WO2004080378A2 - Methodes et outils pour le criblage d’arn actifs in cellulo - Google Patents
Methodes et outils pour le criblage d’arn actifs in cellulo Download PDFInfo
- Publication number
- WO2004080378A2 WO2004080378A2 PCT/FR2004/000499 FR2004000499W WO2004080378A2 WO 2004080378 A2 WO2004080378 A2 WO 2004080378A2 FR 2004000499 W FR2004000499 W FR 2004000499W WO 2004080378 A2 WO2004080378 A2 WO 2004080378A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rna
- cells
- random
- sequence
- library
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
Definitions
- the present invention relates to methods and compositions for screening and selection of active RNA in cellulo. It relates in particular to methods of preparing and producing banks of AKN expression cassettes or banks of cells encoding random RNAs, as well as their uses for the selection of active RNAs capable of producing or altering a cell phenotype d 'interest.
- the invention also relates to the use of the active RNAs identified for the purpose of discovery of new genes (“drug discovery”), validation of gene function, development of pharmacological tools, diagnosis or for therapeutic purposes with in particular the possibility of correcting, thanks to RNAs, the expression of pathogenic phenotypes in a cell in vitro, ex vivo or in vivo, particularly in human and animal cells.
- the possibility of acting or of specifically interfering with biological targets can have multiple applications, in particular in the therapeutic, diagnostic, vaccine or experimental fields.
- the ability to regulate the expression of a gene can make it possible to block or restore activity in a cell and / or to correct a pathology.
- the ability to block the expression of pathogen genes can stop their development, etc.
- the expression of a gene results from the superposition of several stages including the synthesis of messenger RNA, the intracellular metabolism of this RNA, the production of the protein and finally the stability and activity of this protein. Inhibiting the expression of a gene therefore consists in acting on one of these stages.
- other metabolites, signaling pathways or cellular components can be targeted such as sugars, lipids, nucleosides, etc.
- RNAs appear as powerful tools capable of acting effectively, specifically and in a discriminating manner on most stages of gene expression or on biological targets.
- plasticity structural RNA generates a variety of structural motifs capable of binding with most biological targets, and in particular of organic molecules present in cells (RNA, DNA, proteins and various metabolites such as lipids, sugars, etc.).
- the interactions involved are generally very specific, which gives RNA a high selectivity with respect to its target, and the intracellular accumulation of RNA is neither toxic nor immunogenic.
- RNAs are selective and non-toxic for the organism.
- Different strategies have been envisaged in the prior art for identifying or manufacturing such RNAs. Mention may in particular be made of the SELEX technology, intended for manufacturing and selecting in vitro random structural RNAs (Gold, 1995). Mention may also be made of approaches aimed at expressing banks of antisense RNA or of ribozymes in cells, in order to test their biological activity (WO99 / 41371, WO99 / 32618, WO98 / 32880).
- the present application overcomes the drawbacks of the prior art.
- the present application now provides new methods and new tools for the production, expression and selection in cells, in particular of mammals, of so-called "active" RNA sequences.
- the present invention resides in particular in the development of specific conditions for the preparation and screening of active RNAs, making it possible to select particularly advantageous candidate compounds.
- the invention is based in particular on the use of specific constructions, allowing the RNA sequences to be expressed and localized inside the cell, in an active and stable conformation, and in selected compartments.
- the invention is also based on the design and use of specific expression cassettes ensuring high expression efficiency in mammalian cells and having an inducible character.
- the invention further describes the construction of improved viral vectors, allowing efficient and large-scale selection of active RNAs, and the production of products which can be directly used for therapeutic applications.
- the active RNA motifs are thus selected directly in the cell, using innovative approaches, and in particular according to the approach designated by the name "SECAR" ("Selective Enrichment of Cellular Aptamer RNA").
- a first aspect of the invention therefore relates to methods of selection, identification or optimization in cellulo of active RNA.
- the methods of the invention can be adapted for the selection in cellulo of active RNA capable of conferring on a cell a desired phenotype, including active RNA capable of altering the activity of a determined biological target.
- the methods of the invention more particularly include:
- each species of retrovirus comprising an expression cassette derived from a VA gene of an adenovirus, optionally made inducible, expressing a separate random structural RNA, or part thereof, with a population of cells under conditions allowing the infection of said cells by said recombinant retroviruses,
- VA RNA stable RNA structure
- aptRNA composed of a part common to all the aptRNAs (the VA shuttle) which is used to stabilize, present and transport the active motif in the cell.
- This type of intracellular vehicle for aptamer is innovative and makes it possible to considerably improve the intracellular production of RNA aptamers compared to the techniques of the prior art.
- the direct production and selection, in cells, of active RNA stabilized according to the invention is advantageous because it makes it possible to select molecules already found in an active intracellular conformation.
- steps 1) to 3) can be repeated one or more times from the cassettes or active RNAs identified in step 3), in order to improve, as and measurement of cycles, selection and / or quality of active RNAs, and / or of adapting or modulating their properties.
- the starting nucleic acid bank may be more or less complex and more or less constrained.
- it may be an unconstrained random library, or a library produced from the sequence of a given target gene or comprising imposed motifs or residues, depending on the profile of the active RNA sought.
- RNAs pre-selected in vitro can also be a bank pre-selected in vitro, in particular a bank encoding RNAs pre-selected in vitro, for example a bank produced from the RNA sequence selected in vitro for a particular property (for example their ability to bind to a target of interest).
- the advantage of a method is to select, not an RNA structural motif considered in isolation outside the context of its intracellular expression, but a global molecular entity, aptRNA, having an affinity for a pre-identified target and already in a conformation conforming to that of its intracellular expression.
- step 3) of the last cycle carried out (or possibly of one or more or of any intermediate cycle), an additional step 4) can be implemented, in order to confirm the biological activity of the selected active RNA (s).
- the invention therefore proposes an innovative combination of particular genetic elements, according to a particular selection methodology, thus forming a global, integrated and simplified concept of phenotypic screening.
- the tools and methods described in the present application have numerous advantages.
- the invention shows that expression cassettes derived from an adenovirus VA gene can be integrated and expressed in the context of a retroviral vector.
- Retroviral transfer is very efficient and allows the number of integrated copies per cell to be controlled, and the constructed cassettes, derived from VA genes, form integrated cassettes, that is to say containing all the information necessary for efficient transcription (promoter , Stop signal, structure responsible for the stability of RNA in the cell, structure responsible for the export of RNA to the cytoplasm, various possibilities for the insertion of exogenous sequences and fairly wide tolerance with respect to the promoter).
- the invention further shows that the genetic structure of the constructs can be modified to direct and determine the intracellular localization of the RNA produced (nucleus, cytoplasm) and to make expression inducible in a simple manner.
- retroviral transfer and a cassette derived from a VA gene therefore makes it possible to obtain high and controlled levels of expression in most cell lines and to use identical RNA constructs in vitro and in cellulo. , thus ensuring a more efficient selection of active molecules and faster validation of the identified active cassettes.
- the invention is applicable in many fields, and in particular to validate the function of a gene, to search for new targets involved in a cellular function, to find and produce new molecules for diagnosis, pharmacology or therapeutics, etc.
- a particular object of the invention relates to a library of nucleic acids characterized in that it comprises a plurality of species of recombinant viruses, each species of virus comprising an expression cassette expressing a random RNA (and / or active) distinct under the control of a promoter transcribed by RNA polymerase III, in particular derived from the sequence of a VA gene of adenovirus.
- the RNA may be a random structural RNA or one of defined sequence.
- the viruses are recombinant retroviruses.
- RNA expression cassettes comprising a sequence encoding said RNA inserted into a promoter derived from a VA gene of an adenovirus, said promoter being able to further comprise a sequence conferring a inducibility and / or a modification which makes it possible to retain the RNA in the nucleus.
- the invention also relates to any vector comprising such an expression cassette, as well as recombinant cells containing them.
- the subject of the invention is also any composition comprising an active RNA, a cassette, a vector or a cell as defined above and or identified or produced by the selection process described in the invention.
- the invention also relates to pharmaceutical compositions comprising an active RNA, a cassette, a vector or a cell as defined above, and a pharmaceutically acceptable vehicle or excipient.
- the invention also relates to a pharmaceutical composition characterized in that it comprises an active RNA, said active RNA comprising an active sequence inserted into a
- Modified VA RNA said modified VA RNA comprising an RNA motif ensuring its localization in the cell nucleus and / or a sequence conferring an inducible character.
- the invention also relates to a pharmaceutical composition characterized in that it comprises the active RNA sequence or the active motif identified within the active RNA.
- This active RNA sequence or this isolated RNA active motif can also be subsequently modified chemically, for example so as to improve its stability in solution.
- the invention also relates to tools, constructions, lines, etc., useful for the production of the compositions defined above, in particular modified VA genes, modified tRNA genes, modified U6 cassettes, vectors or cells comprising them, and their uses.
- the invention further relates to methods of producing pharmaceutical compositions, comprising (i) screening a library of random RNAs as described above, making it possible to obtain an expression cassette for an active RNA and (ii ) packaging the cassette or the active RNA sequence in any pharmaceutically acceptable excipient or vehicle.
- the invention is useful for the identification, production, expression and / or selection of any RNA active on cells, in particular of mammals. It allows the preparation of compounds active in different situations, in particular for the production of therapeutic agents, in particular anti-infectives, anti-cancer, acting on the metabolism of the cell, acting on the differentiation processes of the cell, on the growth capacity of the cell, etc. As indicated above, the invention offers numerous advantages compared to the prior art, and in particular allows the direct, rapid and simple selection of active RNA molecules in cells.
- FIG. 1 describes the VA1 gene of the adenovirus type 2 as well as its transcript.
- FIG. 1A represents the nucleotide sequences of the VA1 -RNA gene (transcribed region) (SEQ ID NO: 1).
- the underlined nucleotides 93 to 118, corresponding to the sequence of loop IV, are deleted in the construction VA ⁇ IV (SEQ ID NO: 2).
- FIG. 1B represents the secondary structure of the VA1 RNA of PAdenovirus type 2, obtained according to the Mac DNASIS Pro V3.6 software. The deleted part in the RNA
- VA ⁇ TV is indicated by two arrows (nucleotides 93 to 118). Nucleotide 120 is mutated in the VA ⁇ IV construct (C is mutated to T).
- FIG. 2 represents the comparative study of the production and of the cellular localization of the RNA VAl, VA ⁇ IVSrf and VATAR *.
- FIG. 2A TAR * sequence (SEQ ID NO: 23) inserted into the Srfl restriction site of the VA ⁇ IVSrf gene to generate the VATAR * gene.
- the TAR * oligonucleotide is derived from the TAR sequence of the Human Immunodeficiency Virus (HTV-1) (Yamamoto et al., 2000).
- Figure 2B Analysis of the expression of RNA VAl, VA ⁇ IVSrf and VATAR * by Northern Blot. The different RNAs are extracted from cells 293, 48 hours after transfection of these cells with plasmids containing the VAl, VA ⁇ IVSrf and VATAR * ' genes.
- Figure 2C Study of the cellular localization of the RNAs VAl, VA ⁇ IVSrf and VATAR * in human cells 293.
- the RNAs are visualized by in situ hybridization, 48 hours after transfection of these cells with plasmids containing the genes VAl, VA ⁇ IVSrf and VATAR *.
- FIG. 3 represents the promoter of the human U6 snRNA gene (Genebank access: X07425).
- the elements required for the recruitment and activity of RNA polymerase. type III are the DSE (Distal Element Sequence: nucleotides -221 to -216), the PSE (Proximal Element Sequence: nucleotides -64 to -46) and the TATA box (TATA Box: nucleotides -31 to -24).
- TATA Box nucleotides -31 to -24.
- GTCGAC Sal I restriction site
- G the first nucleotide transcribed being the first nucleotide of this site
- FIG. 4 represents the secondary structure of the VA ⁇ IV RNA obtained with the Mac DNASIS Pro V3.6 software.
- FIG. 5 represents the secondary structure of the VA ⁇ IVSrf RNA obtained with the Mac DNASIS Pro V3.6 software.
- FIG. 6 describes the characteristics of the nVA ⁇ IVSrf RNA (nuclear localization).
- Figure 6A Sequence of the gene encoding the RNA . nVA ⁇ IVSrf (SEQ ID NO: 4).
- the nucleotides noted in bold, from 13 to 24 and from 59 to 68, representing respectively box A and box B, are the elements necessary for the transcription of the VA1 gene by RNA polymerase type III.
