amino acids or at least 2250 amino acids in length.
- a fragment of a protein of a mammlian MPV can be can be at most 25 amino acids, at most 50 amino acids, at most 75 amino acids, at most 100 amino acids, at most 125 amino acids, at most 150 amino acids, at most 175 amino acids, at most 200 amino acids, at most 225 amino acids, at most 250 amino acids, at most 275 amino acids, at most 300 amino acids, at most 325 amino acids, at most 350 amino acids, at most 375 amino acids, at most 400 amino acids, at most 425 amino acids, at most 450 amino acids, at most 475 amino acids, at most 500 amino acids, at most 750 amino acids, at most 1000 amino acids, at most 1250 amino acids, at most 1500 amino acids, at most 1750 amino acids, at most 2000 amino acids or at most 2250 amino acids in length.
- the protein of a mammalian MPV is a N protein, wherein the N protein is phylogenetically closer related to a N protein of a mammalian MPV, such as the N protein encoded by, e.g., the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, (see also Table 16 for a description of the SEQ ID Nos) than it is related to the N protein of APV type C.
- the protein of a mammalian MPV is a P protein, wherein the P protein is phylogenetically closer related to a P protein of a mammalian MPV, such as the P protein encoded by, e.g., the viral genome of SEQ ID NO:NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to the N protein of APV type C.
- the protein of a mammalian MPV is a M protein, wherein the M protein is closer related to a M protein of a mammalian MPV, such as the M protein encoded by, e.g., the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ LD NO:96, or SEQ ID NO:97, than it is related to the M protein of APV type C.
- the protein of a mammalian MPV is a F protein, wherein the F protein is phylogenetically closer related to a F protein of a mammalian MPV, such as the F protein encoded by, e.g.
- the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 is related to the F protein of APV type C.
- the protein of a mammalian MPV is a M2-1 protein, wherein the M2-1 protein is phylogenetically closer related to a M2-1 protein of a mammalian MPV, such as the M2-1 protein encoded by, e.g., the viral genome of SEQ DD NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to the M2-1 protein of APV type C.
- the protein of a mammalian MPV is a M2-2 protein, wherein the M2-2 protein is phylogenetically closer related to a M2-2 protein of a mammalian MPV, such as the M2-2 protein encoded by, e.g., the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to the M2-2 protein of APV type C.
- the protein of a mammalian MPV is a G protein, wherein the G protein is phylogenetically closer related to a G protein of a mammalian MPV, such as the G protein encoded by, e.g., the viral genome of SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to any protein of APV type C.
- the protein of a mammalian MPV is a SH protein, wherein the SH protein is phylogenetically closer related to a SH protein of a mammalian MPV, such as the SH protein encoded by, e.g., the viral genome of SEQ ID NO:94, SEQ ID NO: 95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to any protein of APV type C.
- the protein of a mammalian MPV is a L protein, wherein the L protein is phylogenetically closer related to a L protein of a mammalian MPV, sucTi as the SH protein encoded by, e.g., the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to any protein of APV type C.
- the protein of a mammalian MPV is a N protein, wherein the N protein is at least 60%, at least 65%, at least 10%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a N protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the respective N proteins are disclosed in SEQ ID NO:366-369; see also Table 16).
- the protein of a mammalian MPV is a N protein, wherein the P protein is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a P protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the respective P proteins are disclosed in SEQ ID NO:78-85; see also Table 16).
- the protein of a mammalian MPV is a M protein, wherein the M protein is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a JM protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the respective M proteins are disclosed in SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the respective M proteins are disclosed in SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the respective M proteins are disclosed in SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequence
- the protein of a mammalian MPV is a F protein, wherein the F protein is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a F protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID N0:97 (the amino acid sequences of the respective F proteins are disclosed in SEQ ID NO:18-25; see also Table 16).
- the protein of a mammalian MPV is a M2-1 protein, wherein the M2-1 protein is at least 60%>, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a M2-1 protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the respective M2-1 proteins are disclosed in SEQ ED NO:42-49; see also Table 16).
- the protein of a mammalian MPN is a M2-2 protein, wherein the M2-2 protein is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a M2-2 protein encoded by the viral genome of SEQ DD ⁇ O:94, SEQ DD NO:95, SEQ ID NO:96, or SEQ DD NO:97 (the amino acid sequences of the respective M2-2 proteins are disclosed in SEQ DD NO:50-57; see also Table 16).
- the protein of a mammalian MPN is a G protein, wherein the G protein is at least 60%>, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a G protein encoded by the viral genome of SEQ DD ⁇ O:94, SEQ DD NO:95, SEQ DD NO:96, or SEQ ID NO:97 (the amino acid sequences of the respective G proteins are disclosed in SEQ DD NO:26-33; see also Table 16).
- the protein of a mammalian MPV is a SH protein, wherein the SH protein is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a SH protein encoded by the viral genome of SEQ DD NO: 94, SEQ ID NO: 94, SEQ ID
- the protein of a mammalian MPV is a L protein, wherein the L protein is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of a L protein encoded by the viral genome of SEQ DD NO:94, SEQ DD NO:95, SEQ JJD NO:96, or SEQ DD NO:97 (the amino acid sequences of the respective L proteins are disclosed in SEQ DD NO: 34-41; see also Table 16).
- a fragment of a protein of mammalian MPV is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the homologous protein encoded by the vims of SEQ DD NO:94, SEQ DD NO:95, SEQ DD NO:96, or SEQ ID NO:97 over the portion of the protein that is homologous to the fragment.
- the invention provides a fragment of the F protein of a mammalian MPV that contains the ectodomain of the F protein and homologs thereof.
- the homolog of the fragment of the F protein that contains the ectodomain is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the conesponding fragment containing the ectodomain of the F protein encoded by a virus of SEQ DD NO:94, SEQ ID NO:95, SEQ DD NO:96, or SEQ DD NO:97 (the amino acid sequences of the respective F proteins are disclosed in SEQ DD NO:18-25; see also Table 16).
- the invention provides a protein of a mammalian MPV of subgroup A and fragments thereof.
- the invention provides a N protein of a mammalian MPV of subgroup A, wherein the N protein is phylogenetically closer related to the N protein encoded by a vims of SEQ DD NO:95 or SEQ DD NO:96 than it is related to the N protein encoded by a virus encoded by SEQ DD NO:94 or SEQ DD NO:97.
- the invention provides a G protein of a mammalian MPV of subgroup A, wherein the G protein is phylo enetically closer related to the G protein encoded by a virus of SEQ DD NO:95 or SEQ ED NO:96 than it is related to the G protein encoded by a vims encoded by SEQ DD NO:94 or SEQ DD NO:97.
- the invention provides a P protein of a mammalian MPV of subgroup A, wherein the P protein is phylogenetically closer related to the P protein encoded by a vims of SEQ DD NO:95 or SEQ DD NO:96 than it is related to the P protein encoded by a vims encoded by SEQ DD NO:94 or SEQ DD NO:97.
- the invention provides a M protein of a mammalian MPV of subgroup A, wherein the M protein is phylogenetically closer related to the M protein encoded by a vims of SEQ ID NO:95 or SEQ DD NO:96 than it is related to the M protein encoded by a vims encoded by SEQ DD NO:94 or SEQ DD NO:97.
- the invention provides a N protein of a mammalian MPV of subgroup A, wherein the F protein is phylogenetically closer related to the F protein encoded by a vims of SEQ DD NO: 95 or SEQ DD NO:96 than it is related to the F protein encoded by a virus encoded by SEQ DD NO:94 or SEQ DD NO:97.
- the invention provides a M2-1 protein of a mammalian MPV of subgroup A, wherein the M2-1 protein is phylogenetically closer related to the M2-1 protein encoded by a vims of SEQ DD NO:95 or SEQ ID NO:96 than it is related to the M2-1 protein encoded by a vims encoded by SEQ DD NO:94 or SEQ ID NO:97.
- the invention provides a M2-2 protein of a mammalian MPV of subgroup A, wherein the M2-2 protein is phylogenetically closer related to the M2-2 protein encoded by a vims of SEQ DD NO:95 or SEQ JJD NO:96 than it is related to the M2-2 protein encoded by a vims encoded by SEQ ID NO: 94 or SEQ DD NO: 97.
- the invention provides a SH protein of a mammalian MPV of subgroup A, wherein the SH protein is phylogenetically closer related to the SH protein encoded by a vims of SEQ DD NO:95 or SEQ DD NO: 96 than it is related to the SH protein encoded by a virus encoded by SEQ ID NO:94 or SEQ DD NO:97.
- the invention provides a L protein of a mammalian MPV of subgroup A, wherein the L protein is phylogenetically closer related to the L protein encoded by a vims of SEQ DD NO:95 or SEQ DD NO:96 than it is related to the L protein encoded by a vims encoded by SEQ DD NO: 94 or SEQ DD NO: 97.
- the invention provides a protein of a mammalian MPV of subgroup B or fragments thereof.
- the invention provides a N protein of a mammalian MPV of subgroup B, wherein the N protein is phylogenetically closer related to the N protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the N protein encoded by a vims encoded by SEQ DD NO:95 or SEQ DD NO:96.
- the invention provides a G protein of a mammalian MPV of subgroup A, wherein the G protein is phylogenetically closer related to the G protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the G protein encoded by a vims encoded by SEQ DD NO:95 or SEQ DD NO:96.
- the invention provides a P protein of a mammalian MPV of subgroup A, wherein the P protein is phylogenetically closer related to the P protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the P protein encoded by a vims encoded by SEQ DD NO:95 or SEQ ID NO:96.
- the invention provides a M protein of a mammalian MPV of subgroup A, wherein the M protein is phylogenetically closer related to the M protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the M protein encoded by a vims encoded by SEQ DD NO:95 or SEQ DD NO:96.
- the invention provides a N protein of a mammalian MPV of subgroup A, wherein the F protein is phylogenetically closer related to the F protein encoded by a vims of SEQ DD NO: 94 or SEQ DD NO:97 than it is related to the F protein encoded by a virus encoded by SEQ DD NO:95 or SEQ DD NO:96.
- the invention provides a M2-1 protein of a mammalian MPV of subgroup A, wherein the M2-1 protein is phylogenetically closer related to the M2-1 protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the M2-1 protein encoded by a vims encoded by SEQ DD NO:95 or SEQ DD NO:96.
- the invention provides a M2-2 protein of a mammalian MPV of subgroup A, wherein the M2-2 protein is phylogenetically closer related to the M2-2 protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the M2-2 protein encoded by a vims encoded by SEQ ID NO:95 or SEQ DD NO: 96.
- the invention provides a SH protein of a mammalian MPV of subgroup A, wherein the SH protein is phylogenetically closer related to the SH protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the SH protein encoded by a vims encoded by SEQ ID NO:95 or SEQ DD NO:96.
- the invention provides a L protein of a mammalian MPV of subgroup A, wherein the L protein is phylogenetically closer related to the L protein encoded by a vims of SEQ DD NO:94 or SEQ DD NO:97 than it is related to the L protein encoded by a vims encoded by SEQ DD NO:95 or SEQ DD NO:96.
- the invention provides a G protein of a mammalian MPV variant BI, wherein the G protein of a mammalian MPV variant BI is phylogenetically closer related to the G protein of the prototype of variant BI, isolate NL/1/99, than it is related to the G protein of the prototype of variant Al, isolate NL(l/00, the G protein of the prototype of A2, isolate NL/17/00, or the G protein of the prototype of B2, isolate NL/1/94.
- the invention provides a G protein of a mammalian MPV variant BI, wherein the amino acid sequence of the G protein is at least 66%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% or at least 99.5% identical to the G protein of a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:28).
- the G protein of a mammalian MPV has the amino acid sequence of SEQ DD NO : 119- 153.
- the invention provides a N protein of a mammalian MPV variant B 1 , wherein the N protein of a mammalian MPV variant BI is phylogenetically closer related to the N protein of the prototype of variant BI, isolate NL/1/99, than it is related to the N protein of the prototype of variant Al, isolate NL/1/00, the N protein of the prototype of A2, isolate NL/17/00, or the N protein of the prototype of B2, isolate NL/1/94.
- the invention provides a N protein of a mammalian MPV variant BI, wherein the amino acid sequence of the N proteint is at least 98.5% or at least 99% or at least 99.5% identical to the N protein of a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:72).
- the invention provides a P protein of a mammalian MPV variant BI, wherein the P protein of a mammalian MPV variant BI is phylogenetically closer related to the P protein of the prototype of variant BI, isolate NL/1/99, than it is related to the P protein of the prototype of variant Al, isolate NL/1/00, the P protein of the prototype of A2, isolate NL/17/00, or the P protein of the prototype of B2, isolate NL/1/94.
- the invention provides a P protein of a mammalian MPV variant BI, wherein the amino acid sequence of the P protein is at least 96%, at least 98%, or at least 99% or at least 99.5% identical the P protein of a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:80).
- the invention provides a M protein of a mammalian MPV variant BI, wherein the M protein of a mammalian MPV variant BI is phylogenetically closer related to the M protein of the prototype of variant BI, isolate NL/1/99, than it is related to the M protein of the prototype of variant Al, isolate NL/1/00, the M protein of the prototype of A2, isolate NL/17/00, or the M protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M protein of a mammalian MPV variant BI, wherein the amino acid sequence of the M protein is identical to the M protein of a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:64).
- the invention provides a F protein of a mammalian MPV variant BI, wherein the F protein of a mammalian MPV variant J31 is phylogenetically closer related to the F protein of variant BI, isolate NL/1/99, than it is related to the F protein of variant Al, isolate NL/1/00, the F protein of prototype A2, isolate NL/17/00, or the F protein of the prototype of B2, isolate NL/1/94.
- the invention provides a F protein of mammalian MPV variant BI, wherein the amino acid sequence of the F protein is identical at least 99% identical, to the F protein of a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:20).
- the F protein of a mammalian MPV has the amino acid sequence of SEQ DD NO: 248-327.
- the invention provides a M2-1 protein of a mammalian MPV variant B 1 , wherein the M2- 1 protein of a mammalian MPV variant BI is phylogenetically closer related to the M2-1 protein of the prototype of variant BI, isolate NL/1/99, than it is related to the M2-1 protein of the prototype of variant Al, isolate NL/1/00, the M2-1 protein of the prototype of A2, isolate NL/17/00, or the M2-1 protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M2-1 protein of a mammalian MPV variant BI, wherein the amino acid sequence of the M2-1 protein is at least 98% or at least 99% or at least 99.5% identical the M2-1 protein of a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:44).
- the invention provides a M2-2 protein of a mammalian MPV variant BI, wherein the M2-2 protein of a mammalian MPV variant BI is phylogenetically closer related to the M2-2 protein of the prototype of variant BI, isolate NL/1/99, than it is related to the M2-2 protein of the prototype of variant Al, isolate NL/1/00, the M2-2 protein of the prototype of A2, isolate NL/17/00, or the M2-2 protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M2-2 protein of a mammalian MPV variant BI, wherein the amino acid sequence of the M2-2 protein is at least 99%or at least 99.5% identical the M2-2 protein of a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:52).
- the invention provides a SH protein of a mammalian MPV variant BI, wherein the SH protein of a mammalian MPV variant BI is phylogenetically closer related to the SH protein of the prototype of variant BI, isolate NL/1/99, than it is related to the SH protein of the prototype of variant Al, isolate NL/1/00, the SH protein of the prototype of A2, isolate NL/17/00, or the SH protein of the prototype of B2, isolate NL/1/94.
- the invention provides a SH protein of a mammalian MPV variant BI, wherein the amino acid sequence of the SH protein is at least 83%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% or at least 99.5% identical the SH protein of a mammalian MPV variant B 1 as represented by the prototype NL/1/99 (SEQ DD NO:88).
- the invention provides a L protein of a mammalian MPV variant BI, wherein the L protein of a mammalian MPV variant BI is phylogenetically closer related to the L protein of the prototype of variant BI, isolate NL/1/99, than it is related to the L protein of the prototype of variant Al, isolate NL/1/00, the L protein of the prototype of A2, isolate NL/17/00, or the L protein of the prototype of B2, isolate NL/1/94.
- the invention provides a L protein of a mammalian MPV variant BI, wherein the amino acid sequence of the L protein is at least 99% or at least 99.5% identical the L protein a mammalian MPV variant BI as represented by the prototype NL/1/99 (SEQ DD NO:36).
- the invention provides a G protein of a mammalian MPV variant Al, wherein the G protein of a mammalian MPV variant Al is phylogenetically closer related to the G protein of the prototype of variant Al, isolate NL/1/00, than it is related to the G protein of the prototype of variant BI, isolate NL/1/99, the G protein of the prototype of A2, isolate NL/17/00, or the G protein of the prototype of B2, isolate NL/1/94.
- the invention provides a G protein of a mammalian MPV variant Al, wherein the amino acid sequence of the G protein is at least 66%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%>, or at least 99% or at least 99.5% identical to the G protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO:26).
- the invention provides a N protein of a mammalian MPV variant Al , wherein the N protein of a mammalian MPV variant Al is phylogenetically closer related to the N protein of the prototype of variant Al, isolate NL/1/00, than it is related to the N protein of the prototype of variant BI, isolate NL/1/99, the N protein of the prototype of A2, isolate NL/17/00, or the N protein of the prototype of B2, isolate NL/1/94.
- the invention provides a N protein of a mammalian MPV variant Al, wherein the amino acid sequence of the N protein is at least 99.5% identical to the N protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO:70).
- the invention provides a P protein of a mammalian MPV variant Al, wherein the P protein of a mammalian MPV variant Al is phylogenetically closer related to the P protein of the prototype of variant Al, isolate NL/1/00, than it is related to the P protein of the prototype of variant BI , isolate NL/1/99, the P protein of the prototype of A2, isolate NL/17/00, or the P protein of the prototype of B2, isolate NL/1/94.
- the invention provides a P protein of a mammalian MPV variant Al, wherein the amino acid sequence of the P protein is at least 96%, at least 98%, or at least 99% or at least 99.5% identical to the P protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO:78).
- the invention provides a M protein of a mammalian MPV variant Al, wherein the M protein of a mammalian MPV variant Al is phylogenetically closer related to the M protein of the prototype of variant Al, isolate NL/1/00, than it is related to the M protein of the prototype of variant BI, isolate NL/1/99, the M protein of the prototype of A2, isolate NL/17/00, or the M protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M protein of a mammalian MPV variant Al , wherein the amino acid sequence of the M protein is at least 99% or at least 99.5% identical to the M protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO:62).
- the invention provides a F protein of a mammalian MPV variant Al, wherein the F protein of a mammalian MPV variant Al is phylogenetically closer related to the F protein of the prototype of variant Al, isolate NL/1/00, than it is related to the F protein of the prototype of variant BI, isolate NL/1/99, the F protein of the prototype of A2, isolate NL/17/00, or the F protein of the prototype of B2, isolate NL/1/94.
- the invention provides a F protein of a mammalian MPV variant Al, wherein the amino acid sequence of the F protein is at least 98% or at least 99% or at least 99.5%> identical to the F protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO: 18).
- the invention provides a M2- 1 protein of a mammalian MPV variant Al, wherein the M2-1 protein of a mammalian MPV variant Al is phylogenetically closer related to the M2-1 protein of the prototype of variant Al, isolate NL/1/00, than it is related to the M2-1 protein of the prototype of variant BI, isolate NL/1/99, the M2-1 protein of the prototype of A2, isolate NL/17/00, or the M2-1 protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M2-1 protein of a mammalian MPV variant Al, wherein the amino acid sequence of the M2-1 protein is at least 99%o or at least 99.5% identical to the M2-1 protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO:42).
- the invention provides a M2-2 protein of a mammalian MPV variant Al, wherein the M2-2 protein of a mammalian MPV variant Al is phylogenetically closer related to the M2-2 protein of the prototype of variant Al, isolate NL/1/00, than it is related to the M2-2 protein of the prototype of variant BI, isolate NL/1/99, the M2-2 protein of the prototype of A2, isolate NL/17/00, or the M2-2 protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M2-2 protein of a mammalian MPV variant Al, wherein the amino acid sequence of the M2-2 protein is at least 96% or at least 99% or at least 99.5% identical to the M2-2 protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO:50).
- the invention provides a SH protein of a mammalian MPV variant Al, wherein the SH protein of a mammalian MPV variant Al is phylogenetically closer related to the SH protein of the prototype of variant Al, isolate NL/1/00, than it is related to the SH protein of the prototype of variant BI, isolate NL/1/99, the SH protein of the prototype of A2, isolate NL/17/00, or the SH protein of the prototype of B2, isolate NL/1/94.
- the invention provides a SH protein of a mammalian MPV variant Al, wherein the amino acid sequence of the SH protein is at least 84%, at least 90%, at least 95%, at least 98%, or at least 99% or at least 99.5% identical to the SH protein of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD NO:86).
- the invention provides a L protein of a mammalian MPV variant Al, wherein the L protein of a mammalian MPV variant Al is phylogenetically closer related to the L protein of the prototype of variant Al, isolate NL/1/00, than it is related to the L protein of the prototype of variant BI, isolate NL/1/99, the L protein of the prototype of A2, isolate NL/17/00, or the L protein of the prototype of B2, isolate NL/1/94.
- the invention provides a L protein of a mammalian MPV variant Al, wherein the amino acid sequence of the L protein is at least 99% or at least 99.5% identical to the L protein of a vims of a mammalian MPV variant Al as represented by the prototype NL/1/00 (SEQ DD J O:34).
- the invention provides a G protein of a mammalian MPV variant A2, wherein the G protein of a mammalian MPV variant A2 is phylogenetically closer related to the G protein of the prototype of variant A2, isolate NL/17/00, than it is related to the G protein of the prototype of variant BI, isolate NL/1/99, the G protein of the prototype of Al, isolate NL/1/00, or the G protein of the prototype of B2, isolate NL/1/94.
- the invention provides a G protein of a mammalian MPV variant A2, wherein the amino acid sequence of the G protein is at least 66%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.5% identical to the G protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO:27).
- the invention provides a N protein of a mammalian MPV variant A2, wherein the N protein of a mammalian MPV variant A2 is phylogenetically closer related to the N protein of the prototype of variant A2, isolate NL/17/00, than it is related to the N protein of the prototype of variant BI, isolate NL/1/99, the N protein of the prototype of Al, isolate NL/1/00, or the N protein of the prototype of B2, isolate NL/1/94.
- the invention provides a N protein of a mammalian MPV variant A2, wherein the amino acid sequence of the N protein at least 99.5% identical to the N protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO:71).
- the invention provides a P protein of a mammalian MPV variant A2, wherein the P protein of a mammalian MPV variant A2 is phylogenetically closer related to the P protein of the prototype of variant A2, isolate NL/17/00, than it is related to the P protein of the prototype of variant BI, isolate NL/1/99, the P protein of the prototype of Al, isolate NL/1/00, or the P protein of the prototype of B2, isolate NL/1/94.
- the invention provides a P protein of a mammalian MPV variant A2, wherein the amino acid sequence of the P protein is at least 96%, at least 98%, at least 99% or at least 99.5% identical to the P protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO:79).
- the invention provides a M protein of a mammalian MPV variant A2, wherein the M protein of a mammalian MPV variant A2 is phylogenetically closer related to the M protein of the prototype of variant A2, isolate NL/17/00, than it is related to the M protein of the prototype of variant BI, isolate NL/1/99, the M protein of the prototype of Al, isolate NL/1/00, or the M protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M protein of a mammalian MPV variant A2, wherein the the amino acid sequence of the M protein is at least 99%, or at least 99.5% identical to the M protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO:63).
- the invention provides a F protein of a mammalian MPV variant A2, wherein the F protein of a mammalian MPV variant A2 is phylogenetically closer related to the F protein of the prototype of variant A2, isolate NL/17/00, than it is related to the F protein of the prototype of variant BI, isolate NL/1/99, the F protein of the prototype of Al, isolate NL/1/00, or the F protein of the prototype of B2, isolate NL/1/94.
- the invention provides a F protein of a mammalian MPV variant A2, wherein the amino acid sequence of the F protein is at least 98%, at least 99% or at least 99.5% identical to the F protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO:19).
- the invention provides a M2- 1 protein of a mammalian MPV variant A2, wherein the M2- 1 protein of a mammalian MPV variant A2 is phylogenetically closer related to the M2-1 protein of the prototype of variant A2, isolate NL/17/00, than it is related to the M2-1 protein of the prototype of variant BI, isolate NL/1/99, the M2-1 protein of the prototype of Al, isolate NL/1/00, or the M2-1 protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M2-1 protein of a mammalian MPV variant A2, wherein the amino acid sequence of the M2-1 protein is at least 99%, or at least 99.5% identical to the M2-1 protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO: 43).
- the invention provides a M2-2 protein of a mammalian MPV variant A2, wherein the M2-2 protein of a mammalian MPV variant A2 is phylogenetically closer related to the M2-2 protein of the prototype of variant A2, isolate NL/17/00, than it is related to the M2-2 protein of the prototype of variant BI, isolate NL/1/99, the M2-2 protein of the prototype of Al, isolate NL/1/00, or the M2-2 protein of the prototype of B2, isolate NL/1/94.
- the invention provides a M2-2 protein of a mammalian MPV variant A2, wherein the amino acid sequence of the M2-2 protein is at least 96%, at least 98%, at least 99% or at least 99.5% identical to the M2-2 protein of a mammalian MPV variant A2 as represented by the prototype NL/ 17/00 (SEQ DD NO: 51).
- the invention provides a SH protein of a mammalian MPV variant A2, wherein the SH protein of a mammalian MPV variant A2 is phylogenetically closer related to the SH protein of the prototype of variant A2, isolate NL/17/00, than it is related to the SH protein of the prototype of variant BI, isolate NL/1/99, the SH protein of the prototype of Al, isolate NL/1/00, or the SH protein of the prototype of B2, isolate NL/1/94.
- the invention provides a SH protein of a mammalian MPV variant A2, wherein the amino acid sequence of the SH protein is at least 84%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.5% identical to the SH protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO:87).
- the invention provides a L protein of a mammalian MPV variant A2, wherein the L protein of a mammalian MPV variant A2 is phylogenetically closer related to the L protein of the prototype of variant A2, isolate
- the invention provides a L protein of a mammalian MPV variant A2, wherein the amino acid sequence of the L protein is at least 99% or at least 99.5% identical to the L protein of a mammalian MPV variant A2 as represented by the prototype NL/17/00 (SEQ DD NO:35).
- the invention provides a G protein of a mammalian MPV variant B2, wherein the G protein of a mammalian MPV variant B2 is phylogenetically closer related to the G protein of the prototype of variant B2, isolate NL/1/94, than it is related to the G protein of the prototype of variant BI, isolate NL/1/99, the G protein of the prototype of Al, isolate
- the invention provides a G protein of a mammalian MPV variant B2, wherein the amino acid sequence of the G protein is at least 66%, at least 70%, at least 75%, at least 80%, at least 85%>, at least 90%, at least 95%, at least 98%, or at least 99% or at least 99.5% identical to the G protein of a mammalian MPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO:29).
- the invention provides a N protein of a mammalian MPV variant B2, wherein the N protein of a mammalian MPV variant B2 is phylogenetically closer related to the N protein of the prototype of variant B2, isolate NL/1/94, than it is related to the N protein of the prototype of variant BI, isolate NL/1/99, the N protein of the prototype of Al, isolate NL/1/00, or the N protein of the prototype of A2, isolate NL/17/00.
- the invention provides a N protein of a mammalian MPV variant B2, wherein the amino acid sequence of the N protein is at least 99% or at least 99.5% identical to the N protein of a mammalian MCPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO:73).
- the invention provides a P protein of a mammalian MPV variant B2, wherein the P protein of a mamnralian MPV variant B2 is phylogenetically closer related to the P protein of the prototype of variant B2, isolate NL/1/94, than it is related to the P protein of the prototype of variant BI, isolate NL/1/99, the P protein of the prototype of Al, isolate NL/1/00, or the P protein of the prototype of A2, isolate NL/17/00.
- the invention provides a P protein of a mammalian MPV variant B2, wherein the amino acid sequence of the P protein is at least 96%, at least 98%, or at least 99% or at least 99.5% identical to the P protein of a mammalian MPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO:81).
- the invention provides a M protein of a mammalian MPV variant B2, wherein the M protein of a mammalian MPV variant B2 is phylogenetically closer related to the M protein of the prototype of variant B2, isolate
- the invention provides a M protein of a mammalian MPV variant B2, wherein the amino acid sequence of its M protein is identical to the M protein of a mammalian MPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO:65).
- the invention provides a F protein of a mammalian MPV variant B2, wherein the F protein of a mammalian MPV variant B2 is phylogenetically closer related to the F protein of the prototype of variant B2, isolate NL/1/94, than it is related to the F protein of the prototype of variant BI, isolate NL/1/99, the F protein of the prototype of Al, isolate NL/1/00, or the F protein of the prototype of A2, isolate NL/17/00.
