WO2004074439A2 - An expression cassette and vector for transient or stable expression of exogenous molecules - Google Patents

An expression cassette and vector for transient or stable expression of exogenous molecules Download PDF

Info

Publication number
WO2004074439A2
WO2004074439A2 PCT/US2004/004407 US2004004407W WO2004074439A2 WO 2004074439 A2 WO2004074439 A2 WO 2004074439A2 US 2004004407 W US2004004407 W US 2004004407W WO 2004074439 A2 WO2004074439 A2 WO 2004074439A2
Authority
WO
WIPO (PCT)
Prior art keywords
expression cassette
sequence
vector
seq
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/004407
Other languages
English (en)
French (fr)
Other versions
WO2004074439A9 (en
WO2004074439A3 (en
Inventor
William P. Sisk
Holly Prentice
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biogen Inc
Biogen MA Inc
Original Assignee
Biogen Idec Inc
Biogen Idec MA Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to DK04711259.4T priority Critical patent/DK1594955T3/da
Priority to JP2006503592A priority patent/JP2006517802A/ja
Priority to YUP-2005/0614A priority patent/RS20050614A/sr
Priority to EP04711259A priority patent/EP1594955B1/en
Priority to MXPA05008523A priority patent/MXPA05008523A/es
Priority to HK06104824.8A priority patent/HK1084690B/en
Priority to AU2004213797A priority patent/AU2004213797B2/en
Priority to BRPI0407487-4A priority patent/BRPI0407487A/pt
Priority to US10/545,420 priority patent/US7494805B2/en
Priority to AT04711259T priority patent/ATE553185T1/de
Priority to EA200501296A priority patent/EA008439B1/ru
Priority to CA002515481A priority patent/CA2515481A1/en
Priority to NZ542316A priority patent/NZ542316A/en
Priority to CN2004800101473A priority patent/CN1774500B/zh
Application filed by Biogen Idec Inc, Biogen Idec MA Inc filed Critical Biogen Idec Inc
Priority to ES04711259T priority patent/ES2384973T3/es
Publication of WO2004074439A2 publication Critical patent/WO2004074439A2/en
Publication of WO2004074439A3 publication Critical patent/WO2004074439A3/en
Publication of WO2004074439A9 publication Critical patent/WO2004074439A9/en
Priority to IL170178A priority patent/IL170178A/en
Priority to IS7974A priority patent/IS7974A/is
Anticipated expiration legal-status Critical
Priority to NO20054202A priority patent/NO20054202L/no
Priority to US12/349,899 priority patent/US20100158879A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA

Definitions

  • This invention relates to expression vectors and expression cassettes, and more particularly to methods, compositions, and systems for expression of an exogenous molecule in an organism.
  • nucleic acid molecules polypeptide, peptides, and small molecules
  • target cells and tissues are being used both as a therapeutic delivery system as well as in the production of therapeutic molecules in vitro.
  • the applicability of this approach has increased with the further understanding of host cells and the molecular biology of cell division, differentiation, and expression mechanisms.
  • the expression cassette of the invention includes a combination of regulatory elements that provide efficient transcription, efficient transcription termination, and increased mRNA stability of transcribed products.
  • the expression cassette includes a human cytomegalovirus promoter/enhancer, a cloning site or polynucleotide of interest, and a hGHv polyadenylation signal domain.
  • a variable length intervening sequence may be present.
  • the invention provides an expression cassette that includes a human CMV immediate early 1 (hCMV IE1) promoter/enhancer region, a polynucleotide of interest, and a variant human growth hormone (hGHv) polyA signal domain or variant thereof.
  • the polyA signal variant is at least 100 nucleotides in length and contains the sequence AATAAA, and is at least 92% identical to a hGH polyA signal domain.
  • the invention further provides an expression vector that includes an expression cassette of the invention as well as host cells containing a expression cassette or expression vector of the invention.
  • the invention further provides an expression cassette that includes a human CMV immediate early 1 (hCMV IE1) promoter/enhancer region, a variable lengtii intervening sequence (VLIVS) comprising a splice donor and splice acceptor site, a polynucleotide of interest, and a variant human growth hormone (hGHv) polyA signal domain or variant thereof.
  • the polyA signal domain or variant thereof is at least 100 nucleotides in length and contains the sequence AATAAA and is at least 92% identical to a hGHv polyA signal domain.
  • the invention also provides an expression vector that includes a human CMV immediate early 1 (hCMV IE1) promoter/enhancer region, a variable length intervening sequence (VLIVS) comprising a splice donor site and a splice acceptor site, a cloning site, a hGH poly adenylation region, and a selectable marker.
  • hCMV IE1 promoter/enhancer region is upstream (5') to the cloning site and the hGH poly adenylation region is downstream (3') to the cloning site.
  • the invention also includes a method of delivering an agent of interest in vivo.
  • the method includes delivering a composition comprising an expression cassette to a subject, the expression cassette includes a hCMV IE1 promoter/enhancer region; a variable length intervening sequence comprising a splice donor and splice acceptor site; a polynucleotide encoding the agent of interest; and a human growth hormone (hGH) polyA signal domain or variant thereof.
  • hGH human growth hormone
  • the invention further includes an expression system.
  • the expression system mcludes a host cell transfected or transformed with an expression cassette of the invention, wherein the host cell is cultured under conditions to express the polynucleotide of interest; and recovering the agent of interest.
  • FIG. 1 is a plasmid map of the pVIO vector.
  • CMV IE1 promoter/intron (IVS) was generated by PCR and cloned into the Hindlll and
  • FIG. 2 is a plasmid map of pV40. Indicated are the cytomegalovirus immediate early 1 (CMV IE1) promoter, an intron (IVS), a hGHv polyadenylation signal domain (polyA) of about 600 base pairs in length, and the ampicillin resistance gene, beta lactamase (bid).
  • CMV IE1 cytomegalovirus immediate early 1
  • IVS intron
  • polyA hGHv polyadenylation signal domain
  • bid beta lactamase
  • FIG. 3 is a schematic representation of the plasmid pV70. Indicated are the CMV IE1 promoter, the IVS including the deletion junction and the splice donor (SD) and splice acceptor (S A) sites, a hGHv polyA signal domain, and the bla gene. The deletion junction represents the blunt-ended ligation result of BspEl'/ ⁇ pal.
  • FIG. 4 is a schematic representation of the generation of the pXLC .1 vector. The pXLC.l vector was constructed using the expression vector pV70 and a PCR product containing the light chain coding sequence.
  • FIG. 5 is a schematic representation of the generation of the pXLC.2 vector.
  • FIG. 6 is a schematic representation of a p V60 vector and the generation of the pXHC vector.
  • the pXHC vector was constructed using the expression vector pV60 and a PCR product containing most of the heavy chain coding sequence (52 amino acids from the N-terminal were not included). PV60 was linearized with BamHI, the PCR product was digested with BamHI and the two were ligated together.
  • FIG. 7 is a schematic representation of a pXHC.1 vector.
  • FIG 8 is a schematic representation of a pXHC.3 vector.
  • FIG. 9 is a schematic representation of a pXHC.5 vector, resulting from the addition of a dhfr cassette to pXHC.3.
  • the control elements of the expression cassette were derived from pSI (Promega, Genbank accession #U47121) and include the SV40 promoter/enhancer, an artificial intron and the SV40 late polyadenylation sequence.
  • FIG. 10 is a schematic representation of the vector pV80. indicated are the cytomegalovirus immediate early 1 (CMV IE1) promoter/intron (IVS) fragment including the splice donor (SD) and the splice acceptor (SA) sites, a hGHv polyadenylation signal domain (polyA), the ampicillin resistance gene, beta lactamase (bla), the SV40 promoter/enhancer the artificial intron and the SV40 late polyadenylation sequence.
  • CMV IE1 cytomegalovirus immediate early 1
  • IVS cytomegalovirus immediate early 1 promoter/intron fragment
  • SD splice donor
  • SA splice acceptor
  • polyA hGHv polyadenylation signal domain
  • the ampicillin resistance gene beta lactamase
  • bla beta lactamase
  • SV40 promoter/enhancer the artificial intron and the SV40 late polyadenylation sequence.
  • FIGs. HA and 11B are schematic representations of the vector pV90 and the corresponding annotated sequences.
  • FIG. HA is a vector map. Indicated are cytomegalovirus immediate early 1 (CMV IE1) promoter/intron (IVS) fragment including the splice donor (SD) and the splice acceptor (SA) sites, a hGHv polyadenylation signal domain (polyA), the ampicillin resistance gene, beta lactamase (bla), the SV40 promoter/enhancer, the artificial intron and the SV40 late polyadenylation sequence. The vector lacks the Notl site in the dhfr expression cassette.
  • FIG. 11B is the annotated sequence of the pV90 vector. In Fig. 11B, the sequence from nucleotides 1275 to 1866 of SEQ ID NO: 19 represents a hGHv polyA of about 600 nucleotides in length.
  • FIG. 12 is a vector map of pSI-DHFR.2.
  • the SV40 promoter drives the dhfr gene.
  • FIG. 13 is a graph depicting the relative specific productivities of the transfected pools. Three pools were analyzed for pCMV-hGHvPA-SEAP and pSEAP2, and one for pUC18.
  • FIG. 14 is a pair of graphs showing the relative specific productivities of the isolates. The top twenty isolates from each construct are shown in rank order.
  • FIG. 15 shows a sequence in GenBank Accession No. K00470 (SEQ ID NO: 18).
  • the invention relates to an expression cassette and vectors containing the expression cassette.
  • the expression cassette includes a transcriptional regulatory region capable of driving transcription in a eukaryotic host and a transcriptional termination region.
  • the expression cassettes and vectors of the invention provide for a strong transcription start and stop as well as increased mRNA stability of transcribed products.
  • the invention provides promoter and optionally enhancer elements from any strain of cytomegalovirus, such as described herein or in references such as U.S. Patent No. 5,658,759, the disclosure of which is incorporated herein by reference.
  • suitable CMV immediate early promoter regions useful in the expression cassettes of the invention can be obtained from the CMV-promoted -galactosidase expression vector, CMV 3 (MacGregor et al., Nucl. Acids Res. 17:2365 (1989)).
  • the hGHv polyadenylation signal domain provides a strong transcriptional stop signal as well as increases the stability of the mRNA transcript.
  • the regulatory/expression element may be separated from the hGHv polyadenylation signal domain by, for example, a polynucleotide of interest or a cloning site (e.g., a multiple cloning site).
  • a polynucleotide comprising an expression cassette that includes a cytomegalovirus (CMV) transcriptional regulatory region, a variable length intervening sequence (e.g., from intron A of CMV), a polynucleotide of interest, and a polyadenylation signal domain.
  • CMV cytomegalovirus
  • the invention further relates to processes and expression vectors for producing and recovering heterologous polypeptides from host cells.
  • an expression cassette of the invention includes, operably linked, (i) a CMV major immediate early 1 (IE1) promoter/enhancer region and a variable length intervening sequence (e.g., derivative of intron A), (ii) a polynucleotide of interest, and (iii) a hGHv polyadenylation signal domain.
  • IE1 CMV major immediate early 1
  • variable length intervening sequence e.g., derivative of intron A
  • a polynucleotide of interest e.g., a hGHv polyadenylation signal domain.
  • a promoter/enhancer operably linked to a polynucleotide of interest is ligated to the latter in such a way that expression of the polynucleotide of interest is achieved under conditions which are compatible with the activation of expression from the promoter/enhancer.
  • the expression cassette includes a sequence as set forth in SEQ ID NO:l from about nucleotide 1 to about nucleotide 1867 (e.g., from about 1 to 1865, 1866, 1867, 1868, or 1869).
  • the expression cassette set forth from nucleotide 1 to 1867 of SEQ ID NO:l includes a number of distinct domains such as a CMV IE1 promoter/enhancer region having a sequence as set forth from about xi to about x 2 of SEQ ID NO:l, wherein xi is a nucleotide from 1-20 and x is a nucleotide from about 715-720 (e.g., from about 1 to 719 of SEQ ID NO:l).
  • Another domain of the expression cassette includes a variable length intervening sequence (VLIVS) containing a splice donor and a splice acceptor site.
  • VLIVS variable length intervening sequence
  • the VLIVS can be at least 50 bp in length (e.g., at least 100, 150, 200, or 250 bp in length) and can include splice donors and acceptors from any source known in the art. See, e.g., Varani et al., Annu Rev Biophys Biomol Struct 27:407-45 (1998) and Koning, Eur J Biochem 219:25-42 (1994).
  • a suitable intervening domain can include all of intron A of a CMV genome of any strain or may include a smaller fragment comprising a 5' sequence containing a splice donor site ligated to a 3 5 sequence containing a splice acceptor site.
  • the VLIVS includes nucleotides from about x 3 to about x of SEQ ID NO:l, wherein x 3 is a nucleotide from 715-720 and x 4 is a nucleotide from 1236-1254 (e.g., 719 to 1236 of SEQ ID NO:l).
  • the intervening sequence following the CMV IE1 promoter/enhancer can vary in size as much as 317 nucleotides from that present in SEQ ID NO:l.
  • 317 nucleotides were deleted from the IVS sequence as depicted in pV40 and pV70 (see, e.g., FIGs. 2 and 3, respectively) to produce the VLIVS of SEQ ID NO:l.