- Nucleotides 138 to 141 (TTTT), noted in bold, represent the signal to stop transcription of polymerase III.
- the restriction site Srf I (93 to 100) appears underlined.
- Nucleotides 120, 121 and 122 written in lowercase represent the mutations introduced into the VA ⁇ IVSrf RNA to alter the terminal helix and give this RNA a nuclear localization.
- Figure 6B Diagram of the secondary structure of the nVA ⁇ IVSrf RNA obtained with the DNASIS Pro V3.6 software.
- Figure 6C Study of the cellular localization of nVA ⁇ IVSrf RNAs.
- the RNAs are visualized by in situ hybridization, 48 hours after transfection of the 293 cells with a plasmid containing the VA ⁇ IVSrf gene.
- FIG. 7 shows the different inducible VA genes (VAi): their sequences, the sequences of the different DNA oligonucleotides which were used for their construction as well as the study of their level of cellular expression. .
- Figure 7A Sequences of the VAiO (SEQ ID NO: 15), OVAi (SEQ ID NO: 16) and OVAiO (SEQ ID NO: 17) genes. The sequences are numbered from point +1 of transcription; the sequences located upstream are numbered negatively. The sequences of Boxes A and B, as well as the transcription stop signal, are noted in bold. The operating sequence TetOl is underlined; the Srfl cloning site is noted in italics.
- Figure 7B Sequences of the oligonucleotides used to construct the VAi genes by primer extension reaction or by polymerization chain reaction.
- the sequences of Boxes A and B as well as the transcription stop signal are noted in bold.
- the TetOl operating sequences are underlined; the Srfl and PvuII cloning sites are noted in italics.
- the complementary regions between the oligonucleotides VAi up (SEQ ID NO: 18) and VAi down (SEQ ID NO: 19) appear in lowercase letters.
- VAi PvuII (VAi PvuII 5 '(SEQ ID NO: 20), VAi PvuII 3' (SEQ ID NO: 22) or OVAi PvuII 5 '(SEQ ID NO: 21)) with the coding regions VAi genes are also shown in lower case.
- FIG 7C Analysis of the expression of VAi RNA in Hela T-Rex cells after induction by doxycycline (Dox).
- the different VAi genes OVAi, VaiO and OVAiO
- the cells of the packaging line 293GP were used for the production of the BabeVAi recombinant retroviruses.
- the Hela T-Rex cells Invitrogen ref: R714-07 which express the TetR repressor were transduced by the various recombinant retroviruses babeVAi.
- VAi genes were activated by the addition of Doxycycline (Dox: 1.5 ⁇ g / ml).
- Dox 1.5 ⁇ g / ml
- the RNAs were extracted at the times indicated and the expression of the VAi RNAs was analyzed by Northern blot.
- Figure 8 shows the secondary structure of the VAiO RNA obtained with the DNASIS Pro V3.6 Mac software. The region corresponding to the tetOl sequence is limited by arrows.
- FIG. 9 represents the secondary structure of the h9U6, h20U6 and nh20U6 RNAs obtained with the Mac program DNASIS Pro V3.6.
- the . RNA schematized in this figure represent the invariant basic structures of these RNA (shuttle part).
- the active RNA motif is cloned into the Sfr I site indicated by an arrow.
- FIG. 10 represents the retroviral vector pBabe (Morgenstern and Land,. 1990).
- the Nhe I site corresponds to the cloning site of the various expression cassettes of the active RNAs.
- Figure 11 shows the relationship that may exist between the level of expression of an active RNA and its biological activity.
- the active RNA used here is the TAR * aptamer described in FIG. 2B.
- This TAR * motif corresponds to an RNA motif capable of repressing the replication of the human immunodeficiency virus (HIV).
- This TAR * motif was cloned into the Sfr I site of the VA ⁇ IVSfr cassette.
- the VATAR * construct was inserted into the Nhel cloning site of the pBabe retroviral vector (see FIG. 10).
- the cells of the 293 GP packaging line were used for the production of the Babe and Babe / VATAR * recombinant retroviruses.
- the anti-HIV efficacy of VATAR * was measured using the P4 indicator cells which constitute a system commonly used to study the multiplication of HIV (Chameau et al., 1994).
- the P4 cells were transduced by the Babe and Babe / VATAR * retroviruses and selected by the addition of puromycin.
- the level of expression of VATAR * RNA was analyzed by Northern-blot within the selected P4 cell population (parental population), as well as in 2 independent cell clones (clones 1 and 4) isolated from this population.
- the infection of these different cellular systems by HIV-1 demonstrates that clone 1 expressing a high level of VATAR * RNA more effectively resists the multiplication of HIV.
- the HIV-1 infection rate is estimated by measuring the activity of the reporter gene ⁇ -galactosidase contained in the P4 cells and the results are presented as a percentage of the maximum infection.
- Figure 12 depicts an application of the method for selecting active RNA from a library of random RNA expression cassettes cloned into the retroviral vector pBabe.
- FIG 12A The different stages of synthesis of the library of random sequences.
- the library of single-stranded DNA oligonucleoties comprises from 5 'to 3': 8 fixed bases highlighted (run A), 26 random bases then 8 fixed bases highlighted (run B).
- the run A oligonucleotide, complementary to Run B, is hybridized with the library of single-stranded DNA oligonucleotides and extended thanks to Kleenow's DNA polymerase fragment. This neosynthesized double-stranded DNA is called a random double-stranded DNA library.
- Figure 12 B Random Babe VA vector library.
- the library of random Babe VA recombinant retroviral vectors is generated by cloning the library of random double-stranded DNA into the Srf I site of the VA ⁇ IV Srf gene.
- This library therefore consists of a collection of VA ⁇ IV Srf RNA expression cassettes, each containing a random motif and cloned into the retroviral vector pBabe.
- Figure 12 C Method for selecting clones of Hela cells resistant to staurosporine.
- the random Babe VA vector library is transfected into packaging cells of the 293GP line to produce the random VA retrovirus library.
- This retroviral library is used to transduce the library of random cassettes in the cells of the Hela line so that each transduced cell contains on average a single random VA cassette.
- cell papoptosis is induced by adding staurosporine (0.8 ⁇ M - 6 h).
- Staurosporin-resistant cells are amplified as cell clones and cassettes of expression of the active RNAs present in each of the clones are analyzed. At this stage,
- Figure 12D Validation of the anti-apoptotic activity of the RNAs identified using the SECAR selection process.
- the selected active RNA expression cassettes (in Figure 12C) were cloned into the plasmid pBabe. These recombinant plasmids were used to produce recombinant retroviruses by transfection of the cells of the packaging line 293GP.
- Two different cell lines (Hela and Jurkat) were independently transduced with the different retroviral supernatants (clone 2, 5, 9, 11, 13, 14, 15 16, C, J, L, and N) and selected by puromycin.
- the total cellular RNAs from these different populations of transduced cells were extracted and then analyzed by Northern blot.
- Figure 12 E Individual validation of the anti-apoptotic activity of the RNAs identified using the SECAR process.
- the populations of Hela and Jurkat cells expressing the active RNAs selected in FIG. 12C were subjected to tests for resistance to staurosporine (0.8 ⁇ M for 6 hours).
- Hela cells The results presented in the histogram reflect the number of cells resistant to staurosporine (Arbitrary unit).
- Jurkat cells The results presented in the histogram correspond to the percentage of cells resistant to staurosporine (Measurement of mitochondrial membrane permeability).
- Figure 13 illustrates the process of the invention with a constrained library pre-selected in vitro (iv SECAR). Use of inducible expression cassettes.
- Figure 13 A Construction of a library of random VAiO transcription cassettes.
- Step 1 the Sens bank and Antisens iv bank oligonucleotides are hybridized and then extended by DNA polymerase Kleenow fragment to generate the library of random VAiO fragment.
- Step 2 the library of random VAiO expression cassettes is obtained by chain polymerization reaction thanks to the use of a Taq DNA polymerase using for matrix the library of random VAiO fragment and sense oligonucleotides VAi5 'and antisense VAi end Bank.
- Step 3 the library of random T7 VAiO transcription cassettes is obtained by chain polymerization reaction thanks to the use of a Taq DNA polymerase using the library of random VAiO transcription cassettes and the oligonucleotides VApT7 in 5 ′ and VA end in 3 '.
- the RNAs are synthesized in vitro using the DNA polymerase of bacteriophage T7, then are visualized on agarose gel after staining with Ethidium Bromide (200 ng per lane).
- FIG. 13C Obtaining transcription cassettes derived from the VA gene from RNAs synthesized in vitro.
- An RT-PCR reaction is carried out using different RNA substrates synthesized in vitro using the oligonucleotides VapT7 and VA end.
- the transcription cassettes corresponding to the various VA RNAs were obtained: VA ⁇ IV Srf expression cassette obtained from the VA ⁇ IV Srf RNAs; VATAR * expression cassette obtained from VATAR * RNAs; random VAiO expression cassette obtained from random VAiO RNAs.
- VA ⁇ IV Srf, VATAR * and VAiO random allows an equimolecular mixture of the corresponding cassettes to be obtained.
- the RT-PCR reaction products are visualized on 2% agarose gel after staining with Ethidium Bromide.
- Figure 14 provides an example of U6 / VA hybrid gene construction.
- the first step consisted in introducing the promoter of the murine U6 gene into the Nhel site of the plasmid pBabe.
- the murine U6 gene promoter (mU6) was obtained by chain polymerization reaction using the primers mU6 upstream and mU6 downstream.
- the primer mU6 downstream four bases have been added (in italics, bold and underlined). The addition of these bases made it possible to generate the Pmel site indicated in the pBabe mU6 / VAiO construction.
- the four underlined AAAC bases correspond to the last four bases of the U6 promoter and to the first four bases of the restriction site Pme I (GTTTAAAC).
- the matrix used corresponds to the genomic DNA of murine cells.
- the product of this polymerase chain reaction was purified, then ligated into the plasmid pBabe digested with Nhe I.
- the ligation product is called pBabe mU6.
- the second step consisted in inserting the VAiO gene into the Pmel site of the plasmid pBabe mU6.
- the VAiO gene was produced by a polymerase chain reaction using the primers VAiO Start and VAiO End Nhel, the template being the plasmid pBabe VAiO.
- the VAiO End Nhel primer contains the Nhel restriction site marked in bold and underlined.
- the product of this reaction was purified and then ligated into the plasmid pBabe mU6 digested with Pmel.
- the ligation product is called pBabe mU6 / VAiO.
- FIG. 15 provides a general description of the active RNA screening strategies according to the invention.
- Panel A Process for the selection of inducible active RNA (SECAR) expression cassettes: This process allows the selection in cellulo of RNA capable of conferring on a cell a given phenotype.
- the phenotypic screening presented in this panel is carried out through the use of inducible expression cassettes; it is carried out in six stages.
- Step 1 The library of random RNA expression cassettes is transferred to the cells of interest, via a retroviral vector. The transfer is thus optimized: it is suitable for all cell types and allows you to control the number of cassettes inserted per cell.
- Step 2 The cells that have integrated the new genetic material (random RNA expression cassette) are selected using a selection gene present in the retroviral vector.
- Step 3 Thanks to the use of inducible expression cassettes, the expression of the cassettes is induced in order to activate the transcription of the random RNAs.
- Step 4 The selection of cells which express the active RNAs and which have the phenotype of interest is carried out. These cells are amplified.
- Step 5 (optional): The active RNA expression cassettes present in the cells selected in this step can be copied and transferred again to the cells of interest. Thus steps 1 to 4 can be repeated as many times as necessary.
- Step 6 In the cell clones obtained at the end of step 4 or 5, the activity of the cassettes is validated by comparison of the induced or repressed states.
- RNA was validated as an 5 active RNA when the desired cell phenotype is observed only in the condition for which the expression cassette is induced. On the contrary, RNA is not validated as active RNA when the desired cell phenotype is observed regardless of the conditions: induced expression cassette or repressed expression cassette.
- Panel B Method for selecting active RNA expression cassettes after prior enrichment in active sequences (ivSECAR for "in vitro Selective Enrichment of Cellular Aptamer RNA”)
- This method allows the selection in cellulo of RNA capable of conferring on a cell a given phenotype.
- the screening is carried out using a library of random RNAs, enriched in RNA capable of binding a given target.