- the invention provides a F protein of a mammalian MPV variant B2, wherein the amino acid sequence of the F protein is at least 99% or at least 99.5% identical to the F protein of a mammalian MPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO:21).
- the invention provides a M2-1 protein of a mammalian MPV variant B2, wherein the M2-1 protein of a mammalian MPV variant B2 is phylogenetically closer related to the M2-1 protein of the prototype of variant B2, isolate NL/1/94, than it is related to the M2-1 protein of the prototype of variant BI, isolate NL/1/99, the M2-1 protein of the prototype of Al, isolate NL/1/00, or the M2-1 protein of the prototype of A2, isolate NL/17/00.
- the invention provides a M2-1 protein of a mammalian MPV variant B2, wherein the amino acid sequence of the M2-1 protein is at least 98% or at least 99%.
- the invention provides a M2-2 protein of a mammalian MPV variant B2, wherein the M2-2 protein of a mammalian MPV variant B2 is phylogenetically closer related to the M2-2 protein of the prototype of variant B2, isolate NL/1/94, than it is related to the M2-2 protein of the prototype of variant BI, isolate NL/1/99, the M2-2 protein of the prototype of Al, isolate NL/1/00, or the M2-2 protein of the prototype of A2, isolate NL/17/00.
- the invention provides a M2-2 protein of a mammalian MPV variant B2, wherein the amino acid sequence is at least 99% or at least 99.5% identical to the M2-2 protein of a mammalian MPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO:53).
- the invention provides a SH protein of a mammalian MPV variant B2, wherein the SH protein of a mammalian MPV variant B2 is phylogenetically closer related to the SH protein of the prototype of variant B2, isolate NL/1/94, than it is related to the SH protein of the prototype of variant BI, isolate NL/1/99, the SH protein of the prototype of Al, isolate NL/1/00, or the SH protein of the prototype of A2, isolate NL/17/00.
- the invention provides a SH protein of a mammalian MPV variant B2, wherein the amino acid sequence of the SH protein is at least 84%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% or at least 99.5% identical to the SH protein of a mammalian MPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO: 89).
- the invention provides a L protein of a mammalian MPV variant B2, wherein the L protein of a mammalian MPV variant B2 is phylogenetically closer related to the L protein of the prototype of variant B2, isolate NL/1/94, than it is related to the L protein of the prototype of variant BI, isolate NL/1/99, the L protein of the prototype of Al, isolate NL/1/00, or the L protein of the prototype of A2, isolate NL/17/00.
- the invention provides a L protein of a mammalian MPV variant B2, wherein the and/or if the amino acid sequence of the L protein is at least 99% or at least 99.5% identical to the L protein of a mammalian MPV variant B2 as represented by the prototype NL/1/94 (SEQ DD NO:37).
- the percentage of sequence identity is based on an alignment of the full length proteins, hi other embodiments, the percentage of sequence identity is based on an alignment of contiguous amino acid sequences of the proteins, wherein the amino acid sequences can be 25 amino acids, 50 amino acids, 75 amino acids, 100 amino acids, 125 amino acids, 150 amino acids, 175 amino acids, 200 amino acids, 225 amino acids, 250 amino acids, 275 amino acids, 300 amino acids, 325 amino acids, 350 amino acids, 375 amino acids, 400 amino acids, 425 amino acids, 450 amino acids, 475 amino acids, 500 amino acids, 750 amino acids, 1000 amino acids, 1250 amino acids, 1500 amino acids, 1750 amino acids, 2000 amino acids or 2250 amino acids in length.
- the invention further provides nucleic acid sequences derived from a mammalian
- the invention also provides derivatives of nucleic acid sequences derived from a mammalian MPV.
- the nucleic acids are modified.
- a nucleic acid of the invention encodes a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a mammalian MPV as defined above, hi certain embodiments, a nucleic acid of the invention encodes a G protein, a N protein, a P protein, a M protein, a F protein, a M2- 1 protein, a M2-2 protein, a SH protein, or a L protein of subgroup A of a mammalian MPV as defined above.
- the G gene of a mammalian MPV has the nucleotide sequence of SEQ DD NO:98-132.
- the F gene of a mammalian MPV has the nucleotide sequence of SEQ DD NO.T 68-247.
- a nucleic acid of the invention encodes a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of subgroup B of a mammalian MPV as defined above.
- a nucleic acid of the invention encodes a G protein, a N protein, a P protein, a M protein, a F protein, a JVI2- 1 protem, a M2-2 protein, a SH protein, or a L protein of variant Al of a mammalian MPV as defined above.
- a nucleic acid of the invention encodes a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of variant A2 of a mammalian MPV as defined above.
- a nucleic acid of the invention encodes a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of variant BI of a mammalian MPV as defined above.
- a nucleic acid of the invention encodes a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of variant B2 of a mammalian MPV as defined above.
- the invention provides a nucleotide sequence that is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to the nucleotide sequence of SEQ DD NO:94, SEQ DD NO:95, SEQ DD NO:96, or SEQ DD NO:97.
- the nucleic acid sequence of the invention is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5% identical to a fragment of the nucleotide sequence of SEQ DD NO:94, SEQ DD NO:95, SEQ DD NO:96, or SEQ DD NO:97, wherein the fragment is at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, at least 250 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 1,250 nucleotides, at
- a nucleic acid sequence of the invention is capable of hybridizing under low stringency, medium stringency or high stringency conditions to one of the nucleic acid sequences of SEQ DD NO:94, SEQ DD NO:95, SEQ DD NO:96, or SEQ DD NO:97.
- a nucleic acid sequence of the invention is capable of hybridizing under low stringency, medium stringency or high stringency conditions to one of the nucleic acid sequences of SEQ DD NO:98-132; SEQ DD NO:168-247; SEQ DD NO:22-25; SEQ DD NO:30-33; SEQ DD NO:38-41; SEQ DD NO:46-49; SEQ DD NO:54-57; SEQ DD NO:58-61; SEQ DD NO:66-69; SEQ DD NO:74-77; SEQ DD NO:82-85; or SEQ DD NO:90-93.
- a nucleic acid hybridizes over a length of at least 25 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, at least 250 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 1,250 nucleotides, at least 1,500 nucleotides, at least 1,750 nucleotides, at least 2,000 nucleotides, at least 2,00 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 7,500 nucleotides, at least 10,000 nucleotides, at least 12,500 nucleotides, or at least 15,000 nucleotides with the nucleotide
- the invention further provides antibodies and antigen-binding fragments that bind specifically to a protein of a mammalian MPV.
- An antibody of the invention binds specifically to a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a mammalian MPV.
- the antibody is a human antibody or a humanized antibody.
- an antibody of the invention binds specifically to a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a vims of subgroup A of a mammalian MPV. In certain other embodiments, an antibody of the invention binds specifically to a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a vims of subgroup B of a mammalian MPV.
- an antibody of the invention binds specifically to a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protem of a vims of variant Al of a mammalian MPV.
- the antibody of the invention binds specifically to a G protein, a N protem, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a vims of subgroup A2 of a mammalian MPV.
- an antibody of the invention binds specifically to a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a virus of subgroup B 1 of a mammalian MPV. In certain other embodiments, an antibody of the invention binds specifically to a G protein, a N protein, a P protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a vims of subgroup B2 of a mammalian MPV.
- PCR-primer A would contain, from the 5' to 3' end: a unique restriction enzyme site, such as a class IIS restriction enzyme site (i.e., a "shifter" enzyme; that recognizes a specific sequence but cleaves the DNA either upstream or downstream of that sequence); a stretch of nucleotides complementary to a region of the PIV gene; and a stretch of nucleotides complementary to the carboxy-terminus coding portion of the heterologous sequence.
- PCR-primer B would contain from the 5' to 3' end: a unique restriction enzyme site; a stretch of nucleotides complementary to a PTV gene; and a stretch of nucleotides conesponding to the 5' coding portion of the foreign gene.
- RNA molecule containing the exact untranslated ends of the PIV gene with a foreign gene insertion may be excised and cloned using the unique restriction sites. Digestion with the class IIS enzyme and transcription with the purified phage polymerase would generate an RNA molecule containing the exact untranslated ends of the PIV gene with a foreign gene insertion.
- PCR-primed reactions could be used to prepare double-stranded DNA containing the bacteriophage promoter sequence, and the hybrid gene sequence so that RNA templates can be transcribed directly without cloning.
- a heterologous nucleotide sequence can be added or inserted at various positions of the virus of the invention.
- the heterologous nucleotide sequence is added or inserted at position 1. In another embodiment, the heterologous nucleotide sequence is added or inserted at position 2. In another embodiment, the heterologous nucleotide sequence is added or inserted at position 3. In another embodiment, the heterologous nucleotide sequence is added or inserted at position 4. hi another embodiment, the heterologous nucleotide sequence is added or inserted at position 5. In yet another embodiment, the heterologous nucleotide sequence is added or inserted at position 6.
- position refers to the position of the heterologous nucleotide sequence on the viral genome to be transcribed, e.g., position 1 means that it is the first gene to be transcribed, and position 2 means that it is the second gene to be transcribed. Inserting heterologous nucleotide sequences at the lower-numbered positions of the vims generally results in stronger expression of the heterologous nucleotide sequence compared to insertion at higher-numbered positions due to a transcriptional gradient that occurs across the genome of the virus. However, the transcriptional gradient also yields specific ratios of viral mRNAs. Insertion of foreign genes will perturb these ratios and result in the synthesis of different amounts of viral proteins that may influence vims replication.
- both the transcriptional gradient and the replication kinetics must be considered when choosing an insertion site.
- insertion of heterologous nucleotide sequence at position 2 of the b/h PIN3 vector results in the best replication rate and expression level of the heterologous gene. Inserting heterologous nucleotide sequences at lower-numbered positions is the prefened embodiment of the invention if strong expression of the heterologous nucleotide sequence is desired, h a prefened embodiment, the heterologous sequence is added or inserted at position 1, 2 or 3.
- the intergenic region between the end of the coding sequence of the heterologous gene and the start of the coding sequence of the downstream gene can be altered to achieve a desired effect.
- the term "intergenic region" refers to nucleotide sequence between the stop signal of one gene and the start codon (e.g., AUG) of the coding sequence of the next downstream open reading frame.
- An intergenic region may comprise a non-coding region of a gene, i.e., between the transcription start site and the start of the coding sequence (AUG) of the gene.
- This non-coding region occurs naturally in bPIN3 mR ⁇ As and other viral genes, which is illustrated as non-limiting examples in Table 2: Table 2: Lengths of ⁇ on-coding Regions for bPIN3 mR ⁇ As AUG ...
- the intergenic region between the heterologous nucleotide sequence and the downstream gene can be engineered, independently from each other, to be at least 10 nt in length, at least 20 nt in length, at least 30 nt in length, at least 50 nt in length, at least 75 nt in length, at least 100 nt in length, at least 125 nt in length, at least 150 nt in length, at least 175 nt in length or at least 200 nt in length.
- the intergenic region between the heterologous nucleotide sequence and the downstream gene can be engineered, independently from each other, to be at most 10 nt in length, at most 20 nt in length, at most 30 nt in length, at most 50 nt in length, at most 75 nt in length, at most 100 nt in length, at most 125 nt in length, at most 150 nt in length, at most 175 nt in length or at most 200 nt in length, hi various embodiments, the non-coding region of a desired gene in a vims genome can also be engineered, independently from each other, to be at least 10 nt in length, at least 20 nt in length, at least 30 nt in length, at least 50 nt in length, at least 75 nt in length, at least 100 nt in length, at least 125 nt in length, at least 150 nt in length, at least 175 nt in length or at least 200 nt in length,
- the positional effect and the intergenic region manipulation can be used in combination to achieve a desirable effect.
- the heterologous nucleotide sequence can be added or inserted at a position selected from the group consisting of position 1, 2, 3, 4, 5, and 6, and the intergenic region between the heterologous nucleotide sequence and the next downstream gene can be altered (see Table 3).
- liRSV F gene is inserted at position lof a b/h PIV3 vector, and the intergenic region between F gene and N gene (i.e., the next downstream gene of F) is altered to 177 nucleotides.
- Many more combinations are encompassed by the present invention and some are shown by way of example in Table 3.
- the position of the insertion and the length of the intergenic region of the inserted heterologous nucleotide sequence can be determined by various indexes including, but not limited to, replication kinetics and protein or mRNA expression levels, measured by following non-limiting examples of assays: plaque assay, fluorescent-focus assay, infectious center assay, transformation assay, endpoint dilution assay, efficiency of plating, electron microscopy, hemagglutination, measurement of viral enzyme activity, viral neutralization, hemagglutination inhibition, complement fixation, immunostaining, immunoprecipitation and immunoblotting, enzyme-linked immunosorbent assay, nucleic acid detection (e.g., Southern blot analysis, Northern blot analysis, Western blot analysis), growth curve, employment of a reporter gene (e.g., using a reporter gene
- expression levels can be determined by infecting cells in culture with a virus of the invention and subsequently measuring the level of protein expression by, e.g., Western blot analysis or ELISA using antibodies specific to the gene product of the heterologous sequence, or measuring the level of RNA expression by, e.g., Northern blot analysis using probes specific to the heterologous sequence.
- expression levels of the heterologous sequence can be determined by infecting an animal model and measuring the level of protein expressed from the heterologous sequence of the recombinant vims of the invention in the animal model.
- the protein level can be measured by obtaining a tissue sample from the infected animal and then subjecting the tissue sample to Western blot analysis or ELISA, using antibodies specific to the gene product of the heterologous sequence. Further, if an animal model is used, the titer of antibodies produced by the animal against the gene product of the heterologous sequence can be determined by any technique known to the skilled artisan, including but not limited to, ELISA. As the heterologous sequences can be homologous to a nucleotide sequence in the genome of the virus, care should be taken that the probes and the antibodies are indeed specific to the heterologous sequence or its gene product.
- expression levels of F-protein of RSV or hMPV from chimeric b/h PIV3 RSV or b/h PIV3 hMPV or b/h PIV3 RSV F and hMPV F can be determined by any technique known to the skilled artisan.
- Expression levels of the F-protein can be determined by infecting cells in a culture with the chimeric vims of the invention and measuring the level of protein expression by, e.g., Western blot analysis or ELISA using antibodies specific to the F-protein and/or the G-protein of hMPV, or measuring the level of RNA expression by, e.g., Northern blot analysis using probes specific to the F-gene and/or the G-gene of human metapneumovims.
- expression levels of the heterologous sequence can be determined using an animal model by infecting an animal and measuring the level of F-protein and/or G-protein in the animal model.
- the protein level can be measured by obtaining a tissue sample from the infected animal and then subjecting the tissue sample to Western blot analysis or ELISA using antibodies specific to F-protein and/or G-protein of the heterologous sequence. Further, if an animal model is used, the titer of antibodies produced by the animal against F-protein and/or G-protein can be determined by any technique known to the skilled artisan, including but not limited to, ELISA. The rate of replication of a recombinant vims of the invention can be determined by any technique known to the skilled artisan. In certain embodiments, to facilitate the identification of the optimal position of the heterologous sequence in the viral genome and the optimal length of the intergenic region, the heterologous sequence encodes a reporter gene.
- the reporter gene is replaced by a heterologous nucleotide sequence encoding an antigen of choice.
- Any reporter gene known to the skilled artisan can be used with the methods of the invention.
- the rate of replication of the recombinant vims can be determined by any standard technique known to the skilled artisan.
- the rate of replication is represented by the growth rate of the vims and can be determined by plotting the viral titer over the time post infection.
- the viral titer can be measured by any technique known to the skilled artisan, hi certain embodiments, a suspension containing the vims is incubated with cells that are susceptible to infection by the vims.
- Cell types that can be used with the methods of the invention include, but are not limited to, Vero cells, LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells, MRC- 5 cells, WI-38 cells, 293 T cells, QT 6 cells, QT 35 cells, chicken embryo fibroblast (CEF), or tMK cells.
- the vims comprises a reporter gene.
- the number of cells expressing the reporter gene is representative of the number of infected cells.
- the vims comprises a heterologous nucleotide sequence encoding for eGFP, and the number of cells expressing eGFP, i.e., the number of cells infected with the vims, is determined using FACS.
- the replication rate of the recombinant vims of the invention is at most 20 % of the replication rate of the wild type vims from which the recombinant virus is derived under the same conditions.
- the same conditions refer to the same initial titer of vims, the same strain of cells, the same incubation temperature, growth medium, number of cells and other test conditions that may affect the replication rate.
- the replication rate of b/h PIV3 with RSNs F gene in position 1 is at most 20 % of the replication rate of bPIV3.
- the replication rate of the recombinant vims of the invention is at most 5 %, at most 10 %, at most 20 %, at most 30 %, at most 40 %, at most 50 %, at most 75 %, at most 80 %, at most 90 % of the replication rate of the wild type virus from which the recombinant vims is derived under the same conditions.
- the replication rate of the recombinant vims of the invention is at least 5 %, at least 10 %, at least 20 %, at least 30 %, at least 40 %, at least 50 %, at least 75 %, at least 80 %, at least 90 % of the replication rate of the wild type vims from which the recombinant vims is derived under the same conditions.
- the replication rate of the recombinant virus of the invention is between 5 % and 20 %, between 10 % and 40 %, between 25 % and 50 %, between 40 % and 75 %, between 50 % and 80 %, or between 75 % and 90 %> of the replication rate of the wild type vims from which the recombinant vims is derived under the same conditions.
- the expression level of the heterologous sequence in the recombinant virus of the invention is at most 20 % of the expression level of the F-protein of the wild type vims from which the recombinant vims is derived under the same conditions.
- the same conditions refer to the same initial titer of virus, the same strain of cells, the same incubation temperature, growth medium, number of cells and other test conditions that may affect the replication rate.
- the expression level of the heterologous sequence of the F-protein of MPN in position 1 of bPIV3 is at most 20 %> of the expression level of the bovine F-protein of bPIN3.
- the expression level of the heterologous sequence in the recombinant virus of the invention is at most 5 %, at most 10 %, at most 20 %, at most 30 %, at most 40 %>, at most 50 %, at most 75 %, at most 80 %>, at most 90 % of the expression level of the F-protein of the wild type vims from which the recombinant vims is derived under the same conditions, h certain embodiments, the expression level of the heterologous sequence in the recombinant vims of the invention is at least 5 %, at least 10 %, at least 20 %>, at least 30 %, at least 40 %, at least 50 %, at least 75 %, at least 80 %, at least 90 % of the expression level of the F-protein of the wild type virus from which the recombinant virus is derived under the same conditions.
- the expression level of the heterologous sequence in the recombinant virus of the invention is between 5 % and 20 %, between 10 % and 40 %>, between 25 % and 50 %, between 40 % and 75 %, between 50 % and 80 %, or between 75 % and 90 % of the expression level of the F-protein of the wild type virus from which the recombinant virus is derived under the same conditions.
- H ⁇ protein responsible for the hemagglutinin and neuraminidase activities of PIN are coded for by a single gene, H ⁇ .
- the H ⁇ protein is a major surface glycoprotein of the virus.
- the hemagglutinin and neuraminidase proteins have been shown to contain a number of antigenic sites. Consequently, this protein is a potential target for the humoral immune response after infection. Therefore, substitution of antigenic sites of HN with a portion of a foreign protein may provide for a vigorous humoral response against this foreign peptide. If a sequence is inserted within the HN molecule, and it is expressed on the outside surface of the HN, it will be immunogenic.
- a peptide derived from gpl60 of HIV could replace an antigenic site of the HN protein, resulting in a humoral immune response to both gpl60 and the HN protein, h a different approach, the foreign peptide sequence may be inserted within the antigenic site without deleting any viral sequences.
- Expression products of such constructs may be useful in vaccines against the foreign antigen, and may indeed circumvent a problem discussed earlier, that of propagation of the recombinant viras in the vaccinated host.
- An intact HN molecule with a substitution only in antigenic sites may allow for HN function and thus allow for the construction of a viable vims. Therefore, this vims can be grown without the need for additional helper functions.
- the vims may also be attenuated in other ways to avoid any danger of accidental escape.
- Other hybrid constmctions may be made to express proteins on the cell surface or enable them to be released from the cell.
- HN As a surface glycoprotein, HN has an amino- terminal cleavable signal sequence necessary for transport to the cell surface, and a carboxy- terminal sequence necessary for membrane anchoring.
- the fusion protein may be expressed as a separate fusion protein from an additional internal promoter.
- the protein may be secreted out of the cell.
- BICISTRONIC RNA Bicistronic mRNA could be constmcted to permit internal initiation of translation of viral sequences and allow for the expression of foreign protein coding sequences from the regular terminal initiation site.
- a bicistronic mRNA sequence may be constructed wherein the viral sequence is translated from the regular terminal open reading frame, while the foreign sequence is initiated from an internal site.
- Certain internal ribosome entry site (IRES) sequences may be utilized.
- IRES sequences that are chosen should be short enough to avoid interference with parainfluenza packaging limitations.
- the IRES chosen for such a bicistronic approach be no more than 500 nucleotides in length, with less than 250 nucleotides being of ideal length.
- the IRES is derived from a picornavirus and does not include any additional picornaviral sequences.
- Prefened IRES elements include, but are not limited to, the mammalian BiP IRES and the hepatitis C viras IRES.
- a foreign protein may be expressed from a new internal transcriptional unit in which the transcriptional unit has an initiation site and polyadenylation site.
- the foreign gene is inserted into a PTV gene such that the resulting expressed protein is a fusion protein.
- recombinant templates prepared as described above can be used in a variety of ways to express the heterologous gene products in appropriate host cells or to create chimeric viruses that express the heterologous gene products, h one embodiment, the recombinant cDNA can be used to transfect appropriate host cells and the resulting RNA may direct the expression of the heterologous gene product at high levels.
- Host cell systems which provide for high levels of expression include continuous cell lines that supply viral functions such as cell lines superinfected with PIV, cell lines engineered to complement PTV functions, etc.
- the recombinant templates may be used to transfect cell lines that express a viral polymerase protein in order to achieve expression of the heterologous gene product.
- transformed cell lines that express a polymerase protein such as the L protein may be utilized as appropriate host cells.
- Host cells may be similarly engineered to provide other viral functions or additional functions such as HN, NP or N.
- a helper vims may provide the RNA polymerase protein utilized by the cells in order to achieve expression of the heterologous gene product.
- cells may be transfected with vectors encoding viral proteins such as the N or NP, P, M2-1 and L proteins.
- heterologous gene products see, e.g., Flint et al., PRINCIPLES OF VIROLOGY, MOLECULAR BIOLOGY, PATHOGENESIS, AND CONTROL, 2000, ASM Press pp 25 - 56, the entire text is incorporated herein by reference).
- cells infected with the vims are permeabilized with methanol or acetone and incubated with an antibody raised against the heterologous gene products.
- a second antibody that recognizes the first antibody is then added. This second antibody is usually conjugated to an indicator so that the expression of heterologous gene products may be visualized or detected.
- modified cDNAs, viras RNAs, or RNA coding for the PIV genome and/or foreign proteins in the plus or minus sense may be used to transfect cells that provide viral proteins and functions required for replication and rescue.
- cells may be transfected with helper viras before, during, or after transfection by the DNA or RNA molecule coding for the PTV genome and/or foreign proteins.
- the synthetic recombinant plasmid PIV DNAs and RNAs can be replicated and rescued into infectious viras particles by any number of techniques known in the art, as described in U.S. Patent No.
- synthetic recombinant viral RNAs that contain the non-coding regions of the negative strand viras RNA essential for the recognition by viral polymerases and for packaging signals necessary to generate a mature virion, may be prepared.
- the recombinant RNAs are synthesized from a recombinant DNA template and reconstituted in vitro with purified viral polymerase complex to form recombinant ribonucleoproteins (RNPs) that can be used to transfect cells.
- RNPs ribonucleoproteins
- the viral polymerase proteins are present during transcription of the synthetic RNAs either in vitro or in vivo.
- the synthetic RNAs may be transcribed from cDNA plasmids that are either co-transcribed in vitro with cDNA plasmids encoding the polymerase proteins, or transcribed in vivo in the presence of polymerase proteins, i.e., in cells which transiently or constitutively express the polymerase proteins.
- infectious chimeric virus may be replicated in host cell systems that express a PIV viral polymerase protein (e.g., in virus/host cell expression systems; transformed cell lines engineered to express a polymerase protein, etc.), so that infectious chimeric viruses are rescued.
- a PIV viral polymerase protein e.g., in virus/host cell expression systems; transformed cell lines engineered to express a polymerase protein, etc.
- helper viras need not be utilized since this function is provided by the viral polymerase proteins expressed.
- any technique known to those of skill in the art may be used to achieve replication and rescue of recombinant and chimeric viruses.
- One approach involves supplying viral proteins and functions required for replication in vitro prior to transfecting host cells.
- viral proteins may be supplied in the form of wild type viras, helper vims, purified viral proteins or recombinantly expressed viral proteins.
- the viral proteins may be supplied prior to, during or post transcription of the synthetic cDNAs or RNAs encoding the chimeric vims. The entire mixture may be used to transfect host cells.
- viral proteins and functions required for replication may be supplied prior to or during transcription of the synthetic cDNAs or RNAs encoding the chimeric viras.
- viral proteins and functions required for replication are supplied in the form of wild type viras, helper viras, viral extracts, synthetic cDNAs or RNAs that express the viral proteins are introduced into the host cell via infection or transfection. This infection/transfection takes place prior to or simultaneous to the introduction of the synthetic cDNAs or RNAs encoding the chimeric viras.
- cells engineered to express all viral genes of the recombinant or chimeric viras of the invention may result in the production of infectious chimeric viras that contain the desired genotype; thus eliminating the need for a selection system.
- a vims having a mutant protein can be grown in cell lines that are constmcted to constitutively express the wild type version of the same protein. By this way, the cell line complements the mutation in the vims. Similar techniques may be used to constmct transformed cell lines that constitutively express any of the PIV genes.
- viral proteins and functions required for replication may be supplied as genetic material in the form of synthetic cDNAs or RNAs so that they are co- transcribed with the synthetic cDNAs or RNAs encoding the chimeric vims, h a particularly desirable approach, plasmids that express the chimeric viras and the viral polymerase and/or other viral functions are co-transfected into host cells.
- plasmids encoding the genomic or antigenomic PIN R ⁇ A may be co-transfected into host cells with plasmids encoding the PIN viral polymerase proteins ⁇ P or ⁇ , P, M2-1 or L.
- rescue of chimeric b/h PIN3 viras may be accomplished by the use of Modified Vaccinia Viras Ankara (MVA) encoding T7 R ⁇ A polymerase, or a combination of MVA and plasmids encoding the polymerase proteins ( ⁇ , P, and L).
- MVA Modified Vaccinia Viras Ankara
- MVA-T7 or Fowl Pox-T7 can be infected into Vero cells, LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells, tMK cells, LLC-MK2, HUT 292, FRHL-2 (rhesus), FCL-1 (green monkey), WI-38 (human), MRC-5 (human) cells, 293 T cells, QT 6 cells, QT 35 cells and CEF cells.
- a full length antigenomic b/h PIV3 cD ⁇ A may be transfected into the HeLa or Vero cells together with the ⁇ P, P, M2-1 and L encoding expression plasmids.
- the polymerase may be provided by plasmid transfection.
- the cells and cell supernatant can subsequently be harvested and subjected to a single freeze-thaw cycle.
- the resulting cell lysate may then be used to infect a fresh HeLa or Vero cell monolayer in the presence of 1-beta-D-arabinofuranosylcytosine (ara C), a replication inhibitor of vaccinia viras, to generate a viras stock.
- ara C 1-beta-D-arabinofuranosylcytosine
- the supernatant and cells from these plates can then be harvested, freeze-thawed once, and the presence of bPTV3 vims particles detected by immunostaining of viras plaques using PIV3-specif ⁇ c antiserum.
- Another approach to propagating the recombinant viras involves co-cultivation with wild-type viras. This could be done by simply taking recombinant virus and co-infecting cells with this and another wild-type viras (preferably a vaccine strain).
- the wild-type viras should complement for the defective viras gene product and allow growth of both the wild- type and recombinant viras.
- a helper viras may be used to support propagation of the re combinant virus .
- synthetic templates may be replicated in cells co-infected with recombinant viruses that express the PIV viras polymerase protein.
- the PTV polymerase protein may be expressed in any expression vector/host cell system, including but not limited to viral expression vectors (e.g., vaccinia viras, adenovirus, baculovirus, etc.) or cell lines that express a polymerase protein (e.g., see Krystal et al, 1986, Proc. Natl. Acad. Sci. USA 83: 2709-2713). Moreover, infection of host cells expressing all six PTV proteins may result in the production of infectious chimeric virus particles.
- viral expression vectors e.g., vaccinia viras, adenovirus, baculovirus, etc.
- cell lines that express a polymerase protein e.g., see Krystal et al, 1986, Proc. Natl. Acad. Sci. USA 83: 2709-2713.
- infection of host cells expressing all six PTV proteins may result in the production of infectious chimeric virus particles.
- the vims that is propagated using the methods of the invention is PTV.
