WO2003030826A2 - Antisense modulation of insulin-like growth factor binding protein 5 expression - Google Patents

Antisense modulation of insulin-like growth factor binding protein 5 expression Download PDF

Info

Publication number
WO2003030826A2
WO2003030826A2 PCT/US2002/032060 US0232060W WO03030826A2 WO 2003030826 A2 WO2003030826 A2 WO 2003030826A2 US 0232060 W US0232060 W US 0232060W WO 03030826 A2 WO03030826 A2 WO 03030826A2
Authority
WO
WIPO (PCT)
Prior art keywords
growth factor
acid
insulin
binding protein
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2002/032060
Other languages
English (en)
French (fr)
Other versions
WO2003030826A3 (en
Inventor
Susan M. Freier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US10/491,712 priority Critical patent/US20050049211A1/en
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to CA2463521A priority patent/CA2463521C/en
Priority to AU2002334895A priority patent/AU2002334895B2/en
Priority to IL16127702A priority patent/IL161277A0/xx
Priority to AT02800945T priority patent/ATE516364T1/de
Priority to EP02800945A priority patent/EP1442140B1/en
Priority to JP2003533860A priority patent/JP2005506066A/ja
Priority to HU0402327A priority patent/HU228976B1/hu
Publication of WO2003030826A2 publication Critical patent/WO2003030826A2/en
Publication of WO2003030826A3 publication Critical patent/WO2003030826A3/en
Priority to IL161277A priority patent/IL161277A/en
Anticipated expiration legal-status Critical
Priority to IL194382A priority patent/IL194382A/en
Priority to IL194383A priority patent/IL194383A/en
Priority to IL206258A priority patent/IL206258A0/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22Hormones
    • A61K38/28Insulins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/582Recycling of unreacted starting or intermediate materials

Definitions

  • the present invention provides compositions and methods for modulating the expression of insulin-like growth factor binding protein 5.
  • this invention relates to compounds, particularly oligonucleotides, specifically hybridizable with nucleic acids encoding insulin-like growth " factor binding protein 5. Such compounds have been shown to modulate the expression of insulin-like growth factor binding protein 5.
  • the insulin-like growth factor (IGF) family includes insulin-like growth factors type I and II (IGF-I and IGF-II) which are structurally related to pro-insulin. IGFs act as potent mitogens to regulate somatic growth, cellular proliferation, and cellular differentiation. Their action is determined by the availability of free IGFs to interact with IGF receptors. The level of free IGFs in a cell is modulated by the rate of IGF production and clearance, and also by their interaction with insulin-like growth factor binding proteins (IGFBPs) and IGFBP-related proteins (IGFBP-rPs) (Wetterau et al., Mol . Genet . Metab. , 1999, 68, 161-181).
  • IGFBPs insulin-like growth factor binding proteins
  • IGFBP-rPs IGFBP-related proteins
  • the superfamily of insulin-like growth factor binding proteins comprises six IGFBPs that bind to IGFs with high affinity, and an emerging group of nine IGFBP-related proteins which bind to IGFs with lower affinity. Cleavage of IGFBPs by proteases also modulates the levels and the action of free IGFs and IGFBPs . IGFBPs not only regulate IGF action and bioavailability, but also appear to mediate IGF-independent actions including inhibition or enhancement of cell growth and induction of apoptosis. The growth inhibitory effects of sequestration by IGFBPs are evidenced when they competitively bind IGFs and modulate their interactions with type I IGF cell surface receptors (Wetterau et al., Mol . Genet . Metab.
  • rat insulin-like growth factor binding protein 5 also known as insulin-like growth factor binding protein 5 precursor, IGF- binding protein 5, IGFBP5, igfbp-5, and IBP5
  • IGFBP5 insulin-like growth factor binding protein 5 precursor
  • IGFBP5 insulin-like growth factor binding protein 5 precursor
  • IGFBP5 insulin-like growth factor binding protein 5 precursor
  • IGFBP5 insulin-like growth factor binding protein 5 precursor
  • IGFBP5 insulin-like growth factor binding protein 5 precursor, IGF- binding protein 5, IGFBP5, igfbp-5, and IBP5
  • the human genes for insulin-like growth factor binding protein 5 and insulin-like growth factor binding protein 2 are physically linked, as are the homologous mouse genes, which colocalize on mouse chromosome 1 in a region of synteny with the human chromosomal locus 2q33-q36 (Kou et al . , Genomics, 1994, 21 , 653- 655) .
  • the human gene was mapped to chromosome 2 using a panel of somatic cell hybrids, and by fluorescence in si tu hybridization to the 2q33-q34 locus (Allander et al . , J " . Biol . Chem. , 1994, 269, 10891-10898) .
  • WO 92/03470 and WO 92/03471 Disclosed and claimed in the PCT publications WO 92/03470 and WO 92/03471 are recombinant DNA molecules encoding insulinlike growth factor binding protein 5 and subsequences thereof, microorganisms and cell lines containing said molecules, methods for preparing insulin-like growth factor binding protein 5 from these, and the purified protein itself, as well as antibodies to the protein and derivatives thereof (Kiefer and Masiarz, 1992; Kiefer et al . , 1992) .
  • Insulin-like growth factor binding protein 5 is the main IGFBP expressed in the kidney and it is found in substantial amounts in connective tissues and cerebrospinal fluid. Serum levels of insulin-like growth factor binding protein 5 also decrease with age, starting after puberty. Levels in older women are 30% of those of teenagers (Wetterau et al . , Mol . Genet . Metab. , 1999, 68, 161-181).
  • Insulin-like growth factor binding protein 5 has several unique features that suggest it is a key component of the IGF system in bone. Bone cells produce large amounts of insulin-like growth factor binding protein 5, but levels decrease during maturation due to protease activity. Unlike other IGFBPs, insulin-like growth factor binding protein 5 has a high specific binding affinity for hydroxyapatite and extracellular matrix proteins, and thus it is stored in abundance within bone. It appears to act as a growth factor, stimulating bone formation via a mechanism independent of IGF-I, an effect specific for insulin-like growth factor binding protein 5 and not other
  • IGFBPs The only IGFBP shown to stimulate osteoblast cell proliferation in vi tro .
  • a significant age-related decrease in insulin-like growth factor binding protein 5 could contribute in part to the age-related impairment in the coupling of bone formation to resorption (Miyakoshi et al . , J ⁇ Clin . Invest . , 2001, 207, 73-81).
  • Insulin-like growth factor binding protein 5 is a component of a ternary complex in human serum.
  • the other two components of this complex are an insulin-like growth factor and a glycoprotein known as the acid labile subunit (ALS) .
  • ALS acid labile subunit
  • formation of this ternary complex stabilizes insulin-like growth factor binding protein 5 levels and is hypothesized to provide a circulating reservoir of insulin-like growth factor binding protein 5 and IGFs, implying a previously unrecognized form of IGF transport and delivery in the circulation and a novel mechanism for regulating its bioavailability (Twigg and Baxter, J. Biol . Chem. , 1998, 273 , 6074-6079) .
  • a basic carboxyl-terminal domain of the protein is the principal site in insulin-like growth factor binding protein 5 responsible for ALS binding (Twigg et al . , J. Biol . Chem. , 1998, 273, 28791-28798).
  • Insulin-like growth factor binding protein 5 has also been implicated in prostate cancer progression (Miyake et al . , Cancer Res . , 2000, 60, 3058-3064), is expressed with high frequency in neuroendocrine tumors (Wulbrand et al . , Eur. J. Clin . Invest .
  • insulin-like growth factor binding protein 5 activity and/or expression is therefore believed to be an appropriate point of therapeutic intervention in developmental or growth disorders, and in pathological conditions such as cancer, colitis, Duchenne muscular dystrophy, diabetes and other metabolic diseases, such as osteoporosis and osteopetrosis .
  • Antisense mediated inhibition of insulin-like growth factor binding protein 5 has been utilized as an investigative tool to elucidate its mitogenic action in IGF signal transduction pathways and as a therapeutic agent for prostate cancer progression in a mouse model (Miyake et al . , Cancer Res . , 2000, 60, 3058-3064) .