- the first stages of screening are carried out in vitro, using a random RNA bank; the RNAs used for in vitro screening have a structure identical to those which will be expressed in cellulo in the subsequent steps.
- Step 1 From a library of random RNA transcription cassettes, the random RNA library is produced in vitro.
- RNAs thus synthesized in vitro have the same structural properties as the RNAs which are synthesized in cellulo, from a library of random RNA expression cassettes.
- Step 2 The random RNA bank is contacted with the target of interest.
- Step 3 The RNA capable of binding the target are retained using an appropriate process.
- Step 4 The RNAs retained at the end of step 3 are used to produce a new library of random RNA transcription cassettes, enriched with active sequences. Steps 1 to 4 are thus repeated at will. At the end of step 4, a “restricted” library of active RNA expression cassettes is obtained. Step 5: This restricted library is subsequently used in cellular tests according to the SECAR method described in panel A. Detailed Description of the Invention
- the invention relates, in general, to tools and methods for in cellulo selection of active RNA capable of conferring on a cell a desired phenotype, as well as the use of these active RNA or of any DNA coding in the experimental field or pharmaceutical, for example.
- the invention uses, in a particularly advantageous manner, the combination of retroviral vectors and cassettes derived from VA genes, allowing a simple, effective and predictive screening, in vitro as in vivo.
- the present invention is suitable for the production, expression and / or selection of any active RNA molecule, that is to say RNA molecules capable of interacting with and / or altering the activity of biological components, and / or of conferring on a cell a given phenotype.
- active RNA includes in particular structural RNA (such as aptamers) and non-structural RNA, such as antisense, ribozymes or interfering RNA (siRNA, miRNA or their precursors).
- the active RNAs can be of variable length, typically between 8 and 500 bases, more preferably between 8 and 200, in particular between 8 and 150.
- the active RNAs are generally synthesized in the form of single-stranded molecules, even if they can subsequently adopt three-dimensional loop-type structures, double-strand regions, helices, etc.
- the active RNA is a structural RNA, in particular an aptamer (Famulok and Verma, 2002) (Hermann and Patel, 2000). Aptamers are oligonucleotides capable of specifically binding a target molecule.
- the active RNA is an interfering RNA (siRNA, mi RNA or their precursors) (McManus and Sharp, 2002) (Scherr et al., 2003) (Famulok and Verma, 2002) or an antisense RNA.
- the present application is in fact particularly suited to the design and screening of RNA whose activity requires a particular spatial configuration.
- the methods described in the present application make it possible to select active RNAs from collections or banks of random sequences, general or restricted, which may comprise a very large number of distinct random sequences.
- the random sequences can be any DNA or RNA molecule comprising at least one element of sequence which is not known, more precisely of which at least part of the sequence is random.
- the selection of the active RNAs according to the invention is carried out in cellulo, by means of the insertion of the random sequences in expression cassettes and under specific conditions.
- One of the main advantages of selection in cellulo is that the target of the active RNA is not necessarily chosen a priori; moreover the active RNA selected is really effective under the conditions of cellular use.
- a characteristic of the invention resides in the use of specific expression cassettes, allowing the production in cellulo of active RNA, in optimal configurations.
- constructs, compositions and methods of the invention use a promoter derived from the sequence of a VA gene from adenovirus.
- VA1 gene for expressing in the cell ribozymes, aptamers or antisense, including the sequence was perfectly defined (Medina and Joshi, 1999) (Barcellini et al., 1998) (Bertrand et al., 1999) (Cagnon et al., 1995) (Gwizdek et al., 2001).
- the present application demonstrates for the first time the possibility and the efficiency of using this type of construction for the production and screening of random RNA banks (or constrained banks) in cellulo, in particular in a retroviral context. It also describes various modifications in the VA gene in order to generate improved cassettes conferring better control of the expression parameters.
- the sequences encoding the active RNAs can thus be cloned in the cassette, mainly in the central domain of the gene. The positioning of the active sequence within the central domain does not modify the level of production, and the location of the chimeric RNA in the cell (FIG. 2).
- the use of such a promoter is particularly advantageous for the expression of structural active RNA, in particular aptamers.
- the adenovirus genome contains two small genes that are transcribed by RNA polymerase III, the VA1 and VA2 genes (Mathews and Shenk, 1991).
- VAl RNA and to a lesser extent VA2 RNA, are abundantly produced during the replication cycle of the adenovirus.
- PLR or p68 kinase a cellular kinase
- the adenovirus VAl gene codes for a short RNA (VAnt 160nt RNA) characterized by a secondary structure rich in a double-stranded region.
- VAnt 160nt RNA a short RNA
- the genetic organization of this gene transcribed by RNA polymerase III is simple and includes a short promoter region in the intragenic position (box A and box B) and a transcription stop signal (see FIG. 1A).
- the secondary structure of VAl RNA is well known ( Figure 1B).
- the sequence of the VA1 gene of the adenovirus type 2 is represented in FIG. 1A (SEQ ID NO: 1).
- the sequence of the corresponding coded RNA is given below.
- Boxes A and B correspond to nucleotides 11-24 and 59-68 in bold, respectively, and the central domain containing loop IV corresponds to nucleotides 93 to 118.
- the cassette comprises the sequence of a VA1 adenovirus gene deleted from all or a functional part of the IV loop, in which the sequence encoding the active RNA is inserted.
- the central domain containing loop IV corresponds to nucleotides 93 to 118 of the VA gene.
- SEQ ID NO: 2 (VA ⁇ IV): 1- GGGCACUCUU CCGUGGUCUG GUGGAUAAAU UCGCAAGGGU
- the sequence SEQ ID NO: 2 (VA ⁇ IV) is derived from VAl Ad2 by deletion of the central domain from 93 to 118.
- the nucleotide 94 120 in VAl has been mutated so as to create an EcoRV cloning site (in italics underlined) .
- the EcoRV cut-off site is between 92 and 93.
- the sequence SEQ ID NO: 3 (VA ⁇ IVSrf). above, is derived from VA ⁇ IV after insertion of the sequence of the Srfl site into the EcoRV site (in italics underlined).
- the Srfl cutoff site is located between 96 and 97.
- the term double helix of the VA1 gene is altered. This alteration makes it possible to control the cellular localization of the synthesized RNA (Gwizdek et al., 2001).
- the RNA synthesized is naturally found essentially in the cytoplasm. This location is suitable for screening for active RNAs on biological targets present essentially in this cell compartment.
- the synthesized RNA is essentially located in the nucleus. This location is suitable for screening for RNAs active on essentially nuclear biological targets.
- the terminal helix is formed essentially by the pairing between the first 20 and the last 20 nucleotides of the RNA sequence encoded by the VA1 gene.
- the alteration of the helix can be obtained by various modifications introduced within these sequence elements, in particular by mutation, deletion and / or insertion, preferably by mutation.
- the helix sequence is less than about 15 bases, the helix is functionally altered and the VA1 RNA is retained in the nucleus.
- the double helix is mutated so as to introduce a succession of unpaired nucleotides which form an opening within the helix (bubble), the latter is functionally altered and the RNA is retained in the nucleus.
- RNA transcribed by an expression cassette according to the invention comprising the sequence of a VA gene deleted from loop IV and an altered terminal double helix is provided below (SEQ ID NO: 4):
- the sequence SEQ ID NO: 4 (nVA ⁇ IVSrf) is derived from VA ⁇ lVSrf by mutation of nucleotides 120 to 122 (lowercase) and deletion of nucleotide 136..
- the VA1 gene comprises a sequence conferring an inducible character.
- active RNA antisense, ribozyme, aptamer, siRNA, miRNA and their precursors
- the control of its expression is a determining element.
- the present invention shows, for the first time, that the structure of the VA1 genes can be modified so as to make their expression inducible, while also retaining the characteristics described above (high level of expression, localization control , possibility of insertion of active sequences in the central domain).
- an inducible VA gene can be constructed by inserting one or more sequences conferring an inducible character, typically between the boxes A and B of the gene and / or upstream of the gene, preferably as a replacement of all or part of the sequences normally present.
- this new sequence is found in a region of the VAl RNA which is transcribed, and therefore causes alterations in the native secondary structure of the VAl RNA capable of make it less stable.
- compensatory mutations can be introduced within the VAl sequence, so as to correct these structural defects and thus recreate the natural pairings of the VAl RNA.
- the invention therefore relates to a nucleic acid comprising the sequence of a VA gene from an adenovirus, modified by insertion of one or more sequences conferring an inducible character, preferably between boxes A and B and / or upstream of the gene, more preferably in replacement of all or part of the native sequences.
- the sequence conferring an inducible character can be any sequence conferring sensitivity to a factor acting in trans. It may preferably be a site for binding a transcriptional factor or a repressor, or any other agent or molecule. In a preferred embodiment, it is one or more operating sequences of a regulated bacterial promoter, for example the tefracycline promoter.
- the promoter of the bacterial tet genes contains two types of operator sequences O1 and O2 which serve as a binding site for the TetR repressor (Hillen and Berens, 1994). Each of the tetOl and tetO2 sites binds a TetR homodimer. Studies have shown that the tetO2 binding site has a three to five times greater affinity for the TetR phomodimer than tetOl (Hillen and Berens, 1994).
- the tetO1 operator sequences have thus been inserted into eukaryotic heterologous promoter sequences in order to obtain a eukaryotic expression system regulable by tefracycline (Gossen and Bujard, 1992). However, such a modification or application has never been envisaged from the VA1 gene of the adenoviruses, the manipulation of which is particularly delicate taking into account the presence of the promoter in the transcribed sequences.
- the invention therefore relates to a nucleic acid comprising the sequence of the VA1 gene of an adenovirus, modified by insertion of one or more sequences operators serving as a fixation site for the TetR repressor.
- the operator sequence (s) are inserted between boxes A and B of the VA gene sequence and / or placed upstream of the gene, more preferably as a replacement for all or part of the native sequences.
- the invention also relates to any expression cassette comprising a sequence coding for an active RNA inserted under the control of an inducible VA promoter (VAi) in particular by tefracycline.
- VAi inducible VA promoter
- the sequence of specific examples of inducible VA genes constructed according to the invention is represented in the sequences SEQ ID NO: 15 (VaiO), SEQ ID NO: 16 (OVAi) and SEQ ID NO: 17 (OVAiO).
- cassettes derived from the VA gene sequence and allowing the expression of random or active RNA are described in the examples, which represent particular objects of the invention. We can thus cite the cassettes VA ⁇ IVSrf, nVA ⁇ IVSrf, VAi and nVAi.
- the expression cassettes of the invention comprise, in addition to the promoter derived from the VA gene of an adenovirus, a second transcriptional promoter, different from the VA promoter.
- a second transcriptional promoter different from the VA promoter.
- the active RNA configured in the VA sequence can be expressed under the control of a second promoter, which can be of various nature and origin.
- the second promoter is a promoter transcribed by RNA polymerase type III, and which is functional in the cell type concerned, in particular an extra-gene promoter.
- the expression cassette derived from the VA gene is cloned (VA ⁇ IV, VA ⁇ IV Srf, nVA ⁇ IV, VAi or any other cassette derived from the VA gene).
- the promoter of the U6 gene is chosen as the second promoter allowing active transcription of the VA gene thus cloned.
- a particular object of the invention thus resides in a hybrid expression cassette comprising an expression cassette derived from a VA gene from an adenovirus, optionally made inducible, expressing an active RNA (aptamer, antisense, ribozyme, RNA interfere: If RNA, miRNA or their precursors), placed downstream of a second transcriptional promoter.
- an active RNA aptamer, antisense, ribozyme, RNA interfere: If RNA, miRNA or their precursors
- RNA Polymerase III for the expression of active RNAs. It can be a promoter located inside the transcribed sequences (intragenic), such as the promoter of the tRNA genes. U can also be a promoter located upstream of the transcribed sequences (extragenic), such as the promoters of the U6 type encoding the small nuclear RNA U6 (snRNAU6). In addition, the promoter used can be made inducible.
- hU6 human U6 gene
- snU6 RNA small nuclear RNA
- ribonucleoprotein complex responsible for splicing RNA
- the main advantage of this is that it imposes few sequence constraints on the transcribed region of the cassette (Bertrand et al., 1997). Indeed, the second transcribed nucleotide corresponds to the first nucleotide provided by the exogenous sequence and the last nucleotides correspond to the stop signal ( Figure 3).