  • the expression cassette includes a sequence from about nucleotide 1 to about 1254 of SEQ ID NO:l (e.g., a CMV IE1 promoter/enhancer and an intervening sequence).
  • a multiple cloning site may be present after (i.e., downstream of) the IVS region (e.g., nucleotides 1255-1272 of SEQ ID NO:l includes BamHI sites and a Notl site).
  • Different or additional restriction sites may be engineered in the expression cassette using techniques known to those of skill in the art.
  • the expression cassette further includes a polyA domain.
  • the polyA signal domain is derived from a hGHv gene, which can vary in its 3'UTR sequence, e.g., from allele to allele.
  • One allele of the hGHv gene is described in GenBank Accession No. K00470 (SEQ ID NO: 18), while another sequence is described in Fig. 11B as SEQ ID NO:19, which corresponds to nucleotides 2032 to 2625 of SEQ ID NO:18 (See FIG. 15).
  • Non-naturally occurring variants of the polyA signal domain may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms.
  • a polyA variant from a hGHv gene includes polyA signal domain that varies from a wild-type hGHv polyA signal domain yet retains the ability to signal transcriptional termination and/or stabilize mRNA.
  • the polyadenylation signal domain may include an hGHv polyadenylation-signal domain sequence as set forth in SEQ ID NOs:18 or 19.
  • sequences need not be as long as about 600 nucleotides.
  • any polyA sequence domain that includes a contiguous nucleotide sequence of at least 100 nt (e.g., at least 200, 300, 400, 500, or 600 nt), including the canonical AATAAA site, of a hGHv gene is included.
  • the invention encompasses sequences that vary from the foregoing sequences by up to 8% (e.g., have 92% identity to SEQ ID NO: 18 or 19 or a distinct domain thereof).
  • a polynucleotide of 100 nt in length having 95% identity to nucleotides 1-1867 of SEQ ID NO:l and including the sequence AATAAA would retain the ability to terminate transcription.
  • a vector comprising an expression cassette.
  • a "vector” is a nucleic acid molecule (either DNA or RNA) capable of autonomous replication upon introduction into a recipient cell (e.g., a bacterium such as E. coli). Plasmids, viruses and bacteriophages are examples of vectors.
  • the process of "expression" from an expression vector is well known, and includes the use of cellular enzymes and processes to produce an expression product from a polynucleotide of interest.
  • Expression vectors are vectors that are capable of mediating the expression of a cloned polynucleotide in a host cell, which may or may not be the same type of cell used for replication or propagation of the vector. Many mammalian expression vectors can be propagated in common bacteria (recipient cell) but express the polynucleotide of interest in mammalian cells (host cell) and not in bacterium. [0034]
  • the invention concerns the design and use of vectors that are capable of permitting efficient transcription and translation of polynucleotides in eukaryotic (e.g., mammalian, and most particularly, human, murine, simian, bovine, porcine, rodent, or ovine cells) cells.
  • the vectors of the invention include an expression cassette as set forth above, including a polyadenylatioiLsignal domain that provides ior efficient transcriptional jtermination and mRNA
  • the vectors of the invention include: a cloning site for receiving a polynucleotide of interest; transcription regulatory elements (e.g., CMV IE1 promoter/enhancer regions) sufficient to permit transcription of a polynucleotide inserted into the cloning site in a host cell; translation elements sufficient to permit translation of an RNA transcript of said polynucleotide in a host cell and (if desired) replication elements sufficient to permit the replication of said vector in a host cell or another recipient cell used for propagation of the vector.
  • transcription regulatory elements e.g., CMV IE1 promoter/enhancer regions
  • translation elements sufficient to permit translation of an RNA transcript of said polynucleotide in a host cell
  • replication elements sufficient to permit the replication of said vector in a host cell or another recipient cell used for propagation of the vector.
  • the vectors of the invention are capable of mediating such expression transiently or stably in host cells.
  • a vector of the invention includes (1) a sequence as set forth in SEQ ID NO:l; (2) a sequence that is complementary to the sequence as set forth in SEQ ID NO.T; (3) a sequence that is at least 80% (preferably at least 90%; 95%; 98% or 99%) identical to SEQ ID NO:l or its complement; or (4) a vector comprising SEQ ID NO:l from about nucleotide 1 to about nucleotide 1867 and comprising a polynucleotide of interest and/or a selectable marker.
  • the vector comprising SEQ ID NO: 1 has a number of distinct domains and coding regions.
  • a CMV IE1 promoter/enhancer region having a sequence as set forth from about Xi to about x 2 of SEQ ID NO:l, wherein x is a nucleotide from 1-20 and x 2 is a nucleotide from about 715-720 (e.g., from about 1 to 719 of SEQ ID NO:l) is present in the vector.
  • Another domain of an expression vector of the invention includes a variable length intervening sequence (VLIVS) containing a splice donor and splice acceptor site.
  • VLIVS variable length intervening sequence
  • the IVS includes nucleotides from about x 3 to about x 4 of SEQ ID NO:l, wherein x includes a nucleotide from 715-720 and x includes a nucleotide from 1236-1254 (e.g., about nucleotides 719 to 1236 of SEQ ID NO:l).
  • Amultiple cloning site of the expression vector includes nucleotides 1255- 1272 of SEQTD NO:l (e.g., BamHI sites and aNotl site). Different or additional restriction sites may be engineered in the expression vector using techniques known to those of skill in the art.
  • the expression vector further includes a polyA signal domain.
  • the polyA signal domain is a hGHv polyA signal domain or other variant of the hGH polyA signal domain.
  • a polyA signal domain includes an hGHv polyA signal domain sequence as set forth in SEQ ID NO: 19.
  • SEQ ID NO:l includes a dihydrofolate reductase (dhfr) gene (e.g., from about nucleotide 2568 to about nucleotide 3132 of SEQ ID NO:l).
  • a vector of the invention may include additional promoter/enhancer elements and regulatory regions (e.g., polyadenylation domains) in addition to those provided above.
  • Such additional regulatory elements and polyadenylation domains may flank (e.g., be immediately adjacent to, 5 'and 3 Of) a selectable marker or polynucleotide of interest.
  • the vector comprising SEQ ID NO:l contains a dihydrofolate reductase (dhfr) gene from about nucleotide 2568 to about nucleotide 3132 of SEQ ID NO:l.
  • the dhfr gene is flanked by an SV40 promoter/enhancer element and an SV40 polyadenylation region (e.g., about nucleotide 1868 to about nucleotide 2210 and about nucleotide 3144 to about nucleotide 3440 of SEQ ID NO:l, respectively).
  • selectable markers are those that encode proteins that confer resistance to cytostatic or cytocidal drugs, such as the DHFR protein, which confers resistance to methotrexate (Wigler et al., Proc. Natl. Acad. Sci. USA 77:3567 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981)); the GPF protein, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci.
  • the neomycin resistance marker which confers resistance to the amino glycoside G-418 (Colberre- Garapin et al., J. Mol. Biol. 150:1 (1981)); the Hygro protein, which confers resistance to hygromycin (Santerre et al., Gene 30:147 (1984)); and the ZeocinTM resistance marker (available commercially from Invitrogen).
  • the herpes simplex virus thymidine kinase (Wigler et al., Cell 11 :223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl.
  • adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) can be employed in tk “ , hgprt " or aprt " cells, respectively.
  • Other selectable markers encode puromycin N-acetyl transferase or adenosine deaminase.
  • nucleic acid molecules refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using a comparison algorithm or by manual alignment and visual inspection.
  • This definition also refers to the complement of a sequence (e.g., the complement of a sequence as set forth in SEQ ID NO:l or a fragment thereof comprising an expression cassette).
  • the expression cassette and fragments thereof include those with a nucleotide sequence identity that is at least about 80%o, about 90%, and about 95%, about 97%, about 98%> or about 99% identical to a portion of SEQ ID NO:l (e.g., nucleotides 1-719, 1-1254, and the like, of SEQ ID NO:l).
  • SEQ ID NO:l e.g., nucleotides 1-719, 1-1254, and the like, of SEQ ID NO:l.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated or default program parameters.
  • a "comparison window" includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 25 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, PiLEUP, BESTFIT, FASTA, and TFASTAin the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection.
  • HSPs high scoring sequence pairs
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues, always ⁇ 0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • W wordlength
  • E expectation
  • BLOSUM62 scoring matrix see, e.g., Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989).
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin, Proc. Nat'l. Acad. Sci. USA 90:5873-5787, 1993).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • polynucleotides that specifically hybridize to a polynucleotide sequence as set forth in SEQ ID NO:l from about nucleotide 1 to 1867 or a fragment thereof.
  • the phrase “selectively (or specifically) hybridizes to” refers to the binding, duplexing, or hybridizing of a molecule to a particular reference polynucleotide under stringent hybridization conditions.
  • stringent hybridization conditions refers to conditions under which a probe will primarily hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances, e.g., depending on the length of the probe.
  • T m thermal melting point
  • Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to about 50 nucleotides) and at least about 60°C for long probes (e.g., greater than about 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal (e.g., identification of a nucleic acid of the invention) is about 2 times background hybridization.
  • “Stringent” hybridization conditions that are used to identify substantially identical nucleic acids within the scope of the invention include hybridization in a buffer comprising 50% formamide, 5x SSC, and 1% SDS at a temperature between 42°C and 65°C, with a wash of 0.2x SSC and 0.1% SDS at 65°C, for long probes.
  • hybridization conditions can be modified depending on sequence composition.
  • Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40%. formamide, 1 M NaCl, and 1% SDS at 37°C, and a wash in IX SSC at 45°C. A positive hybridization is at least twice background.
  • an expression cassette of the invention can include a hGHv polyA signal domain that hybridizes under high stringency conditions to a ssDNA containing the nucleotide sequence of SEQ ID NO:18 or 19.
  • the expression cassette may be used in the form of a naked nucleic acid construct.
  • the expression cassette may be introduced as part of a nucleic acid vector (e.g., an expression vector such as those described above).
  • a nucleic acid vector e.g., an expression vector such as those described above.
  • Such vectors include plasmids and viral vectors.
  • a vector may include sequences flanking the expression cassette that include sequences homologous to eukaryotic genomic sequences, such as mammalian genomic sequences, or viral genomic sequences. This will allow the introduction of the expression cassette into the genome of eukaryotic cells or viruses by homologous recombination.