  • a phosphorothioate antisense oligonucleotide 18 nucleotides in length and complementary to the translation initiation site of the mouse insulin-like growth factor binding protein 5 mRNA, was used to inhibit its expression and show that the mouse insulin-like growth factor binding protein 5, which is up-regulated after castration, potentiates IGF-I activity and accelerates progression to androgen independence.
  • Mice bearing androgen-dependent Shionogi prostate tumors were temporally delayed in their progression to androgen independence and recurrence of androgen independent tumors was inhibited when this antisense oligonucleotide was administered systemically (Miyake et al . , Cancer Res . , 2000, 60, 3058-3064).
  • insulin-like growth factor binding protein 5 cDNA was cloned in the antisense orientation with respect to the Moloney sarcoma virus promoter in an expression vector.
  • This construct was used to produce antisense sequences complementary to the mRNA for investigation of the role of insulin-like growth factor binding protein 5 in autocrine secretion by C2 myoblasts.
  • Myoblasts expressing the insulin-like growth factor binding protein 5 antisense transcript differentiate prematurely and more extensively than control cells, consistent with a model in which insulin-like growth factor binding protein 5 blocks IGF-sti ulated myogenesis.
  • a possible mechanism of action involves sequestration of IGFs in the extracellular matrix (James et al . , J. Cell Biol . , 1996, 133 , 683-693).
  • a phosphorothioate antisense oligonucleotide 15 nucleotides in length and complementary to a region of the mRNA encompassing the start codon, was used to inhibit expression of insulin-like growth factor binding protein 5 and show that insulin-like growth factor binding protein 5 acts as a diffusible factor to sequester IGFs and/or other growth factors to downregulate Duchenne muscular dystrophy (DMD) myoblast proliferation (Melone et al., J " . Cell Physiol . , 2000, 185, 143- 153) .
  • DMD Duchenne muscular dystrophy
  • a phosphorothioate antisense oligonucleotide 21 nucleotides in length and complementary to nucleotides 813-834 of Genbank Accession NM_000599, has been used in two studies to inhibit the expression of insulin-like growth factor binding protein 5.
  • expression of insulin-like growth factor binding protein 5 is induced by the antiestrogen ICI 182780 and that insulin-like growth factor binding protein 5 assists the drug in inhibiting proliferation of MCF-7 breast cancer cells (Huynh et al . , Cell Growth Differ. , 1996, 7, 1501- 1506) .
  • WO 01/05435 Disclosed and claimed in PCT Publication WO 01/05435 is a method for treating hormone-regulated tumors (for example breast and prostatic tumors) in mammals including humans, by administration of antisense oligonucleotides.
  • the antisense oligonucleotides disclosed are designed to target the murine and human insulin-like growth factor binding protein 5 genes (Gleave, 2001) .
  • Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of insulin-like growth factor binding protein 5 expression.
  • the present invention provides compositions and methods for modulating insulin-like growth factor binding protein 5 expression.
  • the present invention is directed to compounds, particularly antisense oligonucleotides, which are targeted to a nucleic acid encoding insulin-like growth factor binding protein 5, and which modulate the expression of insulin-like growth factor binding protein 5.
  • Pharmaceutical and other compositions comprising the compounds of the invention are also provided.
  • methods of modulating the expression of insulin-like growth factor binding protein 5 in cells or tissues comprising contacting said cells or tissues with one or more of the antisense compounds or compositions of the invention.
  • methods of treating an animal, particularly a human, suspected of having or being prone to a disease or condition associated with expression of insulin-like growth factor binding protein 5 by administering a therapeutically or prophylactically effective amount of one or more of the antisense compounds or compositions of the invention.
  • the present invention employs oligomeric compounds, particularly antisense oligonucleotides, for use in modulating the function of nucleic acid molecules encoding insulin-like growth factor binding protein 5, ultimately modulating the amount of insulin-like growth factor binding protein 5 produced.
  • This is accomplished by providing antisense compounds which specifically hybridize with one or more nucleic acids encoding insulin-like growth factor binding protein 5.
  • target nucleic acid and nucleic acid encoding insulin-like growth factor binding protein 5" encompass DNA encoding insulin-like growth factor binding protein 5, RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA.
  • RNA including pre-mRNA and mRNA
  • antisense means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation of gene expression and mRNA is a preferred target .
  • Targeting an antisense compound to a particular nucleic acid is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding insulin-like growth factor binding protein 5.
  • the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
  • a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5 ' -AUG (in transcribed mRNA molecules; 5 ' -ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the "start codon” or the "AUG start codon”.
  • translation initiation codon having the RNA sequence 5'-GUG, 5 ' -UUG or 5' -CUG, and 5 ' -AUA, 5 ' -ACG and 5 ' -CUG have been shown to function in vivo .
  • the terms "translation initiation codon” and "start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes) .
  • start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding insulin-like growth factor binding protein 5, regardless of the sequence (s) of such codons.
  • a translation termination codon (or "stop codon”) of a gene may have one of three sequences, i.e., 5 ' -UAA, 5 ' -UAG and 5 ' -UGA (the corresponding DNA sequences are 5 ' -TAA, 5 ' -TAG and 5 ' -TGA, respectively).
  • start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3 ' ) from a translation termination codon.
  • Other target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5 ' direction from the translation initiation codon, and thus including nucleotides between the 5 ' cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3 ' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3 ' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3 ' end of an mRNA or corresponding nucleotides on the gene.
  • 5'UTR 5' untranslated region
  • 3'UTR known in the art to refer to the portion of an mRNA in the 3 ' direction from the translation termination cod
  • the 5' cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5'- most residue of the mRNA via a 5' -5' triphosphate linkage.
  • the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap.
  • the 5 ' cap region may also be a preferred target region .
  • introns which are excised from a transcript before it is translated.
  • the remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence.
  • mRNA splice sites i.e., intron-exon junctions
  • intron-exon junctions may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease.
  • Aberrant fusion junctions due to rearrangements or deletions are also preferred targets.
  • introns can also be effective, and therefore preferred, target regions for antisense compounds targeted, for example, to DNA or pre-mRNA. Once one or more target sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
  • adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
  • “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleotides.
  • oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position.
  • the oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target.
  • an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybrr dizable.
  • An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological, conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
  • Antisense and other compounds of the invention which hybridize to the target and inhibit expression of the target are identified through experimentation, and the sequences of these compounds are hereinbelow identified as preferred embodiments of the invention.
  • the target sites to which these preferred sequences are complementary are hereinbelow referred to as "active sites” and are therefore preferred sites for targeting. Therefore another embodiment of the invention encompasses compounds which hybridize to these active sites.
  • Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with 17, specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
  • the antisense compounds of the present invention can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
  • Expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns .
  • Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett . , 2000, 480, 17-24; Celis, et al . , FEBS Lett .
  • Electrophoresis 1999, 20, 2100-10) , expressed sequence tag (EST) sequencing (Celis, et al . , FEBS Lett . , 2000, 480, 2-16; Larsson, et al . , J. Biotechnol . , 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs, et al . , Anal . Biochem. , 2000, 286, 91-98; Larson, et al . , Cytometry, 2000, 41, 203-208), subtractive cloning, differential display (DD) (Jurecic and Belmont, Curr. Opin . Microbiol .
  • EST expressed sequence tag
  • Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man.
  • Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligonucleotides can be useful- therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly.
  • backbone covalent internucleoside
  • modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • antisense oligonucleotides are a preferred form of antisense compound
  • the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below.
  • the antisense compounds in accordance with this invention preferably comprise from about 8 to about 50 nucleobases (i.e. from about 8 to about 50 linked nucleosides) .
  • Particularly preferred antisense compounds are antisense oligonucleotides, even more preferably those comprising from about 12 to about 30 nucleobases.
  • Antisense compounds include ribozymes, external guide sequence (EGS) oligonucleotides (oligozymes) , and other short catalytic RNAs or catalytic oligonucleotides which hybridize to the target nucleic acid and modulate its expression.
  • a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines .
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to either the 2', 3' or 5 ' hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
  • the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
  • the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • oligonucleotides containing modified backbones or non-natural internucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides .
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphoro- dithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 ' -alkylene phosphonates, 5 ' -alkylene phosphonates and chiral phosphonates, phosphinates , phosphoramidates including 3 ' -amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates , thionoalkyl- phosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3 '-5' linkages, 2 '-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3 ' to 3 ' , 5 ' to 5
  • Preferred oligonucleotides having inverted polarity comprise a single 3 ' to 3 ' linkage at the 3 ' -most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof) .