- RNA antisense, ribozymes, aptamers, interfering RNA: siRNA, miRNA and their precursors
- RNAs generated as well as their cellular localization various expression cassettes using a U6 promoter have been constructed by the inventors. These cassettes allow the expression of cytoplasmic or nuclear RNA, structural or non-structural, constrained or unconstrained. Modifications have thus been made to the U6 promoter, in order to facilitate the cloning of active sequences, control the transcribed sequences from point +1 of transcription, stabilize the active sequences and control the intracellular localization of these sequences.
- a sequence serving as a structural base for the active RNA is placed downstream of the U6 promoter.
- This structuring sequence more preferably contains a sequence capable of generating a (short) RNA helix (more or less stable and more or less long), and / or a straight edge cloning site and / or a transcription stop signal (for example TTTTT).
- the sequence allowing the formation of an RNA helix typically comprises two complementary regions spaced apart by a hinge region. This type of cassette is especially useful for the intracellular expression of structural RNA motifs.
- the structuring sequence preferably comprises a short shuttle motif (typically from 5 to 12 bases).
- the structuring sequence preferably comprises a long shuttle motif, typically comprising from 12 to 20 bases.
- This motif can be structured to form a perfect helix ensuring the RNA produced a cytoplasmic localization or else be structured to form a disturbed helix in order to obtain a nuclear localization of the generated RNA.
- a sequence forming a short hairpin structure is placed downstream of the U6 promoter (and, where appropriate, of the structuring sequence). This sequence forms a stable RNA structure placed at the 3 'end of the synthesized active or random RNA, thus protecting the RNA produced from degradation by RNAses. Downstream of this stabilization structure is the polymerase III transcription stop signal: TTTTT.
- the cassette comprises the U6 promoter to which the sequence encoding the active RNA is directly linked.
- a cassette makes it possible to express RNAs whose sequence is chosen from point +1 of transcription.
- the cassette comprises a U6 promoter as defined above and one or more sequences conferring an inducible character, as described previously.
- the sequence or sequences conferring the inducible character can be placed for example upstream of the promoter sequence.
- the promoter transcribed by RNA polymerase III is derived from a promoter of the tRNA genes.
- these promoters can be modified to give them an inducible character.
- the expression cassettes according to the invention are typically cloned or included in vectors, for cloning and / or for expression.
- vectors can be of varied nature and / or origin, such as plasmids, recombinant viruses, viral vectors, episomes, artificial chromosomes, phages, etc.
- the vectors are of the plasmid, viral or episomal type.
- a particular object of the invention resides in a vector comprising at least one expression cassette as defined above.
- the vector When the vector is of the plasmid type, it can come from different known or commercial plasmids. It typically includes an origin of replication compatible with the desired use. It may further comprise a selection gene and, optionally, an integration sequence in the chromosome.
- plasmids which can be used for the production of vectors of the invention are in particular the plasmids pUC, pcDNA, pW2, plasmids with episomal replication derived from the Epstein-Bar virus of the OriP type.
- the vector is of the viral type. It can be a recombinant virus, that is to say a recombinant viral particle comprising a genome recombinant viral in which at least one cassette as defined above is inserted. It can also be a viral vector, that is to say a genetic construction comprising a recombinant viral genome into which is inserted at least one cassette as defined above.
- the vector is a retroviral vector or a recombinant retrovirus.
- the present application indeed shows that the transfer of a cassette of the invention into target cells is very effective after cloning of this cassette into a retroviral vector.
- the present application notably shows unexpectedly that the cassettes derived from the VA1 genes can be efficiently transduced in the target cells, in a retroviral context.
- the level of expression of the chimeric RNA is high and the properties of the cassette are preserved.
- Viruses have been used to vectorize nucleic acids in vitro or in vivo. Different approaches have been described for the production of recombinant viruses, typically leading to the production of viruses defective for replication, comprising an exogenous nucleic acid segment encoding a desired product. Such viruses have been constructed from retroviruses (MLV, lentiviruses, etc.), adenoviruses (Ad5, Ad2, CAV, etc.), AAV, herpes virus, etc. In each of these approaches, a viral vector is constructed comprising the sequences necessary in cis for the packaging of a nucleic acid in a viral particle and, optionally, complementary regulatory or coding sequences.
- refroviruses In the case of refroviruses, numerous constructions have been described, in which all or part of the gag, pol and / or env genes are deleted, and in which a nucleic acid of interest is introduced. The latter can be inserted as a replacement for deleted sequences, or in other regions, such as for example in an LTR.
- Viral vectors known to those skilled in the art include MFG, pBABE, etc.
- a retroviral vector of the invention therefore comprises the LTR terminal regions, the packaging sequence, a selection gene and the nucleic acid encoding the active RNA, according to the invention.
- Such a vector viral can be constructed from different types of retroviruses, and used to produce recombinant viruses by introduction into an packaging line expressing the viral proteins GAG, POL and ENV.
- packaging line expressing the viral proteins GAG, POL and ENV.
- Such lines have been described in the previous part (PsiCRIP, PA317, Gpenv, 293GP etc.).
- a particular object of the invention resides in a retroviral vector defective for replication, comprising an LTR sequence, a retroviral packaging sequence and at least one expression cassette as defined above.
- the vectors of the invention may comprise one or more RNA expression cassettes, identical or different.
- multi-cassette vectors can be constructed, into which cassettes can be inserted, for example in tandem.
- the possibility of cloning several cassettes in the same vector can relate to a single active RNA sequence, or to several different active RNA sequences.
- the same cassette is copied several times before being inserted into the vector; in the second case, the different cassettes are placed one next to the other and inserted into the vector, or cloned sequentially, at sites distinct from the vector.
- the vectors can be constructed by known techniques of molecular biology, in particular by cloning, ligation, amplification, etc.
- the combined use of a retroviral vector and sequences derived from the VA gene of an adenovirus makes it possible to provide an integrated system, simple and predictive of the activity of Random RNAs, both in vitro and in vivo.
- compositions comprising a vector as defined above.
- the composition can be a pharmaceutical composition, as will be described in more detail below.
- Another subject of the invention relates to a composition comprising a plurality of vectors as defined above.
- the composition can be a bank, as will be described in more detail later in the text.
- the term bank designates a complex product or composition comprising a plurality or a multitude of components or members, which may be present in mixture (s) or in separate compartments.
- the libraries according to the invention typically comprise a plurality of active RNAs, or cassettes encoding such active RNAs, which can be cloned into vectors, in particular plasmids, viral vectors, viruses, and / or into cells.
- all the cassettes and / or vectors of the same bank have substantially the same structure, these components differing from one another by nature (eg, length, origin, type, etc.) and / or the structure (eg, sequence) of the coded active RNAs.
- a bank generally includes several copies of each component or member.
- the complexity of the bank can vary to a large extent.
- a library can be composed of two components comprising distinct active RNA expression cassettes, preferably at least 10, even more preferably at least 20.
- Typical libraries include more than 100, 500 or 1000 separate components, for example up to 10 9 or more.
- the precise composition eg, the sequence
- the components of the library eg, cassettes, vectors, cells, etc.
- the bank generally comprises a physical support containing the various members of the bank, which may be in mixture (s), at least partial (s), or separated.
- the support can thus include one or more physically separate compartments, such as flanges, tubes, bottles, multi-well plates, etc.
- the bank can be kept in various forms, in particular in liquid or frozen suspension, replicated, etc., in whole or in part.
- the libraries of the invention typically comprise a plurality of vectors each comprising a cassette for expression of a random RNA as described above, the vectors being at least partly in the form of a mixture.
- the library comprises at least 50, 100 or 200 vectors encoding a distinct random RNA. It can include up to several billion distinct molecular species.
- the random sequences can be any DNA or RNA molecule comprising at least one unknown sequence element, more precisely any DNA or RNA molecule of which at least part of the sequence is random.
- Such random nucleic acids can typically comprise a random region bordered, at one or both ends, by a region of defined sequence.
- the random region can comprise for example from 8 to 50 bases, and the defined region or regions from 2 to 10 bases.
- the random nucleic acid can be a single-stranded RNA, produced by chemical synthesis, or by amplification or mutagenesis from any biological matrix, or by expression of a corresponding DNA.
- the nucleic acid can also be DNA, in particular a random double-stranded DNA encoding a random RNA.
- Such a random double-stranded DNA can be prepared from a population of synthetic single-stranded DNAs of synthesis or obtained by amplification and / or mutagenesis techniques, by synthesis of a complementary second strand according to techniques. known to those skilled in the art.
- a particular object of the invention resides in a library of nucleic acids, characterized in that it comprises a plurality of species of recombinant retroviruses, each species of retrovirus comprising an expression cassette derived from a VA1 gene from an adenovirus expressing a distinct random structural RNA.
- Another particular object concerns a nucleic acid library, characterized in that it comprises a plurality of recombinant refrovirus species, each retrovirus species comprising an expression cassette comprising a distinct random RNA under the control of a U6 promoter .
- Another particular object relates to a nucleic acid library, characterized in that it comprises a plurality of species of recombinant retroviruses, each species of retrovirus comprising an expression cassette comprising a distinct random RNA under the control of a tRNA promoter .
- a particular object of the invention resides in a library of nucleic acids, characterized in that it comprises a plurality of distinct random RNAs encoded by distinct expression cassettes derived from a VA1 gene from an adenovirus.
- a particular object of the invention resides in a library of nucleic acids, characterized in that it comprises a plurality of expression cassettes each comprising a sequence encoding a distinct random structural RNA placed under the control of a promoter transcribed by RNA polymerase III (in particular expression cassettes derived from a VA1 gene from an adenovirus), each random coded structural RNA having the capacity in vitro to bind a target of interest.
- nucleic acid libraries as defined above in which the expression cassettes comprise an inducible VA promoter.
- nucleic acid libraries as defined above, in which the expression cassettes comprise a second transcriptional promoter, distinct and placed upstream of the VA promoter.
- the invention relates, in general, to methods of selection in cellulo, from banks of random nucleic acids, of active RNA capable of conferring on a cell a desired phenotype.
- the methods of the invention generally comprise: a) the supply of a nucleic acid library comprising a plurality of distinct expression cassettes each comprising a nucleic sequence coding for a random RNA placed under the control of a promoter transcribed by RNA polymerase III, b) placing in contact with said bank or a part thereof with a population of cells under conditions allowing the transfer of nucleic acid into said cells, c) selection of one or more cells having the desired phenotype, and d ) the identification of the cassette (s) contained in the selected cell (s), or of the active RNAs which they express.
- the bank implemented in step a) is a general random bank, that is to say comprising a plurality of totally random sequences.
- the use of this type of library is particularly advantageous for the selection of active RNA capable of conferring a desired phenotype on a cell, without a priori knowledge of the targeted biological target or of the targeted metabolic pathway.
- the bank implemented in step a) is a restricted random bank, that is to say comprising a plurality of sequences whose randomness presents a certain level of restriction.
- the restricted library can be a library derived from the sequence of a given target gene, comprising a multitude of sequences complementary to one or more regions of this gene.
- the restricted library can also be a random library in which one or more residues, or one or more sequence motifs are imposed within the random region.
- the restricted library can also be a library of random mutants of a given target sequence or a library encoding RNAs preselected for a particular property.
- the use of restricted random banks is particularly advantageous for the selection of active RNA capable of altering a determined biological target or a determined metabolic pathway.
- the bank implemented in step a) is a restricted random bank encoding random RNAs pre-selected for a particular property, for example for their ability to bind, in vitro, a target of interest (for example a protein, a polypeptide, a peptide, a nucleic acid, a cell, a lipid, etc.) or for their affinity for this target, for its own property, for the presence of a specific structural motif or sequence, etc.
- a target of interest for example a protein, a polypeptide, a peptide, a nucleic acid, a cell, a lipid, etc.
- a particular object of the invention relates to a method of selection, optimization or identification of active RNA, comprising: la) the preparation of a library of nucleic acids comprising a plurality of distinct expression cassettes comprising a nucleic sequence coding for a random RNA placed under the control of a promoter transcribed by RNA polymerase III, the coded random RNA sequences or the complete RNAs containing these random sequences having been pre-selected in vitro for their capacity to bind ( or for their affinity for) a target of interest, lb) bringing this bank or a part of this bank into contact with a population of cells under conditions allowing the transfer of nucleic acid into said cells,
- the libraries can be produced by any technique known to a person skilled in the art, in particular by synthesis, amplification, mutagenesis, etc., or combinations of these methods. It may be a bank of synthetic DNA or produced by recombinant or genetic means, from artificial or synthetic matrices, such as genomic banks, from RNA of sequences obtained by the SELEX method, or by any technique of mutagenesis or directed evolution, etc.