  • a plasmid vector comprising the expression cassette flanked by viral sequences can be used to prepare a viral vector suitable for delivering the expression cassette to a vertebrate, including fish, avian or mammalian cells.
  • the techniques employed are well known to a skilled person.
  • the term "polynucleotide of interest" is intended to cover nucleic acid molecules that are capable of being at least transcribed. The molecule may be in the sense or antisense orientation with respect to the promoter. Antisense constructs can be used to inhibit the expression of a gene in a cell according to well-known techniques.
  • the polynucleotide of interest may include a heterologous polynucleotide.
  • heterologous polynucleotide encompasses any gene.
  • a heterologous polynucleotide typically originates from a foreign species compared to the regulatory element with which it is operably linked in the expression cassette or vector or if originated from the same source, is the modified gene from its original form. Therefore, a heterologous polynucleotide operably linked to a promoter is from a source different from that from which the promoter was derived, or, if originated from the same source, is the modified promoter from its original form. Modification of the heterologous polynucleotide may occur, e.g., by treating the DNA with a restriction enzyme to generate a DNA fragment that is capable of being operably linked to the promoter.
  • Heterologous polynucleotides may also include marker genes (e.g., encoding /3-galactosidase or green fluorescent protein) or genes whose products regulate the expression of other genes. Thus polynucleotides that serve as templates for mRNA, tRNA and rRNA are included within this definition.
  • the heterologous gene may be any allelic variant of a wild-type gene, or it may be a mutant gene.
  • mRNA will optionally include some or all of 5' and/or 3' transcribed but untranslated flanking regions naturally, or otherwise, associated with the translated coding sequence.
  • the polynucleotide of interest may optionally further include the associated transcriptional control elements normally associated with the transcribed molecules, for example transcriptional stop signals, polyadenylation domains and downstream enhancer elements.
  • the polynucleotide of interest can encode or serve as template for a therapeutic product, which can for example be a peptide, polypeptide, protein, or ribonucleic acid.
  • the polynucleotide of interest is typically a DNA sequence (such as cDNA or genomic DNA) coding for a polypeptide product such as enzymes (e.g. /3-galactosidase); blood derivatives; hormones; cytokines; interleukins; interferons; TNF; growth factors (e.g.
  • IGF-1 insulin growth factor-1
  • soluble receptor molecules e.g., soluble TNF receptor molecules
  • neurotransmitters or their precursors trophic factors such as BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3 and NT5; apolipoproteins such as ApoAI and ApoAIV; dystrophin.or.a minidystrophin; tumor-suppressing proteins such as p53, Rb, RaplA, DCC and k-rev; factors involved in coagulation such as factors VII, VIII and IX; or alternatively all or part of a natural or artificial immunoglobulin (e.g. Fab and ScFv, or the light or heavy chain of a cloned IgG).
  • trophic factors such as BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3 and NT5
  • apolipoproteins such as Apo
  • a polynucleotide of interest may also include a template for generation of an antisense molecule, whose transcription in a target cell enables gene expression or the transcription of cellular mRNAs to be controlled.
  • an antisense molecule whose transcription in a target cell enables gene expression or the transcription of cellular mRNAs to be controlled.
  • Such molecules can, for example, be transcribed in a target cell into RNAs complementary to cellular mRNAs and can thus block their translation into protein, according to techniques known in the art.
  • antisense molecules can be used to block translation of inflammatory or catabolic cytokines in the treatment of arthritis and tissue loss caused by these cytokines.
  • the polynucleotide sequence of interest typically will encode a polypeptide of diagnostic or therapeutic use.
  • the polypeptide may be produced in bioreactors in vitro using various host cells (e.g., COS cells or CHO cells or derivatives thereof) containing the expression cassette of the invention.
  • the expression cassette and/or vector of the invention may be used for gene delivery, protein delivery, and/or gene therapy.
  • the invention may also be used for the expression of toxic factors and polypeptides.
  • the latter can be, in particular, cell poisons (such as diphtheria toxin, pseudomonas toxin and ricin A), a product inducing sensitivity to an external agent (e.g. thymidine kinase and cytosine deaminase) or alternatively factors capable of inducing cell death (e.g. Grb3-3 and anti-ras
  • a therapeutic use is meant a use that may provide relief from a disease or disorder, cure a disease or disorder, and/or ameliorate the severity of a disease or disorder.
  • a diagnostic use includes using molecules capable of determining or providing information regarding a cause or relationship of a molecule to a disease process or determining the presence or absence of a disease or disorder. A diagnostic agent does not directly contribute to the amelioration of the disease or disorder.
  • a polynucleotide of interest may also encode an antigenic polypeptide for use as a vaccine.
  • Antigenic polypeptides or nucleic acid molecules are derived from pathogenic organisms such as, for example, a bacterium or a virus.
  • antigenic polypeptides include antigenic determinants present in the genomes or gene products of a pathogenic organism, for example, viral haemorrhagic septicemia, bacterial kidney disease, vibriosis, and furunculosis.
  • Antigenic polypeptides may be selected from regions of the hepatitis C virus genome and gene products, for example.
  • isolated when referring to a molecule or composition, such as, e.g. , a vector or expression cassette of the invention, or polynucleotide of interest, means that the molecule or composition is separated from at least one other compound, such as a protein, DNA, RNA, or other contaminants with which it is associated in vivo or in its naturally occurring state.
  • a polynucleotide of interest is considered isolated when it has been isolated from any other component with which it is naturally associated.
  • An isolated composition can, however, also be substantially pure.
  • An isolated composition can be in a homogeneous state. It can be in a dry/lyophilized or an aqueous solution.
  • nucleic acid molecule and “polynucleotide” are used interchangeably, and include oligonucleotides (i.e., short polynucleotides). They also refer to synthetic and/or non-naturally occurring nucleic acid molecules (e.g., comprising nucleotide analogues or modified backbone residues or linkages).
  • the terms also refer to deoxyribonucleotide or ribonucleotide oligonucleotides in.either single-or double-stranded form.
  • the terms encompass nucleic acids containing analogues of natural nucleotides.
  • the terms also encompass nucleic acid-like structures with synthetic backbones.
  • DNA backbone analogues provided by the invention include phosphodiester, phosphorothioate, phosphorodithioate, methyl-phosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene (methylimino), 3'-N-carbamate, morpholino carbamate, and peptide nucleic acids (PNAs); see Oligonucleotides and Analogues, a Practical Approach, edited by F. Eckstein, IRL Press at Oxford University Press (1991); Antisense Strategies, Annals of the New York Academy of Sciences, Volume 600, Eds. Baserga and Denhardt (NYAS 1992); Milligan (1993) J. Med. Chem.
  • PNAs contain non-ionic backbones, such as N-(2-aminoethyl) glycine units. Phosphorothioate linkages are described in WO 97/03211; WO 96/39154; Mata (1997) Toxicol. Appl. Pharmacol. 144:189-197. Other synthetic backbones encompassed by the term include methyl-phosphonate linkages or alternating methylphosphonate and phosphodiester linkages (Strauss-Soukup (1997) Biochemistry 36:8692-8698), and benzyl-phosphonate linkages (Samstag (1996) Antisense Nucleic Acid Drug Dev 6:153-156).
  • recombinant refers to a polynucleotide synthesized or otherwise manipulated in vitro (e.g., “recombinant polynucleotide”), to methods of using recombinant polynucleotides to produce products in cells or other biological systems, or to a polypeptide (“recombinant protein") encoded by a recombinant polynucleotide.
  • Recombinant polynucleotides encompass nucleic acid molecules from different sources ligated into an expression cassette or vector for expression of, e.g., a fusion protein; or those produced by inducible or constitutive expression of a polypeptide (e.g., an expression cassette or vector of the invention operably linked to a heterologous polynucleotide, such as a polypeptide coding sequence).
  • a human growth hormone variant (hGHv) polyadenylation (polyA) signal domain is provided downstream (3') of a polynucleotide of interest present in an expression cassette or vector of the invention.
  • the hGHv polyA signal domain includes a sequence derived from the human growth hormone genetic sequence.
  • the hGHv polyadenylation signal domain sequence provides for a strong transcriptional termination and provides increased mRNA stability in eukaryotic cells.
  • This hGHv polyadenylation signal domain provides a distinctive advantage over prior expression cassettes and/or vectors including those that may utilize a CMV promoter/enhancer.
  • Translation elements may also be present and are intended to encompass the specialized sequences (such as ribosome binding sites and initiation codons) that are necessary to permit translation of an RNA transcript into protein. Translation elements may also include consensus sequences, leader sequences, splice signals, and the like, that serve to facilitate or enhance the extent of translation, or increase the stability of the expressed product. For example, the hGHv polyadenylation signal domain provides increased mRNA stability.
  • the vectors of the invention may possess ancillary transcription regions, such as introns, polyadenylation signals, Shine/Dalgarno translation signals and Kozak consensus sequences (Shine et al, Proc. Natl. Acad. Sci.
  • replication elements is intended to encompass the specialized sequences (such as origins of replication) that are necessary to permit replication of the vector in a recipient cell. In general, such, vectors will contain at least one origin of replication sufficient to permit the autonomous stable replication of the vector in a recipient cell.
  • one or more selectable markers may be included in the vector.
  • the present invention relates to host cells containing the above-described constructs (e.g., the expression cassette or vector of the invention).
  • the expression cassette of the invention may be used to recombinantly modify a host cell by transfecting a host cell or transforming a host cell to express a desired polynucleotide of interest.
  • the term "recombinantly modified” means introducing an expression cassette or vector of the invention into a living cell or expression system.
  • the expression cassette comprising a polynucleotide of interest is present in a vector (e.g., a plasmid).