- the viras that is propagated using the methods of the invention is a recombinant or a chimeric PTV.
- the viras that is propagated using the methods of the invention is a viras of one of the following viral families Adenoviridae, Arenaviridae, Astroviridae, Baculoviridae, Bunyaviridae, Caliciviridae, Cauhmoviras, Coronaviridae, Cystoviridae, Filoviridae, Flaviviridae, Hepadnaviridae, Herpesviridae, Hypoviridae, Idaeoviras, hioviridae, h ⁇ doviridae, Leviviridae, Lipothrixviridae, Luteovirus, Machlomoviras, Marafiviras, Microviridae, Myoviridae, Necrovirus, Nodaviridae, Orthomy
- the vims that is propagated with the methods of the invention is an RNA virus.
- the viras is not a viras of the family Herpesviridae.
- the virus is not HSV.
- a cell culture infected with a viras or a viral construct of interest is incubated at a lower post-infection incubation temperature as compared to the standard incubation temperature for the cells in culture.
- a cell culture infected with a viral construct of interest is incubated at 33°C or about 33°C (e.g., 33 ⁇ 1°C).
- the post-infection incubation temperature is about 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36 ° C or 37 ° C.
- virus is propagated by incubating a cells before infection with the viras at a temperature optimized for the growth of the cells and subsequent to infection of the cells with the viras, i.e., post-infection, the temperature is shifted to a lower temperature.
- the shift is at least 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11 °C, or at least 12°C. In certain embodiments the shift is at most 1 °C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, or at most 12°C. hi a specific embodiment, the shift is 4°C.
- the cells are cultured in a medium containing serum before infection with a viras or a viral construct of interest and the cells are cultured in a medium without serum after infection with the virus or viral constmct.
- serum is fetal bovine serum and is present a concentration of 5% of culture volume, 2% of culture volume, or 0.5% of culture volume.
- viras is propagated by incubating cells that are infected with the viras in the absence of serum.
- viras is propagated by incubating cells that are infected with the viras in a culture medium containing less than 5% of serum, less than 2.5% of serum, less than 1%> of serum, less than 0.1%> of serum, less than 0.01%> of serum, or less than 0.001% of serum.
- the cells are incubated before infection with the viras in medium containing serum, certain embodiments, subsequent to infection of the cells with the vims, the cells are incubated in the absence of serum.
- the cells are first incubated in medium containing serum; the cells are then transfened into medium without serum; and subsequently, the cells are infected with the viras and further incubated in the absence of vims.
- the cells are transfened from medium containing serum into medium in the absence of serum, by removing the serum-containing medium from the cells and adding the medium without serum.
- the cells are centrifuged and the medium containing serum is removed and medium without serum is added.
- the cells are washed with medium without serum to ensure that cells once infected with the viras are incubated in the absence of serum.
- the cells are washed with medium without serum at least one time, two times, three times, four times, five times, or at least ten times.
- cells are cultured in a medium containing serum and at a temperature that is optimal for the growth of the cells before infection with a viras or a viral constract, and the cell culture is incubated at a lower temperature (relative to the standard incubation temperature for the conesponding viras or viral vector) after infection with the viral construct of interest.
- cells are cultured in a medium containing serum before infection with a viral constract of interest at 37°C, and the cell culture is incubated at 33°C or about 33°C (e.g., 33 ⁇ 1°C) after infection with the viral constract of interest.
- cells are cultured in a medium containing serum and at a temperature that is optimal for the growth of the cells before infection with a viras or a viral constract, and the cell culture is incubated without serum at a lower temperature (relative to the standard incubation temperature for the conesponding virus or viral vector) after infection with the viral constract of interest.
- cells are cultured in a medium contaimng serum before infection with a viral constract of interest at 37°C, and the cell culture is incubated without serum at 33°C or about 33°C (e.g., 33 ⁇ 1 ° C) after infection with the viral constract of interest.
- the viral constructs and methods of the present invention can be used for commercial production of viruses, e.g., for vaccine production.
- the vaccine contains only inactivated viruses or viral proteins that are completely free of infectious viras or contaminating viral nucleic acid, or alternatively, contains live attenuated vaccines that do not revert to virulence.
- cells are cultured in a bioreactor or fermenter.
- Bioreactors are available in volumes from under 1 liter to in excess of 100 liters, e.g., Cyto3 Bioreactor (Osmonics, Minnetonka, MN); NBS bioreactors (New Brunswick Scientific, Edison, N. J.); and laboratory and commercial scale bioreactors from B. Braun Biotech International (B. Braun Biotech, Melsungen, Germany).
- viras can be recovered without helper virus. More specifically, viras can be recovered by introducing into a cell a plasmid encoding the viral genome and plasmids encoding viral proteins required for replication and rescue. In certain embodiments, the cell is grown and maintained in serum-free medium, h certain embodiments, the plasmids are introduced into the cell by electroporation.
- a plasmid encoding the antigenomic cDNA of the vims under the control of the T7 promoter, a plasmid encoding the T7 RNA polymerase, and plasmids encoding the N protein, P protein, and L protein, respectively, under control of the T7 promoter are introduced into SF Vero cells by electroporation. Vero cells were obtained from ATCC and adapted to grow in seram- free media according to the following steps (developed by Mike Berry's laboratory). 1. Thaw ATCC CCL-81 Vial in DMEM + 5% v/v FBS in T-25 flask P121; 2. Expand 5 passages in DMEM + 5% v/v FBS P126; 3.
- the cells used for viral rescue are cells that can be grown and/or maintained without the addition of components derived from animals or humans, hi certain embodiments, the cells used for viral rescue are cells that are adapted to growth without seram. hi a specific embodiment, SF Vero cells are used for the rescue of viras. In certain embodiments, the cells are grown and/or maintained in OptiPRO SFM (Invitrogen Corporation) supplemented with 4mM L-glutamine. In certain embodiments, the cells are grown in medium that is supplemented with seram but for rescue of viral particles the cells are transfened into serum-free medium. In a specific embodiment, the cells are washed in serum-free medium to ensure that the viral rescue takes place in a seram- free environment.
- OptiPRO SFM Invitrogen Corporation
- the plasmids are introduced into the cells by any method known to the skilled artisan that can be used with the cells, e.g., by calcium phosphate transfection, DEAE-Dextran transfection, electroporation or liposome mediated transfection (see Chapter 9 of Short Protocols in Molecular Biology, Ausubel et al. (editors), John Wiley & Sons, hie, 1999). hi specific embodiments, electroporation is used to introduce the plasmid DNA into the cells. SF Vero cells are resistant to lipofection. To select cells that have been transfected with the required plasmids, the plasmids can also cany certain markers. Such markers include, but are not limited to, resistancy to certain antibiotics (e.g.
- kanamycin, blasticidin, ampicillin, Hygromycin B, Puromycin and ZeocinTM makers that confer certain autotrophic properties on a cell that lacks this property without the marker, or a marker can also be a gene that is required for the growth of a cell but that is mutated in the cells into which the plasmid is introduced.
- the transcription of the viral genome and/or the viral genes are under transcriptional control of a promoter.
- the sequences encoding the viral genome or the viral proteins are operatively linked to the promoter sequence.
- the promoter can be a promoter that allows transcription by an RNA polymerase endogenous to the cell, e.g., a promoter sequences that are recognized by a cellular DNA dependent RNA polymerases, such as RNA polymerase I (Pol I) or RNA polymerase II (Pol II).
- the promoter can be an inducible promoter.
- the promoter can be a promoter that allows transcription by an RNA polymerase that is not endogenous to the cell.
- the promoter is a T3 promoter, T7 promoter, SP6 promoter, or CMV promoter.
- a plasmid encoding the RNA polymerase that recognizes the promoter is also introduced into the cell to provide the appropriate RNA polymerase.
- the RNA polymerase is T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, or CMV RNA polymerase.
- the viral genes and the viral genome are transcribed under the control of a T7 promoter and a plasmid encoding the T7 RNA polymerase is introduced to provide the T7 RNA polymerase.
- the transcription of the polymerase can be under the control of any promoter system that would function in the cell type used.
- the CMV promoter is used.
- the viral genome can be in the plus or minus orientation.
- the viral genome can be transcribed from the genetic material to generate either a positive sense copy of the viral genome (antigenome copy) or a negative sense copy of the viral genome (genomic copy).
- the viral genome is a recombinant, chimeric and/or attenuated viras of the invention.
- the efficiency of viral replication and rescue may be enhanced if the viral genome is of hexamer length, hi order to ensure that the viral genome is of the appropriate length, the 5' or 3' end maybe defined using ribozyme sequences, including, Hepatitis Delta Virus (HDV) ribozyme sequence, Hammerhead ribozyme sequences, or fragments thereof, which retain the ribozyme catalytic activity.
- the viral proteins required for replication and rescue include the N, P, and L gene, h certain, more specific, embodiments, the viral proteins required for replication and rescue include the N, P, M2-1 and L gene.
- the recombinant viruses of the invention can be further genetically engineered to exhibit an attenuated phenotype.
- the recombinant viruses of the invention exhibit an attenuated phenotype in a subject to which the virus is administered as a vaccine. Attenuation can be achieved by any method known to a skilled artisan.
- the attenuated phenotype of the recombinant viras can be caused, e.g., by using a viras that naturally does not replicate well in an intended host (e.g., using a bovine PTV3 vector in human), by reduced replication of the viral genome, by reduced ability of the viras to infect a host cell, or by reduced ability of the viral proteins to assemble to an infectious viral particle relative to the wild type strain of the viras.
- the viability of certain sequences of the viras, such as the leader and the trailer sequence can be tested using a minigenome assay (see section 5.5.1).
- the attenuated phenotypes of a recombinant viras of the invention can be tested by any method known to the artisan (see, e.g., section 5.5).
- a candidate viras can, for example, be tested for its ability to infect a host or for the rate of replication in a cell culture system, hi certain embodiments, a mini-genome system is used to test the attenuated vims when the gene that is altered is N, P, L, M2 or a combination thereof.
- growth curves at different temperatures are used to test the attenuated phenotype of the viras.
- an attenuated viras is able to grow at 35°C, but not at 39°C or 40°C.
- different cell lines can be used to evaluate the attenuated phenotype of the viras.
- an attenuated viras may only be able to grow in monkey cell lines but not the human cell lines, or the achievable viras titers in different cell lines are different for the attenuated virus.
- viral replication in the respiratory tract of a small animal model including but not limited to, hamsters, cotton rats, mice and guinea pigs, is used to evaluate the attenuated phenotypes of the vims
- the immune response induced by the virus including but not limited to, the antibody titers (e.g., assayed by plaque reduction neutralization assay or ELISA) is used to evaluate the attenuated phenotypes of the viras.
- the plaque reduction neutralization assay or ELISA is carried out at a low dose.
- the ability of the recombinant viras to elicit pathological symptoms in an animal model can be tested.
- a reduced ability of the viras to elicit pathological symptoms in an animal model system is indicative of its attenuated phenotype.
- the candidate virases are tested in a monkey model for nasal infection, indicated by mucous production.
- the virases of the invention can be attenuated such that one or more of the functional characteristics of the vims are impaired.
- attenuation is measured in comparison to the wild type strain of the vims from which the attenuated viras is derived. In other embodiments, attenuation is determined by comparing the growth of an attenuated viras in different host systems.
- a bovine PIN3 is said to be attenuated when grown in a human host if the growth of the bovine PIN3 in the human host is reduced compared to the growth of the bovine PTV3 in a bovine host.
- the attenuated viras of the invention is capable of infecting a host, is capable of replicating in a host such that infectious viral particles are produced.
- the attenuated strain grows to lower titers or grows more slowly. Any technique known to the skilled artisan can be used to determine the growth curve of the attenuated viras and compare it to the growth curve of the wild type virus.
- the attenuated viras grows to a titer of less than 10 5 pfu/ml, of less than 10 4 pfu/ml, of less than 10 3 pfu/ml, or of less than 10 2 pfu/ml in Vero cells under conditions as described.
- the attenuated viras of the invention e.g., a chimeric PIV3 cannot replicate in human cells as well as the wild type virus (e.g., wild type PIV3) does.
- the attenuated virus can replicate well in a cell line that lack interferon functions, such as Vero cells.
- the attenuated viras of the invention is capable of infecting a host, of replicating in the host, and of causing proteins of the viras of the invention to be inserted into the cytoplasmic membrane, but the attenuated viras does not cause the host to produce new infectious viral particles.
- the attenuated viras infects the host, replicates in the host, and causes viral proteins to be inserted in the cytoplasmic membrane of the host with the same efficiency as the wild type mammalian viras.
- the ability of the attenuated viras to cause viral proteins to be inserted into the cytoplasmic membrane into the host cell is reduced compared to the wild type viras.
- the ability of the attenuated mammalian viras to replicate in the host is reduced compared to the wild type viras. Any technique known to the skilled artisan can be used to determine whether a viras is capable of infecting a mammalian cell, of replicating within the host, and of causing viral proteins to be inserted into the cytoplasmic membrane of the host. For illustrative methods see section 5.5. In certain embodiments, the attenuated viras of the invention is capable of infecting a host.
- the attenuated PIV cannot be replicated in the host
- the attenuated viras can infect a host and can cause the host to insert viral proteins in its cytoplasmic membranes, but the attenuated virus is incapable of being replicated in the host. Any method known to the skilled artisan can be used to test whether the attenuated virus has infected the host and has caused the host to insert viral proteins in its cytoplasmic membranes.
- the ability of the attenuated mammalian viras to infect a host is reduced compared to the ability of the wild type viras to infect the same host.
- mutations are introduced into the genome of the viras to generated a viras with an attenuated phenotype. Mutations (e.g., missense mutations) can be introduced into the N-gene, the P-gene, the F-gene, the M2-gene, the M2- l-gene, the M2-2-gene, the SH-gene, the G-gene or the L-gene of the recombinant vims.
- Mutations can be additions, substitutions, deletions, or combinations thereof, hi specific embodiments, a single amino acid deletion mutation for the N, P, L or M2 proteins are introduced, which can be screened for functionality in the mini-genome assay system and be evaluated for predicted functionality in the vims, hi more specific embodiments, the missense mutation is a cold-sensitive mutation. In other embodiments, the missense mutation is a heat-sensitive mutation, h one embodiment, major phosphorylation sites of P protein of the viras is removed.
- a mutation or mutations are introduced into the L gene of the viras to generate a temperature sensitive strain
- the cleavage site of the F gene is mutated in such a way that cleavage does not occur or occurs at very low efficiency.
- deletions are introduced into the genome of the recombinant vims.
- a deletion can be introduced into the N-gene, the P- gene, the F-gene, the M2-gene, the M2- l-gene, the M2-2-gene, the SH-gene, the G-gene or the L-gene of the recombinant vims, hi specific embodiments, the deletion is in the M2-gene of the recombinant vims of the present invention. In other specific embodiments, the deletion is in the SH-gene of the recombinant virus of the present invention, hi yet another specific embodiment, both the M2-gene and the SH-gene are deleted. In certain embodiments, the intergenic region of the recombinant viras is altered.
- the length of the intergenic region is altered. See Section 5.1.2. for illustrative examples.
- the intergenic regions are shuffled from 5' to 3' end of the viral genome.
- the genome position of a gene or genes of the recombinant viras is changed.
- the F or G gene is moved to the 3' end of the genome.
- the N gene is moved to the 5' end of the genome.
- attenuation of the viras is achieved by replacing a gene of the wild type virus with a gene of a virus of a different species.
- the N-gene, the P-gene, the F-gene, the M2-gene, the M2-l-gene, the M2-2-gene, the SH-gene, the HN-gene or the L-gene of bP!N3 is replaced with the ⁇ -gene, the P-gene, the F-gene, the M2-gene, the M2- l-gene, the M2-2-gene, the SH-gene, the H ⁇ -gene or the L-gene, respectively, of hPIN3.
- the ⁇ -gene, the P-gene, the F- gene, the M2-gene, the M2- l-gene, the M2-2-gene, the SH-gene, the H ⁇ -gene or the L-gene of hPIN3 is replaced with the ⁇ -gene, the P-gene, the F-gene, the M2-gene, the M2- l-gene, the M2-2-gene, the SH-gene, the H ⁇ -gene or the L-gene, respectively, of bPIV3.
- Attenuation of the viras is achieved by replacing one or more polymerase associated genes (e.g., ⁇ , P, L or M2) with genes of a viras of a different species.
- attenuation of the viras is achieved by replacing or deleting one or more specific domains of a protein of the wild type viras with domains derived from the conesponding protein of a vims of a different species.
- the ectodomain of a F protein of bPIV3 is replaced with an ectodomain of a F protein of a metapneumovims.
- one or more specific domains of L, ⁇ , or P protein are replaced with domains derived from conesponding proteins of a vims of a different species.
- the transmembrane domain of the F protein is deleted so that a soluble F protein is expressed.
- the leader and/or trailer sequence of the recombinant virus of the invention can be modified to achieve an attenuated phenotype.
- the leader and/or trailer sequence is reduced in length relative to the wild type viras by at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides or at least 6 nucleotides.
- the sequence of the leader and/or trailer of the recombinant viras is mutated.
- the leader and the trailer sequence are 100% complementary to each other.
- 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides are not complementary to each other where the remaining nucleotides of the leader and the trailer sequences are complementary to each other.
- the non-complementary nucleotides are identical to each other.
- the non-complementary nucleotides are different from each other, h other embodiments, if the non-complementary nucleotide in the trailer is purine, the conesponding nucleotide in the leader sequence is also a purine. In other embodiments, if the non-complementary nucleotide in the trailer is pyrimidine, the conesponding nucleotide in the leader sequence is also a purine.
- a live attenuated vaccine is used, its safety must also be considered. The vaccine must not cause disease. Any techniques known in the art that can make a vaccine safe may be used in the present invention. In addition to attenuation techniques, other techniques may be used.
- a soluble heterologous gene that cannot be incorporated into the virion membrane.
- a single copy of the soluble RSV F gene a version of the RSV gene lacking the transmembrane and cytosolic domains, can be used. Since it cannot be incorporated into the virion membrane, the viras tropism is not expected to change.
- Various assays can be used to test the safety of a vaccine. See section 5.5., infra. Particularly, sucrose gradients and neutralization assays can be used. A sucrose gradient assay can be used to determine whether a heterologous protein is inserted in a virion.
- the virion should be tested for its ability to cause symptoms even if the parental strain does not cause symptoms.
- the viras may have acquired new, possibly pathological, properties.
- a number of assays may be employed in accordance with the present invention in order to determine the rate of growth of a chimeric or recombinant viras in a cell culture system, an animal model system or in a subject.
- a number of assays may also be employed in accordance with the present invention in order to determine the requirements of the chimeric and recombinant viruses to achieve infection, replication and packaging of virions.
- the assays described herein may be used to assay viral titre over time to determine the growth characteristics of the viras.
- the viral titre is determined by obtaining a sample from the infected cells or the infected subject, preparing a serial dilution of the sample and infecting a monolayer of cells that are susceptible to infection with the viras at a dilution of the virus that allows for the emergence of single plaques. The plaques can then be counted and the viral titre express as plaque forming units per milliliter of sample.
- the growth rate of a viras of the invention in a subject is estimated by the titer of antibodies against the viras in the subject. Without being bound by theory, the antibody titer in the subject reflects not only the viral titer in the subject but also the antigenicity.
- the increase of the antibody titer in the subject can be used to determine the growth curve of the viras in the subject.
- the growth rate of the viras in animals or humans is best tested by sampling biological fluids of a host at multiple time points post- infection and measuring viral titer.
- the expression of heterologous gene sequence in a cell culture system or in a subject can be determined by any technique known to the skilled artisan.
- the expression of the heterologous gene is measured by quantifying the level of the transcript.
- the level of the transcript can be measured by Northern blot analysis or by RT-PCR using probes or primers, respectively, that are specific for the transcript.
- the transcript can be distinguished from the genome of the viras because the viras is in the antisense orientation whereas the transcript is in the sense orientation.
- the expression of the heterologous gene is measured by quantifying the level of the protein product of the heterologous gene.
- the level of the protein can be measured by Western blot analysis using antibodies that are specific to the protein.
- the heterologous gene is tagged with a peptide tag.
- the peptide tag can be detected using antibodies against the peptide tag.
- the level of peptide tag detected is representative for the level of protein expressed from the heterologous gene.
- the protein expressed from the heterologous gene can be isolated by virtue of the peptide tag.
- the amount of the purified protein conelates with the expression level of the heterologous gene is well known in the art.
- a variety of peptide tags known in the art may be used in the modification of the heterologous gene, such as, but not limited to, the immunoglobulin constant regions, polyhistidine sequence (Petty, 1996, Metal-chelate affinity chromatography, in Current Protocols in Molecular Biology, volume 1-3 (1994-1998). Ed. by Ausubel, F.M., Brent, R., Kunststoffon, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Strahl, K.
- peptide tags are recognized by specific binding partners and thus facilitate isolation by affinity binding to the binding partner, which is preferably immobilized and/or on a solid support.
- many methods can be used to obtain the coding region of the above-mentioned peptide tags, including but not limited to, DNA cloning, DNA amplification, and synthetic methods.
- Some of the peptide tags and reagents for their detection and isolation are available commercially.
- Samples from a subject can be obtained by any method known to the skilled artisan. In certain embodiments, the sample consists of nasal aspirate, throat swab, sputum or broncho-alveolar lavage.
- Minireplicon constructs can be generated to contain an antisense reporter gene. Any reporter gene known to the skilled artisan can be used with the invention.
- the reporter gene is CAT.
- the reporter gene can be flanked by the negative-sense bPTV or bPTV leader linked to the hepatitis delta ribozyme (Hep-d Ribo) and T7 polymerase termination (T-T7) signals, and the bPTV or hPIV trailer sequence preceded by the T7 RNA polymerase promoter.
- the plasmid encoding the minireplicon is transfected into a host cell.
- the host cell expresses T7 RNA polymerase, the N gene, the P gene, the L gene, and the M2.1 gene.
- the host cell is transfected with plasmids encoding T7 RNA polymerase, the N gene, the P gene, the L gene, and the M2.1 gene, h other embodiments, the plasmid encoding the minireplicon is transfected into a host cell and the host cell is infected with a helper virus.
- the expression level of the reporter gene and/or its activity can be assayed by any method known to the skilled artisan, such as, but not limited to, the methods described in section 5.5.6.
- the minireplicon comprises the following elements, in the order listed: T7 RNA Polymerase or RNA polymerase I, leader sequence, gene start, GFP, trailer sequence, Hepatitis delta ribozyme sequence or RNA polymerase I termination sequence. If T7 is used as RNA polymerase, Hepatitis delta ribozyme sequence should be used as termination sequence. If RNA polymerase I is used, RNA polymerase I termination sequence may be used as a termination signal.
- the sequence of the minireplicon can be in the sense or antisense orientation, h certain embodiments, the leader sequence can be modified relative to the wild type leader sequence of the vims of the invention.
- the leader sequence can optionally be preceded by an AC.
- the T7 promoter sequence can be with or without a G-doublet or triplet, where the G-doublet or triplet provides for increased transcription.
- a cell is infected with a viras of the invention at TO. 24 hours later, at T24, the cell is transfected with a minireplicon constract. 48 hours after TO and 72 hours after TO, the cells are tested for the expression of the reporter gene. If a fluorescent reporter gene product is used (e.g., GFP), the expression of the reporter gene can be tested using FACS.
- a cell is infected with MVA-T7 at TO. 1 hour later, at TI, the cell is transfected with a minireplicon construct. 24 hours after TO, the cell is infected with a virus of the invention. 72 hours after TO, the cells are tested for the expression of the reporter gene. If a fluorescent reporter gene product is used (e.g., GFP), the expression of the reporter gene can be tested using FACS.
- a fluorescent reporter gene product e.g., GFP
- the incidence of infection can be determined by any method well-known in the art, including but not limited to, the testing of clinical samples (e.g., nasal swabs) for the presence of an infection, e.g., hMPV, RSV, hPIV, or bPTV/bPIV components can be detected by immunofluorescence assay (IF A) using an anti-hMPN-antigen antibody, an anti-RSN-antigen antibody, an anti-hPIN-antigen antibody, and/or an antibody that is specific to the gene product of the heterologous nucleotide sequence, respectively.
- an infection e.g., hMPV, RSV, hPIV, or bPTV/bPIV components
- IF A immunofluorescence assay
- samples containing intact cells can be directly processed, whereas isolates without intact cells should first be cultured on a permissive cell line (e.g. HEp-2 cells).
- a permissive cell line e.g. HEp-2 cells.
- cultured cell suspensions are cleared by centrifugation at, e.g., 300xg for 5 minutes at room temperature, followed by a PBS, pH 7.4 (Ca++ and Mg++ free) wash under the same conditions. Cell pellets are resuspended in a small volume of PBS for analysis.
- Primary clinical isolates containing intact cells are mixed with PBS and centrifuged at 300xg for 5 minutes at room temperature.
- Mucus is removed from the interface with a sterile pipette tip and cell pellets are washed once more with PBS under the same conditions. Pellets are then resuspended in a small volume of PBS for analysis. Five to ten microliters of each cell suspension are spotted per 5 mm well on acetone washed 12-well HTC supercured glass slides and allowed to air dry. Slides are fixed in cold (-20°C) acetone for 10 minutes. Reactions are blocked by adding PBS - 1% BSA to each well followed by a 10 minute incubation at room temperature. Slides are washed three times in PBS - 0.1% Tween-20 and air dried.
- Antibody serum titer can be determined by any method well-known in the art, for example, but not limited to, the amount of antibody or antibody fragment in seram samples can be quantitated by a sandwich ELISA. Briefly, the ELISA consists of coating microtiter plates overnight at 4°C with an antibody that recognizes the antibody or antibody fragment in the serum. The plates are then blocked for approximately 30 minutes at room temperature with PBS-Tween-0.5% BSA. Standard curves are constructed using purified antibody or antibody fragment diluted in PBS-BSA-BSA, and samples are diluted in PBS-BSA. The samples and standards are added to duplicate wells of the assay plate and are incubated for approximately 1 hour at room temperature.
- the non-bound antibody is washed away with PBS-TWEEN and the bound antibody is treated with a labeled secondary antibody (e.g., horseradish peroxidase conjugated goat-anti-human IgG) for approximately 1 hour at room temperature.
- a labeled secondary antibody e.g., horseradish peroxidase conjugated goat-anti-human IgG
- Binding of the labeled antibody is detected by adding a chromogenic substrate specific for the label and measuring the rate of substrate turnover, e.g., by a spectrophotometer.
- the concentration of antibody or antibody fragment levels in the serum is determined by comparison of the rate of substrate turnover for the samples to the rate of substrate turnover for the standard curve.
- This assay is used to determine the ability of the recombinant virases of the invention and of the vaccines of the invention to prevent lower respiratory tract viral infection in an animal model system, including but not limited to, cotton rats, Syrian Golden hamsters, and Balb/c mice.
- the recombinant viras and/or the vaccine can be administered by intravenous (IN) route, by intramuscular (LM) route or by intranasal route (IN).
- the recombinant viras and/or the vaccine can be administered by any technique well-known to the skilled artisan.
- This assay is also used to conelate the serum concentration of antibodies with a reduction in lung titer of the viras to which the antibodies bind.
- mice including but not limited to, cotton rats (Sigmodon hispidis, average weight 100 g), cynomolgous macacques (average weight 2.0 kg) and hamsters (e.g., Syrian Golden hamsters) are inoculated with the recombinant virus or the vaccine of interest or BSA by intramuscular injection, by intravenous injection, or by intranasal route.
- the animals Prior to, concunently with, or subsequent to administration of the recombinant viras or the vaccine of the invention, the animals are infected with wild type viras wherein the wild type vims is the viras against which the vaccine was generated.
- the animals are infected with the wild type viras at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks or at least 4 weeks subsequent to the administration of the recombinant vims and/or the vaccine of the invention, hi a prefened embodiment, the animals are infected with the wild type vims 21 days subsequent to the administration of the recombinant viras and/or the vaccine of the invention, h another prefened embodiment, the animals are infected with the wild type viras 28 days subsequent to the administration of the recombinant viras and/or the vaccine of the invention.
- the animals are sacrificed, and their nasal turbinate tissue and/or lung tissue are harvested and viras titers are determined by appropriate assays, e.g., plaque assay and TCDD 50 assay.
- Bovine seram albumin (BSA) 10 mg/kg can be used as a negative control.
- Antibody concentrations in the serum at the time of challenge can be determined using a sandwich ELISA.
- CLINICAL TRIALS Vaccines of the invention or fragments thereof that have been tested in in vitro assays and animal models may be further evaluated for safety, tolerance, immunogenicity, infectivity and pharmacokinetics in groups of normal healthy human volunteers, including all age groups.
- the healthy human volunteers are infants at about 6 weeks of age or older, children and adults.
- the volunteers are administered intranasally, intramuscularly, intravenously or by a pulmonary delivery system in a single dose of a recombinant virus of the invention and/or a vaccine of the invention.
- Multiple doses of viras and/or vaccine of the invention may be required in seronegative children 6 to 60 months of age.