- the DNA library coding for random RNAs is prepared by: synthesis of a single-stranded DNA library comprising a random region framed by one or two regions of defined sequence, synthesis of a second strand using DNA polymerase and in the presence of a primer complementary to the defined sequence of the first strand, or a part thereof, to produce a double-stranded DNA library comprising a random region, and cloning of the double-stranded DNA library into a vector, under the control of the chosen promoter.
- This method can include an additional step of expression and selection in vitro of the RNAs encoded by the library having the capacity to interact with a biological target of interest.
- the DNA library encoding random RNAs is prepared from a collection of random RNA sequences by: reverse transcription to produce a single-stranded DNA library comprising a random region framed by a or two regions of defined sequence, - synthesis of a second strand by means of a DNA polymerase and in the presence of a primer complementary to the defined sequence of the first strand, or of a part thereof, to produce a double-stranded DNA library comprising a random region, and cloning of the double-stranded DNA bank into a vector, under the control of the chosen promoter.
- the vector is a viral vector, in particular a retroviral vector.
- the method advantageously further comprises a step of transfection of said vector into an encapsidation cell line, to produce a library of viruses, in particular of recombinant retroviruses.
- the DNA library codes for random RNAs pre-selected in vitro (see FIG. 15B).
- the method can include the following steps:
- Step A the in vitro synthesis of a bank of expression cassettes (db DNA) using the polymerase III system.
- db DNA a bank of expression cassettes
- the cassettes can be synthesized, for example, from sb DNA oligonucleotides, by means of primer extension and / or PCR amplification reactions;
- - Step B in vitro expression of the cassette bank or a part thereof, producing in vitro a bank of random RNAs
- - Step C in vifro selection of RNAs for their binding capacity or for their affinity for a given target
- Step D production of a library of restricted expression cassettes comprising RNA expression cassettes thus selected.
- the in vitro expression of the cassette bank can be carried out in two phases, a phase of production of transcription cassettes and a phase of transcription proper.
- a bank of in vifro transcription cassettes can be synthesized from the banks of expression cassettes, completely in vitro, using oligonucleotides sb DNA and by PCR reaction.
- the db DNA matrix being constituted by the bank of expression cassettes, the 5 ′ oligonucleotide used in the PCR reaction makes it possible to provide a promoter suitable for in vitro transcription (e.g. SP6, T7, T3, ... ).
- the production of the random RNA bank can then be carried out by in vifro transcription from the bank of transcription cassettes, using a suitable RNA polymerase (purified protein or preparation which contains the required activity: SP6, T7, T3 , ).
- the production of the restricted expression cassette bank can be accomplished in different ways.
- the selected active RNAs (or a part of them) are used to generate the corresponding transcription cassettes, for example by RT-PCR reaction.
- the new cassettes banks thus obtained are used either to carry out new iterations of the process (return to step B), or for in cellulo tests.
- the in cellulo tests can relate to a few identified cassettes or, more generally, this restricted expression cassette bank can be used as starting material for the selection in cellulo (step 1b).
- a particular subject of the invention also resides in a process for the selection of active RNA, comprising (i) the in vitro synthesis of a bank of expression cassettes (db DNA) encoding random RNA under the control of a polymerase III promoter, (ii) in vitro expression of the cassette bank or a part thereof, producing in vitro a random RNA bank and (iii) in vitro selection of RNAs for their binding capacity or for their affinity for a given target.
- the method comprises producing a library of restricted expression cassettes comprising RNA expression cassettes thus selected.
- the library (or a part thereof) is brought into contact with a population of cells.
- the cells used can be of varied nature and origin, and chosen according to the properties sought for the active RNA.
- the method of the invention can be implemented in particular with a population of cells comprising animal (for example mammal), birds, fish, amphibians, plants, insects, yeast or bacterial. They are preferably cells from mammals, in particular human or animals (rodents, cattle, horses, monkeys, etc.).
- the cells can be primary cultures or lines. They can be embryonic or somatic pluripotent cells, differentiated or not, proliferative or quiescent, etc.
- Mention may be made, for example, of stem cells, fibroblasts, hepatocytes, epithelial, muscular, renal, nervous, cardiac cells, or belonging to the hematopoietic lineage (B, T, NK lymphocytes, mast cells, dendritic cells, resident or circulating macrophages, etc., etc.
- the cells used can moreover be modified or treated beforehand, for example to contain a reporter gene system, a marker, etc., or to present a pathological phenotype which it is desired to correct.
- the selection process is typically carried out in vifro, in any suitable type of support, such as flask, flask, multi-well plate, etc.
- the bank in order to be able to measure or observe, on each cell, the effect of a limited number of random RNAs from the bank, the bank is preferably brought into contact with the population of cells under conditions allowing the transfer of '' a limited number of cassettes per cell.
- the bank being typically composed of a mixture of distinct components, it is preferred that each cell of the population is modified by a restricted number of these components for better appreciate its properties. Therefore, it is not necessary that the components of the library are separated from each other, or that the population of cells is distributed in supports with several compartments, which constitutes an important advantage of the invention.
- the bank is a virus bank, it is preferred to incubate the cells at a low MOI, typically less than 5, preferably less than 3, 2 or 1.
- the contacting can be carried out in the presence of agents facilitating the transfection, such as polymers, cationic lipids, peptides, etc.
- agents facilitating the transfection such as polymers, cationic lipids, peptides, etc.
- viruses in particular retroviruses
- such agents are generally not necessary, given the effectiveness of infection.
- the cells can be cultured or stored for a certain time after contacting, before carrying out step c). This duration can be adjusted by a person skilled in the art according to the phenotype sought, the type of vector, the quantity of cells, etc. Furthermore, following contacting, it is possible to carry out a step of selecting cells into which one or more cassettes have actually been transferred. This selection can be carried out by any means known to those skilled in the art, in particular by using a marker gene inserted into the vector. In addition, the cells can also be subjected to specific treatment or conditions, in particular to reveal the phenotype of interest (e.g., addition of a substrate, of a reagent, lysis of the cells, etc.)
- the phenotype of interest can be any activity, property, morphology, etc. It can be the expression of an endogenous or exogenous gene, a marker, the expression of a surface protein, a property of migration, differentiation, growth, resistance, etc.
- the desired phenotype is chosen from an ability or an incapacity for growth, apoptosis, differentiation, migration, resistance to a toxic agent, resistance to an infectious agent, or metabolic action (eg, the cell has become able to modify its metabolic environment).
- the desired phenotype is the activity of a specific biological target or a specific metabolic pathway. Mention may in particular be made of the expression or the activity of a protein, for example an enzyme (eg kinase, protease, etc.), a transcription factor, etc.
- the population of cells comprises cells infected with a virus and the desired phenotype is resistance to said virus.
- the virus can be any known virus, such as a hepatitis virus (B, C, delta %), influenza, HIV, various herpes, papilloma viruses, etc.
- the cell population includes tumor cells and the desired phenotype is loss of tumorigenicity.
- the cell population comprises undifferentiated embryonic stem cells and the desired phenotype is the control of their differentiation.
- the cell population comprises cells capable of acting on a natural metabolic process (for example: blood coagulation, regulation of the level of glucose, of lipids, cholesterol, etc.) and the desired phenotype is the control of this metabolic process.
- a natural metabolic process for example: blood coagulation, regulation of the level of glucose, of lipids, cholesterol, etc.
- the cell population comprises bacterial cells and the desired phenotype is sensitivity to a toxic agent.
- the population of cells comprises cells expressing a determined biological target (eg a protein, a variant of a protein, a nucleic acid, a lipid, a receptor, etc.) and the desired phenotype is the modification of the activity (including expression) of this biological target.
- a determined biological target eg a protein, a variant of a protein, a nucleic acid, a lipid, a receptor, etc.
- the cells expressing the desired phenotype can be selected by a person skilled in the art by any conventional biology technique (molecular modification, survival, expression of a marker, cell sorting, etc.). Also, when the cassette is inducible, RNA activity can be validated directly in cellulo, by comparing induced and repressed states ( Figure 15A). For this, the cells having the desired phenotype are selected, optionally amplified, preferably individually, and their phenotype is analyzed in parallel under conditions of induction and repression of the expression of the cassette. This additional step makes it possible to identify the RNAs whose activity is directly involved in the desired phenotype.
- Step d) comprises the identification of the cassette or cassettes contained in the selected cell or cells, or of the active RNAs which they express.
- These cassettes or RNA are responsible for the phenotype produced and can therefore be used for any application aimed at reproducing this phenotype.
- the cassette, or the RNA can be extracted from the cells and isolated by conventional methods of molecular biology (lysis of the cells, amplification or hybridization, etc.).
- the sequence of the cassette (s) is determined, to allow the corresponding product to be produced synthetically or recombinantly.
- the properties of the cassette or of the RNA can be confirmed in any suitable biological system or model.
- the bank used in step a) is complex (ie, comprises a large number of distinct components, for example greater than 100), it is preferable to repeat steps b) to d) of the method in order to select the most suitable agents. more active.
- the DNA of the expression cassettes of the selected cells is amplified to produce a restricted library, and the steps b) -d) of the method are repeated at least once with said restricted library.
- Carrying out several cycles has several advantages: firstly, it makes it possible to start from very complex banks, used in the form of a mixture. In addition, it gradually increases the efficiency of active RNA. Furthermore, it can make it possible to select active RNAs having a determined profile, by selecting the cassettes on cells or under distinct conditions according to the cycles.
- a particular object of the invention resides in a method for selecting active RNA capable of conferring on a cell a desired phenotype, comprising: a) the supply of a nucleic acid library comprising a plurality of vectors comprising cassettes of 'distinct expression each comprising a nucleic sequence encoding a random RNA placed under the control of a promoter transcribed by RNA polymerase III, b) bringing said library, or a part thereof, into contact with a population of cells under conditions allowing transfer of nucleic acid into said cells, c) selection of cells having the desired phenotype, d) extraction or amplification of the sequence of cassettes contained in said cells, e) cloning of the sequences obtained in d) into a vector to generate a restricted library and, f) the repetition at least once of steps b) to d
- the nucleic acid library is a library encoding random RNAs preselected in vifro, and / or the vector is a recombinant virus, more preferably a recombinant retrovirus.
- the promoter transcribed by RNA polymerase III is a promoter derived from the sequence of a VA gene from an adenovirus.
- the cell population includes mammalian cells.
- a more particular embodiment of the invention comprises: a) the supply of a nucleic acid library comprising a plurality of species of recombinant retroviruses, each species of retrovirus comprising an expression cassette derived from a VA gene an adenovirus expressing a distinct random structural RNA, b) bringing said library or a part thereof into contact with a population of mammalian cells under conditions allowing the infection of said cells by said recombinant refroviruses, c) the selection of cells having the desired phenotype, d) the extraction or amplification of the sequence of cassettes contained in said cells, e) the cloning of the sequences obtained in d) in a vector to generate a restricted library and, f) repeating steps b) to d) at least once with said restricted bank.
- Another particular object of the invention resides in a method for selecting active RNAs on a determined biological target, comprising: a) the supply of a nucleic acid library comprising a plurality of vectors comprising distinct expression cassettes each comprising a nucleic sequence coding for a RNA constrained (or predefined) to act on said determined target, placed under the control of a promoter transcribed by RNA polymerase III, b) contacting said library, or a part thereof, with a population of cells expressing or containing the biological target, under conditions allowing the transfer of nucleic acid into said cells, c) selection of cells having the desired phenotype, d) extraction or l amplification of the sequence of cassettes contained in said cells and, optionally, e) cloning the sequences obtained in d) into a vector to generate a rest library reinte and, f) repeating at least once steps b) to d) with said restricted bank.
- RNA sequence may be derived from the sequence of the biological target (in particular in the case of antisense, RNAi (siRNA, miRNA or their precursors), ribozymes) or else be preselected to interact structurally with the target biological (especially in the case of aptamers).
- the identified active RNAs, the identified active sequences or the expression cassettes of these active RNAs can be used as molecular tools capable of acting in the cell to interfere (inhibition, activation) with a biological activity or the expression of a specific phenotype ("target identification”). As such, they constitute useful products for studying a cellular process and identifying new targets or for exploring the function of a gene in the case where the target is known (“target validation”). Their action in a cell can make it possible to modify the cell so that said cell has new properties. The cell thus modified can then be considered as a new biotechnology tool usable for research purposes or for therapeutic applications.