  • An expression system includes a living host cell into which a polynucleotide of interest, whose product is to be expressed, has been introduced, as described herein. »
  • Host cells are cells in which an expression cassette (including a vector comprising an expression cassette) can be propagated and polynucleotides encoding products can be expressed.
  • a host cell also includes any progeny of the subject host cell or its derivatives. It is understood' - that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell” is used.
  • Host cells which are useful in the invention, include bacterial cells, fungal cells (e.g., yeast cells), plant cells and animal cells.
  • host cells can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology (1986)).
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS or
  • Host cells for use in the invention are eukaryotic host cells (e.g. , mammalian cells).
  • the host cells are mammalian production cells adapted to grow in cell culture.
  • Examples of such cells commonly used in the industry are CHO, VERO, BHK,
  • HeLa, CV1 including Cos; Cos-7
  • MDCK including Cos; Cos-7
  • 293, 3T3, C127 myeloma cell lines (especially murine), PC 12 and W138 cells.
  • Chinese hamster ovary (CHO) cells which are widely used for the production of several complex recombinant proteins, e.g. cytokines, clotting factors, and antibodies (Brasel et al., Blood 88:2004-2012 (1996); Kaufman et al, J.Biol Chem 263: 6352-
  • DHFR dihydrofolate reductase
  • the dihydrofolate reductase (DHFR)-deficient mutant cell lines are the CHO host cell lines of choice because the efficient DHFR selectable and amplifiable gene expression system allows high level recombinant protein expression in these cells (Kaufman, Meth Enzymol 185:527-566 (1990)). In addition, these cells are easy to manipulate as adherent or suspension cultures and exhibit relatively good genetic stability. CHO cells and recombinant proteins expressed in them have been extensively characterized and have been approved for use in clinical manufacturing by regulatory agencies.
  • a derived host cell includes CHO cells (e.g., the DG44 cell line), which have been selectively cultured for a desired phenotype (e.g., by positive and/or negative selection processes).
  • a polynucleotide of interest can encode a polypeptide of pharmaceutical, medicinal, nutritional, and/or industrial value.
  • the polynucleotide of interest can encode a polypeptide- based drug.
  • Receptors for any of the aforementioned proteins can also be expressed using the inventive methods and compositions, including both forms of tumor necrosis factor receptor (referred to as p55 and p75), Interleukin-1 receptors (type 1 and 2), Interleukin-4 receptor, Interleukin- 15 receptor, Interleukin- 17 receptor, Interleukin- 18 receptor, granulocyte- macrophage colony stimulating factor receptor, granulocyte colony stimulating factor receptor, receptors for oncostatin-M and leukemia inhibitory factor, receptor activator of NF-kappa B (RANK), receptors for TRAIL, BAFF receptor, lymphotoxin beta.receptor, TGFjS receptor types I and II, and receptors that include death domains, such as Fas or Apoptosis-Inducing Receptor (AIR).
  • p55 and p75 tumor necrosis factor receptor
  • Interleukin-1 receptors type 1 and 2
  • Interleukin-4 receptor Interleukin- 15 receptor
  • CD proteins cluster of differentiation antigens
  • CD proteins include cluster of differentiation antigens (referred to as CD proteins), for example, those disclosed in Leukocyte Tvping VI (Proceedings of the Vlth International Workshop and Conference; Kishimoto, Kikutani et al., eds.; Kobe, Japan, 1996), or CD molecules disclosed in subsequent workshops.
  • CD proteins include CD27, CD30, CD39, CD40, and ligands thereto (CD27 ligand, CD30 ligand and CD40 ligand).
  • TNF receptor family which also includes 41BB and OX40
  • the ligands are often members of the TNF family (as are 41BB ligand and OX40 ligand); accordingly, members of the TNF and TNFR families can also be expressed using the invention.
  • Polypeptides that are enzymatically active can also be expressed according to the invention.
  • Examples include metalloproteinase-disintegrin family members, various kinases, glucocerebrosidase, superoxide dismutase, tissue plasminogen activator, Factor VIII, Factor IX, apolipoprotein E, apolipoprotein A-I, globins, an IL-2 antagonist, alpha- 1 antitrypsin, TNF-alpha Converting Enzyme (TACE), and numerous other enzymes.
  • Ligands for enzymatically active proteins can also be expressed using the cassette and vector of the invention.
  • inventive compositions and methods are also useful for expression of other types of recombinant proteins and polypeptides, including immunoglobulin molecules or portions thereof and chimeric antibodies (e.g., an antibody having a human constant region coupled to a murine antigen binding region) or fragments thereof.
  • immunoglobulin molecules or portions thereof include immunoglobulin molecules or portions thereof and chimeric antibodies (e.g., an antibody having a human constant region coupled to a murine antigen binding region) or fragments thereof.
  • DNAs encoding immunoglobulin molecules can be manipulated to yield DNAs encoding recombinant proteins such as single chain antibodies, antibodies with enhanced affinity, or other antibody-based polypeptides (see, for example, Larricket al., Biotechnology 7:934-938 (1989); Reichmann et al., Nature 332:323-327 (1988); Roberts et al., Nature 328:731-734 (1987); Verhoeyen et al., Science 239:1534-1536 (1988); Chaudhary et al., Nature 339:394-397 (1989)).
  • fusion proteins include those specifically binding to lymphotoxin beta receptor and integrins such as VLA-1, VLA-4, and ⁇ v36, Such antibodies can be agonists or antagonists.
  • Various fusion proteins can also be expressed using the inventive methods and compositions. Examples of such fusion proteins include proteins expressed as a fusion with a portion of an immunoglobulin molecule, proteins expressed as fusion proteins with a zipper moiety, and novel polyfunctional proteins such as a fusion proteins of a cytokine and a growth factor (e.g., GM-CSF and IL-3, MGF and IL-3).
  • WO 93/08207 and WO 96/40918 describe the preparation of various soluble oligomeric forms of a molecule referred to as CD40L, including an immunoglobulin fusion protein and a zipper fusion protein, respectively; the techniques discussed therein are applicable to other proteins.
  • the expression product e.g. , a protein or polypeptide
  • the expression product may be purified using standard techniques in the art.
  • the polypeptide may be purified using antibodies that specifically bind to the tag.
  • an oligonucleotide encoding a tag molecule is ligated at the 5 ' or 3' end of a polynucleotide of interest encoding a desired polypeptide; the oligonucleotide may encode a polyHis (such as hexaHis), or other "tag” such as FLAG, HA (hemaglutinin Influenza virus) or myc for which commercially available antibodies exist.
  • This tag is typically fused to the polypeptide upon expression of the polypeptide, and can serve as means for affinity purification of the desired polypeptide from the host cell. Affinity purification can be accomplished, for example, by column chromatography using antibodies against the tag as an affinity matrix.
  • the tag can subsequently be removed from the purified polypeptide b various means such as - proteolytic cleavage.
  • the expression cassette and vectors of the invention can be used to provide a stable transfer of a polynucleotide of interest into a host cell.
  • a stable transfer means that the polynucleotide of interest is continuously maintained in the host.
  • the expression cassette or vector of the invention may also provide transient expression of a polynucleotide of interest in a host cell. Transiently transfected host cells lose the exogenous DNA during cell replication and growth.
  • An expression cassette of the invention may be used to deliver a therapeutic agent to a human or animal in need of treatment.
  • the expression cassette of the invention may be used to deliver an agent encoding potentially immunogenic polypeptides in vivo for vaccine purposes to a subject (e.g., a human), particularly for vaccination of domesticated animals including animals of foodstock such as fish, porcine, equine, bovine, canine, and feline species.
  • the expression cassette of the invention may be administered directly as a naked nucleic acid construct, typically comprising flanking sequences homologous to a host cell genome. Uptake of naked nucleic acid constructs by vertebrate cells is enhanced by several known techniques including biolistic transformation and lipofection. [0072] Alternatively, the expression cassette may be administered as part of a vector, including a plasmid vector or viral vector.
  • the expression cassette or vector is combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.
  • Suitable carriers and diluents include isotonic saline solutions including, for example, phosphate-buffered saline.
  • the composition comprising the expression cassette or vector can be formulated for various types of administration including, for example, intramuscular administration.
  • composition comprising the expression cassette or vector When used in an injectable form, it is typically mixed with a vehicle that is pharmaceutically acceptable for an injectable formulation for direct injection at the site to be treated.
  • the pharmaceutically acceptable carrier or diluent may be, for example, a sterile isotonic solution.
  • the composition comprising the expression cassette or vector may also be formulated in an orally active fo ⁇ n.
  • the dose of substance used may be adjusted according to various parameters, especially according to the substance used, the age, weight and condition of the subject to be treated, the mode of administration used and the required clinical regimen. A physician will be able to determine the required route, of administration and dosage for any particular subject and condition.
  • Genomic DNA was isolated from human diploid fibroblasts infected with human cytomegalovirus strain AD 169 (ATCC No. VR-538) and used as a template to PCR amplify the CMV immediate early gene 1 promoter/enhancer region (CMV IE1 P/E) (see FIG. 11(B) (SEQ ID NO:l) for details of the CMV immediate early gene 1 promoter/enhancer region (CMV IE1 P/E) (see FIG. 11(B) (SEQ ID NO:l) for details of the CMV immediate early gene 1 promoter/enhancer region
  • the promoter was amplified using primers containing a Hindlll site at the 5' terminus (tttAAGCTTGACATTGATTATTGACTAG; SEQ ID NO:2; restriction site underlined) and a BamHI site at the 3' terminus (ttttGGATCCCTGTCAAGGACGGTGACTGC;
  • the total reaction volume was 100 ⁇ l: IX NEB Vent polymerase buffer (10 mM KCl, 20 mM Tris pH 8.8 at 25 °C, 10 mM (NH 4 )SO 4 , 2 mM MgSO 4 ,
  • pV40 Vector Construction of pV40 Vector [0079] The construction of pV40 is outlined in FIG. 2. The 3'UTR of the hGHv gene including the polyA signal was PCR amplified from genomic DNA isolated from human fibroblasts. The (+) strand of 5' primer ( TTTTGGATCCCTGCCCGGGTGGCATCC; SEQ ID NO: 0
  • the p V40 vector was digested with BspEl and Hpal to remove a 317 nucleotide section of the Intron A region (IVS) (see, e.g., FIG. 2 and 3).
  • pV60 was generated by blunt end ligation into BspEI-Hpal of the dhfr coding region of pV40.
  • the pV70 expression vector contains the human cytomegalovirus major immediate early 1 (hCMV LEl) promoter/enhancer region to regulate transcription. It also contains the hCMV lEl 5 'UTR and intron A, where the intron contains a 317 base pair deletion.