  • Various salts, mixed salts and free acid forms are also included.
  • Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, ixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • i.i include those having morpholino linkages (formed in part from the sugar portion of a nucleoside) ; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, 0, S and CH 2 component parts.
  • oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938, 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307, 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; ' 5,610,289; 5,618,704; 5,623,070; 5,663,312, 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5, 677 , 439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
  • both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) .
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S.:
  • oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular - CH 2 -NH-0-CH 2 - , -CH 2 -N(CH 3 )-0-CH 2 - [known as a methylene (methylimino) or MMI backbone] , -CH 2 -0-N(CH 3 ) -CH 2 -, -CH 2 -N(CH 3 )- N(CH 3 )-CH 2 - and -0-N(CH 3 ) -CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as -0-P-0-CH 2 -] of the above reference
  • Modified oligonucleotides may also contain one or more substituted sugar moieties.
  • Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; 0-, S-, or N- alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-0- alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • Particularly preferred are 0[ (CH 2 ) n O] m CH 3 , 0(CH 2 ) n OCH 3 , 0(CH 2 ) n NH 2 , 0(CH 2 ) n CH 3 , 0(CH 2 ) n 0NH 2 , and 0 (CH 2 ) n ON[ (CH 2 ) n CH 3 ) ] 2 , where n and are from 1 to about 10.
  • oligonucleotides comprise one of the following at the 2' position: C x to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, 0- alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , 0CF 3 , S0CH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • a preferred modification includes 2 ' -methoxyethoxy (2'-0-CH 2 CH 2 0CH 3 , also known as 2 ' -O- (2-methoxyethyl) or 2 ' -MOE) (Martin et al . , Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group.
  • a further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a 0 (CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMA0E, as described in examples hereinbelow, and 2'- di ethylaminoethoxyethoxy (also known in the art as 2 ' -O- dimethylaminoethoxyethyl or 2*-DMAE0E), i.e., 2 ' -0-CH 2 -0-CH 2 - N(CH 2 ) 2 , also described in examples hereinbelow.
  • 2'-dimethylaminooxyethoxy i.e., a 0 (CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMA0E, as described in examples hereinbelow
  • 2'- di ethylaminoethoxyethoxy also known in the art as 2 ' -O- dimethylaminoeth
  • a further prefered modification includes Locked Nucleic Acids (LNAs) in which the 2 ' -hydroxyl group is linked to the 3' or 4 ' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.
  • the linkage is preferably a methelyne (-CH 2 -) n group bridging the 2 ' oxygen atom and the 4 ' carbon atom wherein n is 1 or 2.
  • LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
  • Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobases include the purine bases adenine (A) and guanine (G) , and the pyrimidine bases thymine (T) , cytosine (C) and uracil (U) .
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C) , 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8- a ino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted
  • nucleobases include tricyclic pyri idines such as phenoxazine cytidine (lH-pyrimido [5, 4-b] [1, 4]benzoxazin-2 (3H) - one), phenothiazine cytidine (lH-pyrimido [5, 4- b] [1, 4]benzothiazin-2 (3H) -one) , G-clamps such as a substituted phenoxazine cytidine (e.g.
  • nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
  • nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al . , Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. , ed. , CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
  • 5-substituted pyrimidines include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B. , eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2 ' -0- ethoxyethyl sugar modifications.
  • oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
  • the compounds of the invention can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups.
  • Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugates groups include cholesterols, lipids, phospho- lipids, biotin, phenazine, folate, phenanthridine, anthra- quinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA.
  • Groups that enhance the pharmacokinetic properties include groups that improve oligomer uptake, distribution, metabolism or excretion.
  • Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl . Acad. Sci . USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let . , 1994, 4 , 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al . , Ann . N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al . , Bioorg . Med. Chem.
  • lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl . Acad. Sci . USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bio
  • a phospholipid e.g., di-hexadecyl-rac-glycerol or triethyl- ammonium 1, 2-di-0-hexadecyl-rac-glycero-3-H-phosphonate
  • Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) -pranoprofen, carprofen, dansylsarcosine, 2, 3 , 5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in United States Patent Application 09/334,130 (filed June 15, 1999) which is incorporated herein by reference in its entirety.
  • the present invention also includes antisense compounds which are chimeric compounds.
  • "Chimeric” antisense compounds or “chimeras, " in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
  • oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
  • An additional region of the oligonucleotide may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA: RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA: DNA duplex.
  • RNA target Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxyoligonucleotides hybridizing to the same target region.
  • Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers . Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S.:
  • the antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA) . Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives .
  • the antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
  • the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents .
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug versions of the oligonucleotides of the invention are prepared as SATE [ (S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al . , published December 9, 1993 or in WO 94/26764 and U.S. 5,770,713 to Imbach et al .
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines .
  • metals used as cations are sodium, potassium, magnesium, calcium, and the like.
  • suitable amines are N,N' -dibenzylethylenedia ine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al . , "Pharmaceutical Salts," J “ . of Pharma Sci . , 1977, 66, 1-19).
  • the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
  • the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
  • the free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention.
  • a "pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or xnorganxc acid salts of the amines .
  • Preferred acid salts are the hydrochlorides , acetates, salicylates, nitrates and phosphates.
  • Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinna ic acid, mandelic acid, salicylic acid, 4-aminosal
  • Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
  • Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible.
  • salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.
  • acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like
  • salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acil, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalactur
  • the antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits.
  • an animal preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of insulinlike growth factor binding protein 5 is treated by administering antisense compounds in accordance with this invention.
  • the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
  • Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.
  • the antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding insulin-like growth factor binding protein 5, enabling sandwich and other assays to easily be constructed to exploit this fact.
  • Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding insulin-like growth factor binding protein 5 can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabellxng of the oligonucleotide or any other suitable detection means. Kits using such detection means for detecting the level of insulin-like growth factor binding protein 5 in a sample may also be prepared.
  • the present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention.
  • the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial , e.g., intrathecal or intraventricular, administration.
  • Oligonucleotides with at least one 2 ' -0-methoxyethyl modification are believed to be particularly useful for oral administration.
  • compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful .
  • Preferred topical formulations include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • Preferred lipids and liposomes include neutral (e.g.
  • dioleoylphosphatidyl DOPE ethanolamine dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA) .
  • Oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes.
  • oligonucleotides may be complexed to lipids, in particular to cationic lipids.
  • Preferred fatty acids and esters include but are not limited arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, l-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C ⁇ _ ⁇ o alkyl ester (e.g.
  • compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non- aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators.
  • Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
  • Prefered bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA) , cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24, 25-dihydro-fusidate, sodium glycodihydrofusidate, .
  • DCA chenodeoxycholic acid
  • UDCA ursodeoxychenodeoxycholic acid
  • Prefered fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, l-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g. sodium) .
  • arachidonic acid e.g. sodium
  • penetration enhancers for example, fatty acids/salts in combination with bile acids/salts.
  • a particularly prefered combination is the sodium salt of lauric acid, capric acid and UDCA.
  • Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
  • Oligonucleotides of the invention may be delivered orally in granular form including sprayed dried particles, or complexed to form micro or nanoparticles .
  • Oligonucleotide complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches.
  • Particularly preferred complexing agents include chitosan, N-trimethylchitosan, poly-L- lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylamino-methylethylene P(TDAE), polyaminostyrene (e.g.
  • polystyrene resin poly(methylcyanoacrylate) , poly (ethylcyanoacrylate) , poly (butylcyanoacrylate) , poly (isobutylcyanoacrylate) , poly (isohexylcynaoacrylate) , DEAE- methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly (D,L-lactic acid), poly (DL-lactic-co-glycolic acid (PLGA) , alginate, and polyethyleneglycol (PEG) .
  • compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients .
  • compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self- emulsifying semisolids.
  • compositions of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier (s) or excipient (s) . In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • the compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas.
  • the compositions of the present invention may also be formulated as suspensions in aqueous, non- aqueous or mixed media.
  • Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension may also contain stabilizers.
  • the pharmaceutical compositions may be formulated and used as foams.
  • Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product. The preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.
  • compositions of the present invention may be prepared and formulated as emulsions.
  • Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ in diameter.
  • Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
  • emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety.
  • Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and antioxidants may also be present in emulsions as needed.
  • compositions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
  • Such complex formulations often provide certain advantages that simple binary emulsions do not.
  • Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
  • a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.
  • Emulsions are characterized by little or no thermodynamic stability.
  • the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation.
  • Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams.
  • Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion.
  • Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
  • Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms , Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y. , 1988, volume 1, p. 199) .
  • Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
  • HLB hydrophile/lipophile balance
  • surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
  • Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
  • Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations.
  • polar inorganic solids such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
  • non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in
  • Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth) , cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose) , and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers) . These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
  • polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
  • cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
  • synthetic polymers for example, carbomers,
  • emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives.
  • preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p- hydroxybenzoic acid, and boric acid.
  • Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
  • Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
  • antioxidant synergists such as citric acid, tartaric acid, and lecithin.
  • Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint.
  • Rosoff in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y. , volume 1, p. 199
  • Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.
  • compositions of oligonucleotides and nucleic acids are formulated as microemulsions .
  • a microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution
  • microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system.
  • microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in : Controlled Release of Drugs : Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215).
  • Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte.
  • microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington ' s Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271) .
  • microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
  • Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310) , tetraglycerol monooleate (MO310) , hexaglycerol monooleate (PO310) , hexaglycerol pentaoleate (PO500) , decaglycerol monocaprate (MCA750) , decaglycerol monooleate (MO750) , decaglycerol sequioleate (SO750) , decaglycerol decaoleate (DAO750) , alone or in combination with cosurfact
  • the cosurfactant usually a short-chain alcohol such as ethanol, 1- propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
  • Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying icroemulsion systems are known in the art.
  • the aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol.
  • the oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
  • Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al . , Pharmaceutical Research, 1994, 11 , 1385-1390; Ritschel, Meth. Find. Exp . Clin . Pharmacol . ,
  • Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al . , Pharmaceutical Research, 1994, 11 , 1385; Ho et al . , J. Pharm. Sci . , 1996, 85, 138-143) . Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides.
  • Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.
  • Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention.
  • Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants (Lee et al . , Cri tical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92) . Each of these classes has been discussed above.
  • liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
  • Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo .
  • lipid vesicles In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.
  • liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y. , volume 1, p. 245) .
  • Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes .
  • Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes . As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
  • Liposomes have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations . Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin. Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.
  • Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively cnarge ⁇ cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their cor tents into the cell cytoplasm (Wang et al . , Biochem . Biophys . Res . Commun . , 1987, 147, 980-985). Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs.
  • pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al . , Journal of Controlled Release, 1992, 19, 269-274) .
  • liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
  • Neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC) .
  • Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol , while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE) .
  • Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
  • PC phosphatidylcholine
  • Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
  • Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
  • Non-ionic liposomal formulations comprising NovasomeTM I (glyceryl dilaurate/cholesterol/polyoxyethylene-10- stearyl ether) and NovasomeTM II (glyceryl distearate/ cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al . S. T. P. Pharma . Sci . , 1994, 4, 6, 466) .
  • Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
  • sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G H1 , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • PEG polyethylene glycol
  • liposomes comprising (1) sphingomyelin and (2) the ganglioside G H1 or a galactocerebroside sulfate ester.
  • U.S. Patent No. 5,543,152 discloses liposomes comprising sphingomyelin. Liposomes comprising 1 , 2-sn- dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al . ) .
  • liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art.
  • Sunamoto et al . (Bull . Chem. Soc. Jpn . , 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C 12 15G, that contains a PEG moiety.
  • Ilium et al . (FEBS Lett . , 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives.
  • Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols e. g.
  • DSPE-PEG formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG.
  • DSPE distearoylphosphatidylethanolamine
  • PEG distearoylphosphatidylethanolamine
  • Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 Bl and WO 90/04384 to Fisher.
  • Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al . (U.S. Patent Nos. 5,013,556 and 5,356,633) and Martin et al . (U.S. Patent No: 5,213,804 and European Patent No. EP 0 496 813 Bl) .
  • Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Patent No. 5,225,212 (both to Martin et al . ) and in WO 94/20073 (Zalipsky et al . )
  • Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al . ) .
  • U.S. Patent Nos. 5,540,935 (Miyazaki et al . ) and 5,556,948 (Tagawa et al . ) describe PEG- containing liposomes that can be further derivatized with functional moieties on their surfaces.
  • a limited number of liposomes comprising nucleic acids are known in the art.
  • WO 96/40062 to Thierry et al discloses methods for encapsulating high molecular weight nucleic acids in liposomes.
  • U.S. Patent No. 5,264,221 to Tagawa et al discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA.
  • U.S. Patent No. 5,665,710 to Rahman et al . describes certain methods of-, encapsulating oligodeoxynucleotides in liposomes.
  • WO 97/04787 to Love et al discloses liposomes comprising antisense oligonucleotides targeted to the raf gene.
  • Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e . g. they are self- optimizing (adaptive to the shape of pores in the skin) , self- repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin.
  • the transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
  • Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes.
  • the most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB) .
  • HLB hydrophile/lipophile balance
  • the nature of the hydrophilic group also known as the "head" provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).
  • Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure.
  • Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters .
  • Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
  • The. polyoxyethylene surfactants are the most popular members of the nonionic surfactant class. If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic.
  • Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates .
  • the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
  • Cationic surfactants include quaternary ammonium salts and ethoxylated amines .
  • the quaternary ammonium salts are the most used members of this class.
  • amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides .
  • the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides, to the skin of animals.
  • nucleic acids particularly oligonucleotides
  • Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
  • Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al . , Cri tical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92) . Each of the above mentioned classes of penetration enhancers are described below in greater detail.
  • surfactants are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced.
  • these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al . , Cri tical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43.
  • Fatty acids Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid) , myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol) , dilaurin, caprylic acid, arachidonic acid, glycerol 1- onocaprate, l-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C ⁇ alkyl esters thereof ( e.
  • Bile salts The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat- soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, ,9th Ed., Hardman et al . Eds., McGraw-Hill, New York, 1996, pp. 934-935).
  • the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
  • the bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate) , dehydrocholic acid (sodium dehydrocholate) , deoxycholic acid (sodium deoxycholate) , glucholic acid (sodium glucholate) , glycholic acid (sodium glycocholate) , glycodeoxycholic acid (sodium glycodeoxycholate) , taurocholic acid (sodium taurocholate) , taurodeoxycholic acid (sodium taurodeoxycholate) , chenodeoxycholic acid (sodium chenodeoxycholate) , ursodeoxycholic acid (UDCA) , sodium tauro- 24, 25-dihydro-fusidate (STDHF) , sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al . , Cri tical Reviews in
  • Chelating agents can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced.
  • chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr. , 1993, 618, 315-339).
  • Chelating agents of the invention include but are not limited to disodium ethylenediaminetetraacetate (EDTA) , citric acid, salicylates (e . g. , sodium salicylate, 5-methoxysalicylate and homovanilate) , I7-acyl derivatives of collagen, laureth-9 and iV-amino acyl derivatives of beta-diketones (enamines) (Lee et al . , Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Cri tical Reviews in Therapeutic Drug Carrier Systems,
  • Non-chelating non-surfactants can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33) .
  • This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1- alkenylazacyclo-alkanone derivatives (Lee et al .
  • non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al . , J. Pharm. Pharmacol . , 1987, 39, 621-626).
  • Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention.
  • cationic lipids such as lipofectin (Junichi et al , U.S. Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al . , PCT Application WO 97/30731) , are also known to enhance the cellular uptake of oligonucleotides .
  • agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
  • glycols such as ethylene glycol and propylene glycol
  • pyrrols such as 2-pyrrol
  • azones such as 2-pyrrol
  • terpenes such as limonene and menthone.
  • compositions of the present invention also incorporate carrier compounds in the formulation.
  • carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
  • carrier compound can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
  • the coadministration of a nucleic acid and a carrier compound typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney
  • the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4 ' isothiocyano- 0 stilbene-2,2 '-disulfonic acid (Miyao et al . , Antisense Res .
  • a "pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
  • the excipient may be liquid or solid and is selected, with the 0 planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc. , when combined with a nucleic acid and the other components of a given pharmaceutical composition.
  • Typical pharmaceutical carriers include, but are not limited to, binding agents ( e . g.