- RNAs identified and, more generally, the expression cassettes identified can be used directly as pharmaceutical products.
- pharmaceutical includes any use in the medical, therapeutic, preventive or curative, veterinary, agronomic, diagnostic, cosmetic, etc. fields.
- one aspect of the invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising an expression cassette, a vector or a cell as defined above, and a pharmaceutically acceptable vehicle or excipient.
- Another aspect of the invention relates to a pharmaceutical composition, characterized in that it comprises an active RNA, said active RNA comprising an active sequence inserted into a modified VA RNA, said modified VA RNA optionally comprising an altered terminal propeller and / or a sequence conferring an inducible character.
- the invention further relates to methods of producing pharmaceutical compositions, comprising (i) screening a library of random RNAs as described above, making it possible to obtain an expression cassette for an active RNA and (ii) packaging the expression cassette or the active RNA sequence in any pharmaceutically acceptable excipient or vehicle.
- the invention relates to a method for producing a pharmaceutical composition for the treatment of a pathogen infection in a human patient, comprising (i) screening a library of Random RNAs as described above, the population of cells used being infected with the pathogenic agent and the RNAs selected for their capacity to reduce or block the infectious cycle, making it possible to obtain a cassette for expression of an active RNA and (ii) packaging the expression cassette or the active RNA sequence in any pharmaceutically acceptable excipient or vehicle.
- the invention also relates to the use of an active RNA, an expression cassette, a vector or a recombinant cell as defined above, for the preparation of a medicament intended for the delivery implementation of a method of therapeutic treatment of the human body.
- the drug can be used for the treatment of cancers, infections, neurodegenerative diseases, etc.
- the invention further relates to a method of treating a patient, comprising administering an effective amount of an active RNA, an active sequence, an expression cassette, a vector or a recombinant cell as defined above to a patient.
- the administration can be carried out by different routes, in particular by iv, ip, im, se, local or general, in particular infratumoral or systemic route.
- VA1 RNA viral gene
- VA1 RNA viral gene
- the RNA produced is very structured, its size is 160 bases.
- the cellular localization of this RNA is cytoplasmic.
- the IV loop (which interacts with the protein kinase p68) was deleted in this construction and the EcoRV restriction site was inserted: construction VA ⁇ IV (Barcellini et al., 1998) and (Gwizdek et al., 2001).
- the VA ⁇ TV RNA has a size of 134 bases, it is rich in secondary structures ( Figure 4) and has a cytoplasmic localization (Barcellini et al., 1998) (Gwizdek et al., 2001). Its sequence is represented by the sequence SEQ ID NO: 2.
- VA ⁇ IV cassette cytoplasmic ⁇ and nVA ⁇ IV (nuclear !.
- This example describes the construction of cassettes allowing the expression of the active motifs integrated in the VA ⁇ IV RNA, and the localization of which is mainly cytoplasmic.
- the VA ⁇ IVSrf cassette was generated by inserting the Srfl site in the form of a double-stranded DNA octanucleotide (5'GCCCGGGC3 ') inside the EcoRV restriction site (position 90-96 in the VA ⁇ IV).
- the transcribed RNA has 142 bases (FIG. 5) and a cytoplasmic localization (FIG. 2C), SEQ ID NO: 3. This RNA allows the optimized expression of active RNA sequences (FIG. 2B).
- This example describes the construction of cassettes making it possible to express active RNA sequences integrated into the VA ⁇ IVSrf RNA, and the localization of which remains nuclear.
- the double helix structure containing the 5 'and 3' ends is the sequence responsible for transporting this RNA from the nucleus to the cytoplasm. This structure is called the terminal helix (Gwizdek et al., 2001). It has been mapped: bases 1 to 20 and bases 136 to 155. If the double helix structure is disturbed, the RNA is retained in the cytoplasm.
- the 3 ′ part of the VA ⁇ IV gene was thus modified in order to create a rupture in the terminal double helix of the RNA according to the approach proposed in Gwizdek et al., 2001.
- the 5 ′ sequences of the VA ⁇ IV gene were modified from nucleotide 93 and replaced by the following double-stranded DNA sequence (SEQ ID NO: 5):
- This example describes the construction of cassettes making it possible to express active motifs integrated into an expression cassette inducible by tetracycline.
- the VA ⁇ IV gene has been modified in order to integrate an operating sequence tetOl between Boxes A and B of the VA gene and / or upstream of the site of initiation of the transcription of this gene (FIG. 7).
- the tetOl sequence therefore replaces the native sequences of the VA gene either between boxes A and B (position 24 to 59 in the VAiO gene) or upstream of the transcribed sequences (position - 29 to - 50 in the OVAi gene), or at the level of the two positions (extragenic and intragenic: OVAiO gene).
- the VAi cassettes are obtained synthetically using 4 single-stranded DNA oligonucleotides.
- the first two oligonucleotides of single-stranded DNA VAi up and VAi down (SEQ ID NOs: 18 and 19, FIG. 7B) are used to generate all of the transcribed sequences of the neogen VAi as well as part of the adjacent sequences in 5 'and in 3 '. Thanks to a sequence of 20 complementary bases, these oligonucleotides are hybridized and then used to generate double-stranded DNA in the presence of PADN polymerase fragment from Kleenow.
- the two external oligonucleotides VAi PvuII 5 '(SEQ ID NO: 20) and VAi PvuII 3' (SEQ ID NO: 22) are used to add the upstream and downstream sequences of the VA gene using a PCR reaction.
- the two PvuII restriction sites placed at the 5 ′ and 3 ′ ends of the VAiO gene make it possible to clone it in any DNA vector.
- the two oligonucleotides VAiO2PvuII 5 'and VAiPvuII 3' are used to add the tetOl sequence upstream of the VA ⁇ IVSrf gene or of the VaiO gene in order to generate the OVAi and OVAiO genes respectively.
- the VAiO transcribed RNA has 142 bases, its secondary structure is presented in FIG. 8.
- This example describes the construction of cassettes making it possible to express active motifs integrated into an expression cassette inducible by tetracycline.
- the localization of this motif must be mainly nuclear.
- the principle of retention of this RNA in the nucleus is the same as for the nVA ⁇ IVSrf expression cassette (see above).
- the 3 ′ part of the various VAi genes is therefore modified in the same way as for the nVA ⁇ IVSrf gene in order to create a rupture in the terminal double helix of the RNA.
- the promoter sequence of the human U6 gene is in the extragenic position.
- the RNA generated therefore corresponds to the sequences which we have chosen to clone downstream of the promoter (from point +1 of transcription). This type of promoter therefore makes it possible to express fully synthetic RNAs as opposed to the VA system which requires preserving promoter sequences positioned within the transcribed sequences.
- RNA transcribed by these cassettes have a nuclear or cytoplasmic localization, depending on the constructions.
- the objective of these cassettes is the intracellular expression of structural RNA motifs.
- a sequence serving as a structural base for the RNA to be inserted is placed downstream of the U6 promoter. It contains: a sequence capable of generating a short RNA helix (more or less stable and more or less long), a clear edge cloning site (Srfl: 5'GCCCGGGC3 ') as well as the transcription stop signal TTTTT.
- RNA shuttle which supports the active motif has a clean and stable structure in the form of a helix.
- This example describes the construction of three types of shuttle derived from U6: when the active motif is itself structured in the form of a helix, we use a cassette with a short shuttle motif (helix 9: h9U6), when the active motif is not structured in a helix or very short, we use a cassette allowing the expression of a shuttle formed by the pairing of about twenty nucleotides (helix 20 h20U6).
- h20U6 also makes it possible to modify the terminal rod of the export motif shuttle and to generate a nuclear localized shuttle (nh20U6).
- h9U6 (SEQ ID NO: 6)
- h20U6 (SEQ ID NO: 8)
- nh20U6 (SEQ ID NO: 10) 5 'TCGAGGATATCGACTGCCCGGGCAGAGATAAGGTCGACTTTTTC 3'
- RNA corresponding to a helix structure on 18 bases, with a helix interruption on 6 bases. Its sequence is indicated below (SEQ ID NO: 11)
- the objective of this cassette is to express RNAs whose sequence is chosen from point +1 of transcription.
- the restriction site with cohesive ends Sal I is replaced by the restriction site with free edges Srfl.
- the U6 promoter is modified by PCR reaction with the U6 cassette described above as a matrix.
- the 5 'primer is a plasmid sequence located upstream of the promoter and the 3 'primer makes it possible to modify the sequences near the +1 transcription site:
- sequence Srfl GCCCGGGC replaces the sequence CACCGTCG present in the original gene (Bertrand et al., 1997) (5 'CACCGTCG 3' of the original cassette has been changed by the site Srfl 5 'GCCCGGGC 3 '(the underlined sequences represent the beginning of the transcribed sequences).
- the size of the transcribed RNA is a function of the sequence cloned downstream of the promoter, inside the Srfl site. Likewise, the cellular localization of the transcribed RNA is a function of the sequence of the latter.
- RNA sequences aptamer, antisense, ribozyme, RNAi: siRNA or miRNA
- RNA Downstream of the U6 promoter, inside the so-called SalI restriction, is cloned a sequence called terminal stem. It generates a hairpin structure at the 3 'end of the RNA, thus avoiding degradation by the RNAses.
- Upstream of this terminal rod is the GTCGAC sequence which reconstitutes a SalI restriction site, in order to represent the site for cloning of the antisense sequences.
- Downstream of the terminal rod is the polymerase III transcription stop signal: TTTTT.
- Terminal stem sequence (SEQ ID NO: 13) 5 'GCGGACTTCGGTCCGCTTTTT 3' The underlined sequences form the RNA helix
- the sequence transcribed in this cassette is (SEQ ID NO: 14)
- This example illustrates the construction of a hybrid gene which can be used in particular in murine lines.
- the VA1 gene as well as the expression cassettes derived from this gene, are not expressed in murine lines.
- the promoter of the murine U6 gene is used to transcribe the expression cassettes derived from the VA1 gene.
- the mU6 / VAiO construction was carried out in two stages: the first consisted in inserting the promoter U6 of the murine gene (mU6) in the retroviral vector pBabe and the second consisted in inserting the VAiO gene downstream of the promoter mU6.
- Step 1 Cloning of mU6 in pBabe ( Figure 14)
- the murine U6 gene was copied by polymerase chain reaction using the primers mU6 upstream and mU6 downstream. At 3 'of the downstream mU6 primer, 4 additional bases were added in order to integrate a restriction site.
- the restriction site chosen is the Pme I site of sequence GTTTAAAC. This restriction site has two advantages: it allows i) to keep intact the last bases of the murine U6 promoter (GTTT) and ii) to integrate a free edge cut site usable in step N ° 2 (insertion of the VAiO gene ).
- the polymerase chain reaction was carried out using a genomic DNA matrix extracted from murine cells. The reaction product was purified and then inserted into the retroviral vector pBabe at the Nhel restriction site (FIG. 10) to generate the plasmid pBabe mU6.
- Step 2 Cloning mU6 into pBabe mU6 ( Figure 14)
- the VAiO gene obtained by polymerase chain reaction, was cloned into the plasmid pBabe mU6 at the Pmel restriction site previously introduced.
- the oligonucleotides used to obtain the VAiO gene are VAiO 5 ′ and VAiO End Nhel, an Nhe I restriction site being introduced 3 ′ of the VaiO End Nhel primer.
- the DNA template used was the plasmid pBabe VaiO.
- the retroviral vector chosen is the pBabe vector (Morgenstern and Land, 1990).
- the insertion site chosen is the Nhel site which is located in the 3 'LTR (FIG. 10). This integration site has several advantages:
- the 3 'LTR is the one which is copied to generate the two new LTRs of the integrated provirus. It is therefore responsible for the activity of the viral promoter in a situation of integration into cellular DNA.
- the fact of integrating an exogenous sequence inside this LTR does not disturb the production of the recombinant viruses by the packaging cells, but makes it possible to inactivate the viral promoter in a situation integrated in the transduced cells.
- the integration of such sequences into a cell genome therefore does not involve the activation of the genes located downstream of the insertion. This type of construction is particularly advantageous from the point of view of use for gene or cell therapy projects.
- the cassettes constructed are thus transferred into the pBabe vector at the Nhel insertion site (inside the 3 'LTR).