  • the vector contains the human growth hormone variant polyadenylation (hGHv polyA) region, SEQ ID NO: 19. Construction of pV40, pV60, and pV70 are detailed below and further described in the Figures.
  • A. Generation of pXLC.l [0081] A PCR product containing a light chain coding sequence for an antibody was digested with BamHI and cloned into a unique BamHI site in the expression vector pV70 (FIG. 3). The light chain coding region was inserted into a unique BamHI site between the 5' UTR sequence at the 3' end of the hCMV IE1 intron and the 5' end of the hGHv poly A region. This plasmid was designated as pXLC.l.
  • FIG. 4 shows a schematic of the generation of the pXLC.l vector.
  • neomycin transferase (neo) expression cassette was introduced into pXLC.1 to act as a selectable marker (FIG. 5).
  • the neo cassette was prepared as a BamHII EcoRI fragment from a commercially available plasmid called pGT-N28 (New England Biolabs, catalog #307-28).
  • pGT-N28 New England Biolabs, catalog #307-28
  • the neo gene is driven by the phosphoglycerate kinase (PGK) promoter and terminated at a PGK poly-adenylation site.
  • PGK phosphoglycerate kinase
  • the BamHI end at the 5' end of the neo cassette was converted to a Narl end using the following adaptor oligos:
  • CTACTTAAGCCGC SEQ ID NO:5
  • GCCCGG ⁇ rCCTCATTTACCCGGAGACAG also contains an added linker region with a B ⁇ mHI site (italics) and a sequence that corresponds heavy chain coding sequence including the termination codon (underlined).
  • the expected PCR product of 1268 base pairs was obtained.
  • the heavy chain coding region was incomplete.
  • the BamHI fragment, containing the incomplete heavy chain was cloned into the plasmid pV60 (FIG. 6).
  • This vector is identical to pV70 (described above) except that it contains the dhfr coding region at the site of the deletion in the intron.
  • the heavy chain coding region was inserted into a unique BamHI site between the 5' untranslated sequence at the 3' end of the hCMV IE1 intron and the 5' end of the hGHv variant poly A region. This plasmid, with the incomplete heavy chain, was designated as pXHC.
  • pXHC.l The coding region that was missing from the heavy chain sequence was inserted into pXHC to generate the plasmid designated as pXHC.l (FIG. 7). To do this, a fragment was generated by PCR using a plasmid containing the coding sequence for the antibody as a template.
  • pXHC.l contained a dhfr gene in the hCMV IE1 intron. Due to potential problems with amplification found with this configuration, the dhfr gene was removed from the intron and an expression cassette was inserted 3' of the heavy chain cassette (FIG. 8). The first step was the removal of the dhfr gene from the intron. This was accomplished by cutting the heavy chain coding sequence out of pXHC.l as a Pstl/EcoRI fragment and cloning it into the pXLC.l plasmid cut with the same enzymes. This cloning step simply switched the light chain for the heavy chain in the plasmid.
  • the resulting plasmid was identical to pXHC.l except that the intron containing the dhfr gene was replaced by an intron with a deletion as described above for pXLC.1.
  • This heavy chain plasmid was designated as pXHC.3 (FIG. 8).
  • the second step in the alteration of the dhfr configuration was the insertion of the dhfr expression cassette 3' of the heavy chain expression cassette (FIG. 9).
  • the dhfr expression cassette was derived from the plasmid pSI-DHFR on a Bglll/BamHI fragment and includes an
  • This adaptor was first ligated to the EcoRI cut plasmid and then the Bglll/BamHI dhfr cassette was ligated to the adapted plasmid.
  • This plasmid was designated as pXHC.5 (FIG. 9). Characterization of pXLC.2 and pXHC.5
  • Both plasmids were analyzed using restriction enzymes to confirm the presence and orientation of the inserted fragments.
  • the coding region of the plasmids was sequenced to verify that no mutations were accumulated during the PCR or cloning steps.
  • the presence of a functional neo selection marker was confirmed by transfecting pXLC.2 into CHO cells and demonstrating resistance to G418. The ability to do a dual selection was demonstrated when the pXLC.2 and pXHC.5 plasmids were co-transfected into a serum free adapted DG44 CHO host.
  • Colonies grew out from the co-transfection in a dual selection media (a - MEM 10%) dFBS with 400 mg/ml G418). Under the same conditions, either selection alone (a - MEM or 400 mg/ml G418) was able to kill untransfected cells.
  • pV80 was generated from the heavy chain expression vector pXHC.5 (FIG. 10).
  • the heavy chain coding sequence was deleted from pXHC.5 using BamHI.
  • the backbone was ligated to re-circularize it at the BamHI site.
  • Notl BamHI compatible GATCCGCGGCCGC SEQ ID NO: 13
  • CGCCGGCGCCTAGG SEQ JD WD:U
  • BamHI compatible [0093] This clomng step recreated BamHI sites on either side of the Notl site. These BamHI sites may be useful in the genetic analysis of stable cell lines generated with this vector.
  • the cloning site sequence of pV90 was confirmed by sequence analysis.
  • a polynucleotide e.g. , a coding sequence
  • a polynucleotide may be cloned into the
  • a polynucleotide e.g., a coding sequence
  • GGATCC GCGGCCGC GGATCC CTGCCCGGGT SEQ ID NO: 16
  • Notl site For optimal results when using the Notl site, a "C” should be added prior to the start codon in the PCR primers to best match the Kozak sequence (e.g., GGATCC GCGGCCGC C
  • pV80 and pV90 are identical with the exception of Notl restriction sites: pV80 has a single Notl site at position 3166 (end of the dhfr coding region ) and pV90 has a single Notl site at position 1260 (cloning site).
  • SEAP secreted alkaline phosphatase
  • the SV40 based expression vector, pSEAP2-control (Cat # 6052-1, Clontech), expresses SEAP under the control of the SV40 early promoter and SV40 enhancer.
  • the SEAP coding sequence is followed by the SV40 late polyadenylation signal to ensure proper, efficient processing of the SEAP transcript in eukaryotic cells.
  • a synthetic transcription blocker (TB) composed of adjacent polyadenylation and transcription pause sites, located upstream of the MCS reduces background transcription.
  • the vector incorporates a number of features that improve the sensitivity of SEAP by increasing the efficiency of SEAP expression or that enhance the utility of the vectors.
  • the SEAP coding sequence was extracted from the pSEAP2-control plasmid by PCR and cloned into a pVHO vector.
  • the pVl 10 plasmid is a derivative of pV90 (no dhfr expression cassette, different polylinker, but otherwise the same).
  • the pCMV-hGHvPA-SEAP plasmid construct was verified by sequencing.
  • the host used for transfections was the dihydrofolate reductase (DHFR) deficient Chinese hamster ovary cell line DG44 (Urlaub et al, Cell 33, 405-412 (1983)).
  • the CMVSEAP and pSEAP2-control reporter plasmids were, co-transfected with a plasmid encoding . dihydrofolate reductase (dhfr) so that stable transfectants could be selected for (pSI-DHFR.2, FIG. 12).
  • dhfr dihydrofolate reductase
  • Each transfection contained 50 ⁇ g of a reporter plasmid and 5 ⁇ g pSI-DHFR.2. All DNA was prepared by Megaprep kit (Qiagen).
  • DNA Prior to transfection, DNA was ETOH precipitated, washed in 70% EtOH, dried, resuspended in HEBS (20 mM Hepes, pH 7.05, 137 mM NaCl, 5 mM KCl, 0.7 mM Na 2 HPO 4 , 6 mM dextrose), and quantitated prior to transfection.
  • Negative controls included pUC18 (ATCC No. 37253) as a reporter control and a no DNA transfection as a transfection control (Table 3).
  • SEAP assay Conditioned medium was analyzed using the Great EscAPeTM SEAP Reporter System 3 (Clontech). This assay uses a fluorescent substrate to detect the SEAP activity in the conditioned medium.
  • the kit was used in a 96 well format according to the manufacturer's instructions, with the following exceptions.
  • the assay buffer from the kit was substituted with 1.5 M diethanolamine, 0.75 mM MgCl , 15 mM L-homoarginine, and 10% Emerald II (Cat # 9761, Applied Biosystems). All standards and samples were diluted in fresh medium rather than the dilution buffer provided.
  • Isolates were obtained by "picking" colonies from the transfection. "Picking” was accomplished by aspirating directly over a colony with a P200 PipetmanTM set at 50 ml. The aspirated colony was transfe ⁇ ed first to a 48 well plate and then to a 6 well plate when there was a sufficient number of cells. Specific productivities were assessed in 6 well plates at near confluent to confluent cell densities using the 24-hour assay described above (FIG.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Sampling And Sample Adjustment (AREA)
  • Crystals, And After-Treatments Of Crystals (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Tents Or Canopies (AREA)
  • Paints Or Removers (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
PCT/US2004/004407 2003-02-14 2004-02-13 An expression cassette and vector for transient or stable expression of exogenous molecules Ceased WO2004074439A2 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
NZ542316A NZ542316A (en) 2003-02-14 2004-02-13 An expression cassette and vector for transient or stable expression of exogenous molecules
YUP-2005/0614A RS20050614A (sr) 2003-02-14 2004-02-13 Ekspresiona kaseta i vektor za prolaznu ili stabilnu ekspresiju egzogenih molekula
EP04711259A EP1594955B1 (en) 2003-02-14 2004-02-13 An expression cassette and vector for transient or stable expression of exogenous molecules
MXPA05008523A MXPA05008523A (es) 2003-02-14 2004-02-13 Un casete de expresion y vector para la expresion transitoria o estable de moleculas exogenas.
HK06104824.8A HK1084690B (en) 2003-02-14 2004-02-13 An expression cassette and vector for transient or stable expression of exogenous molecules
AU2004213797A AU2004213797B2 (en) 2003-02-14 2004-02-13 An expression cassette and vector for transient or stable expression of exogenous molecules
BRPI0407487-4A BRPI0407487A (pt) 2003-02-14 2004-02-13 cassete e um vetor de expressão para a expressão transitória ou estável de moléculas exógenas
US10/545,420 US7494805B2 (en) 2003-02-14 2004-02-13 Expression cassette and vector for transient or stable expression of exogenous molecules
JP2006503592A JP2006517802A (ja) 2003-02-14 2004-02-13 外来性分子の一過性の発現もしくは安定な発現のための発現カセットおよび発現ベクター
EA200501296A EA008439B1 (ru) 2003-02-14 2004-02-13 Экспрессионная кассета и вектор для временной или постоянной экспрессии экзогенных молекул
CA002515481A CA2515481A1 (en) 2003-02-14 2004-02-13 An expression cassette and vector for transient or stable expression of exogenous molecules
DK04711259.4T DK1594955T3 (da) 2003-02-14 2004-02-13 Ekspressionskassette og vektor til transient eller stabil ekspression af eksogene molekyler
AT04711259T ATE553185T1 (de) 2003-02-14 2004-02-13 Expressionskassette und vektor zur transienten oder stabilen expression exogener moleküle
CN2004800101473A CN1774500B (zh) 2003-02-14 2004-02-13 用于瞬时或稳定表达外源分子的表达盒和载体
ES04711259T ES2384973T3 (es) 2003-02-14 2004-02-13 Un casete y vector de expresión para la expresión transitoria o estable de moléculas exógenas
IL170178A IL170178A (en) 2003-02-14 2005-08-09 Expression cassette comprising a human cmv immediate early 1 promoter/enhancer region and a vector comprising said expression cassette
IS7974A IS7974A (is) 2003-02-14 2005-08-11 Tjáningarsnælda og ferja til varanlegrar eða sammvinnrar tjáningar á framandi sameindum
NO20054202A NO20054202L (no) 2003-02-14 2005-09-09 Ekspresjonskassett og vektor for transient eller stabil ekspresjon av eksogene molekyler
US12/349,899 US20100158879A1 (en) 2003-02-14 2009-01-07 Expression cassette and vector for transient or stable expression of exogenous molecules