  • pregelatinized maize 5 starch polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.
  • fillers e.g., lactose and other sugars, microcrystalline cellulose t pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.
  • lubricants e.g., magnesium stearate, talc, silica, colloidal silicon 0 dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.
  • compositions of the present invention can also be used to formulate the compositions of the present invention.
  • suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non- aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
  • the solutions may also contain buffers, diluents and other suitable additives.
  • Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
  • Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
  • the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • additional materials useful in physically formulating various dosage forms of the compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • auxiliary agents e. g.
  • Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension may also contain stabilizers.
  • Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
  • chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis- chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, de
  • chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide) , or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide) .
  • chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide) , or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide) .
  • Anti-inflammatory drugs including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al . , eds., 1987, Rahway, N.J. , pages 2499-2506 and 46-49, respectively). Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
  • compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target .
  • antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • the formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient .
  • Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 s found to be effective in in vitro and in vivo animal models . In general, dosage is from 0.01 ug to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
  • oligonucleotide is administered in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • 2'-Deoxy and 2 ' -methoxy beta-cyanoethyldiisopropyl, phosphoramidites were purchased from commercial sources (e.g. Chemgenes, Needham MA or Glen Research, Inc. Sterling VA) .
  • Other 2 ' -0-alkoxy substituted nucleoside amidites are prepared as described in U.S. Patent 5,506,351, herein incorporated by reference.
  • the standard cycle for unmodified oligonucleotides was utilized, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds.
  • Oligonucleotides containing 5-methyl-2 ' -deoxycytidine (5- Me-C) nucleotides were synthesized according to published methods [Sanghvi, et. al . , Nucleic Acids Research, 1993, 21 , 3197-3203] using commercially available phosphoramidites (Glen Research, Sterling VA or ChemGenes, Needham MA) .
  • 2 '-fluoro oligonucleotides were synthesized as described previously [Kawasaki, et. al . , J. Med. Chem. , 1993, 36, 831-841] and United States patent 5,670,633, herein incorporated by reference. Briefly, the protected nucleoside N6-benzoyl-2 ' - deoxy-2 ' -fluoroadenosine was synthesized utilizing commercially available 9-beta-D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-alpha- fluoro atom is introduced by a S H 2-displacement of a 2 ' -beta- trityl group.
  • N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively protected in moderate yield as the 3 ' , 5 ' - ditetrahydropyranyl (THP) intermediate.
  • THP ditetrahydropyranyl
  • Deprotection of the THP and N6-benzoyl groups was accomplished using standard methodologies and standard methods were used to obtain the 5 ' - dimethoxytrityl- (DMT) and 5 ' -DMT-3 ' -phosphoramidite intermediates . 2 ' -Fluorodeoxyguanosine
  • TPDS tetraisopropyldisiloxanyl
  • 2 ' -deoxy-2 ' -fluorocytidine was synthesized via amination of 2 ' -deoxy-2 ' -fluorouridine, followed by selective protection to give N4-benzoyl-2 ' -deoxy-2 ' -fluorocytidine. Standard procedures were used to obtain the 5 ' -DMT and 5 ' -DMT-3 'phosphoramidites .
  • 2 ' -O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504.
  • a first solution was prepared by dissolving 3 ' -O-acetyl-2 ' - O-methoxyethyl-5 ' -0-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH 3 CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH 3 CN (1
  • N4-Benzoyl-2 ' -O-methoxyethyl-5 ' -O-dimethoxytri yl-5-methyl- cytidine (74 g, 0.10 M) was dissolved in CH 2 C1 2 (1 L) .
  • Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra (isopropyl) - phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete) .
  • the reaction mixture was extracted with saturated NaHC0 3 (1x300 mL) and saturated NaCl (3x300 mL) .
  • 2 '- (Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2 ' -0- (dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs.
  • Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.
  • the reaction was stopped, concentrated under reduced pressure (10 to 1mm Hg) in a warm water bath (40-100°C) with the more extreme conditions used to remove the ethylene glycol.
  • a warm water bath 40-100°C
  • the remaining solution can be partitioned between ethyl acetate and water.
  • the product will be in the organic phase.
  • the residue was purified by column chromatography (2kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1) . The appropriate fractions were combined, stripped and dried to product as a white crisp foam (84g, 50%) , contaminated starting material
  • reaction mixture was flushed with argon and dry THF (369.8mL, Aldrich, sure seal bottle) was added to get a clear solution.
  • Diethyl-azodicarboxylate (6.98mL, 44.36mmol) was added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop.
  • the reaction was stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate:hexane, 60:40). The solvent was evaporated in vacuum.
  • Residue obtained was placed on a flash column and eluted with ethyl acetate:hexane (60:40), to get 2 ' -0- ( [2-phthalimidoxy) ethyl] -5 ' - t-butyldiphenylsilyl-5-methyluridine as white foam (21.819 g, 86%) .
  • Residue was dissolved in a solution of IM PPTS in MeOH (30.6mL). Formaldehyde (20% w/w, 30mL, 3.37mmol) was added and the reaction mixture was stirred at room temperature for 10 minutes. Reaction mixture cooled to 10°C in an ice bath, sodium cyanoborohydride (0.39g, 6.13mmol) was added and reaction mixture stirred at 10°C for 10 minutes. After 10 minutes, the reaction mixture was removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHC0 3 (25mL) solution was added and extracted with ethyl acetate (2x25mL) .
  • Triethylamine trihydrofluoride (3.91mL, 24.0mmol) was dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH) .
  • This mixture of triethylamine-2HF was then added to 5 ' -0- ert-butyldiphenylsilyl-2 ' -0- [N,N- dimethylaminooxyethyl] -5-methyluridine ( 1.40g, 2.4mmol) and stirred at room temperature for 24 hrs. Reaction was monitored by TLC (5% MeOH in CH 2 C1 2 ) .
  • reaction mixture was stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction was monitored by TLC (hexane: ethyl acetate 1:1). The solvent was evaporated, then the residue was dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHC0 3 (40mL) . Ethyl acetate layer was dried over anhydrous Na 2 SO d and concentrated. Residue obtained was chromatographed (ethyl acetate as eluent) to get
  • 2 ' - (Aminooxyethoxy) nucleoside amidites [also known in the art as 2 ' -0- (aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.
  • the 2 ' -O-aminooxyethyl guanosine analog may be obtained by selective 2 ' -O-alkylation of diaminopurine riboside.
  • Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2 ' -0- (2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3 ' -0- isomer.
  • 2 ' -O- (2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2 ' -O- (2-ethylacetyl) guanosine by treatment with adenosine deaminase.
  • Standard protection procedures should afford 2 ' -0- (2-ethylacetyl) -5 ' -O- (4, 4 ' -dimethoxytrityl) guanosine and 2-N-isobutyryl-6-0- diphenylcarbamoyl-2 ' -0- (2-ethylacetyl) -5 ' -0- (4,4'- dimethoxytrityl) guanosine which may be reduced to provide 2-N- isobutyryl-6-0-diphenylcarbamoyl-2 ' -0- (2-hydroxyethyl) -5 ' -0- (4, 4 ' -dimethoxytrityl) guanosine.
  • the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-0-diphenylcarbamoyl-2 ' -0- ( [2- phthalmidoxy] ethyl) -5 ' -0- (4,4 ' -dimethoxytrityl) guanosine-3 ' - [ (2- cyanoethyl) -N,N-diisopropylphosphoramidite] .
  • 2 ' -dimethylaminoethoxyethoxy nucleoside amidites (also known in the art as 2 ' -O-dimethylaminoethoxyethyl , i . e . , 2 ' -0- CH 2 -0-CH 2 -N(CH 2 ) 2 , or 2 ' -DMAEOE nucleoside amidites) are prepared as follows. Other nucleoside amidites are prepared similarly.
  • the bomb is cooled to room temperature and opened.
  • the crude solution is concentrated and the residue partitioned between water (200 mL) and hexanes (200 mL) .
  • the excess phenol is extracted into the hexane layer.
  • the aqueous layer is extracted with ethyl acetate (3x200 mL) and the combined organic layers are washed once with water, dried over anhydrous sodium sulfate and concentrated.