- Any other vector or means making it possible to penetrate the expression cassettes into the cell is also envisaged: transfection, fransduction or the like.
- any vectorization intended to make the cell penetrate not the cassette expression, but active RNA is also envisaged.
- all vectors and methods facilitating the introduction of RNA into cells will be used.
- RNA expression library was generated from single stranded DNA fragments having a size of 42 bases. These fragments are broken down into three parts: from 5 'to 3' there is a known sequence of 8 bases (runA), then a random sequence of 26 bases (chemically synthesized in a perfectly random manner by a DNA synthesis machine), finally, a second known sequence of 8 bases (runB).
- runA the sequence of 8 bases
- runB the sequence of 8 bases
- the single-stranded DNA fragments have the sequence 5 'ATGAACGC (N) 26 GCGTTCAT 3', in which N represents any base (A, T, G or C).
- the random part therefore contains 26 variable positions.
- oligonucleotide primer complementary to runB was used as primer for Kleenow's RNA polymerase, which synthesizes the DNA strand complementary to the entire sequence.
- the primer complementary to runB has the sequence 5 'ATGAACGC 3'.
- random sequence bank a population of double-stranded DNA with blunt ends is obtained.
- This bank of random sequences is then cloned into an expression cassette as described in Examples A and B above.
- the random sequences can be inserted into the two types of cassettes derived from VA1 or U6.
- the plasmids or viral vectors for example, pBabe in the case of retroviral vectors
- the random sequence bank (double stranded DNA with free edges) is cloned by competitive ligation, in the presence of the restriction enzyme Srfl.
- each vector therefore integrates a double stranded DNA fragment containing a different random sequence.
- the heterogeneous population of plasmids or vectors obtained after insertion of the random sequences is called "bank of random plasmids or bank of random vectors".
- These libraries constitute random RNA expression libraries, within the meaning of the invention, which can be used directly for the in cellulo selection of active RNA.
- the expression library used is a viral, in particular refroviral, expression library.
- a viral, in particular refroviral, expression library can be constructed from a library of random viral vectors, as described below.
- the random vector bank is introduced into the cells of an packaging line (here the line 293GP (Burns et al., 1993)) by transfection with calcium phosphate.
- the library is simultaneously transfected with an expression vector encoding the envelope glycoprotein G of the vesicular stomatitis virus (VSV-G).
- VSV-G vesicular stomatitis virus
- This protein is reputed to be very effective for the functionality (stability, infectivity) of retroviral viruses produced after transfection.
- the “Random virus bank” is then removed, purified and concentrated. Its infectious titre or MOI (number of infectious recombinant retroviral particles per milliliter) can then be determined according to the methods known to those skilled in the art.
- MOI number of infectious recombinant retroviral particles per milliliter
- the expression libraries described in Examples C and D can be used for the in cellulo selection of active RNAs.
- the “Random virus bank” it is possible to transfer the random RNA expression cassettes into the cells to be studied.
- the objective is to obtain a bank of random cells in which each cell expresses one, or more, different random RNA (s).
- the cells used can be those of a reference line, such as for example 293 cells (ATCC N ° CRL 1573), Jurkat A3 cells (ATCC N ° CRL-2570) or HELA cells (ATCC N ° CCL 2)
- the cells to be infected have a particular nature in the sense that they have a specific activity on which we want to act (growth, differentiation, infection ).
- the “random virus bank” makes it possible to transduce cells of any line as well as cells in primary culture.
- the infection of the cells is thus done using a viral supernatant having an MOI of less than 1.
- the selection of the transduced cells is carried out by virtue of the presence of the puromycin resistance gene in the recombinant pBabe retroviruses. After the action of the selection agent, the cell population obtained therefore consists of all the cells which have received one or more copies of the retroviral genome and therefore containing one or more copies of pol III expression cassette, each coding for a different random RNA. .
- the bank's cells are available for a first series of tests.
- the target on which we wish to act thanks to the active RNA can be known (a protein, an RNA, a DNA ...) or can represent an enzymatic activity, a metabolic pathway, a process of proliferation or differentiation, a resistance to a drug or pathogen, etc.
- the selection test must be adapted to each case.
- the selection of cells containing an RNA acting on the target is carried out by virtue of the positive selection of cells having acquired the required phenotype and having a selective advantage.
- the selection of an RNA active against an infectious agent is carried out by virtue of the positive selection of cells which have become resistant to the multiplication of this virus.
- the selection of an active RNA capable of protecting cells against a process of programmed cell death (apoptosis) is carried out through the selection of cells that have become resistant to the addition of a signal triggering Papoptosis.
- the positive selection of the cells of interest may also include a direct selection of the cells by direct observation (overgrowth, change in molecular status, altered differentiation, expression of a fluorescent membrane marker, etc.).
- the colonies of cells of interest are removed by microdissection using an automated device allowing laser microdissection of the groups of cells of interest (Simone et al., 1998) or else by a positive sorting based on the selection. cells of interest marked with antico ⁇ s.
- the cells potentially containing an active RNA are isolated: they constitute the first generation of selected cells.
- the selected cells can be amplified naturally thanks to their proliferation.
- the cells can be cloned if they appear as independent clones, each comprising several thousand cells.
- cells can be globally brought together to form a population of first-round cells. In all cases, the cells can be preserved by freezing.
- This first generation of selected cells (population or independent clones) is directly usable for carrying out a second selection round then, several selection rounds in an iterative mode, with the possibility of varying the selection parameters.
- the mode of selection and / or the mode of analysis of the selected cells may require working on dead cells because they are fixed by a fixing agent such as, for example, formaldehyde.
- a fixing agent such as, for example, formaldehyde.
- the selection mode requires marking of the cells using antico ⁇ s.
- the natural amplification of cells by growth is not possible and an additional step of amplification by PCR of cassettes containing active RNA is carried out to carry out a second round of selection.
- the genomic DNA of cells from the first "selection round” is extracted and purified. From this DNA, molecular biology techniques make it possible to specifically amplify by PCR the DNA sequences corresponding to the random RNA expression cassettes contained in the selected cells. A first generation of expression cassettes containing sequences potentially active on the target is thus obtained. This first generation is known as the “restricted first-round cassette bank”.
- the restricted bank of cassettes from the first round is treated in the same way as the random starting bank. It is cloned into the retroviral vector pBabe at the level of the 3 'LTR. After this new cloning step, a first restricted bank of viral vectors is obtained. The infectious forms of these viral vectors are obtained in the same way as before by transfection of the packaging cells to arrive at a first restricted library of refrovirus, used to infect, in turn, the cell type studied. The MOI is again adjusted to be less than 1 copy of virus per cell. The cells thus transduced are again selected according to the same rules as those which govern the selection of the first round, or according to other parameters. This leads to the establishment of a limited bank of cassettes for the second round.
- This second round of selection enriches the restricted bank of the first round with active sequences.
- the iterative succession of rounds based on the principle of selection for the desired phenotype makes it possible to enrich, at each round, the restricted bank in sequence of active cassettes.
- the desired phenotype seems to be finally stabilized, that is to say when all of the cells having received a recombinant viral vector present the desired phenotype (usually after 5 to 6 rounds of selection), it is considered that selection cassettes in the cells is completed.
- genomic DNA is extracted and purified. Then PCR amplification provides the last restricted bank of active cassettes.
- the cloning of these cassettes in the cloning vectors allows their physical separation thanks to the propagation of these vectors in bacteria forming isolated colonies.
- the sequencing of the cassettes found in the different bacterial colonies (usually around thirty colonies are analyzed) makes it possible to know the most frequent random sequences or to determine a motif contained in the random sequences which has been particularly preserved during the selection process. Knowledge of this motif makes it possible to define and construct, by molecular biology, one or more cassettes containing this motif.
- the cassette or cassettes thus defined can, at this stage, be analyzed individually to validate their effectiveness in acting on the target.
- the cassette is cloned into the vector pBabe, the homogeneous retroviral vectors obtained are then used individually to produce recombinant viruses which in turn serve to infect the cells studied.
- the comparison of the relative efficiency of the different cassettes analyzed makes it possible to choose the cassette (s) best suited to act on the target.
- This screening method was used to identify active RNA capable of rendering the Hela line cells resistant to staurosporine-induced cell papoptosis (0.8 ⁇ M - 6 hours).
- various cell clones resistant to staurosporine were selected (FIG. 12C) and the expression cassettes which they contain were identified: clones 2, 5, 9, 11, 13, 14, 15, 16, C, J, L and N.
- the validation of the active RNAs thus identified was carried out according to the mode indicated above in the Hela cells as well as in the Jurkat cells (with a multiplicity of infection less than 1). In each of the cell populations, the level of expression of the active RNAs was evaluated by Northern blot (FIG. 12D).
- RNA clones 5, 9 13, 15 and 16 exhibit significant activity in Jurkat cells (RNA clone 9 being the most active) while only clone 9 exhibits anti-apoptotic activity in Hela cells ( Figure 12E).
- the use of an inducible system such as the VAi system can facilitate the various steps described in this process in order to validate the active RNA directly in the cells in which they have been selected (direct elimination of false positives, Figure 15 Panel A)).
- the VAi system is for this purpose validated in the cells of the Hela T-Rex line (invitrogen ref: R714-07) which constitutively express the TetR transgene of the bacterial repressor of the Tefracycline gene (FIG. 7C).
- the first step is to hybridize and lengthen two strands of DNA in order to reconstitute a library of fragments of the VA gene into which a random sequence is inserted.
- This fragment then serves as a matrix for a polymerization chain reaction which makes it possible to obtain the library of random VA expression cassette in its entirety (2 nd step).
- 3 ⁇ eme step consists in adding, upstream cassettes random VA expression sequences of a promoter operable to effect in vitro transcription. From this random VA transcription library, an in vitro transcription step makes it possible to obtain the random VA RNA library.
- the single-stranded DNA fragments from the first step are as follows: sense strand: sense bank
- the random sequence is represented by a 30 base fragment flanked upstream and downstream of two constant 5 base sequences, capable of forming a double helix structure in the final RNA molecule.
- This structure is positioned at a level which is equivalent to the insertion of the random sequences into the Srfl site of the VAiO inducible expression cassette (see FIG. 7).
- the two oligonucleotides are extended by DNA polymerase Kleenow fragment which produces the random double-stranded VAiO fragment (FIG. 13 A).
- the second step consists in constructing from the random double-stranded VAiO fragment the library of full size random VAiO inducible expression cassettes. This step was carried out by a chain polymerization reaction using the following oligonucleotides: sense oligo: VAi5 '
- the promoter of bacteriophage T7 was added upstream of each random VAiO inducible expression cassette to generate the library of random VAiO inducible transcription cassettes. This step was carried out by polymerase chain reaction using the oligonucleotides VApT7:
- the library of random T7 VAiO transcription cassettes thus obtained was used to generate in vitro a library of random VAiO RNA thanks to the use of bacteriophage T7 RNA polymerase ( Figure 13B). In these experiments several tens of micrograms of RNA were obtained.
- the random VA RNA library is used to select RNAs capable of binding a specific subsfrat in vifro.
- the active RNAs selected by any suitable method known to those skilled in the art serve as a matrix for generating, by a reverse transcription step followed by an amplification step (RT-PCR reaction), the corresponding expression cassettes.
- This mixture of active RNA expression cassettes is then cloned into a vector suitable for gene transfer and then used as starting material for the in cellulo selection of active RNA (library of random RNA expression cassettes enriched with Active RNAs).
- the random VA ⁇ IV Srf, VA TAR * or VAiO RNAs were used to obtain the corresponding transcription cassettes.
- the RT-PCR reaction was carried out in the presence of suitable primers: VApT7 and VAend ( Figure 13 C).
- suitable primers VApT7 and VAend
- FIG. 13 C shows that under the conditions under which frois matrix RNA are mixed (VA ⁇ TV Srf RNA VATAR * RNA and VAiO RNA random) equimolecularly (1/3; 1/3; l / 3) the RT-PCR reaction produces three cassettes whose respective quantities reflect the initial quantities of each of the substrate RNAs. So under conditions where the library of random VAiO RNA is used as substrate, the products of the RT-PCR reaction are representative of a library of expression cassettes.
- constructs of the invention can also be used to test defined active sequences, and / or to express such sequences in biological tissues.
- the active sequence to be inserted is in the form of double-stranded DNA, the sequence of which has been chosen to generate an effective active RNA (of antisense, ribozyme, interfering RNA type (siRNA, miRNA or their precursors) or RNA aptamer).