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US44817903P 2003-02-14 2003-02-14
US60/448,179 2003-02-14

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/349,899 Continuation US20100158879A1 (en) 2003-02-14 2009-01-07 Expression cassette and vector for transient or stable expression of exogenous molecules

Publications (3)

Publication Number Publication Date
WO2004074439A2 true WO2004074439A2 (en) 2004-09-02
WO2004074439A3 WO2004074439A3 (en) 2004-10-28
WO2004074439A9 WO2004074439A9 (en) 2004-12-23

Family

ID=32908549

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/004407 Ceased WO2004074439A2 (en) 2003-02-14 2004-02-13 An expression cassette and vector for transient or stable expression of exogenous molecules

Country Status (21)

Country Link
US (2) US7494805B2 (enExample)
EP (1) EP1594955B1 (enExample)
JP (2) JP2006517802A (enExample)
KR (1) KR20050101554A (enExample)
CN (1) CN1774500B (enExample)
AT (1) ATE553185T1 (enExample)
AU (1) AU2004213797B2 (enExample)
BR (1) BRPI0407487A (enExample)
CA (1) CA2515481A1 (enExample)
DK (1) DK1594955T3 (enExample)
EA (2) EA200700469A1 (enExample)
ES (1) ES2384973T3 (enExample)
IL (1) IL170178A (enExample)
IS (1) IS7974A (enExample)
MX (1) MXPA05008523A (enExample)
NO (1) NO20054202L (enExample)
NZ (1) NZ542316A (enExample)
PL (1) PL378110A1 (enExample)
RS (1) RS20050614A (enExample)
WO (1) WO2004074439A2 (enExample)
ZA (1) ZA200506413B (enExample)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7494805B2 (en) 2003-02-14 2009-02-24 Biogen Idec Ma Inc. Expression cassette and vector for transient or stable expression of exogenous molecules
US8242173B2 (en) 2004-09-15 2012-08-14 Janssen Pharmaceutica N.V. 4-((phenoxyalkyl)thio)-phenoxyacetic acids and analogs
US8633184B2 (en) 2006-04-18 2014-01-21 Janssen Pharmaceutica N.V. Benzoazepin-oxy-acetic acid derivatives as PPAR-delta agonists used for the increase of HDL-C, lower LDL-C and lower cholesterol
US8669288B2 (en) 2005-09-14 2014-03-11 Janssen Pharmaceutica N.V. Lysine salts of 4-((phenoxyalkyl)thio)-phenoxyacetic acid derivatives
US8871503B2 (en) 2006-03-28 2014-10-28 Isis Innovation Limited Construct
WO2014162318A3 (en) * 2013-03-30 2015-02-12 Usha Biotech Limited Methods and constructs for expressing biologically active proteins in mammalian cells
US9724322B2 (en) 2003-09-19 2017-08-08 Janssen Pharmaceutica N.V. 4-(phenoxyalkyl)thio)-phenoxyacetic acids and analogs

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RS20060266A (sr) * 2003-10-14 2008-09-29 Biogen Idec Ma Inc., Flp posredovana rekombinacija
BRPI0508862A (pt) * 2004-03-15 2007-09-04 Biogen Idec Inc métodos e construtos para expressar multìmeros de polipeptìdios em células eucarióticas utilizando junção alternativa
US20080166766A1 (en) * 2006-10-18 2008-07-10 The Scripps Research Institute Genetic incorporation of unnatural amino acids into proteins in mammalian cells
WO2011017319A1 (en) 2009-08-03 2011-02-10 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Methods of treating disorders associated with protein polymerization
US8809617B2 (en) * 2009-11-05 2014-08-19 The University of Pittsburgh—Of the Commonwealth System of Higher Education Automated high-content live animal drug screening using C. elegans
US9072772B2 (en) 2009-11-05 2015-07-07 University of Pittsburgh—of the Commonwealth System of Higher Education Methods of treating disorders associated with protein aggregation
WO2011084659A1 (en) * 2009-12-21 2011-07-14 Sanofi-Aventis Transgenic non-human animal and uses thereof
UY33126A (es) * 2009-12-21 2011-07-29 Sanofi Sa Animal transgénico no humano y sus usos
US8993316B2 (en) 2011-11-16 2015-03-31 Brian P. Hanley Methods and compositions for gene therapy and GHRH therapy
US20150064137A1 (en) 2012-04-17 2015-03-05 Kythera Biopharmaceuticals, Inc. Use of engineered viruses to specifically kill senescent cells
US9816102B2 (en) 2012-09-13 2017-11-14 Indiana University Research And Technology Corporation Compositions and systems for conferring disease resistance in plants and methods of use thereof
ES2780398T3 (es) 2012-12-10 2020-08-25 Biogen Ma Inc Anticuerpo anti-antígeno 2 de células dendríticas sanguíneas y uso de los mismos
WO2015162930A1 (ja) * 2014-04-24 2015-10-29 一般社団法人 医療産業イノベーション機構 タンパク質発現を向上させる方法およびタンパク質発現用組成物
TWI747098B (zh) 2018-12-21 2021-11-21 美商美國禮來大藥廠 抗angptl3/8複合物抗體及其使用方法
US11415263B2 (en) * 2020-03-20 2022-08-16 Edwards Vacuum Llc Conversion kit for a support frame, a support frame and an integrated vacuum system mounted in a support frame