- viras and/or vaccine of the invention may also be required in the first six months of life to stimulate local and systemic immunity and to overcome neutralization by maternal antibody.
- a primary dosing regimen at 2, 4, and 6 months of age and a booster dose at the beginning of the second year of life are used.
- a recombinant viras of the invention and/or a vaccine of the invention can be administered alone or concunently with pediatric vaccines recommended at the conesponding ages.
- double-blind randomized, placebo-controlled clinical trials are used.
- a computer generated randomization schedule is used. For example, each subject in the study will be enrolled as a single unit and assigned a unique case number.
- Each volunteer is preferably monitored for at least 12 hours prior to receiving the recombinant viras of the invention and/or a vaccine of the invention, and each volunteer will be monitored for at least fifteen minutes after receiving the dose at a clinical site. Then volunteers are monitored as outpatients on days 1-14, 21, 28, 35, 42, 49, and 56 postdose. h a preferred embodiment, the volunteers are monitored for the first month after each vaccination as outpatients. All vaccine related serious adverse events will be reported for the entire duration of the trial.
- a serious adverse event is defined as an event that 1) results in death, 2) is immediately life threatening, 3) results in permanent or substantial disability, 4) results in or prolongs an existing in-patient hospitalization, 5) results in a congenital anomaly, 6) is a cancer, or 7) is the result of an overdose of the study vaccine.
- Serious adverse events that are not vaccine related will be reported beginning on the day of the first vaccination (Day 0) and continue for 30 days following the last vaccination. Non- vaccine related serious adverse events will not be reported for 5 to 8 months after the 30 day reporting period following the last vaccination.
- a dose of vaccine/placebo will not be given if a child has a vaccine-related serous adverse event following the previous dose.
- Blood samples are collected via an indwelling catheter or direct venipuncture (e.g., by using 10 ml red-top Vacutainer tubes) at the following intervals: (1) prior to administering the dose of the recombinant virus of the invention and/or a vaccine of the invention; (2) during the administration of the dose of the recombinant vims of the invention and/or a vaccine of the invention; (3) 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, and 48 hours after administering the dose of the recombinant viras of the invention and/or a vaccine of the invention; and (4) 3 days, 7 days 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, and 56 days after administering the dose of the recombinant viras of the invention
- a total of 5 blood draws (3-5 ml each) are obtained, each just prior to the first, third and booster doses and approximately one month following the third dose and booster dose of administration of the vaccine or placebo.
- Samples are allowed to clot at room temperature and the serum is collected after centrifugation.
- Sera are tested for strain-specific serum hemaglutination inhibition (HAI) antibody levels against the viras of the invention.
- HAI strain-specific serum hemaglutination inhibition
- Other indicators of immunogenicity such as IgG, IgA, or neutralizing antibodies are also tested. Serum antibody responses to one or more of the other vaccines given concunently may be measured.
- the amount of antibodies generated against the recombinant viras of the invention and/or a vaccine of the invention in the samples from the patients can be quantitated by ELISA.
- T-cell immunity cytotoxic and helper responses
- the concentration of antibody levels in the serum of volunteers are conected by subtracting the predose serum level (background level) from the seram levels at each collection interval after administration of the dose of recombinant viras of the invention and/or a vaccine of the invention.
- the pharmacokinetic parameters are computed according to the model-independent approach (Gibaldi et al, eds., 1982,
- Nasal washes obtained approximately 2, 3, 4, 5, 6, 7 or 8 days after each doses of vaccine/placebo will be cultured to detect shedding of the vaccine virus of the invention.
- nasal washes obtained 7 days after each doses of vaccine/placebo are cultured.
- a nasopharyngeal swab, a throat swab, or a nasal wash is also used to dete ⁇ nine the presence of other virases in volunteers with medically attended febrile illness (rectal temperature greater than or equal to 102° F ) and/or croup, bronchiolitis, or pneumonia at any time during the study. Samples are shipped on dry ice to designated site for study. Assays for isolation and quantitation of the vaccine viras of the invention and immunostaining assays using MAb to identify the vaccine viras of the invention are used (examples of such assays are given in the Example sections, infra).
- Nasal wash specimens may be tested for other virases and immune responses including IgG, IgA, and neutralizing antibody. 5.5.6.
- REPORTER GENES in certain embodiments, assays for measurement of reporter gene expression in tissue culture or in animal models can be used with the methods of the invention.
- the nucleotide sequence of the reporter gene is cloned into the viras, such as bPTV, hPIV, or b/hPrV3, wherein (i) the position of the reporter gene is changed and (ii) the length of the intergenic regions flanking the reporter gene are varied. Different combinations are tested to determine the optimal rate of expression of the reporter gene and the optimal replication rate of the virus comprising the reporter gene.
- minigenome constructs are generated to include a reporter gene.
- the construction of minigenome constructs is described in section 5.5.1.
- the abundance of the reporter gene product can be dete ⁇ nined by any technique known to the skilled artisan. Such techniques include, but are not limited to, Northern blot analysis or Western blot analysis using probes or antibodies, respectively, that are specific to the reporter gene.
- the reporter gene emits a fluorescent signal that can be detected in a FACS. FACS can be used to detect cells in which the reporter gene is expressed.
- Techniques for practicing the specific aspect of this invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, and recombinant DNA manipulation and production, which are routinely practiced by one of skill in the art. See, e.g., Sambrook, 1989, Molecular Cloning, A Laboratory Manual, Second
- the biochemical activity of the reporter gene product represents the expression level of the reporter gene.
- the total level of reporter gene activity depends also on the replication rate of the recombinant viras of the invention. Thus, to determine the true expression level of the reporter gene from the recombinant viras, the total expression level should be divided by the titer of the recombinant viras in the cell culture or the animal model.
- Reporter genes that can be used with the methods of invention include, but are not limited to, the genes listed in the Table 4 below:
- CAT chloramphenicol acetyltransferase Transfers radioactive acetyl groups to chloramphenicol or detection by thin layer chromatography and autoradiography
- GAL b-galactosidase Hydrolyzes colorless galactosides to yield colored products.
- GUS b-glucuronidase Hydrolyzes colorless glucuronides to yield colored products.
- LUC luciferase Oxidizes luciferin, emitting photons
- GFP green fluorescent protein
- SEAP secreted alkaline phosphatase
- HRP horseradish peroxidase
- AP alkaline phosphatase
- the abundance of the reporter gene can be measured by, ter alia, Western blot analysis or Northern blot analysis or any other technique used for the quantification of transcription of a nucleotide sequence, the abundance of its mRNA its protein (see Short Protocols in Molecular Biology, Ausubel et al. (editors), Jolm Wiley & Sons, Inc., 4 th edition, 1999).
- the activity of the reporter gene product is measured as a readout of reporter gene expression from the recombinant viras.
- biochemical characteristics of the reporter gene product can be investigated (see Table 1). The methods for measuring the biochemical activity of the reporter gene products are well-known to the skilled artisan. A more detailed description of illustrative reporter genes that can be used with the methods of the invention is set forth below.
- Luciferases are enzymes that emit light in the presence of oxygen and a substrate (luciferin) and which have been used for real-time, low-light imaging of gene expression in cell cultures, individual cells, whole organisms, and transgenic organisms (reviewed by Greer & Szalay, 2002, Luminescence 17(l):43-74).
- luciferase as used in relation to the invention is intended to embrace all luciferases, or recombinant enzymes derived from luciferases that have luciferase activity.
- the luciferase genes from fireflies have been well characterized, for example, from the Photinus and Luciola species (see, e.g., International Patent Publication No. WO 95/25798 for Photinus pyralis, European Patent Application No. EP 0 524 448 for Luciola cruciata and ⁇ uciola lateralis, and Devine et al, 1993, Biochim. Biophys. Acta 1173(2):121- 132 for Luciola mingrelica.
- eucaryotic luciferase genes include, but are not limited to, the sea panzy (Renilla reniformis, see, e.g., Lorenz et al, 1991, Proc Natl Acad Sci U S A 88(10):4438-4442), and the glow worm (Lampyris noctiluca, see e.g., Sula-Newby et al, 1996, Biochem J. 313:761-767).
- Bacterial luciferin-luciferase systems include, but are not limited to, the bacterial lux genes of te ⁇ estrial Photorhabdus luminescens (see, e.g.,
- the luciferases encompassed by the present invention also includes the mutant luciferases described in U.S. Patent No. 6,265,177 to Squinell et al, which is hereby incorporated by reference in its entirety.
- GFP GREEN FLUORESCENT PROTEIN Green fluorescent protein
- green fluorescent protein or "GFP” as used in relation to the invention is intended to embrace all GFPs (including the various forms of GFPs that exhibit colors other than green), or recombinant enzymes derived from GFPs that have GFP activity.
- the native gene for GFP was cloned from the bioluminescent jellyfish Aequorea victoria (see, e.g., Morin et al, 1972, J. Cell Physiol. 77:313-318). Wild type GFP has a major excitation peak at 395 nm and a minor excitation peak at 470 nm.
- the absorption peak at 470 nm allows the monitoring of GFP levels using standard fluorescein isothiocyanate (FITC) filter sets.
- Mutants of the GFP gene have been found useful to enhance expression and to modify excitation and fluorescence. For example, mutant GFPs with alanine, glycine, isoleucine, or threonine substituted for serine at position 65 result in mutant GFPs with shifts in excitation maxima and greater fluorescence than wild type protein when excited at 488 nm (see, e.g., Heim et al, 1995, Nature 373:663-664); U.S. Patent No.
- GFPs are isolated from organisms other than the jellyfish, such as, but not limited to, the sea pansy, Ren ⁇ lla reriformis.
- EGFP is a red-shifted variant of wild-type GFP (3-5) which has been optimized for brighter fluorescence and higher expression in mammalian cells.
- EGFP encodes the GFPmutl variant which contains the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr.
- the coding sequence of the EGFP gene contains more than 190 silent base changes which conespond to human codon-usage preferences.
- BETA GALACTOSIDASE Beta galactosidase (“/3-gal”) is an enzyme that catalyzes the hydrolysis of b- galactosides, including lactose, and the galactoside analogs o-nitrophenyl- 3-D- galactopyranoside (“ONPG”) and chlorophenol red-b-D-galactopyranoside (“CPRG”) (see, e.g., Nielsen et al, 1983 Proc Natl Acad Sci USA 80(17):5198-5202; Eustice et al, 1991, Biotechniques 11:739-742; and Henderson et al, 1986, Clin. Chem. 32:1637-1641).
- ONPG o-nitrophenyl- 3-D- galactopyranoside
- CPRG chlorophenol red-b-D-galactopyranoside
- the ⁇ - gal gene functions well as a reporter gene because the protein product is extremely stable, resistant to proteolytic degradation in cellular lysates, and easily assayed.
- ONPG is used as the substrate
- /3-gal activity can be quantitated with a spectrophotometer or a microplate reader.
- beta galactosidase or "(3-gal” as used in relation to the invention is intended to embrace all b-gals, including lacZ gene products, or recombinant enzymes derived from b-gals which have b-gal activity.
- the b-gal gene functions well as a reporter gene because the protein product is extremely stable, resistant to proteolytic degradation in cellular lysates, and easily assayed, h an embodiment where ONPG is the substrate, b-gal activity can be quantitated with a spectrophotometer or microplate reader to determine the amount of ONPG converted at 420 nm. hi an embodiment when CPRG is the substrate, b-gal activity can be quantitated with a spectrophotometer or microplate reader to determine the amount of CPRG converted at 570 to 595 nm.
- CAT Chloramphenicol acetyl transferase
- TLC thin layer chromatography
- chloramphenicol acetyltransferase or "CAT” as used in relation to the invention is intended to embrace all CATs, or recombinant enzymes derived from CAT which have CAT activity. While it is preferable that a reporter system which does not require cell processing, radioisotopes, and chromatographic separations would be more amenable to high through-put screening, CAT as a reporter gene may be preferable in situations when stability of the reporter gene is important. For example, the CAT reporter protein has an in vivo half life of about 50 hours, which is advantageous when an accumulative versus a dynamic change type of result is desired.
- SEAP secreted alkaline phosphatase
- SEAP secreted alkaline phosphatase
- SEAP secreted alkaline phosphatase
- SEAP activity can be detected by a variety of methods including, but not limited to, measurement of catalysis of a fluorescent substrate, immunoprecipitation, HPLC, and radiometric detection.
- the luminescent method is prefened due to its increased sensitivity over calorimetric detection methods.
- the advantages of using SEAP is that a cell lysis step is not required since the SEAP protein is secreted out of the cell, which facilitates the automation of sampling and assay procedures.
- a cell-based assay using SEAP for use in cell-based assessment of inhibitors of the Hepatitis C virus protease is described in U.S. Patent No. 6,280,940 to Potts et al. which is hereby incorporated by reference in its entirety.
- cell culture systems include, but are not limited to, primary cell culture that are prepared from animal tissues (e.g., cell cultures derived from monkey kidney, human embryonic amnion, kidney, and foreskin, and chicken or mouse embryos); diploid cell strains that consist of a homogeneous population of a single type and can divide up to 100 times before dying (e.g., cell culture derived from human embryos, such as the WI-38 strain derived from human embryonic lung); and continuous cell lines consist of a single cell type that can be propagated indefinitely in culture (e.g., HEp-2 cells, Hela cells, Vero cells, L and 3T3 cells, and BHK-21 cells). Virases of the invention can also be propagated in embryonated chicken eggs.
- animal tissues e.g., cell cultures derived from monkey kidney, human embryonic amnion, kidney, and foreskin, and chicken or mouse embryos
- diploid cell strains that consist of a homogeneous population of a single type and can divide up
- a hole is drilled in the shell and viras is injected into the site appropriate for its replication.
- Any animal models known in the art can be used in the present invention to accomplish various purposes, such as to determine the effectiveness and safeness of vaccines of the invention. Examples of such animal models include, but are not limited to, cotton rats (Sigmodon hispidis), hamsters, mice, monkeys, and chimpanzees. In a prefened embodiment, Syrian Golden hamsters are used.
- NEUTRALIZATION AS SAY Neutralization assays can be canied out to address the important safety issue of whether the heterologous surface glycoproteins are incorporated into the virion which may result in an altered viras tropism phenotype.
- the tenn "tropism” refers to the affinity of a viras for a particular cell type. Tropism is usually determined by the presence of cell receptors on specific cells which allow a virus to enter that and only that particular cell type.
- a neutralization assay is performed by using either MAbs of the heterologous surface glycoprotein (non-limiting example is the F protein of a negative strand RNA viras) or polyclonal antiserum comprising antibodies against the heterologous surface glycoprotein. Different dilution of the antibodies are tested to see whether the chimeric viras of the invention can be neutralized .
- the heterologous surface glycoprotein should not be present on the virion surface in an amount sufficient to result in antibody binding and neutralization.
- SUCROSE GRADIENT ASSAY The question of whether the heterologous proteins are incorporated into the virion can be further investigated by use of a biochemical assay.
- Infected cell lysates can be fractionated in 20 - 60% sucrose gradients, various fractions are collected and analyzed for the presence and distribution of heterologous proteins and the vector proteins by Western blot.
- the fractions and the viras proteins can also be assayed for peak viras titers by plaque assay. Examples of sucrose gradient assay are given in section 23, infra.
- the invention encompasses vaccine formulations comprising the engineered negative strand RNA viras of the present invention.
- the recombinant PTV virases of the present invention may be used as a vehicle to express foreign epitopes that induce a protective response to any of a variety of pathogens.
- the invention encompasses the use of recombinant bPIV virases or attenuated hPIV that have been modified in vaccine formulations to confer protection against hPIV infection.
- the vaccine preparations of the invention encompass multivalent vaccines, including bivalent and trivalent vaccine preparations.
- the bivalent and trivalent vaccines of the invention may be administered in the form of one PIV vector expressing each heterologous antigenic sequence or two or more PTV vectors each encoding different heterologous antigenic sequences.
- a first chimeric PIV expressing one or more heterologous antigenic sequences can be administered in combination with a second chimeric PTV expressing one or more heterologous antigenic sequences, wherein the heterologous antigenic sequences in the second chimeric PIV are different from the heterologous antigenic sequences in the first chimeric PIV.
- the heterologous antigenic sequences in the first and the second chimeric PIV can be derived from the same viras but encode different proteins, or derived from different virases.
- the heterologous antigenic sequences in the first chimeric PTV are derived from respiratory syncytial viras
- the heterologous antigenic sequences in the second chimeric PIV are derived from human metapneumovirus.
- the heterologous antigenic sequences in the first chimeric PTV are derived from respiratory syncytial viras
- the heterologous antigenic sequences in the second chimeric PTV are derived from avian pneumovirus.
- the vaccine formulation of the invention is used to protect against infections caused by a negative strand RNA viras, including but not limited to, influenza viras, parainfluenza viras, respiratory syncytial viras, and mammalian metapneumovirus (e.g., human metapneumovirus). More specifically, the vaccine formulation of the invention is used to protect against infections by a human metapneumovirus and/or an avian pneumovirus.
- a negative RNA viras including but not limited to, influenza viras, parainfluenza viras, respiratory syncytial viras, and mammalian metapneumovirus (e.g., human metapneumovirus). More specifically, the vaccine formulation of the invention is used to protect against infections by a human metapneumovirus and/or an avian pneumovirus.
- the vaccine formulation of the invention is used to protect against infections by (a) a human metapneumovirus and a respiratory syncytial viras; and/or (b) an avian pneumovims and a respiratory syncytial viras.
- the invention provides a proteinaceous molecule or metapneumoviras-specific viral protein or functional fragment thereof encoded by a nucleic acid according to the invention.
- Useful proteinaceous molecules are for example derived from any of the genes or genomic fragments derivable from a viras according to the invention.
- a pharmaceutical composition comprising a viras, a nucleic acid, a proteinaceous molecule or fragment thereof, an antigen and/or an antibody according to the invention can for example be used in a method for the treatment or prevention of a MPV infection and/or a respiratory illness comprising providing an individual with a pharmaceutical composition according to the invention.
- This is most useful when said individual is a human, specifically when said human is below 5 years of age, since such infants and young children are most likely to be infected by a human MPV as provided herein.
- patients will suffer from upper respiratory symptoms predisposing for other respiratory and other diseases. Also lower respiratory illnesses may occur, predisposing for more and other serious conditions.
- compositions of the invention can be used for the treatment of immuno-compromised individuals including cancer patients, transplant recipients and the elderly.
- the invention also provides methods to obtain an antiviral agent useful in the treatment of respiratory tract illness comprising establishing a cell culture or experimental animal comprising a viras according to the invention, treating said culture or animal with an candidate antiviral agent, and determining the effect of said agent on said viras or its infection of said culture or animal.
- the invention also provides use of an antiviral agent according to the invention for the preparation of a pharmaceutical composition, in particular for the preparation of a pharmaceutical composition for the treatment of respiratory tract illness, specifically when caused by an MPV infection or related disease, and provides a pharmaceutical composition comprising an antiviral agent according to the invention, useful in a method for the treatment or prevention of an MPV infection or respiratory illness, said method comprising providing an individual with such a pharmaceutical composition.
- the vaccine of the invention comprises mammalian metapneumovims. hi certain, more specific embodiments, the mammalian metapneumovims is a human metapneumovims.
- the mammalian metapneumovirus to be used in a vaccine formulation has an attenuated phenotype.
- the invention provides vaccine formulations for the prevention and treatment of infections with PIV, RSV, APV, and/or hMPV.
- the vaccine of the invention comprises recombinant and chimeric virases of the invention.
- the viras is attenuated.
- the vaccine comprises APV and the vaccine is used for the prevention and treatment for hMPV infections in humans.
- the vaccine comprises hMPV and the vaccine is used for the prevention and treatment for APV infection in birds, such as, but not limited to, in turkeys.
- infection with hMPV will result in the production of antibodies in the host that will cross-react with APV and protect the host from infection with APV and related diseases.
- the vaccine formulation of the invention is used to protect against infections by (a) a human metapneumovirus and a human parainfluenza viras; and/or (b) an avian pneumoviras and a human parainfluenza viras and related diseases.
- the vaccine formulation of the invention is used to protect against infections by (a) a human metapneumovims, a respiratory syncytial viras, and a human parainfluenza virus; and/or (b) an avian pneumoviras, a respiratory syncytial viras, and a human parainfluenza viras and related diseases.
- the vaccine formulation of the invention is used to protect against infections by a human metapneumovirus, a respiratory syncytial virus, and a human parainfluenza viras.
- the vaccine formulation of the invention is used to protect against infections by an avian pneumoviras, a respiratory syncytial viras, and a human parainfluenza viras, and related diseases. Due to the high degree of homology among the F proteins of different viral species, for exemplary amino acid sequence comparisons see Figure 1, the vaccine formulations of the invention can be used for protection from virases different from the one from which the heterologous nucleotide sequence encoding the F protein was derived.
- a vaccine formulation contains a viras comprising a heterologous nucleotide sequence derived from an avian pneumoviras type A, and the vaccine formulation is used to protect from infection by avian pneumoviras type A and avian pneumoviras type B.
- a vaccine formulation contains a viras comprising a heterologous nucleotide sequence derived from an avian pneumoviras subgroup C, and the vaccine formulation is used to protect from infection by avian pneumoviras subgroup C and avian pneumoviras subgroup D.
- the invention encompasses vaccine formulations to be administered to humans and animals that are useful to protect against PIV, hMPV, APV (including APV C and APV D), influenza, RSV, Sendai viras, mumps, laryngotracheitis viras, simianviras 5, human papillomavirus, as well as other vimses, pathogens and related diseases.
- the invention further encompasses vaccine formulations to be administered to humans and animals that are useful to protect against human metapneumovims infections, avian pneumoviras infections, and related diseases.
- the invention encompasses vaccine formulations that are useful against domestic animal disease causing agents including rabies viras, feline leukemia viras (FLV) and canine distemper viras.
- the invention encompasses vaccine formulations that are useful to protect livestock against vesicular stomatitis virus, rabies viras, rinderpest viras, swinepox viras, and further, to protect wild animals against rabies vims.
- Attenuated virases generated by the reverse genetics approach can be used in the vaccine and pharmaceutical formulations described herein. Reverse genetics techniques can also be used to engineer additional mutations to other viral genes important for vaccine production.
- mutations in the 5' non-coding region may affect mRNA translation
- mutations in capsid proteins are believed to influence viral assembly
- temperature-sensitive and cold-adapted mutants are often less pathogenic than the parental viras.
- the epitopes of useful vaccine strain variants can be engineered into the attenuated viras.
- completely foreign epitopes, including antigens derived from other viral or non- viral pathogens can be engineered into the attenuated strain.
- antigens of non-related viruses such as HIV (gpl60, gpl20, gp41), parasite antigens (e.g., malaria), bacterial or fungal antigens, or tumor antigens can be engineered into the attenuated strain.
- epitopes which alter the tropism of the virus in vivo can be engineered into the chimeric attenuated virases of the invention.
- Virtually any heterologous gene sequence may be constructed into the chimeric virases of the invention for use in vaccines.
- moieties and peptides that act as biological response modifiers are constructed into the chimeric viruses of the invention for use in vaccines.
- epitopes that induce a protective immune response to any of a variety of pathogens, or antigens that bind neutralizing antibodies may he expressed by or as part of the chimeric virases.
- heterologous gene sequences that can be constructed into the chimeric viruses of the invention include, but are not limited to influenza and parainfluenza hemagglutinin neuraminidase and fusion glycoproteins such as the HN and F genes of human PIV3.
- heterologous gene sequences that can be engineered into the chimeric virases include those that encode proteins with immunomodulating activities.
- immunomodulating proteins include, but are not limited to, cytokines, interferon type 1, gamma interferon, colony stimulating factors, interleukin -1, -2, -4, -5, -6, -12, and antagonists of these agents.
- heterologous gene sequences that can be constructed into the chimeric virases of the invention for use in vaccines include but are not limited to sequences derived from a human immunodeficiency viras (HIV), preferably type 1 or type 2.
- HIV human immunodeficiency viras
- an immunogenic HlV-derived peptide that may be the source of an antigen may be constructed into a chimeric PIV that may then be used to elicit a vertebrate immune response.
- HlV-derived peptides may include, but are not limited to, sequences derived from the env gene (i.e., sequences encoding all or part of gpl60, gpl20, and/or gp41), the pol gene (i.e., sequences encoding all or part of reverse transcriptase, endonuclease, protease, and/or integrase), the gag gene (i.e., sequences encoding all or part of p7, p6, p55, pl7/18, p24/25), tat, rev, nef, vif, vpu, vpr, and/or vpx.
- sequences derived from the env gene i.e., sequences encoding all or part of gpl60, gpl20, and/or gp41
- the pol gene i.e., sequences encoding all or part of reverse transcriptase,
- heterologous sequences may be derived from hepatitis B viras surface antigen (HBsAg); hepatitis A or C viras surface antigens, the glycoproteins of Epstein Ban viras; the glycoproteins of human papillomaviras; the glycoproteins of respiratory syncytial viras, parainfluenza virus, Sendai viras, simianvirus 5 or mumps viras; the glycoproteins of influenza viras; the glycoproteins of herpes virases; VP1 of poliovirus; antigenic determinants of non- viral pathogens such as bacteria and parasites, to name but a few.
- HBsAg hepatitis B viras surface antigen
- hepatitis A or C viras surface antigens the glycoproteins of Epstein Ban viras
- the glycoproteins of human papillomaviras the glycoproteins of respiratory
- immuno globulin genes may be expressed.
- variable regions of anti-idiotypic immunoglobulins that mimic such epitopes may be constructed into the chimeric viruses of the invention.
- Other heterologous sequences may be derived from tumor antigens, and the resulting chimeric virases can be used to generate an immune response against the tumor cells leading to tumor regression in vivo.
- These vaccines may be used in combination with other therapeutic regimens, including but not limited to, chemotherapy, radiation therapy, surgery, bone marrow transplantation, etc. for the treatment of tumors.
- recombinant virases may be engineered to express tumor-associated antigens (TAAs), including but not limited to, human tumor antigens recognized by T cells (Robbins and Kawakami, 1996, Cun. Opin. Immunol.
- TAAs tumor-associated antigens
- melanocyte lineage proteins including gplOO, MART-1/MelanA, TRP-1 (gp75), tyrosinase; Tumor-specific widely shared antigens, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-1, N-acetylglucosammyltransferase-V, pi 5; Tumor-specific mutated antigens, /3-catemh, MUM-1, CDK4; Nonmelanoma antigens for breast, ovarian, cervical and pancreatic carcinoma, HER-2/neu, human papillomaviras -E6, -E7, MUC-1.
- melanocyte lineage proteins including gplOO, MART-1/MelanA, TRP-1 (gp75), tyrosinase; Tumor-specific widely shared antigens, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-1, N-acetylglucosammyltransferas
- a heterologous nucleotide sequence is derived from a metapneumovirus, such as human metapneumovirus and/or avian pneumoviras.
- the viras of the invention contains two different heterologous nucleotide sequences wherein one is derived from a metapneumovirus, such as human metapneumovirus and/or avian pneumoviras, and the other one is derived from a respiratory syncytial viras.
- heterologous nucleotide sequence encodes a F protein or a G protein of the respective virus
- a heterologous nucleotide sequences encodes a chimeric F protein, wherein the chimeric F protein contains the ectodomain of a F protein of a metapneumovirus and the transmembrane domain as well as the luminal domain of a F protein of a parainfluenza virus.
- Either a live recombinant viral vaccine or an inactivated recombinant viral vaccine can be formulated.
- a live vaccine may be prefened because multiplication in the host leads to a prolonged stimulus of similar kind and magnitude to that occurring in natural infections, and therefore, confers substantial, long-lasting immunity.
- production of such live recombinant viras vaccine formulations may be accomplished using conventional methods involving propagation of the virus in cell culture or in the allantois of the chick embryo followed by purification. Additionally, as bPTV has been demonstrated to be non-pathogenic in humans, this viras is highly suited for use as a live vaccine.
- the use of genetically engineered PIN (vectors) for vaccine purposes may desire the presence of attenuation characteristics in these strains.
- the introduction of appropriate mutations (e.g., deletions) into the templates used for transfection may provide the novel viruses with attenuation characteristics. For example, specific missense mutations that are associated with temperature sensitivity or cold adaption can be made into deletion mutations.
- chimeric virases with "suicide" characteristics may be constructed. Such virases would go through only one or a few rounds of replication within the host. When used as a vaccine, the recombinant viras would go through limited replication cycle(s) and induce a sufficient level of immune response but it would not go further in the human host and cause disease. Recombinant virases lacking one or more of the PIV genes or possessing mutated PTV genes would not be able to undergo successive rounds of replication. Defective virases can be produced in cell lines which permanently express such a gene(s).
- Virases lacking an essential gene(s) would be replicated in these cell lines, however, when administered to the human host, they would not be able to complete a round of replication.
- Such preparations may transcribe and translate —in this abortive cycle — a sufficient number of genes to induce an immune response.
- larger quantities of the strains could be administered, so that these preparations serve as inactivated (killed) viras vaccines.