  • the residue is columned on silica gel using methanol/methylene chloride 1:20 (which has 2% triethylamine) as the eluent. As the column fractions are concentrated a colorless solid forms which is collected to give the title compound as a white solid.
  • the reaction mixture is poured into water (200 mL) and extracted with CH 2 C1 2 (2x200 mL) .
  • CH 2 C1 2 (2x200 mL)
  • the combined CH 2 C1 2 layers are washed with saturated NaHC0 3 solution, followed by saturated NaCl solution and dried over anhydrous sodium sulfate.
  • Evaporation of the solvent followed by silica gel chromatography using MeOH:CH 2 Cl 2 :Et 3 N (20:1, v/v, with 1% triethylamine) gives the title compound.
  • Diisopropylaminotetrazolide (0.6 g) and 2-cyanoethoxy-N,N- diisopropyl phosphoramidite (1.1 mL, 2 eq. ) are added to a solution of 5 ' -O-dimethoxytrityl-2 ' -0- [2 (2-N,N-dimethylamino- ethoxy) ethyl) ] -5-methyluridine (2.17 g, 3 mmol) dissolved in CH 2 C1 2 (20 mL) under an atmosphere of argon. The reaction mixture is stirred overnight and the solvent evaporated. The resulting residue is purified by silica gel flash column chromatography with ethyl acetate as the eluent to give the title compound.
  • the thiation wait step was increased to 68 sec and was followed by the capping step.
  • oligonucleotides were purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution. Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference.
  • Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference.
  • 3 ' -Deoxy-3 ' -methylene phosphonate oligonucleotides are prepared as described in U.S. Patents 5,610,289 or 5,625,050, herein incorporated by reference.
  • Phosphoramidite oligonucleotides are prepared as described in U.S. Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference.
  • Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively) , herein incorporated by reference.
  • Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incorporated by reference.
  • Borano phosphate oligonucleotides are prepared as described in U.S. Patents 5,130,302 and 5,177,198, both herein incorporated by reference.
  • Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference.
  • Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein incorporated by reference.
  • PNAs Peptide nucleic acids
  • Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the "gap" segment of linked nucleosides is positioned between 5' and 3' "wing" segments of linked nucleosides and a second "open end” type wherein the "gap” segment is located at either the 3' or the 5' terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides . Oligonucleotides of the second type are also known in the art as “hemimers” or "wing ers” .
  • Chimeric oligonucleotides having 2 ' -O-alkyl phosphorothioate and 2 ' -deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 380B, as above. Oligonucleotides are synthesized using the automated synthesizer and 2 ' -deoxy-5 ' - dimethoxytrityl-3 ' -O-phosphoramidite for the DNA portion and 5 ' - dimethoxytrityl-2 ' -O-methyl-3 ' -O-phosphoramidite for 5' and 3' wings.
  • the standard synthesis cycle is modified by increasing the wait step after the delivery of tetrazole and base to 600 s repeated four times for RNA and twice for 2'-0-methyl.
  • the fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3 : 1 ammonia/ethanol at room temperature overnight then lyophilized to dryness.
  • Treatment in methanolic ammonia for 24 hrs at room temperature is then done to deprotect all bases and sample was again lyophilized to dryness.
  • the pellet is resuspended in IM TBAF in THF for 24 hrs at room temperature to deprotect the 2' positions.
  • the reaction is then quenched with IM TEAA and the sample is then reduced to 1/2 volume by rotovac before being desalted on a G25 size exclusion column.
  • the oligo recovered is then analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
  • chimeric oligonucleotides chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to United States patent 5,623,065, herein incorporated by reference.
  • the oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on ⁇ enaturxng gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis were periodically checked by 31 P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol . Chem. 1991, 266, 18162- 18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
  • Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96 well format.
  • Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine.
  • Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
  • Standard base-protected beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial vendors (e.g.
  • Non-standard nucleosides are synthesized as per known literature or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.
  • Oligonucleotides were cleaved from support and deprotected with concentrated NH ⁇ OH at elevated temperature (55-60°C) for 12- 16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
  • oligonucleotide Analysis - 96 Well Plate Format
  • concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy.
  • the full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96 well format (Beck an P/ACETM MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACETM
  • the effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following 4 cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, Ribonuclease protection assays, or RT-PCR.
  • the human transitional cell bladder carcinoma cell line T- 24 was obtained from the American Type Culture Collection (ATCC) (Manassas, VA) .
  • T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD) , penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD) .
  • Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis.
  • cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide .
  • A549 cells The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, VA) .
  • A549 cells were routinely cultured in DMEM basal media (Gibco/Life Technologies, Gaithersburg, MD) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, MD) , penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, MD) . Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.
  • NHDF Human neonatal dermal fibroblast
  • HEK cells Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville MD) . HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville MD) formulated as recommended by the s ⁇ pplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier.
  • HEK Human embryonic keratinocytes
  • the concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations.
  • the positive control oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO:
  • concentration of positive control oligonucleotide that results in 80% inhibition of c-Ha-ras (for ISIS 13920) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line.
  • the lowest concentration of positive control oligonucleotide that results in 60% inhibition of H-ras or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments .
  • Antisense modulation of insulin-like growth factor binding protein 5 expression can be assayed in a variety of ways known in the art.
  • insulin-like growth factor binding protein 5 mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or realtime PCR (RT-PCR) .
  • Real-time quantitative PCR is presently preferred.
  • RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. Methods of RNA isolation are taught in, for example, Ausubel, F . M. et al . , Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993.
  • Protein levels of insulin-like growth factor binding protein 5 can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting) , ELISA or fluorescence-activated cell sorting (FACS) .
  • Antibodies directed to insulin-like growth factor binding protein 5 can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI) , or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in > for example, Ausubel, F.M.
  • Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F.M. et al . , Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997.
  • Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F.M. et al . , Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.
  • Poly (A) + mRNA was isolated according to Miura et al - , Clin . Chem . , 1996, 42, 1758-1764. Other methods for poly(A)+ mRNA isolation are taught in, for example, Ausubel, F.M. et al . , Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1- 4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells grown on 96-we11 plates, growth medium was removed from the cells and each well was washed with 200 ⁇ L cold PBS.
  • lysis buffer (10 M Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 ⁇ L of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine CA) . Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 ⁇ L of wash buffer (10 mM Tris-HCl pH 7.6, 1 M EDTA, 0.3 M NaCl) .
  • the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes.
  • 60 ⁇ L of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70°C was added to each well, the plate was incubated on a 90°C hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.
  • Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
  • Total RNA Isolation Total RNA was isolated using an RNEASY 96TM kit and buffers purchased from Qiagen Inc . (Valencia CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 ⁇ L cold PBS. 100 ⁇ L Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 100 ⁇ L of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY 96TM well plate attached to a QIAVACTM manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 15 seconds.
  • Buffer RW1 1 mL of Buffer RW1 was added to each well of the RNEASY 96TM plate and the vacuum again applied for 15 seconds. 1 mL of Buffer RPE was then added to each well of the RNEASY 96TM plate and the vacuum applied for a period of 15 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 10 minutes. The plate was then removed from the QIAVACTM manifold and blotted dry on paper towels. The plate was then re-attached to the QIAVACTM manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 60 ⁇ L water into each well, incubating 1 minute, and then applying the vacuum for 30 seconds. The elution step was repeated with an additional 60 ⁇ L water .
  • the repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA) . Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
  • Quantitation of insulin-like growth factor binding protein 5 mRNA levels was determined by real-time quantitative PCR using the ABI PRISMTM 7700 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR, in which amplification products are quantitated after the PCR is completed, products' in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes.
  • PCR polymerase chain reaction
  • a reporter dye e.g., JOE, FAM, or VIC, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA
  • a quencher dye e.g., TAMRA, obtained from either Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA
  • reporter dye emission is quenched by the proximity of the 3' quencher dye.
  • annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5 ' -exonuclease activity of Taq polymerase.
  • cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated.
  • additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISMTM 7700 Sequence
  • Detection System In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
  • primer-probe sets specific to the target gene being measured are evaluated for their ability to be "multiplexed" with a GAPDH amplification reaction.
  • multiplexing both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample.
  • mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ( "single-plexing" ) , or both (multiplexing).
  • standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples.
  • the primer-probe set specific for that target is deemed multiplexable.
  • Other methods of PCR are also known in the art.