- Double stranded DNA can be obtained by various techniques such as hybridization between two complementary oligonucleotides, purification of restriction fragments, copying of a matrix by PCR, etc.
- a vector as described in Example B, containing an expression cassette is digested with the appropriate restriction enzyme and the cloning of the active sequence is carried out in this restriction site by conventional cloning techniques.
- Vectors can thus be produced, whether they are plasmid or viral vectors, for example.
- recombinant viruses can also be generated, as described in Example C.
- the recombinant refroviruses produced are then used to infect cells whose phenotype is to be altered.
- the infection is preferably made with a high multiplicity of infection in order to integrate a high number of cassettes of expression of active RNA in the cell genome. Indeed, the activity of the active sequence is strongly dependent on its level of expression ( Figure 11).
- the presence of the puromycin resistance gene in the pBabe retroviruses allows rapid selection of the cells which have been infected and which contain the transduced sequence.
- vectors can also be purified and packaged in any acceptable vehicle or excipient, to produce administrable compositions, for example in mammalian organisms, in particular human.
- RNA therapeutic molecule determines the functional activity of ribozymes in mammalian cells by controlling their intracellular localization. Rna 3, 75-88 75-88. Bertrand, E., Gwizdek, C, Fenard, D., and Doglio, A. (1999). RNA therapeutic molecule? towards a rational conception of the development of antisense RNA, ribozymes and RNA aptamers. Medicine / Science 15, 677-681.
- Vesicular stomatitis virus G glycoprotein pseudotyped refroviral vectors concenfration to very high titer and efficient gene fransfer into mammalian and nonmammalian cells. Proc Natl Acad SciU S A 90, 8033-7.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP04716629A EP1599604A2 (fr) | 2003-03-04 | 2004-03-03 | Methodes et outils pour le criblage d'arn actifs in cellulo |
US10/547,489 US20070122798A1 (en) | 2003-03-04 | 2004-03-03 | Methods and tools for screening active rna in cellulo |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR03/02633 | 2003-03-04 | ||
FR0302633A FR2852021B1 (fr) | 2003-03-04 | 2003-03-04 | Methodes et outils pour le criblage d'arn actifs in cellulo |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2004080378A2 true WO2004080378A2 (fr) | 2004-09-23 |
WO2004080378A3 WO2004080378A3 (fr) | 2005-04-21 |
Family
ID=32865224
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FR2004/000499 WO2004080378A2 (fr) | 2003-03-04 | 2004-03-03 | Methodes et outils pour le criblage d’arn actifs in cellulo |
Country Status (4)
Country | Link |
---|---|
US (1) | US20070122798A1 (fr) |
EP (1) | EP1599604A2 (fr) |
FR (1) | FR2852021B1 (fr) |
WO (1) | WO2004080378A2 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005073380A2 (fr) * | 2004-01-23 | 2005-08-11 | Cold Spring Harbor Laboratory | Systemes d'expression regulee de la polymerase iii et methodes associees |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE102020211050B4 (de) | 2020-09-02 | 2022-05-19 | Volkswagen Aktiengesellschaft | Antriebseinrichtung für ein Kraftfahrzeug |
IL302046A (en) * | 2020-10-15 | 2023-06-01 | Hoffmann La Roche | Nucleic acid structures for va RNA transcription |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997027309A1 (fr) * | 1996-01-23 | 1997-07-31 | Institut National De La Recherche Agronomique - I.N.R.A. | Constructions d'adn et vecteurs d'expression derives du gene de l'arn va i d'adenovirus |
WO1998032880A1 (fr) * | 1997-01-23 | 1998-07-30 | Immusol Incorporated | Analyse fonctionnelle et decouverte de genes a l'aide de banques de vecteurs de genes de ribozymes specifiques a une cible ou bien rendues aleatoires |
WO1999041371A1 (fr) * | 1998-02-13 | 1999-08-19 | Genetrace Systems, Inc. | Utilisation de ribozymes afin d'identifier la fonction de genes |
WO2003022311A1 (fr) * | 2001-09-13 | 2003-03-20 | Genvec, Inc. | Vecteur adenoviral, systeme correspondant et procedes de fabrication et d'utilisation |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2687411A1 (fr) * | 1992-02-13 | 1993-08-20 | Nice Sophia Antipolis Universi | Vecteur comportant un gene viral transcrit par l'arn polymerase iii, et procede de production intracellulaire d'arn. |
US5837503A (en) * | 1993-07-07 | 1998-11-17 | Universite De Nice-Sophia-Antipolis | Vector containing viral gene transcribed by RNA polymerase III and methods for use |
CA2158932A1 (fr) * | 1993-09-03 | 1995-03-09 | Douglas J. Jolly | Methodes de suppression de la reponse auto-immunitaire |
US6183959B1 (en) * | 1997-07-03 | 2001-02-06 | Ribozyme Pharmaceuticals, Inc. | Method for target site selection and discovery |
JP2005533504A (ja) * | 2002-07-24 | 2005-11-10 | イミューソル インコーポレイテッド | ポリメラーゼプライマーヘアピンリンカーを用いたsiRNA発現カセット及び発現ライブラリーの製造用単一プロモーター系 |
-
2003
- 2003-03-04 FR FR0302633A patent/FR2852021B1/fr not_active Expired - Fee Related
-
2004
- 2004-03-03 US US10/547,489 patent/US20070122798A1/en not_active Abandoned
- 2004-03-03 WO PCT/FR2004/000499 patent/WO2004080378A2/fr not_active Application Discontinuation
- 2004-03-03 EP EP04716629A patent/EP1599604A2/fr not_active Withdrawn
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997027309A1 (fr) * | 1996-01-23 | 1997-07-31 | Institut National De La Recherche Agronomique - I.N.R.A. | Constructions d'adn et vecteurs d'expression derives du gene de l'arn va i d'adenovirus |
WO1998032880A1 (fr) * | 1997-01-23 | 1998-07-30 | Immusol Incorporated | Analyse fonctionnelle et decouverte de genes a l'aide de banques de vecteurs de genes de ribozymes specifiques a une cible ou bien rendues aleatoires |
WO1999041371A1 (fr) * | 1998-02-13 | 1999-08-19 | Genetrace Systems, Inc. | Utilisation de ribozymes afin d'identifier la fonction de genes |
WO2003022311A1 (fr) * | 2001-09-13 | 2003-03-20 | Genvec, Inc. | Vecteur adenoviral, systeme correspondant et procedes de fabrication et d'utilisation |
Non-Patent Citations (7)
Title |
---|
DATABASE Geneseq [Online] 17 mai 1994 (1994-05-17), "Adenovirus 2 VA I gene with anti-Tat insert." XP002309698 extrait de EBI accession no. GSN:AAQ51311 Database accession no. AAQ51311 -& FR 2 687 411 A (NICE SOPHIA ANTIPOLIS UNIVERSI) 20 août 1993 (1993-08-20) * |
DATABASE Geneseq [Online] 4 octobre 1995 (1995-10-04), "Adenovirus 2 (Ad2) VARNA1 promoter forward strand." XP002309697 extrait de EBI accession no. GSN:AAQ85743 Database accession no. AAQ85743 -& WO 95/06718 A (VIAGENE INC) 9 mars 1995 (1995-03-09) * |
ELOIT M ET AL: "High level of transgene expression in cell cultures and in the mouse by replication-incompetent adenoviruses harboring modified VAI genes" JOURNAL OF VIROLOGY, vol. 71, no. 7, 1997, pages 5375-5381, XP002269684 ISSN: 0022-538X * |
GWIZDEK CAROLE ET AL: "Terminal minihelix, a novel RNA motif that directs polymerase III transcripts to the cell cytoplasm: Terminal minihelix and RNA export" JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 28, 13 juillet 2001 (2001-07-13), pages 25910-25918, XP002269631 ISSN: 0021-9258 * |
ILVES HEINI ET AL: "Retroviral vectors designed for targeted expression of RNA polymerase III-driven transcripts: A comparative study" GENE (AMSTERDAM), vol. 171, no. 2, 1996, pages 203-208, XP002269685 ISSN: 0378-1119 * |
MEDINA M F C ET AL: "RNA POLYMERASE III-DRIVEN EXPRESSION CASSETTES IN HUMAN GENE THERAPY" CURRENT OPINION IN MOLECULAR THERAPEUTICS, CURRENT DRUGS, LONDON,, GB, vol. 1, no. 5, octobre 1999 (1999-10), pages 580-594, XP001055319 ISSN: 1464-8431 cité dans la demande * |
YU M ET AL: "IN VITRO AND IN VIVO CHARACTERIZATION OF A SECOND FUNCTIONAL HAIRPIN RIBOZYME AGAINST HIV-1" VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 206, no. 1, 1995, pages 381-386, XP000652043 ISSN: 0042-6822 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005073380A2 (fr) * | 2004-01-23 | 2005-08-11 | Cold Spring Harbor Laboratory | Systemes d'expression regulee de la polymerase iii et methodes associees |
WO2005073380A3 (fr) * | 2004-01-23 | 2005-10-13 | Cold Spring Harbor Lab | Systemes d'expression regulee de la polymerase iii et methodes associees |
Also Published As
Publication number | Publication date |
---|---|
EP1599604A2 (fr) | 2005-11-30 |
WO2004080378A3 (fr) | 2005-04-21 |
US20070122798A1 (en) | 2007-05-31 |
FR2852021A1 (fr) | 2004-09-10 |
FR2852021B1 (fr) | 2007-12-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN116590257B (zh) | VI-E型和VI-F型CRISPR-Cas系统及其用途 | |
DE60225586T2 (de) | Sirna knockout prüfverfahren und konstrukte | |
Sumanas et al. | Morpholino phosphorodiamidate oligonucleotides in zebrafish: a recipe for functional genomics? | |
Silva et al. | Second-generation shRNA libraries covering the mouse and human genomes | |
US20040002077A1 (en) | siRNA expression system and method for producing functional gene knock-down cell using the system | |
EP1462525B1 (fr) | Systeme d'expression d'arnsi et procede de production de cellule knockdown a gene fonctionnel ou analogue utilisant ce systeme | |
FR3024464A1 (fr) | Ciblage de vecteurs integratifs non-viraux dans les sequences d'adn nucleolaires chez les eucaryotes | |
FR2838442A1 (fr) | Sirnas inhibiteurs de l'expression de genes responsables de l'inactivation de la p53 et leur utilisation dans le traitement des cancers | |
FR2882062A1 (fr) | Vecteurs d'expression stable et de longue duree de sirna et leurs applications | |
KR20210126014A (ko) | CRISPR-Cas로 표적화된 핵 RNA 분열 및 폴리아데닐화 | |
US20210246180A1 (en) | Methods for expressing proteins in axons | |
EP1599604A2 (fr) | Methodes et outils pour le criblage d'arn actifs in cellulo | |
US20230071834A1 (en) | Exported rna reporters for live-cell measurement | |
FR3124522A1 (fr) | Composition et méthode permettant l’édition génomique | |
JP4877835B2 (ja) | Rna干渉誘導エレメント及びその用途 | |
WO2006111544A1 (fr) | Methode d'inhibition de la traduction et/ou la replication d'une sequence d'arn par multimerisation d'une de ses regions d'arn non codant replie | |
EP1563080A1 (fr) | Methode d'expression inductible d'arni dans des cellules, les molecules d'acide nucleique pour sa mise en oeuvre et les cellules transformees par ces molecules | |
Carmell | The role of argonaute proteins in mammalian development | |
Staffa | Post-transcriptional regulation in HIV-1 and human fibronectin: multiple CIS-acting elements | |
D'Souza | Thermo-modulation of MuSVts110 splicing by inhibitory RNA sequences | |
Alexander | The Roles of Forkhead Transcription Factors in Stem Cell and Myogensis | |
WO2006006514A1 (fr) | PROCÉDÉ DE PRÉPARATION D’UNE BANQUE DE VECTEURS D’EXPRESSION DE L’ARNsi | |
WO2005026369A2 (fr) | Vecteurs d’expression d’arn interferents, leurs procedes de preparation et leurs utilisations. | |
FR2872171A1 (fr) | Methode universelle d'extinction d'un transgene par arn interferent |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2004716629 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007122798 Country of ref document: US Ref document number: 10547489 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 2004716629 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 10547489 Country of ref document: US |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2004716629 Country of ref document: EP |