- inactivated vaccines it is prefened that the heterologous gene product be expressed as a viral component, so that the gene product is associated with the virion.
- the advantage of such preparations is that they contain native proteins and do not undergo inactivation by treatment with formalin or other agents used in the manufacturing of killed viras vaccines.
- mutated PIV made from cDNA may be highly attenuated so that it replicates for only a few rounds.
- the vaccine of the invention comprises an attenuated viras.
- the attenuated viras can be effective as a vaccine even if the attenuated viras is incapable of causing a cell to generate new infectious viral particles because the viral proteins are inserted in the cytoplasmic membrane of the host thus stimulating an immune response.
- inactivated vaccine formulations may be prepared using conventional techniques to "kill" the chimeric virases. Inactivated vaccines are "dead" in the sense that their infectivity has been destroyed.
- the infectivity of the viras is destroyed without affecting its immunogenicity.
- the chimeric viras may be grown in cell culture or in the allantois of the chick embryo, purified by zonal ultracentrifugation, inactivated by formaldehyde or /3-propiolactone, and pooled.
- the resulting vaccine is usually inoculated intramuscularly.
- Inactivated virases may be formulated with a suitable adjuvant in order to enhance the immunological response.
- Such adjuvants may include but are not limited to mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin, pluronic polyols, polyanions; peptides; oil emulsions; and potentially useful human adjuvants such as BCG, Corynebacterium parvum, ISCOMS, and virosomes.
- Many methods may be used to introduce the vaccine formulations described above, these include but are not limited to oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, percutaneous, and intranasal and inhalation routes. It may be preferable to introduce the chimeric virus vaccine formulation via the natural route of infection of the pathogen for which the vaccine is designed.
- the invention relates to immunogenic compositions.
- the immunogenic compositions comprise a chimeric PIV.
- the immunogenic composition comprises an attenuated chimeric PTV.
- the immunogenic composition further comprises a pharmaceutically acceptable carrier.
- An effective vaccine is a vaccine that protects vaccinated individuals from illness due to pathogens, by invoking proper innate, cellular, and humoral responses with minimal side effect. The vaccine must not cause disease. Any techniques that are able to measure the replication of the viras and the immune response of the vaccinated subject may be used to evaluate the vaccine. For example, challenge studies and clinical trials can be used.
- the present invention provides vaccines and immunogenic preparations comprising chimeric PIV expressing one or more heterologous or non-native antigenic sequences.
- the vaccines or immunogenic preparations of the invention encompass single or multivalent vaccines, including bivalent and trivalent vaccines.
- the vaccines or immunogenic formulations of the invention are useful in providing protections against various viral infections. Particularly, the vaccines or immunogenic formulations of the invention provide protection against respiratory tract infections in a host.
- a recombinant virus and/or a vaccine or immunogenic formulation of the invention can be administered alone or in combination with other vaccines.
- a vaccine or immunogenic formulation of the invention is administered in combination with other vaccines or immunogenic formulations that provide protection against respiratory tract diseases, such as but not limited to, respiratory syncytial viras vaccines, influenza vaccines, measles vaccines, mumps vaccines, rabella vaccines, pneumococcal vaccines, rickettsia vaccines, staphylococcus vaccines, whooping cough vaccines or vaccines against respiratory tract cancers.
- the viras and/or vaccine of the invention is administered concunently with pediatric vaccines recommended at the conesponding ages.
- the vims and/or vaccine of the invention can be administered concunently with DtaP (TM), Hib (DVI), Polio (D?V or OPV) and Hepatitis B (IM).
- TM DtaP
- DVI Hib
- Polio D?V or OPV
- IM Hepatitis B
- the virus and/or vaccine of the invention can be administered concunently with Hib (IM), Polio (JPV or OPV), MMRII® (SubQ); Varivax® (SubQ), and hepatitis B (IM).
- a vaccine or immunogenic formulation of the invention may be administered to a subject er se or in the form of a pharmaceutical or therapeutic composition.
- Pharmaceutical compositions comprising an adjuvant and an immunogenic antigen of the invention (e.g.
- a viras, a chimeric viras, a mutated viras may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophihzing processes.
- Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the immunogenic antigen of the invention into preparations which can be used pharmaceutically. Proper fonnulation is, or amongst others, dependent upon the route of administration chosen.
- a vaccine or immunogenic composition of the invention comprises adjuvants or is administered together with one or more adjuvants
- the adjuvants that can be used include, but are not limited to, mineral salt adjuvants or mineral salt gel adjuvants, particulate adjuvants, microparticulate adjuvants, mucosal adjuvants, and immunostimulatory adjuvants.
- adjuvants include, but are not limited to, aluminum hydroxide, aluminum phosphate gel, Freund's Complete Adjuvant, Freund's Incomplete Adjuvant, squalene or squalane oil-in-water adjuvant fonnulations, biodegradable and biocompatible polyesters, polymerized liposomes, triterpenoid glycosides or saponins (e.g., QuilA and QS-21, also sold under the trademark STIMULON, ISCOPREP), N-acetyl-muramyl-L-threonyl-D- isoglutamine (Threonyl-MDP, sold under the trademark TERMURTDDE), LPS, monophosphoryl Lipid A (3D-MLAsold under the trademark MPL).
- adjuvants include, but are not limited to, aluminum hydroxide, aluminum phosphate gel, Freund's Complete Adjuvant, Freund's Incomplete Adjuvant, squalene or squalane oil-in-water adju
- the subject to which the vaccine or an immunogenic composition of the invention is administered is preferably a mammal, most preferably a human, but can also be a non-human animal, including but not limited to, primates, cows, horses, sheep, pigs, fowl (e.g., chickens, turkeys), goats, cats, dogs, hamsters, mice and rodents.
- Many methods may be used to introduce the vaccine or the immunogenic composition of the invention, including but not limited to, oral, intiadermal, intramuscular, intraperitoneal, intravenous, subcutaneous, percutaneous, intranasal and inhalation routes, and via scarification (scratching through the top layers of skin, e.g., using a bifurcated needle).
- the vaccine or immunogenic preparations of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
- the preparation for use according to the present invention can be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- the vaccine or immunogenic preparations may be fo ⁇ nulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- the solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the proteins may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- an effective dose of the vaccine or immunogenic fo ⁇ nulation for administration is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
- An effective dose can be estimated initially from in vitro assays.
- a dose can be formulated in animal models to achieve an induction of an immunity response using techniques that are well known in the art.
- Dosage amount and interval may be adjusted individually.
- a suitable dose is an amount of the composition that when administered as described above, is capable of eliciting an antibody response.
- the vaccine or immunogenic formulations of the invention may be administered in about 1 to 3 doses for a 1-36 week period. Preferably, 1 or 2 doses are administered, at intervals of about 2 weeks to about 4 months, and booster vaccinations may be given periodically thereafter. Alternate protocols may be appropriate for individual animals.
- a suitable dose is an amount of the vaccine formulation that, when administered as described above, is capable of raising an immunity response in an irnmunized animal sufficient to protect the animal from an infection for at least 4 to 12 months.
- the amount of the antigen present in a dose ranges from about 1 pg to about 100 mg per kg of host, typically from about 10 pg to about 1 mg, and preferably from about 100 pg to about 1 ⁇ g.
- Suitable dose range will vary with the route of injection and the size of the patient, but will typically range from about 0.1 mL to about 5 mL.
- the virases and/or vaccines of the invention are administered at a starting single dose of at least 10 3 TCID 50 , at least 10 4 TCDD 5 o, at least 10 5 TCDD 50 , at least 10 6 TCDD 50 .
- the viras and/or vaccines of the invention are administered at multiple doses.
- a primary dosing regimen at 2, 4, and 6 months of age and a booster dose at the beginning of the second year of life are used.
- each dose of at least 10 5 TCDD 50 , or at least 10 6 TCDD 50 is given in a multiple dosing regimen.
- the replication rate of a virus can be used as an index to adjust the dosage of a vaccine in a clinical trial.
- assays to test the replication rate of a viras e.g., a growth curve, see Section 5.5. for available assays
- bovine PTV3 vaccine is generally safe and well tolerated by healthy human volunteers, including adults, children 6-60 months of age, and infants 2-6 months of age.
- subjects have received at least a single dose of bPIN3 vaccine from 10 TC ⁇ D 50 to lO TCDD 5 Q. Twelve children received two doses of 10 5 TCDD 50 PTV3 vaccine instead of one dose without untoward effects.).
- a comparable replication rate as to bPIN3 suggests that a comparable dosage may be used in a clinical trial.
- a lower replication rate compared to that of bPIN3 suggests that a higher dosage can be used.
- the target population for the therapeutic and diagnostic methods of the invention is defined by age.
- the target population for the therapeutic and/or diagnostic methods of the invention is characterized by a disease or disorder in addition to a respiratory tract infection.
- the target population encompasses young children, below 2 years of age.
- the children below the age of 2 years do not suffer from illnesses other than respiratory tract infection.
- the target population encompasses patients above 5 years of age.
- the patients above the age of 5 years suffer from an additional disease or disorder including cystic fibrosis, leukaemia, and non-Hodgkin lymphoma, or recently received bone manow or kidney transplantation.
- the target population encompasses subjects in which the hMPV infection is associated with immunosuppression of the hosts, hi a specific embodiment, the subject is an immunocompromised individual.
- the target population for the methods of the invention encompasses the elderly.
- the subject to be treated with the methods of the invention was infected with hMPV in the winter months. The following examples are illustrative, but not limiting, of the present invention.
- the RSV A2 strain the bovine parainfluenza type 3/human parainfluenza type 3 (b/h PIV3) viras
- the human metapneumovirus NL/1/00 strain hMPV
- the bovine parainfluenza type 3/human parainfluenza type 3 vectored RSV virases b/h PIV3/RSV virases
- the bovine parainfluenza type 3/human parainfluenza type vectored human metapneumovirus b/h PIN3/hMPN
- Opti-MEM Gabco/BRL
- the modified vaccinia viras Ankara (MVA-T7) or fowl-pox-T7 (FP-T7) which expressed the phage T7 R ⁇ A polymerase were grown in chicken embryonic kidney cells (SPAFAS). Vero, HeLa and Hep-2 cells were maintained in MEM (JRH Biosciences) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, non-essential amino acids, and antibiotics.
- FBS fetal bovine serum
- FBS fetal bovine serum
- EXAMPLE 1 CONSTRUCTION AND CLONING OF CHIMERIC BOVINE PARAINFLUENZA 3 / HUMAN PARAINFLUENZA 3 cDNA hi order to substitute the F and HN genes of bPIN3 with those of hPIN3, additional restriction enzyme sites were introduced into the infectious bPIV3 cD ⁇ A. Using site- directed mutagenesis, a unique ⁇ he I site was introduced at nucleotide position 5041 and a Sal I site was introduced at nt 8529 of the bPIV3 cD ⁇ A.
- the modified full-length bPIN3 cD ⁇ A was treated with ⁇ he I and Sal I restriction enzymes and a -14 kb D ⁇ A fragment encompassing all of the viral bPIN3 sequences except the F and H ⁇ genes, was isolated by gel purification.
- a 10 cm dish of confluent Vero cells was infected with a strain of hPIV3 (hPIV3/Tex/12084/1983). After 3 days of incubation at 37°C, the cells were harvested and total R ⁇ A was isolated using R ⁇ A STAT-LS 50 (Tel-Test Inc.).
- Viral cD ⁇ A was generated by reverse transcription using a hPIN3 specific oligo annealing at position 4828 of the hPIN3 genome.
- the hPIV3 F and H ⁇ genes were amplified by PCR (polymerase chain reaction) using Taq polymerase.
- the PCR product was cloned into the pT/A TOPO cloning vector (Invitrogen) and from two clones (#11 and #14) the hPIV3 F and H ⁇ genes were sequenced. Sequence analysis revealed that for clone #11, the F gene was conect, but the H ⁇ gene contained abenant sequences; for clone #14, the H ⁇ gene was conect, but the F gene contained abenant stop codons.
- a plasmid containing functional hPrV3 F and H ⁇ genes, was constructed by combining the conect F gene of #11 with the conect H ⁇ gene of #14 in the following manner.
- Both hPIV3 plasmids (#11 and #14) were digested with ⁇ hel and EcoRl .
- a 1.6 kb fragment harboring the conect F gene was isolated from clone #11 and a 8.5 kb fragment containing the conect H ⁇ gene and plasmid sequences, was isolated from clone #14. The two fragments were ligated to produce the intact hP ⁇ V3 F and H ⁇ genes-containing plasmid.
- the conect sequence was confirmed by D ⁇ A sequence analysis.
- a single nucleotide was added at the 3' end of the H ⁇ gene in the untranslated region to satisfy the "Rule of Six.”
- the addition of the single nucleotide was accomplished by using the QuikChange mutagenesis kit (Stratagene) and was confirmed by D ⁇ A sequencing.
- the conect hPIV3 F and H ⁇ gene D ⁇ A fragment was then isolated by digestion with ⁇ he 1 and Sal 1 and a 3.5 kb D ⁇ A fragment was gel purified.
- the full-length b/h PIV3 chimeric cD ⁇ A was constructed by ligating the 14.5 kb D ⁇ A fragment harboring bPIV3 sequences described above and the 3.5 kb D ⁇ A fragment containing the hPIN3 F and H ⁇ genes (see Figure 3).
- the full-length chimeric plasmid D ⁇ A was confirmed by extensive restriction enzyme mapping.
- the M/F and H ⁇ /L gene junctions of the chimeric constract were confirmed by D ⁇ A sequencing to both contain bPTV3 and hPIN3 sequences as well as a ⁇ he 1 and a Sal 1 restriction enzyme site, respectively.
- EXAMPLE 2 CONSTRUCTION AND CLONING OF CHIMERIC BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS F OR G cDNAs h order to determine the effects of RSV antigen insertions in position 1 or 2 of the b/h PIV3 genome on virus replication, respiratory syncytial viras (RSV) F and G genes were cloned into different positions of the chimeric bovine parainfluenza 3/human parainfluenza 3 vector (b/h PIV3 vector). See Figure 4.
- ⁇ 4vrII restriction enzyme sites were introduced in the b/h PIN3 cD ⁇ A plasmid (Haller et al, 2000; 2001, this is the same constract as in Example 6) by site-directed mutagenesis using the QuickChange kit (Stratagene).
- One Avrll site was introduced at nucleotide (nt) 104 in the b/h PTV3 genome altering four nucleotides using the following oligo 5'GAA ATC CTA AGA CCC TAG GCA TGT TGA GTC3' and its complement.
- This restriction enzyme site was used to insert the RSN genes in the first (most 3') position of the viral genome.
- Another Avrll site was introduced in the ⁇ -P intergenic region at nt 1774 changing two nucleotides using the following oligo 5'CCACAACTCAATCAACCTAGGATTCATGGAAGACAATG 3' and its complement.
- This restriction site was used to insert the RSN genes in the second position between the ⁇ and P genes of b/h PIV3 ( Figure 4).
- Full-length b/h PIN3 cD ⁇ As harboring the Avrll sites at nts 104 and 1774 were tested for functionality by recovering virases by reverse genetics.
- RSV G cassette ( ⁇ -P gene stop/start): A D ⁇ A fragment was generated that contained the bPIN3 ⁇ -P intergenic region as well as the 3' end sequences of the RSN G gene, using the b/h PIN3 cD ⁇ A as PCR template. This fragment was generated by PCR using the following oligos: 5'CCCAACACACCACGCCAGTAGTCACAA AGAGATGACCACTATCAC3' and 5'CCCAAGCTTCCTAGGTGAATCTTTG GTTGATTGAGTTGTGG3'. This fragment was then used to cany out overlapping PCR to add the bPTV3 ⁇ -P intergenic region to the RSV G gene. For the second PCR reaction, a plasmid containing the RSV G and F gene was used as a D ⁇ A template, the oligo
- the DNA fragments harboring the RSV G gene were inserted into the first or second position using the Avrll restriction enzyme sites into a subclone harboring only the first 5200 nucleotides of the bPIV3 (1-5 bPIN3) genome that was linearized withy ⁇ vrll.
- 1-5 bPTV3 refers to the nucleotide 1 to 5196 (or 5200) of bovine P1V3 genome. There is BstBl site at this location.
- RSN F cassette ( ⁇ -P gene start/stop): The RSV F gene fragment was isolated by PCR from a full-length bPIV3/RSV F+G cD ⁇ A plasmid using oligos that added ⁇ 4vrII sites at the 5' and 3' end of the RSN F gene, and introduced into the 1-5 bPIN3 plasmid containing the first 5200 nucleotides of the bPIN3 genome and the Avrll site at nt 1774, which was linearized with Avrll.
- the bPIV3 ⁇ -P intergenic region was isolated by PCR using 1-5 bPrV3/RSV G2 as a template.
- the oligo 5'GACGCGTCGACCACAAAGAGATGACCACTATCACC 3' and an oligo annealing in the bPTV3 F open reading frame were used to generate a PCR fragment containing the bPIV3 ⁇ -P intergenic region, Avrll site, and bPIV3 sequences up to nt 5200.
- the PCR fragment was digested with Sail and Nhel, and added to the 1-5 bPIN3 plasmid harboring the RSV F gene in position 2, which was digested with Sail and Nhel.
- the 1.8 kb RSN F cassette was excised using ⁇ 4vrII, and ligated into 1-5 bPIV3 containing the Avrll site at nt 104, which was linearized with ⁇ 4vrII.
- the RSV G and RSV F transcriptional units were inserted into the first or second position using the Avrll restriction enzyme sites into a subclonel-5 bPIV3 that was linearized with Avrll.
- the plasmids harboring the RSV genes in the first position were digested with Sphl and BssHH and 4 kb (1-5 bPIV3/RSV GI) or 4.8 kb (1-5 bPIV3/RSV FI) DNA fragments were isolated.
- the remainder of the b/h PIV3 genome was added as a Sphl-BssHll 15.1 kb DNA fragment, yielding full-length cDNAs.
- the rest of the b/h PIV3 genome was ligated as an Nhel-Sphl DNA fragment of 14 kb in size.
- the full- length chimeric b/h PIV3/RSN plasmids were propagated in STBL-2 cells (Gibco/BRL) that provided high yields of full-length viras cD ⁇ A plasmids.
- EXAMPLE 3 BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS F OR G DISPLAYED A POSITIONAL EFFECT WITH REGARDS TO mRNA PRODUCTION AND PROTEIN EXPRESSION AS WELL AS VIRUS REPLICATION IN VITRO Three experiments were performed to confirm the effective expression of the RSV F or G gene in the constructs of Example 2, and to determine positional effects of gene insertions in the PIV3 genome. First, in order to demonstrate RSV protein expression by the chimeric virases, a
- Membranes were washed 4 times with PBST and developed using a chemiluminescence substrate (Amersham Pharmacia) and exposed to Biomax Light Film (Kodak) for visualization of protein bands. Consistent with the reduced replication efficiency of b/h RSV F1*N-N in Vero cells ( Figure 5C, see below), the amount of RSV FI detected at 48 hours post infection was about 10 times less than that present in b/h PIV3/RSV F2 or wild-type RSV A2 infected cells (compare lanes 2, 3, and 4, Figure 5A).
- a -50 kDa band representing the RSV FI fragment was detected in cells infected with b/h PTN3/RSV FI and b/h PIV3/RSV F2 as well as wild- type RSN.
- b/h PIN3/RSV FI expressed RSV FI protein levels at 48 hrs post-infection (hpi) similar to those observed for b/h PIN3/RSV F2.
- Only low levels of F0 were detected in cells infected with b/h PIV3/RSN FI and b/h PIN3/RSN F2 indicating that the F0 precursors were efficiently processed during infections as was also observed in wild-type RSN infections.
- b/h PIV3/RSV GI infected cells showed levels of RSN G expression similar to that seen in wild-type RSV infected cells (lanes 1 and 3, Figure 5A). However, in b/h PIV3/RSV G2 infected cells, the accumulation of RSV G was about 2- 3 times more than that present in wild-type RSV infected cells (lanes 2 and 3, Figure 5A). The higher levels of RSV G expression may be due to the more 3' proximal position of the RSV G gene in the PIV3 genome compared to its position in the RSV genome.
- Northern blot analysis showed that the mRNA transcription conelated with the result of the protein expression demonstrated by the Western blot, see Figure 5B.
- Northern blot was performed as follows: total cellular RNA was prepared from virus-infected cells using Trizol LS (Life Technologies). The RNA was further purified by one phenol- chloroform extraction and precipitated with ethanol. RNA pellets were resuspended in diethyl pyrocarbonate-treated water and stored at -80°C. Equal amounts of total RNA were separated on 1%> agarose gels containing 1% formaldehyde and transfened to nylon membranes (Amersham Pharmacia Biotech) using a Turboblotter apparatus (Schleicher & Schuell).
- the blots were hybridized with digoxigenin (DIG)-UTP-labeled riboprobes synthesized by in vitro transcription using a DIG RNA labeling kit (Roche Molecular Biochemicals). Hybridization was carried out at 68°C for 12 h in Express Hyb solution (Clontech). The blots were washed at 68°C twice with 2X SSC (IX SSC contained 0.015 M NaCl with 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS) followed by one wash with 0.5X SSC-0.1% SDS and a final wash with 0.1X SSC-0.1%SDS.
- DIG digoxigenin
- SDS sodium dodecyl sulfate
- the growth curve showed in Figure 5C was obtained as follows: Vero cells were grown to 90% confluence and infected at an MOI of 0.01 or 0.1 with b/h PTV3, b/h PIN3 RSN FI, b/h PTV3 RSV GI, b/h PIV3 RSV F2, and b/h PTV3 RSV G2. The infected monolayers were incubated at 37°C. At 0, 24, 48, 72, 96 and 120 hours post-infection, cells and media were harvested together and stored at -70°C. Viras titers for each time point harvest were determined by TCDD 5 o or plaque assays in Vero cells.
- TCDD 50 assays were inspected visually for CPE following incubation at 37°C for 6 days, while plaque assays were immunostained with RSV polyclonal antisera for quantification after 5 days of incubation.
- the chimeric virases harboring the RSV G or F genes in the first position (b/h PIV3 RSV GI and b/h PIV3 RSV F1* ⁇ - ⁇ ) replicated at a slower rate, yielded lower peak titers, and exhibited a greater lag phase than the virases that contained the RSV genes in the second position.
- Peak titers of b/h PIV3/RSV FI *N-N and b/h PIV3/RSV GI at 96 hours post-infection were 10 67 and 10 5'5 TCDD 50 /ml, respectively ( Figure 5C).
- peak titers of b/h PTV3/RSV F2 and b/h PIV3/RSV G2 were 10 8 0 and 10 7 ' 4 at 72 and 96 hours post-infection, respectively ( Figure 5C).
- the b/h PIN3 control viras displayed peak titers of 10 80 TCDD50/ml, respectively ( Figure 5C).
- the b/h PIN3/RSV F2 yielded 1.3 log ⁇ 0 higher titers than b/h PIN3/RSV F1* ⁇ - ⁇ .
- the b/h PTV3/RSV G2 replicated to 1.9 log 10 higher titers than b/h PIN3/RSV GI.
- EXAMPLE 4 POSITIONAL EFFECT OF eGFP INSERTIONS IN THE BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 GENOME ON VIRUS REPLICATION
- Figure 6 This type of assay investigates the importance of the transcriptional gradient observed for paramyxoviruses that yields specific ratios of viral mRNAs. Insertion of foreign genes will perturb these ratios and result in the synthesis of different amounts of viral proteins which may influence viras replication.
- the eGFP gene was chosen for this assay since it will not be inco ⁇ orated into the virion membrane, and therefore should not interfere with viral processes such as packaging, budding, entry, etc.
- the eGFP gene was inserted into four positions of the b/h PIV3 genome, three of which were characterized for eGFP expression and viras replication.
- the eGFP gene cassette was linked to the bPTN3 ⁇ -P intergenic region, b/h GFP1 harbored the eGFP gene cassette in the 3' most proximal position of the b/h PIV3 genome, b/h PIV3/GFP2 contained the eGFP gene cassette between the ⁇ and P genes of the b/h PIN3 genome, b/h PIV3/GFP3 was located between P and M, and b/h PIV3/GFP4 had the eGFP gene between M and F of b/h PJN3 ( Figure 6).
- the template of the eGFP gene is commercially available, e.g., it can be purchased from BD Biosciences (pIRES2-EGFP) or Clontech (pEGFP- ⁇ l). See Hoffmann et al, Virology 267:310-317 (2000).
- the eGFP gene was isolated by PCR and the bPIV3 ⁇ -P intergenic region was added by employing the overiappmg PCR method, using the following oligos: 5'ATTCCTAGGATGGTGAGCAAG GGCG3', 5'GGACGAGCTGTACAAGTAAAAAAAAATAGCACCTAATCATG3', and 5'CTACCTAGGTGAATCTTTGGTTG3'.
- the eGFP cassette was inserted into pCR2.1, sequenced, and adherence to the rale-of-six was confirmed. Then the eGFP cassette was digested with Avrll, gel purified, and inserted into positions 1, 2, 3, and 4 of b/h PIV3 as described below.
- Generation of full-length cD ⁇ As harboring the eGFP gene in positions 1 and 2 the eGFP gene cassette was inserted into the 1-5 bPIN3 plasmids which contained bPIN3 sequences from nts 1 - 5200 and an Avrll restriction enzyme site either at nt 104 (position 1) or nt 1774 (position 2).
- the plasmid harboring the eGFP gene in the first position was digested with Sphl and BssHII and 4 kb (1-5 eGFPl) D ⁇ A fragments were isolated.
- the rest of the b/h PIN3 genome was added as a Sphl-BssHII 15.1 kb D ⁇ A fragment, yielding full-length cD ⁇ As.
- the bPIV3 subclones harboring the eGFP genes in the second position were cut with Sphl and ⁇ hel, and 5.8 kb (1- 5 eGFP2) D ⁇ A fragments were isolated.
- the full-length chimeric b/h PIV3/eGFP plasmids were propagated in STBL-2 cells (Gibco/BRL) that provided high yields of full- length viras cDNA plasmids.
- an Avrll restriction enzyme site was introduced at nt 3730 in the P-M intergenic region of a subclone containing nts 1 - 5200 of bPTV3, altering two nucleotides.
- the following oligo and its complement were used in a QuickChange PCR reaction to introduce the Avrll site:
- the eGFP cassette was digested with Avrll and ligated into the Avrll linearized 1-5 bPIV3 subclone harboring the Avrll site at nt 3730.
- a 5.5 kb DNA fragment from Sphl to Nhel was isolated from the GFP containing subclone and introduced into the b/h PIV3 cDNA digested with Sphl and Nhel to produce a full-length plasmid.
- a subclone containing b/h PIV3 sequences from nts 1- 8500 was generated. This subclone was linearized with Nhel (nt 5042), and the eGFP cassette containing compatible Avrll ends was inserted. Then the subclone harboring the eGFP cassette was digested with Sphl and Xhol and a 7.1 kb DNA fragment was isolated. The b/h PIV3 plasmid was treated with Sphl and Xhol and a 11 kb fragment was produced. These two DNA fragments were ligated to generate b/h PIV3/GFP4.
- the amount of eGFP produced by b/h PIV3/GFP1, 2, and 3 was assessed in two ways. First, the amount of green cells produced upon infecting Vero cells with b/h PIV3 GFP1, 2, and 3 at MOIs of 0.1 and 0.01 for 20 hours, was determined using a fluorescent microscope ( Figure 7A). b/h PIV3/GFP3 produced strikingly fewer green cells than b/h PIV3/GFPl or 2. Secondly, western analysis was performed on infected cells and the blots were probed with a GFP MAb as well as a PIV3 PAb. The initial observation that b/h PIV3/GFP3 produced dramatically less eGFP protein, was confirmed (Figure 7B).
- the b/h PIV3/RSV FI constract was generated that contained the identical RSV F gene cassette as was used for b/h PIV3/RSV F2.
- EXAMPLE 6 THE LENGTH AND/OR NATURE OF THE INTERGENIC REGION DOWNSTREAM OF THE RESPIRATORY SYNCYTIAL VIRUS GENE HAS AN EFFECT ON VIRUS REPLICATION
- the three constructs in Example 5 were used in the following experiments to determine the effects of the intergenic region on viral protein expression and viral replication. See Figure 9.
- RSV F protein expression for b/h PTV3/RSV FI, b/h PIV3/RSV F1*N-N, and b/h PTV3/RSV F2 was compared at 24 and 48 firs post-infection at an MOI of 0.1 in Vero cells using Western blots.
- Western blots were performed as follows: Chimeric viruses were used to infect (70-80%>) subconfluent Vero cells at a MOI of 0.1. Twenty- four hours and forty-eight hours post infection the media overlay was removed and infected monolayers were washed once with 1 ml of PBS. The cells were subsequently lysed in 400 ml of Laemmli buffer (Bio-Rad) containing 0.05% b-Mercaptoethanol (Sigma). 15 ml of each sample was separated on 12% Tris-HCl Ready Gel (Bio-Rad) and transfened to nylon membranes using a semi-dry transfer cell (Bio-Rad).