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8717430D0 (en) 1987-07-23 1987-08-26 Celltech Ltd Recombinant dna product
CA2121798C (en) 1991-10-25 2007-07-24 Richard J. Armitage Novel cytokine
ATE229076T1 (de) 1992-04-02 2002-12-15 Sembiosys Genetics Inc Cis elemente des ölkörperproteins als regulationische signale
CA2223103A1 (en) 1995-06-06 1996-12-12 Isis Pharmaceuticals Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
CA2222914C (en) 1995-06-07 2002-04-02 Immunex Corporation Novel cd40l mutein
US5985662A (en) 1995-07-13 1999-11-16 Isis Pharmaceuticals Inc. Antisense inhibition of hepatitis B virus replication
US6087129A (en) 1996-01-19 2000-07-11 Betagene, Inc. Recombinant expression of proteins from secretory cell lines
WO1997040165A1 (en) * 1996-04-23 1997-10-30 The Wistar Institute Of Anatomy And Biology Novel human cytomegalovirus dna constructs and uses therefor
CA2297375A1 (en) * 1997-07-24 1999-02-04 Valentis, Inc. Ghrh expression system and methods of use
EP1047774A1 (en) * 1998-01-16 2000-11-02 California Pacific Medical Center Research Institute Methods and compositions for gene delivery
US6455677B1 (en) * 1998-04-30 2002-09-24 Boehringer Ingelheim International Gmbh FAPα-specific antibody with improved producibility
EP0953639A1 (en) * 1998-04-30 1999-11-03 Boehringer Ingelheim International GmbH FAPalpha-specific antibody with improved producibility
ES2326893T3 (es) * 1998-05-27 2009-10-21 Genzyme Corporation Vectores aav para la fabricacion de medicamentos para administracion potenciada por conveccion.
EP1092768A1 (en) * 1999-10-16 2001-04-18 ARTEMIS Pharmaceuticals GmbH Conditional gene trapping construct for the disruption of genes
WO2001094599A1 (en) 2000-06-07 2001-12-13 Smittskyddsinstitutet Gene expression cassette and its use
WO2002002765A2 (en) 2000-07-05 2002-01-10 Transgene S.A. Chimeric promoters for controlling expression in smooth muscle cells
JP2002233374A (ja) * 2001-02-06 2002-08-20 Japan Science & Technology Corp 遺伝子導入及び/又は遺伝子欠損非ヒト動物作製用ベクター
DE10133407A1 (de) 2001-07-13 2003-01-23 Basf Ag Expressionskassetten zur transgenen Expression von Nukleinsäuren
US20030235823A1 (en) * 2002-06-24 2003-12-25 The University Of Alabama Nucleotide sequences that code for torsin genes, torsin proteins, and methods of using the same to treat protein-aggregation
EA200700469A1 (ru) 2003-02-14 2008-10-30 Байоджен Айдек Ма Инк. Экспрессионная кассета и вектор для временной или постоянной экспрессии экзогенных молекул

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MACGREGOR ET AL., NUCL. ACIDS RES., vol. 17, 1989, pages 2365

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7494805B2 (en) 2003-02-14 2009-02-24 Biogen Idec Ma Inc. Expression cassette and vector for transient or stable expression of exogenous molecules
US9724322B2 (en) 2003-09-19 2017-08-08 Janssen Pharmaceutica N.V. 4-(phenoxyalkyl)thio)-phenoxyacetic acids and analogs
US8242173B2 (en) 2004-09-15 2012-08-14 Janssen Pharmaceutica N.V. 4-((phenoxyalkyl)thio)-phenoxyacetic acids and analogs
US8669288B2 (en) 2005-09-14 2014-03-11 Janssen Pharmaceutica N.V. Lysine salts of 4-((phenoxyalkyl)thio)-phenoxyacetic acid derivatives
US8871503B2 (en) 2006-03-28 2014-10-28 Isis Innovation Limited Construct
US11214815B2 (en) 2006-03-28 2022-01-04 Ip2Ipo Innovations Limited Nucleic acid Construct
US8633184B2 (en) 2006-04-18 2014-01-21 Janssen Pharmaceutica N.V. Benzoazepin-oxy-acetic acid derivatives as PPAR-delta agonists used for the increase of HDL-C, lower LDL-C and lower cholesterol
WO2014162318A3 (en) * 2013-03-30 2015-02-12 Usha Biotech Limited Methods and constructs for expressing biologically active proteins in mammalian cells

Also Published As

Publication number Publication date
PL378110A1 (pl) 2006-03-06
CN1774500B (zh) 2011-03-02
JP2010213718A (ja) 2010-09-30
WO2004074439A9 (en) 2004-12-23
AU2004213797B2 (en) 2009-09-17
US20100158879A1 (en) 2010-06-24
KR20050101554A (ko) 2005-10-24
US20060141625A1 (en) 2006-06-29
DK1594955T3 (da) 2012-06-25
RS20050614A (sr) 2007-12-31
AU2004213797A1 (en) 2004-09-02
ES2384973T3 (es) 2012-07-16
HK1084690A1 (en) 2006-08-04
IS7974A (is) 2005-08-11
IL170178A (en) 2011-12-29
MXPA05008523A (es) 2005-10-20
CN1774500A (zh) 2006-05-17
EP1594955B1 (en) 2012-04-11
US7494805B2 (en) 2009-02-24
CA2515481A1 (en) 2004-09-02
EA008439B1 (ru) 2007-06-29
EA200501296A1 (ru) 2006-04-28
WO2004074439A3 (en) 2004-10-28
BRPI0407487A (pt) 2006-02-14
ZA200506413B (en) 2006-04-26
EA200700469A1 (ru) 2008-10-30
NO20054202L (no) 2005-11-11
EP1594955A2 (en) 2005-11-16
NO20054202D0 (no) 2005-09-09
JP2006517802A (ja) 2006-08-03
EP1594955A4 (en) 2006-07-19
NZ542316A (en) 2006-04-28
ATE553185T1 (de) 2012-04-15

Similar Documents

Publication Publication Date Title
US20100158879A1 (en) Expression cassette and vector for transient or stable expression of exogenous molecules
JP7472121B2 (ja) アルブミン遺伝子座からの導入遺伝子発現のための組成物及び方法
JP2006517802A5 (enExample)
CA2195303C (en) Method for selecting high-expressing host cells
EP0505500B1 (en) Endogenous gene expression modification with regulatory element by way of homologous recombination
US6924365B1 (en) Optimized messenger RNA
JP3073009B2 (ja) 組換えdna法及びそこに使用するベクター
AU2008339985C1 (en) Mammalian expression vector
US20090017533A1 (en) Optimized messenger rna
WO2002064799A2 (en) Optimized messenger rna
EP0724639B1 (en) Methods for selection of recombinant host cells expressing high levels of a desired protein
KR20170132784A (ko) 글로빈 유전자 클러스터의 조절 요소를 포함하는 진핵생물 발현 벡터
CA1310601C (en) Expression vectors
US20030232414A1 (en) Hybrid vector having a cytomegalovirus enhancer and myeloproliferative sarcoma virus promoter
US20070134795A1 (en) Flp-mediated recombination
HK1084690B (en) An expression cassette and vector for transient or stable expression of exogenous molecules
EP1325138A2 (en) Optimized messenger rna

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: P-2005/0614

Country of ref document: YU

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
COP Corrected version of pamphlet

Free format text: PAGES 1/17-17/17, DRAWINGS, REPLACED BY NEW PAGES 1/15-15/15; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

WWE Wipo information: entry into national phase

Ref document number: 2515481

Country of ref document: CA

Ref document number: 170178

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 200506413

Country of ref document: ZA

Ref document number: PA/a/2005/008523

Country of ref document: MX

Ref document number: 3579/DELNP/2005

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2006141625

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10545420

Country of ref document: US

Ref document number: 2006503592

Country of ref document: JP

Ref document number: 1020057014937

Country of ref document: KR

Ref document number: 378110

Country of ref document: PL

WWE Wipo information: entry into national phase

Ref document number: 2004711259

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2004213797

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 542316

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 8979

Country of ref document: GE

Ref document number: 200501296

Country of ref document: EA

ENP Entry into the national phase

Ref document number: 2004213797

Country of ref document: AU

Date of ref document: 20040213

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004213797

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 20048101473

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 1020057014937

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2004711259

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 1-2005-501489

Country of ref document: PH

ENP Entry into the national phase

Ref document number: PI0407487

Country of ref document: BR

WWP Wipo information: published in national office

Ref document number: 542316

Country of ref document: NZ

WWP Wipo information: published in national office

Ref document number: 10545420

Country of ref document: US