  • PCR reagents were obtained from PE-Applied Biosystems, Foster City, CA.
  • RT-PCR reactions were carried out by adding 25 ⁇ L PCR cocktail (lx TAQMANTM buffer A, 5.5 mM MgCl 2 , 300 ⁇ M each of dATP, dCTP and dGTP, 600 ⁇ M of dUTP, 100 nM each of forward primer, reverse primer, and probe, 20 Units RNAse inhibitor, 1.25 Units AMPLITAQ GOLDTM, and 12.5 Units MuLV reverse transcriptase) to 96 well plates containing 25 ⁇ L total RNA solution.
  • the RT reaction was carried out by incubation for 30 minutes at 48°C.
  • Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes, Inc. Eugene, OR) .
  • GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately.
  • Total RNA is quantified using RiboGreenTM RNA quantification reagent from Molecular Probes. Methods of RNA quantification by RiboGreenTM are taught in Jones, L. J. , et al, Analytical Biochemistry, 1998, 265, 368-374.
  • RiboGreenTM working reagent 175 ⁇ L of RiboGreenTM working reagent (RiboGreenTM reagent diluted 1:2865 in lOmM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 25uL purified, cellular RNA. The plate is read in a CytoFluor 4000
  • Probes and primers to human insulin-like growth factor binding protein 5 were designed to hybridize to a human insulin-like growth factor binding protein 5 sequence, using published sequence information (GenBank accession number M65062, incorporated herein as SEQ ID NO: 3).
  • the PCR primers were: forward primer: CCAAACACACCCGCATCTC (SEQ ID NO: 4) reverse primer: TTGGACTGGGTCAGCTTCTTTC (SEQ ID NO: 5) and the PCR probe was: FAM-AGGCTGAAGCAGTGAAGAAGGACCGC-TAMRA (SEQ ID NO: 6) where FAM (PE-Applied Biosystems, Foster City, CA) is the fluorescent reporter dye) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quencher dye.
  • PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the PCR probe was : 5 ' JOE-CAAGCTTCCCGTTCTCAGCC- TAMRA 3 ' ( SEQ ID NO : 9 ) where JOE ( PE-Applied Biosystems , Foster City, CA) is the f luorescent reporter dye) and TAMRA ( PE-Applied Biosystems , Foster City, CA) is the quencher dye .
  • JOE PE-Applied Biosystems , Foster City, CA
  • TAMRA PE-Applied Biosystems , Foster City, CA
  • RNAZOLTM TEL- TEST "B” Inc., Friendswood, TX
  • Total RNA was prepared following manufacturer's recommended protocols. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, OH) .
  • a human insulin-like growth factor binding protein 5 specific probe was prepared by PCR using the forward primer CCAAACACACCCGCATCTC (SEQ ID NO: 4) and the reverse primer TTGGACTGGGTCAGCTTCTTTC (SEQ ID NO: 5).
  • membranes were stripped and probed for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA) .
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGERTM and IMAGEQUANTTM Software V3.3 (Molecular
  • oligonucleotides are shown in Table 1. "Target site” indicates the first (5 '-most) nucleotide number on the particular target sequence to which the oligonucleotide binds.
  • All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap” region consisting of ten 2 ' -deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five- nucleotide "wings".
  • the wings are composed of 2 ' -methoxyethyl
  • SEQ ID NOs 13, 14, 15, 16, 17, 18, 19, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 38, 39, 40, 41, 42 and 43 demonstrated at least 50% inhibition of human insulin-like growth factor binding protein 5 expression in this assay and are therefore preferred.
  • the target sites to which these preferred sequences are complementary are herein referred to as "active sites” and are therefore preferred sites for targeting by compounds of the present invention.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/US2002/032060 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression Ceased WO2003030826A2 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
HU0402327A HU228976B1 (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression
CA2463521A CA2463521C (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression
AU2002334895A AU2002334895B2 (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression
IL16127702A IL161277A0 (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression
AT02800945T ATE516364T1 (de) 2001-10-09 2002-10-07 Antisense-modulation der expression des insulinähnlicher-wachstumsfaktor-bindungsprotei s 5
EP02800945A EP1442140B1 (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression
JP2003533860A JP2005506066A (ja) 2001-10-09 2002-10-07 インスリン様成長因子結合タンパク質5発現のアンチセンスモジュレーション
US10/491,712 US20050049211A1 (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression
IL161277A IL161277A (en) 2001-10-09 2004-04-04 Opposite-readable modulation of protein expressions binds 5 insulin-like growth hormone
IL194383A IL194383A (en) 2001-10-09 2008-09-25 Antisense oligonucleotide targeted to insulin-like growth binding protein 5
IL194382A IL194382A (en) 2001-10-09 2008-09-25 An oligonucleotide of the insulin-directed binding protein # 5 of insulin-like growth factor
IL206258A IL206258A0 (en) 2001-10-09 2010-06-09 An antisense oligonucleotide targeted to insulin-like growth factor binding protein 5

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US09/975,123 US6750019B2 (en) 2001-10-09 2001-10-09 Antisense modulation of insulin-like growth factor binding protein 5 expression
US09/975,123 2001-10-09
US10/491,712 US20050049211A1 (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression

Publications (2)

Publication Number Publication Date
WO2003030826A2 true WO2003030826A2 (en) 2003-04-17
WO2003030826A3 WO2003030826A3 (en) 2003-08-07

Family

ID=37772670

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/032060 Ceased WO2003030826A2 (en) 2001-10-09 2002-10-07 Antisense modulation of insulin-like growth factor binding protein 5 expression

Country Status (8)

Country Link
US (2) US6750019B2 (https=)
EP (2) EP1442140B1 (https=)
JP (1) JP2005506066A (https=)
KR (1) KR100622275B1 (https=)
CA (1) CA2463521C (https=)
HU (1) HU228976B1 (https=)
IL (1) IL161277A0 (https=)
WO (1) WO2003030826A2 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005030260A1 (en) * 2003-10-01 2005-04-07 The University Of British Columbia Bispecific oligonucleotide for the treatment of cns malignancies
JP2010207232A (ja) * 2004-01-20 2010-09-24 Isis Parmaceuticals Inc グルココルチコイドレセプター発現の調節
EP1664271B1 (en) * 2003-08-18 2011-06-08 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
US7973017B2 (en) 2002-01-17 2011-07-05 The University Of British Columbia Treatment of cancer by inhibition of IGFBP's and clusterin
EP2222851B1 (en) * 2007-11-20 2017-06-28 Ionis Pharmaceuticals, Inc. Modulation of cd40 expression
EP2806900B1 (en) 2012-01-27 2021-12-15 BioMarin Technologies B.V. Rna modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7491816B2 (en) * 1999-07-19 2009-02-17 The University Of British Columbia Antisense therapy for hormone-regulated tumors
CA2375467C (en) 1999-07-19 2013-10-29 The University Of British Columbia Antisense therapy for hormone-regulated tumors
US20090062914A1 (en) * 2007-08-29 2009-03-05 Marino James F Devices and methods for intervertebral therapy
JP5390179B2 (ja) * 2008-12-24 2014-01-15 花王株式会社 Igfbp−5発現抑制剤
EP3868396A1 (en) * 2020-02-20 2021-08-25 Enthera S.R.L. Inhibitors and uses thereof

Family Cites Families (205)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4426330A (en) 1981-07-20 1984-01-17 Lipid Specialties, Inc. Synthetic phospholipid compounds
US4534899A (en) 1981-07-20 1985-08-13 Lipid Specialties, Inc. Synthetic phospholipid compounds
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
JPS5927900A (ja) 1982-08-09 1984-02-14 Wakunaga Seiyaku Kk 固定化オリゴヌクレオチド
CA1211428A (en) * 1982-09-30 1986-09-16 Joseph F. Porinchak Alumina-silica cogel
FR2540122B1 (fr) 1983-01-27 1985-11-29 Centre Nat Rech Scient Nouveaux composes comportant une sequence d'oligonucleotide liee a un agent d'intercalation, leur procede de synthese et leur application
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (fr) 1984-07-19 1989-02-17 Centre Nat Rech Scient Nouveaux oligonucleotides, leur procede de preparation et leurs applications comme mediateurs dans le developpement des effets des interferons
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5430136A (en) 1984-10-16 1995-07-04 Chiron Corporation Oligonucleotides having selectably cleavable and/or abasic sites
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
FR2575751B1 (fr) 1985-01-08 1987-04-03 Pasteur Institut Nouveaux nucleosides de derives de l'adenosine, leur preparation et leurs applications biologiques
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
JPS638396A (ja) 1986-06-30 1988-01-14 Wakunaga Pharmaceut Co Ltd ポリ標識化オリゴヌクレオチド誘導体
DE3788914T2 (de) 1986-09-08 1994-08-25 Ajinomoto Kk Verbindungen zur Spaltung von RNS an eine spezifische Position, Oligomere, verwendet bei der Herstellung dieser Verbindungen und Ausgangsprodukte für die Synthese dieser Oligomere.