- Laemmli buffer Bio-Rad
- b-Mercaptoethanol Sigma
- Nylon membranes were rinsed in PBS (pH 7.6) containing 0.5% (v/v) Tween-20 (Sigma) (PBST) and blocked with PBST containing 5% (w/v) dry milk (PBST-M) for 20-30 minutes at room temperature.
- Membranes were incubated with either a mixture of RSV F monoclonal antibodies (WHO 1269,1200, 1153, 1112, 1243, 1107) at a 1:1000 dilution in PBST-M in PBST-M for 1 hour at room temperature.
- the spacing between the gene start element and the translation start codon may be critical for viras replication.
- the N gene start sequences were changed to P gene start sequences, however this change only incuned the alteration of a single nucleotide. Either of these factors may be responsible for rescuing the RSV F protein expression phenotype.
- multicycle growth curves were carried out to compare the kinetics of viras replication of b/h PIV3/RSV FI, b/h PIV3/RSV F1*N-N, and b/h PIV3/RSV F2 in Vero cells at an MOI of 0.1 (see Figure 9B), which was performed as follows: Vero cells were grown to 90% confluence and infected at an MOI of 0.1 with b/h PTN3, b/h PIN3/RSV F1* ⁇ - ⁇ , b/h PIV3/RSV FI , and b/h PTV3/RSV F2. The infected monolayers were incubated at 37°C.
- Virus titers for each time point harvest were determined by plaque assays in Vero cells. The plaque assays were immunostained with RSV polyclonal antisera for quantification after 5 days of incubation. As was shown on Figure 9B, the onset of replication of b/h PIV3/RSV F1*N-N was delayed and peak titers were lower than those of b/h PIV3/RSV F2. In contrast, b/h PTV3/RSV FI displayed a growth curve that was nearly identical to that observed for b/h PTV3/RSV F2.
- EXAMPLE 7 CLONING OF TRIVALENT BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED CONSTRUCTS
- the following examples relate to the generation of trivalent vaccines that harbor the surface glycoproteins (F and HN) of hP ⁇ V3, RSV F, and hMPV F to protect children from disease caused by RSV, hMPV and hPIV3 using a single live attenuated viras vaccine. These trivalent virases were recovered by reverse genetics.
- plasmids b/h PIN3/RSN F2 or b/h PIN3/hMPN F2 was digested with Sphl and ⁇ hel, and a 6.5 kb fragment was isolated.
- the full-length cD ⁇ A for b/h PTV3 RSV FI or b/h PIV3/hMPV FI was digested with Sphl and ⁇ hel and a 14.8 kb D ⁇ A fragment was isolated and ligated with the 6.5 kb D ⁇ A fragment derived from plasmid b/h PIV3/RSV F2 or b/h PTV3/hMPV F2 to generate full-length viral cD ⁇ As.
- Viras generated from the above described constructs i.e., with F RSV at position 1 and FhMPv at position 3 and with FhMPv at postion 1 and F RSV at position 3) have been replicated and packaged in Vero cells.
- the rescued virases preferably the viras comprising the first constract as described herein, can be used as a trivalent vaccine against parainfluenza viras infection, metapneumovirus infection, and respiratory syncytial viras infection.
- EXAMPLE 8 CLONING OF TWO RESPIRATORY SYNCYTIAL VIRUS F TO THE BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTOR Chimeric virases that cany two copies of the RSV F gene were designed in order to determine whether more RSV protein produced by the chimeric viras will result in an improved immunogenicity. This viras was rescued by reverse genetics, biologically cloned and amplified in Vero cells to yield a viras stock with a titer of 1 x 10 6 pfu/ml.
- This virus b/h PIV3/RSN F1F2
- RSN F protein production can be assessed for viras growth kinetics, for RSN F protein production, and for replication and immunogenicity in hamsters.
- the constructs were generated in the following manner (see Figure 11): the 1-5 RSN F2 plasmid was digested with Sphl and ⁇ hel, and a 6.5 kb fragment was isolated.
- the full-length cD ⁇ A for b/h PIN3 RSV FI was digested with Sphl and ⁇ hel and a 14.8 kb D ⁇ A fragment was isolated and ligated with the 6.5 kb D ⁇ A fragment derived from 1-5 bPIV3/RSV F2 to generate full-length viral cD ⁇ As.
- EXAMPLE 9 CONSTRUCTION AND CLONING OF BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED HUMAN METAPNEUMOVIRUS F cDNA
- the F gene of human metapneumovirus (hMPV) was inserted in positions 1 and 2 of the b/h PIV3 genome ( Figure 12).
- the hMPV F gene cassette harbored the bPIV3 N-P intergenic region.
- a plasmid (pRF515) carrying the hMPV F gene (NL/1/00) was used, and a single nucleotide mutation in the hMPV F gene was conected (i.e., nucleotide 3352 was conected from C to T (wild type)), generating pRF515-M4.
- the bPIV3 N-P intergenic region was added at the 3' end of the hMPV F gene using overlapping PCR.
- the overlapping PCR oligo was 5'GGCTTCATACCACATAATTAGAAAAATAGCA CCTAATCATGTTCTTACAATGGTCGACC 3'.
- oligos were used at the 5' end (5' GCAGCCTAGGCCGCAATAACAATGTCTTGGAAAGTGGTG ATC 3') and at the 3' end of the hMPV F gene cassette (5' CTACCTAGGTGAATCTT TGGT TG 3') in the PCR reaction that contained Avrll restriction enzyme sites.
- the hMPV F gene cassette was adjusted to conform to the rale of six using QuickChange mutagenesis kit and the following oligos (5'CCTAGGCCGCAATAGACAATGT CTTGG 3', 5'CCAAGACATT GTCTATTGCGGCCTAGG 3').
- b/h PIV3/hMPV FI position 1
- F2 position 2
- cDNA plasmids were generated in the same fashion as described in section 9, Example 4, supra, for b/h PIV3/eGFPl and eGFP2.
- the hMPV F gene cassette was sequenced to confirm the presence of an intact open reading frame, the predicted amino acid sequences, and to verify the rale of six.
- the hMPV F transcriptional unit was inserted into the first or second position using the ⁇ 4vrII restriction enzyme sites into a subclone 1-5 bPIV3 that was linearized with ⁇ vrll.
- the plasmid harboring the hMPV gene in the first position was digested with Sphl and BssHII and 4.8 kb (1-5 hMPV FI) DNA fragment was isolated.
- the rest of the b/h PIV3 genome was ligated as a Sphl-BssHll 15.1 kb DNA fragment, yielding full-length cDNAs.
- a bPIV3 subclone harboring the hMPV gene in the second position was cut with Sphl and Nhel, and a 6.5 kb (bPIV3/hMPV F2) DNA fragment was isolated.
- the rest of the b/h PIV3 genome was ligated as an Nhel-Sphl DNA fragment of 14 kb in size to generate full-length cDNA plasmids.
- EXAMPLE 10 IMMUNOPRECIPITATION AND REPLICATION ASSAYS OF BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED HUMAN METAPNEUMOVIRUS F
- hMPN F2 human metapneumovims F at position 2
- guinea pig or human antiserum were used to immunoprecipitate the hMPV F protein (see Figure 13 A).
- Vero cells were infected with b/h PIV3 or b/h PIV3/hMPV FI or F2 at an MOI of 0.1 or 0.05. Twenty-four hours post-infection, the cells were washed once with DME without cysteine and minus methionine (IC ⁇ ) and incubated in the same media for 30 min. The media was removed and 0.5 ml DME lacking cysteine and methionine containing 100 ⁇ Ci of [ 35 S] -Pro-Mix (Amersham) was added to the cells.
- the infected cells were incubated in the presence of 35 S-isotopes for 5 hours at 37°C. Media was removed and the infected cells were lysed in 0.3 M RIP A buffer containing protease inhibitors. The cell lysate was incubated with guinea pig or human polyclonal antisera against hMPV and bound to IgG-agarose (Sigma). After washing three times with 0.5 M PJPA buffer, the samples were fractionated on a 10% protein gel. The gel was dried and exposed to X-ray film.
- hMPV F protein by b/h PIN3/hMPV FI and F2 was shown by immunoprecipitation using the guinea pig hMPV antisera ( Figure 13 A), hiterestingly, a specific band migrating at approximately 80 kDa was observed in the lysates of b/h PrV3/hMPV FI and F2. This size conesponded to the F precursor protein, F0. Non-specific bands of different sizes were also observed in the b/h PIV3 and mock control lanes ( Figure 13). This data suggested that the b/h PIV3/hMPV FI and F2 expressed the hMPV F protein. The FI cleavage product of the F0 precursor were not observed.
- F protein cleavage site Analysis of the F protein cleavage site revealed that the hMPV F protem cleavage site consisted of uncharged amino acid residues (RQSRFVL) while related virases like RSV or APV A have charged amino acids at the F protein processing site, RKRRFLG and RRRRFVL, respectively. It is known from influenza viruses that F proteins with charged amino acids at the cleavage site can process the F protein efficiently and display a virulent phenotype (Hatta et al, Science (2001) 293(5536):1840-22001).
- the "weak" cleavage site of the hMPV F protein maybe responsible for detecting only the F0 protem since the FI and F2 fragments would be present only at low levels that may not be detectable with the methods applied.
- Inefficient F protein cleavage may be one process directing the slow growth of hMPV replication in tissue culture and explain the trypsin requirement of some hMPV strains (van den Hoogen, 2001).
- the hMPV antibody reagents available are limited and these antisera interact only with the precursor of the hMPV F protein. It could also be possible that the cleaved FI is unstable and thus not easily visualized using this method.
- the plaque size of b/h hMPV FI is also smaller compared to b/h hMPV F2.
- the chimeric viras harboring the hMPV F gene in position 2 of the b/h PIV3 genome replicated to levels observed for b/h PIV3.
- Peak titers observed for b/h PIV3/hMPV F2 at 96 hours post-infection were 8.1 loglO PFU/ml.
- the PIN3 expressing hMPN F protein from position 1 displayed a delayed onset of viras replication, and the peak titers were decreased by 1.8 loglO compared to b/h PIN3/hMPN F2 at 96 hrs post-infection.
- the chimeric virases, b/h PrV3/hMPV FI and F2 were therefore used to infect Syrian Golden hamsters intranasally and their ability to replicate in the respiratory tract was analyzed (Table 15).
- Five week old Syrian Golden hamsters (six animals per group) were infected intranasally with 1 x 10 6 pfu or 1 x 10 4 PFU of b/h PIN3, b/h PIN3/hMPV FI or F2, or hMPN/ ⁇ L/1/00 in a 100 ⁇ l volume.
- the different groups were maintained separately in micro-isolator cages.
- Four days post-infection the nasal turbinates and lungs of the animals were harvested, homogenized and stored at -70°C.
- the titers of viras present in the tissues were determined by TCDD 50 assays in Nero cells.
- the animals were inoculated on day 28 intranasally with 1 x 10 6 pfu/ml of hPTV3 or hMPN/ ⁇ L/1/00.
- the nasal turbinates and lungs of the animals were isolated and assayed for challenge viras replication by plaque assays on Nero cells that were immunostained for quantification.
- TCDD 50 assays were read for CPE on Day 10. The results showed that b/h PIV3/hMPV FI and F2 replicated in the nasal turbinates of hamsters to high levels of 5.3 and 5.7 log 10 TCDD 50 /g tissue, respectively. These titers were similar to those observed for b/h PIV3 (4.8 log 0 TCDD 5 o/g tissue). In comparison, wild type hMPV displayed titers of 5.3 log 10 TCDDso/g tissue in the upper respiratory tracts of hamsters (Table 5).
- b/h PIV3/l ⁇ MPV FI and F2 replicated to titers of 5.7 and 4.6 log ]0 TCflD 5 o/g tissue in the lungs of hamsters (Table 5). These titers were similar to those observed for b/h PIV3 (5.6 log 10 TCDDso/g tissue). Wild-type hMPV displayed reduced titers of 3.6 log 10 TCDDso/g tissue in the lower respiratory tract of hamsters (Table 5). These data demonstrated that b/h PIV3/hMPV FI and F2 could efficiently infect and replicate in the upper and lower respiratory tract of Syrian Golden hamsters. These results suggested that hamsters are a suitable small animal model to study immunogenicity of hMPV as well as hMPV vaccine candidates.
- EXAMPLE 11 CLONING OF THE SOLUBLE RESPIRATORY SYNCYTIAL VIRUS F GENE CONSTRUCT A constract (i.e., b/h PIV3/sol RSV F2) containing a single copy of the soluble RSV F gene, a version of the RSV F gene lacking the transmembrane and cytosolic domains, was also generated ( Figure 14). This constract can be used to test for immunogenicity (soluble RSV F is still expected to elicit an RSV specific immune response). Its advantage would be the inability of the soluble RSV F to be inco ⁇ orated into the virion membrane.
- the cDNA plasmid for b/h PIV3/sol RSV F can be rescued by reverse genetics.
- the b/h PrV3/sol RSV F2 was constructed as follows. The bovine/human (b/h) PTV3/sol RSV F2 cDNA harbored the fusion (F) and hemagglutinin-neuraminidase (HN) genes derived from human PIV3 while the rest of the viral genome originated from bPIV3.
- the previously described plasmid 1-5 bPIV3/RSV F2 was used as a DNA template for PCR.
- This plasmid contained bPTV3 sequences from nucleotides (nt) 1 - 52O0 and the RSV F gene inserted at nt 1774.
- An oligo which anneals at nt 5946 (in the F gene) of the RSV A2 genome and the oligo 5'CGTGGTCGACCATTG TAAGAACATGATTAGGTGCTATTTTTATTTAATTTGTGGTGGATTTACCGGC3' were employed to remove the trans-membrane and cytoplasmic domains of RSV F, deleting 150 nucleotides.
- the resulting PCR fragment was digested with Hpal and Sail and introduced into 1-5 bPIV3/RSV F2 treated with Hpal and Sail to yield the plasmid 1-5 bPIV3/sol RSV F2.
- the bPIV3 subclone harboring the sol RSN F gene in the second position was cut with Sphl and Nhel and a 6.3 kb D ⁇ A fragment was isolated.
- the rest of the bovine/human PIN3 genome was ligated as an Nhel-SphlUNA fragment of 14 kb in size to generate the full-length b/h PIN3/sol RSV F2 cD ⁇ A plasmid.
- the recombinant viras was recovered by reverse genetics. High titer viras stocks were generated and quantified by plaque assays on Vero cells that were immunoperoxidase stained using RSV goat polyclonal antisera. The viras stocks were stored at -70°C.
- EXAMPLE 12 EXPRESSION OF HUMAN METAPNEUMOVIRUS F IN CELLS INFECTED WITH BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED HUMAN METAPNEUMO VIRUS F
- the b/h 104 hMPV F virus stocks were serially diluted 10 fold and used to infect subconfluent Vero cells. Infected cells were overlayed with optiMEM media containing gentamycin and incubated at 35°C for 5 days.
- hMPV F hMPV F viras stocks were serially diluted 10 fold and used to infect subconfluent Vero cells.
- Infected cells were overlayed with 1% methyl cellulose in EMEM/L-15 medium (JRH Biosciences; Lenexa, KS) supplemented with lx L15/MEM media containing penicillin/streptomycin, L-glutamine and fetal bovine serum. Infected cells were incubated at 35°C for 5 days, fixed with 100%> methanol and immunostained with 1:1000 dilution of anti-hMPVOOl guinea pig sera followed by 1:1000 dilution of anti- guinea pig HRP conjugated antibodies. (See Figure 15B). The anti hMPVOOl guinea pig seram is specific for hMPVOOl proteins and do not bind to b/h PTV3 proteins.
- EXAMPLE 13 RESCUE OF CHIMERIC BOVINE PARAINFLUENZA TYPE 3 / HUMAN PARAINFLUENZA TYPE 3 VIRUS IN HELA CELLS AND VERO CELLS
- Rescue of the chimeric b/h PIV3 viras by reverse genetics was carried out in HeLa cells using LipofecTACE (Gibco/BRL). The 80% confluent HeLa cells, Hep-2 cells, or Vero cells were infected with MVA at an MOI of 4.
- the full- length anti-genomic b/h PIN3 cD ⁇ A (4 ⁇ g) was transfected into the infected HeLa or Vero cells together with the ⁇ P (0.4 ⁇ g), P (0.4 ⁇ g), and L/pCITE (0.2 ⁇ g) expression plasmids. Forty hours post-transfection, the cells and the cell supernatant were harvested (P0) and subjected to a single freeze-thaw cycle.
- the resulting cell lysate was then used to infect a fresh Vero cell monolayer in the presence of 1-beta-D-arabinofuranosylcytosine (ara C), a replication inhibitor of vaccinia vims, to generate a PI viras stock.
- ara C 1-beta-D-arabinofuranosylcytosine
- the supernatant and cells from these plates were harvested, freeze-thawed once and the presence of bPIV3 viras particles was assayed for by immunostaining of viras plaques using PIV3-specific antiserum.
- the cell lysates of the PI harvest resulted in complete CPE of the Vero cell monolayers and immunostaining indicated the presence of an extensive viras infection.
- EXAMPLE 14 RESCUE OF BOVINE PARAINFLUENZA TYPE 3/HUMAN PARAINFLUENZA TYPE 3 VECTORED HUMAN METAPNEUMOVIRUS F VIRUSES
- the b/h PIV3 viruses expressing hMPV F at position one (b/h 104 hMPV F) or position two (b/h NP-P hMPV F) were obtained as follows.
- HEp-2 or Vero cells at 80-90% confluency in 6 well dishes were infected with Fowlpox-T7 at a multiplicity of infection (m.o.i) of 0.1 to 0.3.
- plasmid DNA full length b/h 104 hMPV F or b/h NP-P hMPV F cDNA 2.0 ⁇ g, pCite N 0.4 ⁇ g, pCite P 0.4 ⁇ g, pCite L 0.2 ⁇ g.
- the pCite plasmids have a T7 promoter followed by the IRES element derived from the encephalomyocarditis virus (EMCV)). Transfection was performed in the presence of Lipofectamine 2000 (Invitrogen) according to manufacturer's instraction.
- the transfection reaction was incubated at 33°C for 5 to 12 hours following which the media containing lipofectamine 20O0 was replaced with 2 ml of fresh OptiMEM containing gentamicin.
- the transfected cells were further incubated at 33°C for two days. Cells were stabilized with SPG and lyzed by one freeze-thaw cycle at -80°C.
- the crade cell lysate was used to infect a new Vero monolayer in order to amplify rescued virases.
- the chimeric virases were purified by limiting dilutions in Vero cells and high titer viras stocks of 10 6 - 10 8 PFU/ml were generated. Expression of the hMPV F protein was confirmed by immunostaining with polyclonal hMPV guinea pig antiserum.
- EXAMPLE 15 RESCUE OF BOVINE PARAINFLUENZA TYPE 3/HUMAN P ARAINFLUENZA TYPE 3 VECTORED RESPIRATORY SYNCYTIAL V IRUS GENES BY REVERSE GENETICS Infectious virus was recovered by reverse genetics in HeLa or HEp-2 cells using transfection methods described previously (see Example 13). Briefly, HEp-2 or Vero cells at 80-90% confluency in 6 well tissue culture dishes were infected with FP-T7 or MVA-T7 at a multiplicity of infection (m.o.i.) of 0.1 - 0.3 or 1 - 5, respectively.
- m.o.i. multiplicity of infection
- plasmid DNA 2.0 ⁇ g full-length b/h PIV3 RSV F or G cDNA, 0.4 ⁇ g pCITE/N, 0.4 ⁇ g pCITE/P, 0.2 ⁇ g pCITE/L.
- Transfections were performed in the presence of Lipofectamine20O0 (hivitiogen) according to manufacturer's instraction. The transfection reactions were incubated at 33°C for 5 to 12 hours following which the media containing Lipofectamine 2000 was replaced with 2 ml of fresh OptiMEM containing gentamicin.
- the transfected cells were incubated further at 33°C for two days. Cells were stabilized with SPG and lysed with one freeze-thaw cycle at -80°C. The crade cell lysate was used to infect a new Vero cell monolayer in order to amplify rescued vimses.
- the chimeric virases were purified by limiting dilutions in Vero cells and high titer viras stocks of 10 6 - 10 8 PFU/ml were generated.
- the RSV genes of the chimeric virases were isolated by RT-PCR and the sequences were confirmed. Expression of the RSV proteins was confirmed by immunostaining of infected Vero cell monolayers with RSV goat polyclonal antiserum (Biogenesis).
- EXAMPLE 16 CONFIRMATION OF CHIMERIC BOVINE PARAINFLUENZA TYPE 3 / HUMAN PARAINFLUENZA TYPE 3 VIRUS RESCUE BY RT-PCR
- Vero cells, infected with the PI viras stock of three independently derived isolates of b/h PIV3 were harvested and total RNA was isolated.
- the viral RNA was amplified using an oligo that anneals at position 4757 of bPIN3.
- a viral region from nt 5255 to 6255 was amplified by PCR.
- the resulting 1 kb PCR fragment should contain hPIN3 sequences. This was confirmed by digestion with enzymes (Sacl and Bgl II) specific for hPlV3 and that do not cut in the complementary region of bPIV3 (see Figure 2). As expected, Sacl and Bgl II cut the PCR fragment into smaller fragments confirming that the isolated sequences are derived from hPIV3 (see lanes 3, 5, 7).
- Sacl and Bgl II cut the PCR fragment into smaller fragments confirming that the isolated sequences are derived from hPIV3 (see lanes 3, 5, 7).
- a region in the polymerase L gene from nt 9075 to nt 10469 was amplified by PCR. This region should contain bPIN3 sequences.
- the resulting 1.4 kb PCR fragment was digested using enzyme specific for bPIN3 (Pvull and BamHI) that do not cut in the equivalent region of hPIV3 ( Figure 3).
- the 1.4 kb fragment was indeed digested by both Pvull and BamHI confirming that the polymerase gene is bPIV3 in origin (see lanes 3, 4, 6, 7, 9 and 10 of Figure 3).
- the RT-PCR analysis shows that the rescued b/h PIV3 viras is chimeric in nature. It contains hPTV3 F and H ⁇ genes in a bPIV3 genetic backbone.
- EXAMPLE 17 GENETIC STABILITY OF BOVINE PARAINFLUENZA TYPE 3/HUMAN PARAINFLUENZA TYPE 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS AND HUMAN METAPNEUMOVIRUS GENES
- infected cell lysates were serially blind passaged ten times in Vero cells.
- Sub-confluent Vero cells in T25 flasks were infected with b/h PIV3/RSV or b/h PIV3/hMPV at an MOI of 0.1 and incubated for 4 days at 33°C or until CPE was visible. At the end of the incubation period the infected cells and media were harvested, frozen and thawed two times, and the resulting cell lysate was used to infect a new T25 flask of Vero cells. This cycle was repeated ten times. All cell lysates from PI to PlO were analyzed by plaque assay and immunostaining for expression of RSV or hMPV proteins and viras titers.
- the RSV F, RSV G, or hMPV F gene cassettes were isolated by RT-PCR from PlO lysates, and were verified by DNA sequence analysis (to identify possible nucleotide alterations). All of the isolates maintained the RSV or hMPV gene cassettes and RSV or hMPV protein expression for the 10 passages analyzed. An increased insert stability of PIV3 expressing RSV or hMPV genes depending on location of gene insertion in the PIN3 genome, position 1 or 2, was not observed.
- EXAMPLE 18 VIRION FRACTIONATION OF BOVINE PARAINFLUENZA TYPE 3/HUMAN PARAINFLUENZA TYPE 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS GENES ON SUCROSE GRADIENTS
- Vero cells were inoculated with each of the chimeric b/h PIN3/RS V virases at an MOI of 0.1. When maximum CPE was visible, the infected monolayers were frozen, thawed, and spun for 10 minutes at 2000 ⁇ m.
- the clarified supernatants were spun through a 20% sucrose cushion at 100,000 x g for 90 minutes.
- the pellet was then resuspended in PBS and layered gently on top of a 20-66% sucrose gradient.
- the gradients were spun at 100,000 x g for 20 hours to achieve equilibrium.
- Eighteen 2 ml fractions were harvested starting from the top of the gradient. 0.4 ml of each fraction was removed for virus titer determination. Each fraction was resuspended in 2 volumes of 20%) PBS and concentrated by spinning at 100,000 x g for 1 hour.
- the pellet was then resuspended in 0.05 ml Laemmli buffer (Biorad) and analyzed for RSV and PIV3 proteins by Western blot, using an RSV F MAb ( ⁇ uMax L1FR-S28R), RSV (Biogenesis) and bPrV3 (VMRD) polyclonal antisera.
- RSV F MAb ⁇ uMax L1FR-S28R
- RSV Biogenesis
- VMRD bPrV3
- C-terminally truncated RSV F protein expressed in baculovirus that was purified to homogeneity was also analyzed on a sucrose gradients. The fractions were also analyzed for peak virus titers by plaque assay. Control gradients of free RSV F (generated in baculovirus and C-terminally truncated), RSV A2, and b/h PIV3 were carried out initially.
- the b/h PIV3 virions may be more pleiomo ⁇ hic and thus the spread of the peak fractions containing b/h PIN3 virions was more broad, b/h PIN3 virions were present in fractions 9, 10, 11, 12, and 13 ( Figure 16C). Again the fractions harboring the most amounts of virions, also displayed the highest viras titers by plaque assay ( Figure 16C). Sucrose gradient fractions of b/h PIN3/RSV F2 were analyzed with both a PIV3 polyclonal antiserum and an RSN F MAb ( Figure 16D). The fractions containing most of the virions were fractions 11, 12, 13, and 14 as was shown by western using the PIN3 antiserum.
- EXAMPLE 19 THE CHIMERIC BOVINE PARAINFLUENZA TYPE 3/HUMAN PARAINFLUENZA TYPE 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS (RSV) COULD NOT BE NEUTRALIZED WITH RSV ANTISERA
- neutralization assays were carried out (Tables 6 and 7). Neutralization assays were performed for b/h PIV3, b/h PIV3/RSV chimeric viruses or RSV using Vero cells.
- hPrV3 F MAb C191/9 neutralized 50% of b/h PIV3 as well as the b/h PIV3/RSV at a dilution of 1 :500 (Table 7).
- a b/h PIV3 was generated that expressed a soluble form of the RSV F protein lacking the transmembrane and cytosolic domains, rendering the RSV F protein incapable of being inserted into the virion membrane (Fig. 14).
- the removal of the transmembrane and cytosolic domains was accomplished by deleting 50 amino acids at the C terminus of the RSV F protein.
- the bPIV3 gene end and gene start sequences of the sol RSN F gene cassette remained identical to that of the full-length RSV F gene cassette (Fig. 14). Both chimeric b/h PIV3 expressed the native and soluble RSV F proteins efficiently and replicated to high titers of 10 7 -10 8 PFU/ml in tissue culture.
- EXAMPLE 20 THE CHIMERIC BOVINE PIV DEMONSTRATE ATTENUATED PHENOTYPES AND ELICIT STRONG PROTECTIVE RESPONSES WHEN ADMINISTERED IN VIVO
- Five week old Syrian Golden hamsters were infected with 5 x 10 5 pfu of wildtype bPIV3, recombinant bPIV3, hPIV3, human/bovine PIN3, and placebo. The five different animal groups were kept separate in micro-isolator cages. Four days post-infection, the animals were sacrificed. The nasal turbinates and lungs of the animals were homogenized and stored at -80°C.
- Viras present in the tissues was determined by TCDD 50 assays in MDBK cells at 37°C. Virus infection was confirmed by hemabso ⁇ tion with guinea pig red blood cells.
- Table 8 shows the replication titers of the different PIV3 strains in hamsters in the lungs and nasal turbinates. Note that recombinant bPIN3 and the b/h PIN3 chimeric virases are attenuated in the lungs of the hamsters: Table 8 Replication of PIV3 Viruses in Syrian Golden Hamsters in the Nasal Turbinates and Lungs.
- Wildtype bPIV3 and hPIV3 were added to two-fold serially diluted hamster serum samples.
- Table 9 shows the antibody response generated in the hamsters upon being infected with the different PIV3 strains. Note that the b/h PIN3 chimeric viras generates as strong an antibody response against hPIV3 as does wild type hPIV3, far exceeding the response generated by the recombinant or wildtype bPIV3: Table 9 Hemaglutination Inhibition Assay Using Serum from Hamsters Infected with Different PIV3 Viruses.
- EXAMPLE 21 REPLICATION OF BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS G OR F PROTEIN IN THE UPPER AND LOWER RESPIRATORY TRACT OF HAMSTERS Five week old Syrian Golden hamsters (six animals per group) were infected intranasally with 1 x 10 6 PFU or 1 x 10 4 PFU of b/h PIV3, b/h PIV3/RSV, RSV A2, or placebo medium in a 100 ⁇ l volume. The different groups were maintained separately in micro-isolator cages.
- the nasal turbinates and lungs of the animals were harvested, homogenized and stored at -70°C.
- the titers of viras present in the tissues were determined by TCID 50 assays in Vero cells.
- the animals were inoculated on day 28 intranasally with 1 x 10 6 pfu/ml of hPIN3 or RSN A2.
- the nasal turbinates and lungs of the animals were isolated and assayed for challenge viras replication by plaque assays on Vero cells that were immmiostained for quantification.
- Table 10 shows the replication titers of the different strains in hamsters in the lungs and nasal turbinates.
- EXAMPLE 22 BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS IMMUNIZED HAMSTERS WERE PROTECTED UPON CHALLENGE WITH HUMAN PARAINFLUENZA 3 AND RESPIRATORY SYNCYTIAL VIRUS A2
- the animals were challenged intranasally with 10 6 PFU RSV or hPIN3 per animal on Day 28 post- vaccination.
- EXAMPLE 23 VACCINATION OF HAMSTERS WITH BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS INDUCES SERUM HAI AND NEUTRALIZING ANTIBODIES
- serum samples were obtained on Day 28 from the b/h PIV3/RSV immunized animals.
- the hamster sera were analyzed for the presence or RSV neutralizing antibodies using a 50%> plaque reduction assay, and for PIV3 HAI serum antibodies by ca ⁇ ying out hemaggluination inhibition (HAI) assays (Table 12).
- plaque reduction assay 50% plaque reduction assay (neutralization assay) was carried out as follows: the hamster sera were two-fold serially diluted, and incubated with 100 PFU of RSV A2 for one hour. Then the virus-serum mixtures were transfened to Vero cell monolayers and overlaid with methylcellulose. After 5 days of incubation at 35°C, the monolayers were immunostained using RSV polyclonal antiserum for quantification. Hemagglutination-inhibition (HAI) assays were performed by incubating serial two-fold dilutions of Day 28 hamster sera at 25°C for 30 min with hP ⁇ V3 in V-bottom 96-well plates.
- HAI Hemagglutination-inhibition
- guinea pig erythrocytes were added to each well, incubation was continued for an additional 90 min, and the presence or absence of hemagglutination in each well was recorded. Titers were expressed as the mean reciprocal log2 of the highest serum dilution that inhibited hemagglutination.
- Table 12 Vaccination of Hamsters with b/h PIV3/RSV Induces Serum HAI and Neutralizing Antibodies
- a Viruses used to immunize hamsters b
- the neutralizing antibody titers were determined by a 50% plaque reduction assay.
- the neutralizing antibody titers of hamster pre-serum were ⁇ 1.0 and the HAI antibody titers were ⁇ 4.0.
- EXAMPLE 24 VACCINATION OF HAMSTERS WITH LOW DOSE OF BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED RESPIRATORY SYNCYTIAL VIRUS PROTECTED HAMSTERS FROM CHALLENGE WITH RESPIRATORY SYNCYTIAL VIRUS A2, AND INDUCES SERUM HAI AND NEUTRALIZING ANTIBODIES h order to identify the best vaccine candidate, low dose viras with different constructs (see Example 2) were used to immunize hamsters. The results of the challenging experiments are summarized in Table 13.
- neutralizing antibody titers were determined by a 50%> plaque reduction assay (neutralization assay). Neutralization assays were performed for b/h PIV3, b/h PIV3/RSV chimeric virases or RSV using Vero cells. Serial two-fold dilutions of RSV polyclonal antiserum (Biogenesis; Poole, England), an RSV F MAb (WHO 1200 MAb) obtained from Medlmmune or hPIV3 F (C 191/9) and HN (68/2) MAbs, were incubated with approximately 100 PFU of either b/h PIV3, b/h PIV3/RSV chimeric virases or RSV in 0.5 ml OptiMEM at RT for 60 min.
- virus-serum mixtures were transfened to Vero cell monolayers, incubated at 35_C for 1 hour, overlaid with 1% methyl cellulose in EMEM/L-15 medium (JRH Biosciences; Lenexa, KS) and incubated at 35_C .
- EMEM/L-15 medium JRH Biosciences; Lenexa, KS
- the infected cell monolayers were immunostained.
- Neutralization titers were expressed as the reciprocal of the highest seram dilution that inhibited 50% of viral plaques.
- Neutralization assays were also canied out for seram obtained on Day 28 post- infection from hamsters immunized with b/h PTV3, b/h PIV3/RSV chimeric viruses, or RSV A2.
- the hamster sera were two-fold serially diluted, and incubated with 100 PFU of RSV A2 for one hour. Then the virus-serum mixtures were transfened to Vero cell monolayers and overlaid with methylcellulose. After 5 days of incubation at 35°C the monolayers were immunostained using RSV polyclonal antiserum for quantification.
- the neutralizing antibody titers of hamster pre-seram were ⁇ 1.0 and the HAI antibody titers were ⁇ 4.0.
- HAI Hemagglutination-inhibition
- the restricted replication phenotype of the chimeric virases possessing RSV genes in the first position was exacerbated when the inoculation dose was reduced to 1 x 10 4 PFU per animal, b/h PIN3/RSV FI and GI replicated in the upper respiratory tracts of hamsters to titers that were reduced by 1.0 - 2.0 log 10 compared to those of b/h PIV3 (Table 13).
- b/h PIV3/RSV with the RSN genes in position 2 replicated in the upper respiratory tract to levels observed for b/h PTV3. Replication in the lungs of hamsters was also more restricted for the b/h PIV3/RSV harboring RSV genes in the first position (Table 13).
- Serum was collected from the immunized hamsters on Day 28, and analyzed for the presence of RSV neutralizing and PIV3 HAI seram antibodies (Table 14).
- An approximately 50%) drop in RSV neutralizing antibody titers was observed in sera obtained from hamsters immunized with b/h PTV3/RSV as compared to the titers observed for wt RSV sera (Table 14).
- the sera obtained from animals that had received b/h PIV3 harboring the RSV genes in position 2 still displayed higher RSV neutralization antibody titers than was observed for sera from b/h PIV3/RSV with the RSV genes in position 1.
- the PIV3 HAI seram antibody titers were also slightly reduced compared to the b/h PIV3 sera (Table 14).
- EXAMPLE 25 BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED HUMAN METAPNEUMOVIRUS F IMMUNIZED HAMSTERS WERE PROTECTED UPON CHALLENGE WITH HUMAN PARAINFLUENZA VIRUS 3 OR HUMAN METAPNEUMOVIRUS NL/001
- Five groups of Syrian Golden Hamsters (each group had six hamsters) were immunized with b/h PTV3, b/h hMPV FI, b/h hMPV F2, hMPV or placebo repectively. The five different animal groups were kept separate in micro-isolator cages.
- the hamsters were challenged with 1 x 10 6 PFU of either hPIV3 or hMPV (NL/001 strain) to evaluate the immunogenicity induced by the b/h PrV3/hMPV F.
- the animals were sacrificed.
- the nasal turbinates and lungs of the animals were homogenized and stored at -80°C.
- Viras present in the tissues was determined by TCDD 5 o assays in MDBK cells at 37°C. Viras infection was confirmed by hemabso ⁇ tion with guinea pig red blood cells.
- Table 15 shows the replication titers of the PIV3 strain and the MPN strain in hamsters in the lungs and nasal turbinates.
- Viras used to immunize groups of six hamsters on day 0. On day 28, the hamsters were challenged with 10 6 pfu of hPIV3 or hMPN. Four days post-challenge, the lungs and nasal turbinates of the animals were harvested. ⁇ D not determined.
- EXAMPLE 26 BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED HUMAN METAPNEUMOVIRUS VACCINATED HAMSTERS PRODUCED HMPV NEUTRALIZING AND PIV3 HAI SERUM ANTIBODIES
- Seram samples were obtained from the hamsters on Day 28 prior to administering the challenge viras, and analyzed for the presence of hMPV neutralizing antibodies and HAI seram antibodies (Table 16). High levels of hMPV neutralizing antibodies, 7.36 log2, were observed for sera derived from wt hMPV-infected animals.
- the neutralizing antibody titers were determined by a 50% plaque reduction assay.
- the results showed that b/h PIV3 expressing hMPV F protein in positions 1 or 2 of the b/h PIV3 genome can efficiently infect and replicate in Syrian Golden hamsters and induce a protective immune response and protect from challenge with hPIV3 and hMPV.
- the immunization of hamsters with these chimeric virases also elicited the production of hMPV neutralizing antibodies and HAI seram antibodies to levels similar to those observed for wt hMPV or b/h PTV3, respectively.
- EXAMPLE 2 TRIVALENT BOVINE PARAINFLUENZA 3/HUMAN PARAINFLUENZA 3 VECTORED CONSTRUCT REPLICATES IN HAMSTERS AND PROTECTS HAMSTERS FROM hMPV/NLl/00, hPIV3 AND RSV A2
- Five week old Syrian Golden hamsters (six animals per group) were infected intranasally with 1.0 x 10 6 PFU of the b/h PIV3 viras and 1.0 x 10 5 PFU of the trivalent viras b/h PIV3/RSV Fl/hMPV F3 in a 0.1 ml volume, respectively.
- the different groups were maintained separately in micro-isolator cages.
- the nasal turbinates and lungs of the animals were harvested, homogenized and stored at -70C.
- the titers of viras present in the tissues were determined by TCDD 50 assay in Vero cells.
- Table 17 shows the replication titers of the different strains in hamsters in the lungs and nasal turbinates.
- the RSV/hMPV animals were inoculated intranasally with 1.0 x 10 5 PFU viras in a 0.1 ml volume, the b/h PIV3 animals received 1.0 x 10 6 PFU viras. Standard enor.
- the animals were challenged (inoculated) on day 28 intranasally with lx 10 6 PFU of hPIV3, lx 10 6 PFU of RSV, and 1.0 x 10 5 PFU of hMPV/NL/1/00.
- the nasal turbinates and lungs of the animals were isolated and assayed for challenge viras replication by plaque assays on Vero cells that were immunostained for quantification.
- a b/h PIV3 vector was employed to express the native and soluble forms of the RSV F protein from PIV3 genome position 2, juxtaposed between ⁇ and P.
- Previous analysis of b/h PIV3/RSV F2 had shown that high levels of RSV F protein were expressed by chimeric b/h PTV3 from this genome position and that hamsters vaccinated with this vaccine were protected from both RSV and hPrV3 challenge.
- the efficacy of two b/h PIV3 vaccines was compared that expressed either native RSV F protein capable of being inserted into the virion envelope or soluble RSV F protein which could not be incorporated into the virion.
- the soluble RSV F protein cannot be anchored into the virion envelope due to the absence of the transmembrane domain.
- Antibodies produced in response to expression of the RSV F protein by b/h PIV3 are expected to result in cross-neutralization and cross-protection against infection by all strains of RSV, because the RSV F genes are highly conserved between subgroups A and B of RSV.
- Both b/h PIV3/RSV F2 and b/h PIV3/sol RSV F2 expressed the RSV F proteins efficiently from PIV3 genome position 2.
- These RSV vaccines were analyzed for levels of replication in the respiratory tract of African green monkeys (AGMs), and the ability to elicit a protective immune response from wildtype RSV challenge.
- Cells and Viruses Vero cells were maintained in Modified Eagle's Medium (MEM) (JRH Biosciences) supplemented with 2 mM L-glutamine, non-essential amino acids ( ⁇ EAA), antibiotics, and 10% FBS.
- MEM Modified Eagle's Medium
- ⁇ EAA non-essential amino acids
- FBS FBS
- b/h PTV3/RSV F2 b/h PIN3/sol RSV F2
- RSV A2 RSV B 9320, bMPV/ ⁇ L/1/00 were propagated in Nero cells.
- Cells were infected with the virases at a multiplicity of infection (MOI) of 0.1 PFU/cell.
- MOI multiplicity of infection
- lOx SPG is 2.18 M Sucrose, 0.038 M KH 2 PO 4 , 0.072 M K 2 HPO 4 , 0.054 M L-Glutamate
- the virus stocks were stored at -70°C.
- the viras titers were determined by plaque assays on Vero cells. Plaques were quantified after immunoperoxidase staining using PTV3 (VMRD) or RSV goat polyclonal antisera (Biogenesis).
- RSV- and PIV3-seronegative African Green monkeys (Cercopithecus aethiops) (3.5 to 6.5 years old, 2.6 to 5.8 kg) were identified using an RSV F IgG ELISA (Immuno- Biological Laboratories) and a hemagglutination inhibition (HAI) assay (described below) for primate pre-sera collected on day -14 prior to the study start date.
- the primates were housed in individual micro-isolator cages.
- the monkeys were anesthetized with a ketamine-valium mixture and infected intranasally and intratracheally with b/h PIV3/RSV F2, b/h PIV3/sol RSV F2, RSV A2, and hMPV/NL/1/00.
- the nasal dose volume was 0.5 ml per nostril, and the intratracheal dose volume was 1 ml.
- each animal received a dose of 2 ml containing 2-3 x 10 5 PFU of viras.
- the placebo animal group received the same dose volume of Opti-MEM.
- all animals were challenged intratracheally and intranasally with 7 x 10 5 PFU of RSV A2 (1 ml at each site).
- Nasopharyngeal (NP) swabs were collected daily for 11 days and tracheal lavage (TL) specimens were collected on Days 1, 3, 5, 7 and 9 post- immunization and post-challenge.
- Blood samples obtained from the femoral vein were collected on Days 0, 7, 14, 21, 28, 35, 42, 49 and 56 for serological analysis. The animals were monitored for body temperature changes indicating a fever, signs of a cold, runny nose, sneezing, loss of appetite, and body weight.
- Viras present in the primate NP and TL specimens was quantitated by plaque assays using Vero cells that were immunostained with RSV goat polyclonal antiserum.
- Mean peak viras titers represent the mean of the peak viras titer measured for each animal on any of the 11 days following immunization or challenge.
- Plaque Reduction Neutralization Assay PRNA : PRNAs were carried out for sera obtained on days 1, 28, and 56 post-dose from primates infected with b/h PTV3/RSV F2 and b/h PIV3/sol RSV F2, respectively. The primate sera were two-fold serially diluted, and incubated with 100 PFU of RSV A2 in the presence of guinea pig complement for one hour at 4°C.
- the virus-serum mixtures were transfened to Vero cell monolayers and overlaid with 1% methyl cellulose in EMEM/L-15 medium (JRH Biosciences; Lenexa, KS) containing 2% FBS and 1% antibiotics. After 6 days of incubation at 35°C, the monolayers were immunostained using RSV goat polyclonal antiserum for quantitation. Neutralization titers were expressed as the reciprocal log 2 of the highest seram dilution that inhibited 50% of viral plaques.
- RSV F IgG Elisa The primate sera from days 1, 28 and 56 from the vaccinated animals were analyzed for the presence of RSV F IgG using an ELISA kit (hnmuno-Biological Laboratories, Hamburg, Germany) according to the manufacturer's instructions. The secondary monkey antiserum (Rockland Inc.) was used at a 1:1000 dilution. The RSV F IgG antibody titers were expressed as log 2 IgG U/ml.
- hPIV3 Microneutralization Assays Microneutralization assays were performed on Vero cells. Serial two-fold dilutions of primate serum, starting at 1:4, were incubated at 37°C for 60 min with 100 TCDD 50 of hPIV3.
- virus-serum mixtures were transferred to cell monolayers in 96-well plates and incubated at 37°C for six days, after which all wells were observed for CPE.
- Neutralization titers were expressed as the reciprocal of the highest serum dilution that inhibited CPE.
- Neutralization antibody titers of ⁇ 1:4 (the lowest seram dilution tested) were assigned a reciprocal log 2 titer of 2.
- HAI assays were performed by incubating serial two-fold dilutions of primate seram at 25°C for 30 min with 8 HA units/0.05 ml of either bPIV3 or hPrV3. Subsequently, guinea pig red blood cells were added to each well, incubation was continued for 90 min, and each well was observed for hemagglutination. HAI titers were expressed as the reciprocal of the highest dilution of antiserum that inhibited virus-mediated agglutination of erytlirocytes. 2. Results
- PIV3/RSN F2 and b/h PIV3/sol RSV F2 vaccines the experiment was designed as follows (see Figure 17). Briefly, on Day 1, RSV and PIV3 sero-negative AGMs, four animals per group, were immunized intranasally and intratracheally with b/h PIV3/RSV F2 or b/h PIV3/sol RSV F2 with a dose of 2-3 x 10 5 PFU. A positive control group was infected with wildtype RSV A2 and the negative control group was administered placebo medium. On Day 28, all animals were challenged intranasally and intratracheally with 7 x 10 5 PFU of wildtype RSV A2. The animals were housed in micro-isolator cages for the duration of this study.
- ⁇ asopharyngeal swabs were collected daily for 11 days post-immunization and post- challenge, and tracheal lavage samples were obtained on days 2, 4, 6, 8, and 10 post- immunization and post-challenge. Serum samples for antibody analyses were collected every seven days throughout the duration of the study (see Figure 17). As shown in Table 19, following vaccination with b/h PIV3/RSV F2, monkeys shed for seven days in the nasopharynx displaying a mean peak titer of 5.6 log 10 PFU/ml, and for nine days in the trachea with mean peak titers of 7.0 log PFU/ml.
- infection of primates with wt RSV A2 resulted in six days of virus shedding in the nasopharynx achieving mean peak titers of 3.3 logTM PFU/ml and eight days of viras shedding in the trachea displaying peak titers of 5.0 log 10 PFU/ml.
- both vaccine candidates b/h PIV3/RSV F2 and b/h PIV3/sol RSV F2
- the replication titers observed for the two RSV vaccine candidates in the respiratory tract of AGMs were higher than those for wildtype RSV A2.
- the levels of replication observed for the potential RSV candidate vaccines afforded complete protection from wt RSN challenge 28 days post-dose.
- High replication titers of the RSV A2 challenge viras were observed only for animals administered placebo medium or animals that had been vaccinated with hMPV, a related paramyxovirus, that did not result in immunological cross- protection.
- AGMs Immunized with b/h PTV3/RSV F2 or b/h PIN3/sol RSV F2 Were Completely Protected From Wildtype RSN A2 Challenge
- the vaccinated primates were challenged with a high dose of wildtype RSV A2 four weeks post-immunization.
- Efficacy was measured as a reduction in shed RSV challenge viras titer in the URT and LRT of the infected animals. Primates immunized with b/h PIV3/RS V F2 or b/h PIV3/sol RSV F2 were protected efficiently from wt RSV A2 challenge (Table 19). Only one animal vaccinated with b/h PIV3/RSV F2 shed low levels of challenge viras (1.8 log 10 PFU/ml) for one day in the nasopharynx and one day in the trachea (1.6 logTM PFU/ml).
- the mean peak titers for this treatment group were 1.2 logTM PFU/ml in the URT and 1.2 logTM PFU/ml in the LRT.
- the animals that were administered b/h PIN3/sol RSV F2 were also completely protected from wt RSV challenge (Table 19).
- One animal displayed low levels of challenge viras shedding (1.3 logTM PFU/ml) for three days in the nasopharynx, but this animal did not shed RSV in the trachea.
- the mean peak titers observed for the b/h PIV3/sol RSV F2- immunized primates were 1.1 logTM PFU/ml in the nasopharynx and 1.0 logTM PFU/ml in the trachea.
- treatment groups that had received placebo medium displayed high levels of RSV challenge viras replication, 4.3 logTM PFU/ml in the nasopharynx and 5.7 logTM PFU/ml in the trachea and the primates shed challenge viras for eight days in both the URT and LRT.
- AGMs that were administered hMPV, a related paramyxovirus, on Day 1 were not protected from RSV challenge and shed RSV challenge viras for eight days in the URT and LRT.
- Mean peak titers of 4.0 logTM PFU/ml and 5.0 logTM PFU/ml in the URT and LRT of AGMs were observed (Table 19).
- AGMs infected with wildtype RSV A2 displayed high RSV neutralizing antibody titers of 9 log 2 four weeks post-infection when an RSV subgroup A was used as antigen in the PRNA.
- a five log 2 reduction in RSV neutralizing antibody titers was observed when RSV subgroup B was employed in the PRNA.
- the vaccine candidates, b/h PIV3/RSV F2 and b/h PPV3/sol RSV F2 showed RSV neutralizing antibody titers of ⁇ 4 log 2 on Day 28 post-dose when RSV subgroup A or subgroup B were used as antigen.
- serum derived from animals that were administered placebo medium did not display RSV neutralizing antibody titers for either RSV subgroup A or B.
- Placebo animal serum samples showed a 7 log 2 increase in RSV neutralizing antibody titer on Day 56 for subgroup A RSV, but only a low level of neutralizing antibodies for subgroup B.
- RSN F protein specific IgG levels were analyzed pre-dose (Day 1), four weeks post-dose (Day 28), and four weeks post-challenge (Day 56) (Table 20).
- the pre-dose primate sera from all treatment groups displayed values of less than 3.6 log 2 IgG U/ml indicating the absence of RSV F-specific IgG.
- RSV F-specific IgG levels for sera derived from b/h PIV3/RSV F2 or b/h PIV3/sol RSV F2 showed titers of 8.2 and 8.0 log 2 , respectively. Similar levels of 8.6 log RSV F IgG titers were observed in Day 28 sera originating from RSV A2 infected animals. Only the Day 28 sera of the placebo animals did not contain RSV F IgG. The RSV F IgG titers for Day 56 sera from RSV A2, b/h PIV3/RSV F2, and b/h PIV3/sol RSN F2-immunized animals rose by 0.5 to 1.4 log 2 in titer from the levels observed for Day 28 sera.
- RSV neutralizing antibody titers were lower by 5 lo 2 for b/h PIV3/RSV F than those observed for primate sera obtained from AGMs infected with wildtype RSV A2.
- RSV neutralizing antibodies were produced only in response to the RSV F protem rather than to the whole RSV virus particle.
- the levels of RSV B cross-neutralizing antibody for sera obtained from AGMs infected with wildtype RSV A2 were reduced by 5 log 2 as compared to the antibody levels observed when the homologous RSV A2 antigen was tested, hi contrast, a decrease in RSV B specific- neutralizing antibody titers produced by b/h PIV3/RSV F2 and b/h PIV3/sol RSV F2 was not observed.
- These results suggested that the serum neutralizing antibody levels induced by the RSV F protein were sufficient to protect primates completely from RSV challenge.
- the RSV neutralizing antibody titers were lower for b/h PIV3/RSV F primate sera, the neutralizing activity for subgroup A and B RSV strains were identical.
- PIV3 is highly immunogenic and the first PIN/RSV vaccination induces high levels of PIN3 antibodies. This may result in vector immunity such that subsequent immunizations with PIV/RS V may not produce a further rise in antibody titer.
- a recent study by Kanon et al. presented data showing that multiple doses of PIV3 will not result in vector immunity provided the intervals between dose administrations are spaced far enough apart (see Kanon et al, Pediatr. Infect. Dis. J. 22:394-405 (2003)).
- the frequency of infection with a second dose of vaccine was clearly influenced by the dosing interval. Only 24% of infants shed viras when a second dose of vaccine was administered 1 month later. In contrast, 62% of infants shed virus when the second dose was administered 3 months after the first dose.
- Human PIV3- specific HAI antibody titers of 128 and 64 were observed for b/h PIV3/RSV F2 and b/h PrV3/sol RSV F2 Day 28 and Day 56 sera, respectively.
- Lower HAI antibody titers of 11.3 and 16.0 were displayed when the bPIV3 antigen was tested using Day 28 sera.
- the Day 56 sera displayed even lower bPIV3 HAI titers of 8.0. Since the surface glycoproteins, F and HN, of b/h PIV3/RSV virases were derived from human PIV3, a higher HAI serum antibody titer to the homologous antigen (hPIN3) was observed than to the heterologous bPIN3 antigen. hPIV3 neutralizing or PIN3 HAI serum antibodies were not detected in sera derived from placebo recipients. These results suggested that b/h PIN3/RSN vaccines may be also efficacious for bPIV3 infections.
- EXAMPLE 29 EVALUATING THE EFFICACY AND IMMUNOGE1NICITY OF b/h PIV3 EXPRESSING AN ANTIGENIC PROTEIN OF MPV IN AFRICAN GREEN MONKEYS
- MPV vaccine candidates e.g., b/h PIV3 expressing an antigenic protein of MPV such as MPV F, are evaluated for efficacy and immunogenicity in a non-human primate model, such as African green monkeys. Vero cells are maintained in Modified Eagle's Medium (MEM) (JRH Biosciences) supplemented with 2 mM L-glutamine, non-essential amino acids (NEAA), antibiotics, and 10% FBS.
- MEM Modified Eagle's Medium
- b/h PIV3 expressing an antigenic protein of MPV e.g., b/h PIV3/MPV F2
- a wildtype MPV e.g., hMPV/NL/1/00
- the viras stocks are stored at -70°C.
- the viras titers are determined by plaque assays on Vero cells. Plaques are quantified after immunoperoxidase staining using PrV3 (VMRD) or MPV goat polyclonal antisera (Biogenesis). MPV- and PIN3-seronegative African Green monkeys (Cercopithecus aethiops) (3.5 to 6.5 years old, 2.6 to 5.8 kg) are identified using an MPV F IgG ELISA (Immuno- Biological Laboratories) and a hemagglutination inl ibition (HAI) assay for primate pre-sera collected on day 14 prior to the study start date.
- MPV F IgG ELISA Immuno- Biological Laboratories
- HAI hemagglutination inl ibition
- MPV F IgG ELISA is performed as follows: the primate sera from days 1, 28 and 56 from the vaccinated animals are analyzed for the presence of MPV F IgG using an ELISA kit (Immuno-Biological Laboratories, Hamburg, Germany) according to the manufacturer's instructions. The secondary monkey antiserum (Rockland Inc.) is used at a 1:1000 dilution. The MPV F IgG antibody titers are expressed as log 2 IgG U/ml. The HAI assays are performed by incubating serial two-fold dilutions of primate serum at 25°C for 30 min with 8 HA units/0.05 ml of either bPIV3 or hP ⁇ N3.
- HAI titers are expressed as the reciprocal of the highest dilution of antiserum that inhibited virus-mediated agglutination of erythrocytes.
- the primates are housed in individual micro-isolator cages.
- the monkeys are anesthetized with a ketamine-valium mixture and infected intranasally and intratracheally with a b/h PIN3 vector expressing an antigenic protein of MPV, e.g., b/h PIV3/MPV F2, and a wildtype MPV, e.g., hMPV/ ⁇ L/1/00.
- the nasal dose volume is 0.5 ml per nostril, and the intratracheal dose volume is 1 ml.
- each animal receives a dose of 2 ml containing 2-3 x 10 5 PFU of viras.
- the placebo animal group receives the same dose volume of OptiMEM.
- NP Nasopharyngeal
- TL tracheal lavage
- Blood samples obtained from the femoral vein are collected on Days 0, 7, 14, 21, 28, 35, 42, 49 and 56 for serological analysis.
- the animals are monitored for body temperature changes indicating a fever, signs of a cold, runny nose, sneezing, loss of appetite, and body weight.
- Viras present in the primate NP and TL specimens is quantitated by plaque assays using Vero cells that are immunostained with MPV goat polyclonal antiseram.
- Mean peak vims titers represent the mean of the peak viras titer measured for each animal on any of the 11 days following immunization or challenge.
- Plaque reduction neutralization assays are canied out for sera obtained on days 1, 28, and 56 post-dose from primates infected with a b/h PIV3 vector expressing an antigenic protein of MPV, e.g., b/h PIV3/MPV F2.
- the primate sera are two-fold serially diluted, and incubated with 100 PFU of hMPV/NL/100 in the presence of guinea pig complement for one hour at 4°C.
- the virus-serum mixtures are transfened to Vero cell monolayers and overlaid with 1% methyl cellulose in EMEM/L-15 medium (JRH Biosciences; Lenexa, KS) containing 2% FBS and 1% antibiotics. After 6 days of incubation at 35°C, the monolayers are immunostained using MPV goat polyclonal antiserum for quantitation. Neutralization titers are expressed as the reciprocal log 2 of the highest serum dilution that inhibits 50% of viral plaques.
- hPrV3 Microneutralization assays are performed on Vero cells. Serial two-fold dilutions of primate seram, starting at 1 :4, are incubated at 37°C for 60 min with 100 TCDD 50 of hPrV3. Then virus-serum mixtures are transferred to cell monolayers in 96-well plates and incubated at 37°C for six days, after which all wells are observed for CPE. Neutralization titers are expressed as the reciprocal of the highest seram dilution that inhibited CPE. Neutralization antibody titers of ⁇ 1 :4 (the lowest serum dilution tested) are assigned a reciprocal log 2 titer of 2.
- MPV and PIV3 sero-negative African green monkeys are immunized intranasally and intratracheally with a MPV vaccine candidate, e.g., b/h PIV3/MPV F2, with a dose of 2-3 x 10 5 PFU.
- a positive control group is infected with wildtype MPV, e.g., hMPV/NL/100, and the negative control group is administered placebo medium.
- all animals are challenged intranasally and intratracheally with 7 x 10 5 PFU of wildtype MPV, e.g., hMPV/NL/100.
- the animals are housed in micro-isolator cages for the duration of this study.
- Nasopharyngeal swabs are collected daily for 11 days post-immunization and post-challenge, and tracheal lavage samples are obtained on days 2, 4, 6, 8, and 10 post-immunization and post-challenge.
- Serum samples for antibody analyses are collected every seven days throughout the duration of the study.
- h order to evaluate immune protection from MPV infection the vaccinated primates are challenged with a high dose of wildtype MPV, e.g., hMPV/NL/100, four weeks post- immunization. Efficacy is measured as a reduction in shed MPV challenge virus titer in the URT and LRT of the infected animals.
- Efficacy of the b/h PIV3 vectored MPV vaccine candidates is further evaluated by the levels of MPV neutralizing and MPV F IgG serum antibody titers produced four weeks post- immunization.
- the MPV neutralizing antibody titers are determined using a 50% plaque reduction neutralization assay (PRNA).
- PRNA plaque reduction neutralization assay
- the immune responses elicited by the MPV vaccine candidates are also analyzed by measuring MPV F protein specific IgG levels at pre-dose (Day 1), four weeks post-dose (Day 28), and four weeks post-challenge (Day 56).
- primate sera are also analyzed for the presence of hPIV3 neutralization and HAI serum antibodies.
- EXAMPLE 30 MICRONEUTRALIZATION ASSAY USING A b/h PIV3 CONSTRUCTS CONTAINING GFP OR eGFP GENE
- a microneutralization assay is used to analyze the remaining infectivity of the virases after the virases are incubated with dilutions of seram containing antibodies.
- Microneutralization assays are performed as follows: sera are serially diluted with
- Opti-MEM Medium (lx). Seram and medium are mixed gently by inversing, and then place on ice. Each dilution of sera is incubated with a viras of interest, wherein the genome of the viras has been manipulated to contain one or more GFP or eGFP gene (see Section 9, Example 4). Cells are washed with phosphate buffered saline ("PBS"). The virus/sera mixture are added to cells and incubated for one hour at 35°C. All of the medium, which contain the viras, are removed, and cells are washed with PBS. Opti-MEM medium is added to the cells and the cell cultures are incubated for three days.
- PBS phosphate buffered saline
- the remaining infectivity of the viruses is measured by quantify GFP or eGFP green foci on the images captured with fluorescence microscope.
- Plaque reduction assay using a conesponding virus without GFP or eGFP, e.g., wildtype RSV, can also be performed for comparing the sensitivity of the microneutralization assay.
- EXAMPLE 31 DEVELOPMENT OF AROBUST AND HIGH-YIELDING CELL CULTURE FOR MANUFACTURE OF THE VIRUS VACCINE CANDIDATES This example describes a robust and high-yielding cell culture process. This process can be used, e.g., for the manufacture of the viras vaccines described in the application.
- the viras a bovine/human PIV-3 viras containing a RSV F gene insert constract as shown in Figure 4, hereinafter refened as "b/h PIV3/RSV F2" was propagated using Vero cells (ATCC) that have been adapted to grow in a seramfree medium (SFM) composed of OPTI PRO SFM (Gibco) supplemented with 4mM Lglutamine.
- SFM seramfree medium
- the anchorage-dependent Vero cells were routinely maintained by seeding at 5 xlO 4 cells/ml in the SFM, refeeding the cultures 3 days post-seeding, and passaging the flask 5 days post-seeding.
- Viras titers were determined using a 50% tissue culture infective dose (TCDD50) assay and were quantified in logioTCIDso/mL. RESULTS Process Optimization Small-scale process optimization studies were conducted in T-75 flasks seeded with
- Vero cells in SFM at 1.75 x 10 6 cells/flask All pre-infection cultures were incubated at 37 ⁇ 1°C, 5 ⁇ 1%) CO 2 and infected either 3 or 5 days post-seeding. For cultures infected 5 days post- seeding, complete SFM exchange was performed on the third day post-seeding. At the time of infection, the spent medium was replaced by SFM containing the b/h PIV3/RSV F2 viras. Cultures were sampled at least once daily, and assayed for infectious viras by TCDD 50 . Enor bars in the Figures represent the standard deviation obtained from duplicate cultures.
- EXAMPLE 32 PLASMID-ONLY RECOVERY OF PI V3 IN SERUM FREE VERO CELLS BY ELECTROPORATION
- the process demonstrated in this example allows recovery of recombinant PIV3 using plasmids only, in the absence of helper virases.
- the recovery of PIV3 was carried out using SF Vero cells, which were propagated in the absence of animal and human derived products. This process allows recovery of recombinant PIV3 with similar efficiency to previous methods using helper virases (recombinant vaccinia or fowl-pox virases expressing T7 polymerase).
- the vaccine virases are free of contaminating agents, simplifying downstream vaccine production.
- the cells used for vaccine viras recovery were grown in media containing no animal or human derived products. This eliminates concerns about transmissible spongiform encephalopathies (e.g. BSE), for product end users.
- This method enables generation of a recombinant vaccine seed that is completely free of animal or human derived components. The seed is also free of contaminating helper virases.
- Plasmid-based expression systems for rescue of virases from cDNA are described, e.g., in RA Lerch et al., Wyeth Vaccines, Pearl River NY, USA (Abstract 206 from XII International Conference on Negative Strand Virases, June 14 th -19 th 2003, Pisa Italy) and G. Neumann et. al., J. Virol., 76, pp 406-410.
- bPIV3 N plasmids (4 ⁇ g; marker: kanamycin resistancy), bPIV3 P plasmids (4 ⁇ g; marker: kanamycin resistancy), bPIV3 L plasmids (2 ⁇ g; marker: kanamycin resistancy), cDNA encoding PIV3 antigenomic cDNA (5 ⁇ g; marker: kanamycin resistancy) and pADT7(N)DpT7 encoding T7 RNA polymerase (5 ⁇ g; marker: blasticidin) were introduced into SF Vero cells using electroporation in serum- free medium.
- bPTV3 N, bPIV3 P, and bPIV3 L are in pCITE vectors under the control of the T7 promoter.
- pADT7(N) ⁇ pT7 is in a modified pcDNA6/N5-His C in which the T7 promoter was deleted leaving only the CMV promoter.
- the T7 polymerase is expressed from the CMV promoter.
- Antigenomic bPIV3 is in pUC19 and transcription of the antigenome is under the T7 promoter.
- the pulse for the electroporation was 220V and 950 microfarads. 5.5 X 10 6 SF Vero cells were used per electroporation.
- the electroporated cells were allowed to recover at 33°C in the presence of OptiC (a custom formulation from GD3CO Invitrogen Corporation) overnight. Recovered cells were washed twice with 1 mL of PBS containing calcium and magnesium and overlayed with 2 mL of OptiC. Electroporated cells were further incubated at 33°C for 5-7 days. At the end of the incubation period, cells were scraped into the media and total cell lysate was analyzed for presence of PIN3. Virus recovery was confirmed by immunostaining of plaque assays using RSV or hMPV specific polyclonal antibodies. The titers recovered from electroporated cells are shown in Table 22 and Table 23.
- Table 22 shows the titers of different virases recovered by electroporation into SF Vero cells.
- the virases are different chimeric bovine PIV3.
- the plasmids with the cD ⁇ As encoding the different chimeric bovine PIV3 are PIN3 with the F gene of human RSV at position 2 (MEDI 534), the marker on the plasmid is kanamycin (position 2 is the position between the first and the second open reading frame of the native viral genome, or alternatively, the position of the second gene of the viral genome to be transcribed); bovine PIV3 with a soluble form of the F gene lacking the transmembrane and luminal domains of human RSV at position 2 (MEDI 535), the marker on the plasmid is kanamycin; bovine PIV3 with the F gene of human metapneumovirus at position 2 (MEDI 536), the marker on the plasmid is kanamycin; bovine PIV3 with the F gene of human RSV at
- Viras recovery by electroporation under different conditions is shown in 23 for chimeric viras MEDI 534.
- the Vero cells were grown in the presence of serum for titiation.
- MEDI 534 were electroporated using (i) Opti C, (ii) Opti C containing IX gentamicin, (iii) Opti MEM (opti C containing human transferring) to test the efficiency of viras recovery using different media. Electroporations were done under identical conditions using the same SF Vero cells. The results showed that IX gentamicin is completely inhibitory to viras recovery and human transferrin does not play a role in the efficiency of virus recovery. The presence of bacterial RNA is also inhibitory to virus recovery.
- PO and PI in Table 22 and Table 23 refer to the virases.
- PO indicates virases obtained from electroporated cells.
- PI indicates virases that were amplified once in vero cells grown in the presence of fetal bovine serum. Similar titers are obtained if PO virases were amplified in SF vero cells.
- Virases (Medi 543-537) recovered by electroporation in serum-free Vero (PI 7) and passaged in serum-containing Vero cells.
- PI 7 serum-free Vero
- SF Vero used at Passage 17.
- PO and PI are passages of virases after electroporation and after one amplification in Vero cells respectively.
- SEQ DD NO: 18 F protein sequence for HMPV isolate NL/1/00
- SEQ DD NO:20 F protein sequence for HMPV isolate NL/1/99
- SEQ DD NO:21 F protein sequence for HMPV isolate NL/1/94
- SEQ DD NO: 152 G-protein sequence for isolate NL/29/01 (A2)
- SEQ DD NO: 180 F-gene coding sequence for isolate NL/8/01
- SEQ DD NO: 186 F-gene coding sequence for isolate NL/28/01
- SEQ DD NO:205 F-gene coding sequence for isolate NL/17/00
- SEQ DD NO:206 F-gene coding sequence for isolate NL/22/01
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Pulmonology (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Communicable Diseases (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP04809338A EP1622574A4 (en) | 2003-04-25 | 2004-04-23 | EXPRESSION SYSTEMS OF RECOMBINANT PARAINFLUENZA VIRUSES AND VACCINES COMPRISING HETEROLOGOUS ANTIGENS DERIVED FROM METAPNEUMOVIRUS |
| JP2006513300A JP2006524511A (ja) | 2003-04-25 | 2004-04-23 | メタニューモウイルス由来の異種抗原を含む組換えパラインフルエンザウイルス発現系およびワクチン |
| MXPA05011268A MXPA05011268A (es) | 2003-04-25 | 2004-04-23 | Sistemas de expresion de virus de parainfluenza recombinante y vacunas que comprenden antigenos heterologos derivados del metaneumovirus. |
| AU2004273776A AU2004273776B2 (en) | 2003-04-25 | 2004-04-23 | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
| KR1020057020308A KR101187955B1 (ko) | 2003-04-25 | 2004-04-23 | 메타뉴모바이러스 유래 이종 항원을 포함하는 재조합파라인플루엔자 바이러스 발현 시스템 및 백신 |
| CA002523657A CA2523657A1 (en) | 2003-04-25 | 2004-04-23 | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
| CN2004800178032A CN1813061B (zh) | 2003-04-25 | 2004-04-23 | 重组副流感病毒表达系统以及包含源自间质肺病毒的异种抗原的疫苗 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US46618103P | 2003-04-25 | 2003-04-25 | |
| US60/466,181 | 2003-04-25 | ||
| US49927403P | 2003-08-28 | 2003-08-28 | |
| US60/499,274 | 2003-08-28 | ||
| US55093104P | 2004-03-05 | 2004-03-05 | |
| US60/550,931 | 2004-03-05 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005027825A2 true WO2005027825A2 (en) | 2005-03-31 |
| WO2005027825A3 WO2005027825A3 (en) | 2006-02-09 |
Family
ID=34381928
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2004/012723 Ceased WO2005027825A2 (en) | 2003-04-25 | 2004-04-23 | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US20050142148A1 (https=) |
| EP (1) | EP1622574A4 (https=) |
| JP (2) | JP2006524511A (https=) |
| KR (2) | KR101187955B1 (https=) |
| CN (1) | CN1813061B (https=) |
| AU (1) | AU2004273776B2 (https=) |
| CA (1) | CA2523657A1 (https=) |
| MX (1) | MXPA05011268A (https=) |
| WO (1) | WO2005027825A2 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010149743A3 (en) * | 2009-06-24 | 2011-03-10 | Id Biomedical Corporation Of Quebec | Vaccine |
| EP3054013A4 (en) * | 2013-10-01 | 2016-08-31 | Pontificia Universidad Católica De Chile | IMMUNOGENOUS FORMULATION WITH RECOMBINANT LIVE BCG FOR THE EXPRESSION OF ANTIGENES OF METAPNEUMOVIRUS (HMPV) IN A SUSPENSION MADE FROM A LYOPHILISATE WITHOUT THE NEED FOR A PHARMACEUTICAL USE AGENT |
| WO2018107088A3 (en) * | 2016-12-08 | 2018-07-12 | Modernatx, Inc. | Respiratory virus nucleic acid vaccines |
| EP3636755A1 (en) * | 2012-12-26 | 2020-04-15 | BioComo Inc. | Vaccine prepared utilizing human parainfluenza virus type 2 vector |
| US11351242B1 (en) | 2019-02-12 | 2022-06-07 | Modernatx, Inc. | HMPV/hPIV3 mRNA vaccine composition |
Families Citing this family (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20040002853A (ko) | 2001-01-19 | 2004-01-07 | 비로노바티브 비.브이. | 감응성 포유류에서 호흡계 질환을 유발하는 바이러스 |
| US20040096451A1 (en) * | 2002-07-25 | 2004-05-20 | Young James F. | Methods of treating and preventing RSV, hMPV, and PIV using anti-RSV, anti-hMPV, and anti-PIV antibodies |
| US20030232061A1 (en) * | 2001-10-18 | 2003-12-18 | Fouchier Ronaldus Adrianus Maria | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
| US8715922B2 (en) * | 2001-01-19 | 2014-05-06 | ViroNovative | Virus causing respiratory tract illness in susceptible mammals |
| EP1485468A4 (en) | 2002-02-21 | 2007-01-03 | Medimmune Vaccines Inc | RECOMBINANT PARAIN FLUENZAVIRUS EXPRESSION SYSTEMS AND VACCINES WITH ANTIGENS FROM METAPNEUMOVIRUS STEM-RELATED HETEROLOGISTS |
| CN101410519B (zh) * | 2003-04-25 | 2013-04-24 | 免疫医疗有限责任公司 | 间质肺病毒株及其在疫苗制剂中以及用作抗原性序列表达载体的用途和繁殖病毒的方法 |
| CA2600484A1 (en) * | 2005-03-10 | 2006-09-21 | Medimmune Vaccines, Inc. | Metapneumovirus strains and their use in vaccine formulations and as vectors for expression of antigenic sequences and methods for propagating virus |
| US7759104B2 (en) * | 2005-07-14 | 2010-07-20 | Mayo Foundation For Medical Education And Research | Paramyxoviridae virus preparations |
| US20090017517A1 (en) * | 2007-07-13 | 2009-01-15 | Medimmune, Llc | Preparation of Negative-Stranded RNA Viruses by Electroporation |
| US20090186050A1 (en) * | 2007-11-16 | 2009-07-23 | Fouchier Ron A M | Live attenuated metapneumovirus strains and their use in vaccine formulations and chimeric metapneumovirus strains |
| US11446374B2 (en) | 2008-12-09 | 2022-09-20 | Novavax, Inc. | Modified RSV F proteins and methods of their use |
| PL2370099T3 (pl) | 2008-12-09 | 2016-10-31 | Zmodyfikowane białka F RSV i sposoby ich zastosowania | |
| KR101073991B1 (ko) * | 2009-10-27 | 2011-10-21 | 대한민국 | 국내사육 닭에서 유행하는 신규한 b형 조류메타뉴모바이러스 sc1509주 및 이의 용도 |
| RU2014117068A (ru) * | 2011-09-30 | 2015-11-10 | Новавакс, Инк. | Вакцина на основе рекомбинантных наночастиц f из rsv против респираторно-синцитиального вируса |
| JP6132420B2 (ja) * | 2011-10-25 | 2017-05-24 | 国立大学法人岐阜大学 | 変異狂犬病ウイルス合成・増殖方法、並びに狂犬病ワクチン製剤 |
| GB201119032D0 (en) * | 2011-11-03 | 2011-12-14 | Isis Innovation | Multisomes: encapsulated droplet networks |
| EP2970398B1 (en) | 2013-03-13 | 2024-05-08 | The United States of America, as Represented by The Secretary, Department of Health and Human Services | Prefusion rsv f proteins and their use |
| CN105229021A (zh) * | 2013-03-15 | 2016-01-06 | 加利福尼亚大学董事会 | 在哺乳动物中起抗病毒免疫作用的rna干扰 |
| JP6589159B2 (ja) * | 2014-04-01 | 2019-10-16 | 共立製薬株式会社 | 新規ネコモルビリウイルス株、不活化ワクチン製剤、並びにネコモルビリウイルス感染症予防方法 |
| DK3247388T3 (da) | 2015-01-20 | 2025-12-22 | Us Health | Rekombinant human/bovin parainfluenzavirus 3 (b/hpiv3), der udtrykker et kimærisk rsv/bpiv3 f-protein, og anvendelser deraf |
| CA2996007A1 (en) | 2015-09-03 | 2017-03-09 | Novavax, Inc. | Vaccine compositions having improved stability and immunogenicity |
| EP4011451A1 (en) | 2015-10-22 | 2022-06-15 | ModernaTX, Inc. | Metapneumovirus mrna vaccines |
| WO2017172890A1 (en) | 2016-03-29 | 2017-10-05 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Substitutions-modified prefusion rsv f proteins and their use |
| US11084850B2 (en) | 2016-12-16 | 2021-08-10 | The Pirbright Institute | Recombinant prefusion RSV F proteins and uses thereof |
| US11273214B2 (en) | 2017-05-29 | 2022-03-15 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Recombinant chimeric bovine/human parainfluenza virus 3 expressing RSV G and its use |
| JP7317796B2 (ja) | 2017-07-24 | 2023-07-31 | ノババックス,インコーポレイテッド | 呼吸器疾患を治療するための方法および組成物 |
| CN120227451A (zh) | 2018-03-19 | 2025-07-01 | 诺瓦瓦克斯股份有限公司 | 多价流感纳米颗粒疫苗 |
| TWI708877B (zh) | 2019-10-18 | 2020-11-01 | 福懋興業股份有限公司 | 導電布及其製備方法與應用 |
| CN111961652A (zh) * | 2020-07-09 | 2020-11-20 | 温氏食品集团股份有限公司 | 一种禽偏肺病毒的无血清全悬浮培养方法及其在疫苗中的应用 |
| CN117729935A (zh) | 2021-04-27 | 2024-03-19 | 美国政府(由卫生和人类服务部的部长所代表) | 表达sars-cov-2刺突蛋白的重组嵌合牛/人副流感病毒3及其用途 |
| CN113593639B (zh) * | 2021-08-05 | 2023-08-25 | 湖南大学 | 一种用于病毒基因组变异分析、监测方法和系统 |
| MX2024006506A (es) | 2021-11-30 | 2024-08-14 | Sanofi Pasteur Inc | Vacunas basadas en vectores virales de metapneumovirus humano. |
| KR20250006975A (ko) * | 2022-05-02 | 2025-01-13 | 더 리젠트스 오브 더 유니이버시티 오브 캘리포니아 | 부위 특이적 게놈 변형을 위한 다성분 시스템 |
| WO2026003578A1 (en) * | 2024-06-26 | 2026-01-02 | Popvax Private Limited | Multisubunit rsv, hmpv and hpiv vaccines and therapeutics |
| WO2026003579A1 (en) * | 2024-06-27 | 2026-01-02 | Popvax Private Limited | Multisubunit papillomavirus vaccines and therapeutics |
| WO2026080706A1 (en) | 2024-10-10 | 2026-04-16 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Recombinant chimeric bovine/human parainfluenza virus 3 expressing avian influenza virus proteins and use thereof |
Family Cites Families (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5166057A (en) * | 1989-08-28 | 1992-11-24 | The Mount Sinai School Of Medicine Of The City University Of New York | Recombinant negative strand rna virus expression-systems |
| US5854037A (en) * | 1989-08-28 | 1998-12-29 | The Mount Sinai School Of Medicine Of The City University Of New York | Recombinant negative strand RNA virus expression systems and vaccines |
| US5824307A (en) * | 1991-12-23 | 1998-10-20 | Medimmune, Inc. | Human-murine chimeric antibodies against respiratory syncytial virus |
| US5869036A (en) * | 1995-12-08 | 1999-02-09 | St. Louis University | Live attenuated vaccines based on CP45 HPIV-3 strain and method to ensure attenuation in such vaccine |
| US6180398B1 (en) * | 1996-07-12 | 2001-01-30 | Virogeneitics Corporation | Two-step immunization procedure against the pyramyxoviridae family of viruses using recombinant virus and subunit protein preparation |
| US7192593B2 (en) * | 1997-05-23 | 2007-03-20 | The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Use of recombinant parainfluenza viruses (PIVs) as vectors to protect against infection and disease caused by PIV and other human pathogens |
| US6656719B1 (en) | 1997-10-27 | 2003-12-02 | Merck & Co., Inc. | Serum-free, low-protein media for rotavirus vaccine production |
| US6146642A (en) * | 1998-09-14 | 2000-11-14 | Mount Sinai School Of Medicine, Of The City University Of New York | Recombinant new castle disease virus RNA expression systems and vaccines |
| ES2288473T3 (es) * | 1999-05-18 | 2008-01-16 | Dnavec Research Inc. | Vector de virus deficiente en el gen de la envoltura de paramyxoviridae. |
| CA2378661A1 (en) * | 1999-07-09 | 2001-01-18 | Alexander C. Schmidt | Attenuated human-bovine chimeric parainfluenza virus (piv) vaccines |
| EP1103610A1 (en) * | 1999-11-26 | 2001-05-30 | Introgene B.V. | Production of vaccines from immortalised mammalian cell lines |
| US20030232061A1 (en) * | 2001-10-18 | 2003-12-18 | Fouchier Ronaldus Adrianus Maria | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
| KR20040002853A (ko) * | 2001-01-19 | 2004-01-07 | 비로노바티브 비.브이. | 감응성 포유류에서 호흡계 질환을 유발하는 바이러스 |
| US8715922B2 (en) * | 2001-01-19 | 2014-05-06 | ViroNovative | Virus causing respiratory tract illness in susceptible mammals |
| AU2002364121C1 (en) * | 2001-11-21 | 2010-02-18 | The United States Of America As Represented By The Secretary, Department Of Health And Human Services | Recovery of recombinant human parainfluenza virus type 1 (HPIVI) from cDNA |
| EP1485468A4 (en) * | 2002-02-21 | 2007-01-03 | Medimmune Vaccines Inc | RECOMBINANT PARAIN FLUENZAVIRUS EXPRESSION SYSTEMS AND VACCINES WITH ANTIGENS FROM METAPNEUMOVIRUS STEM-RELATED HETEROLOGISTS |
| US7704491B2 (en) * | 2003-02-28 | 2010-04-27 | The United States Of America As Represented By The Department Of Health And Human Services | Recombinant human metapneumovirus and its use |
| CN101410519B (zh) * | 2003-04-25 | 2013-04-24 | 免疫医疗有限责任公司 | 间质肺病毒株及其在疫苗制剂中以及用作抗原性序列表达载体的用途和繁殖病毒的方法 |
| US20040229219A1 (en) * | 2003-04-30 | 2004-11-18 | Gallaher William R. | Method of inhibiting human metapneumovirus and human coronavirus in the prevention and treatment of severe acute respiratory syndrome (SARS) |
-
2004
- 2004-04-23 EP EP04809338A patent/EP1622574A4/en not_active Withdrawn
- 2004-04-23 MX MXPA05011268A patent/MXPA05011268A/es active IP Right Grant
- 2004-04-23 AU AU2004273776A patent/AU2004273776B2/en not_active Ceased
- 2004-04-23 US US10/831,781 patent/US20050142148A1/en not_active Abandoned
- 2004-04-23 KR KR1020057020308A patent/KR101187955B1/ko not_active Expired - Fee Related
- 2004-04-23 CA CA002523657A patent/CA2523657A1/en not_active Abandoned
- 2004-04-23 KR KR1020117016892A patent/KR20110097971A/ko not_active Abandoned
- 2004-04-23 WO PCT/US2004/012723 patent/WO2005027825A2/en not_active Ceased
- 2004-04-23 CN CN2004800178032A patent/CN1813061B/zh not_active Expired - Fee Related
- 2004-04-23 JP JP2006513300A patent/JP2006524511A/ja active Pending
-
2010
- 2010-10-20 US US12/908,351 patent/US20120045471A1/en not_active Abandoned
-
2011
- 2011-04-06 JP JP2011084567A patent/JP2011167197A/ja not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of EP1622574A4 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010149743A3 (en) * | 2009-06-24 | 2011-03-10 | Id Biomedical Corporation Of Quebec | Vaccine |
| CN102548578A (zh) * | 2009-06-24 | 2012-07-04 | 魁北克益得生物医学公司 | 疫苗 |
| US8889146B2 (en) | 2009-06-24 | 2014-11-18 | Glaxosmithkline Biologicals, Sa | Vaccine |
| EP3636755A1 (en) * | 2012-12-26 | 2020-04-15 | BioComo Inc. | Vaccine prepared utilizing human parainfluenza virus type 2 vector |
| EP3054013A4 (en) * | 2013-10-01 | 2016-08-31 | Pontificia Universidad Católica De Chile | IMMUNOGENOUS FORMULATION WITH RECOMBINANT LIVE BCG FOR THE EXPRESSION OF ANTIGENES OF METAPNEUMOVIRUS (HMPV) IN A SUSPENSION MADE FROM A LYOPHILISATE WITHOUT THE NEED FOR A PHARMACEUTICAL USE AGENT |
| KR101822836B1 (ko) | 2013-10-01 | 2018-01-29 | 폰티피씨아 유니베르시다드 까똘리까 데 칠레 | 약제학적 사용에 적합한, 보조제를 요구하지 않는, 동결건조물로부터 준비된 현탁액 내의 메타뉴모바이러스 (hmpv)의 항원을 발현하는 재조합 생 bcg를 함유하는, 면역원성 제제 |
| RU2665848C2 (ru) * | 2013-10-01 | 2018-09-04 | Понтифисиа Универсидад Католика Дэ Чиле | Иммуногенная лекарственная композиция для медицинского использования, содержащая рекомбинант живой бцж, выделяющий антигены метапневмовируса (hmpv) в суспензию, приготовленную из лиофилизата без добавления адъюванта |
| WO2018107088A3 (en) * | 2016-12-08 | 2018-07-12 | Modernatx, Inc. | Respiratory virus nucleic acid vaccines |
| US11103578B2 (en) | 2016-12-08 | 2021-08-31 | Modernatx, Inc. | Respiratory virus nucleic acid vaccines |
| US11351242B1 (en) | 2019-02-12 | 2022-06-07 | Modernatx, Inc. | HMPV/hPIV3 mRNA vaccine composition |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2004273776B2 (en) | 2010-07-08 |
| KR101187955B1 (ko) | 2012-10-08 |
| KR20110097971A (ko) | 2011-08-31 |
| MXPA05011268A (es) | 2006-06-20 |
| JP2006524511A (ja) | 2006-11-02 |
| US20120045471A1 (en) | 2012-02-23 |
| AU2004273776A1 (en) | 2005-03-31 |
| EP1622574A4 (en) | 2006-10-18 |
| CN1813061B (zh) | 2013-05-29 |
| KR20060022234A (ko) | 2006-03-09 |
| CN1813061A (zh) | 2006-08-02 |
| US20050142148A1 (en) | 2005-06-30 |
| CA2523657A1 (en) | 2005-03-31 |
| JP2011167197A (ja) | 2011-09-01 |
| EP1622574A2 (en) | 2006-02-08 |
| WO2005027825A3 (en) | 2006-02-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2004273776B2 (en) | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus | |
| AU2003219839B2 (en) | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus | |
| US20100297730A1 (en) | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus | |
| AU2004235347B2 (en) | Metapneumovirus strains and their use in vaccine formulations and as vectors for expression of antigenic sequences and methods for propagating virus | |
| AU2008202252B2 (en) | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus | |
| US20090186050A1 (en) | Live attenuated metapneumovirus strains and their use in vaccine formulations and chimeric metapneumovirus strains | |
| HK1158111A (en) | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from other viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GE GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MK MN MW MX MZ NA NI NO NZ PG PH PL PT RO RU SC SD SE SG SK SY TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL TZ UG ZM ZW AM AZ BY KG MD RU TJ TM AT BE BG CH CY DE DK EE ES FI FR GB GR HU IE IT MC NL PL PT RO SE SI SK TR BF CF CG CI CM GA GN GQ GW ML MR SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2005/011268 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2523657 Country of ref document: CA Ref document number: 2006513300 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020057020308 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 171568 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004273776 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004809338 Country of ref document: EP Ref document number: 3130/CHENP/2005 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2004273776 Country of ref document: AU Date of ref document: 20040423 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004273776 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20048178032 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004809338 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020057020308 Country of ref document: KR |