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4920016A (en) 1986-12-24 1990-04-24 Linear Technology, Inc. Liposomes with enhanced circulation time
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
AU598946B2 (en) 1987-06-24 1990-07-05 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
DE3738460A1 (de) 1987-11-12 1989-05-24 Max Planck Gesellschaft Modifizierte oligonukleotide
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
ATE151467T1 (de) 1987-11-30 1997-04-15 Univ Iowa Res Found Durch modifikationen an der 3'-terminalen phosphodiesterbindung stabilisierte dna moleküle, ihre verwendung als nukleinsäuresonden sowie als therapeutische mittel zur hemmung der expression spezifischer zielgene
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
WO1989009221A1 (en) 1988-03-25 1989-10-05 University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
GB8824593D0 (en) 1988-10-20 1988-11-23 Royal Free Hosp School Med Liposomes
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5457183A (en) 1989-03-06 1995-10-10 Board Of Regents, The University Of Texas System Hydroxylated texaphyrins
US5354844A (en) 1989-03-16 1994-10-11 Boehringer Ingelheim International Gmbh Protein-polycation conjugates
US5108921A (en) 1989-04-03 1992-04-28 Purdue Research Foundation Method for enhanced transmembrane transport of exogenous molecules
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5227170A (en) 1989-06-22 1993-07-13 Vestar, Inc. Encapsulation process
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5356633A (en) 1989-10-20 1994-10-18 Liposome Technology, Inc. Method of treatment of inflamed tissues
US5527528A (en) 1989-10-20 1996-06-18 Sequus Pharmaceuticals, Inc. Solid-tumor treatment method
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5225212A (en) 1989-10-20 1993-07-06 Liposome Technology, Inc. Microreservoir liposome composition and method
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
ATE269870T1 (de) 1989-10-24 2004-07-15 Isis Pharmaceuticals Inc 2'-modifizierte oligonukleotide
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5469854A (en) 1989-12-22 1995-11-28 Imarx Pharmaceutical Corp. Methods of preparing gas-filled liposomes
US5580575A (en) 1989-12-22 1996-12-03 Imarx Pharmaceutical Corp. Therapeutic drug delivery systems
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5506351A (en) 1992-07-23 1996-04-09 Isis Pharmaceuticals Process for the preparation of 2'-O-alkyl guanosine and related compounds
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
AU7579991A (en) 1990-02-20 1991-09-18 Gilead Sciences, Inc. Pseudonucleosides and pseudonucleotides and their polymers
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5264618A (en) 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
US5665710A (en) 1990-04-30 1997-09-09 Georgetown University Method of making liposomal oligodeoxynucleotide compositions
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (es) 1990-05-11 1998-08-01 Microprobe Corp Soportes solidos para ensayos de hibridacion de acidos nucleicos y metodos para inmovilizar oligonucleotidos de modo covalente.
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
BR9106702A (pt) 1990-07-27 1993-06-08 Isis Pharmaceuticals Inc Analogo de oligonucleotideos e processos para modular a producao de uma proteina por um organismo e para tratar um organismo
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
ES2083593T3 (es) 1990-08-03 1996-04-16 Sterling Winthrop Inc Compuestos y metodos para inhibir la expresion de genes.
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
IE913034A1 (en) 1990-08-28 1992-03-11 Chiron Corp New insulin-like growth factor binding protein (igfbp-5)
EP0546074B1 (en) 1990-08-28 2001-11-14 Chiron Corporation Genetic material encoding igfbp-5
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
CA2092002A1 (en) 1990-09-20 1992-03-21 Mark Matteucci Modified internucleoside linkages
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
WO1992008728A1 (en) 1990-11-08 1992-05-29 Hybridon, Inc. Incorporation of multiple reporter groups on synthetic oligonucleotides
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
JP3220180B2 (ja) 1991-05-23 2001-10-22 三菱化学株式会社 薬剤含有タンパク質結合リポソーム
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
NZ244306A (en) 1991-09-30 1995-07-26 Boehringer Ingelheim Int Composition for introducing nucleic acid complexes into eucaryotic cells, complex containing nucleic acid and endosomolytic agent, peptide with endosomolytic domain and nucleic acid binding domain and preparation
US5521291A (en) 1991-09-30 1996-05-28 Boehringer Ingelheim International, Gmbh Conjugates for introducing nucleic acid into higher eucaryotic cells
EP0538194B1 (de) 1991-10-17 1997-06-04 Novartis AG Bicyclische Nukleoside, Oligonukleotide, Verfahren zu deren Herstellung und Zwischenprodukte
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
AU3222793A (en) 1991-11-26 1993-06-28 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
FR2687679B1 (fr) 1992-02-05 1994-10-28 Centre Nat Rech Scient Oligothionucleotides.
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
FR2692265B1 (fr) 1992-05-25 1996-11-08 Centre Nat Rech Scient Composes biologiquement actifs de type phosphotriesters.
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (de) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
AU4684993A (en) 1992-07-23 1994-02-14 Isis Pharmaceuticals, Inc. Novel 2'-o-alkyl nucleosides and phosphoramidites processes for the preparation and uses thereof
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
CA2140542A1 (en) 1992-07-27 1994-02-03 Abeysingle Padmapriya Oligonucleotide alkylphosphonothioates
US5583020A (en) 1992-11-24 1996-12-10 Ribozyme Pharmaceuticals, Inc. Permeability enhancers for negatively charged polynucleotides
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
JP3351476B2 (ja) 1993-01-22 2002-11-25 三菱化学株式会社 リン脂質誘導体及びそれを含有するリポソーム
KR960701077A (ko) 1993-01-25 1996-02-24 다알렌 반스톤 올리고누클레오티드 알킬포스포네이트 및 알킬포스포노티오에이트(oligonucleotide alkylphosphonates and alkylphosphonothioates)
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US6020317A (en) 1993-02-19 2000-02-01 Nippon Shinyaku Co. Ltd. Glycerol derivative, device and pharmaceutical composition
US5395619A (en) 1993-03-03 1995-03-07 Liposome Technology, Inc. Lipid-polymer conjugates and liposomes
GB9304620D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Compounds
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
AU6449394A (en) 1993-03-30 1994-10-24 Sterling Winthrop Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
CA2159629A1 (en) 1993-03-31 1994-10-13 Sanofi Oligonucleotides with amide linkages replacing phosphodiester linkages
DE4311944A1 (de) 1993-04-10 1994-10-13 Degussa Umhüllte Natriumpercarbonatpartikel, Verfahren zu deren Herstellung und sie enthaltende Wasch-, Reinigungs- und Bleichmittelzusammensetzungen
US5462854A (en) 1993-04-19 1995-10-31 Beckman Instruments, Inc. Inverse linkage oligonucleotides for chemical and enzymatic processes
FR2705099B1 (fr) 1993-05-12 1995-08-04 Centre Nat Rech Scient Oligonucléotides phosphorothioates triesters et procédé de préparation.
US5534259A (en) 1993-07-08 1996-07-09 Liposome Technology, Inc. Polymer compound and coated particle composition
US5543158A (en) 1993-07-23 1996-08-06 Massachusetts Institute Of Technology Biodegradable injectable nanoparticles
US5417978A (en) 1993-07-29 1995-05-23 Board Of Regents, The University Of Texas System Liposomal antisense methyl phosphonate oligonucleotides and methods for their preparation and use
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5540935A (en) 1993-12-06 1996-07-30 Nof Corporation Reactive vesicle and functional substance-fixed vesicle
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
EP0733059B1 (en) 1993-12-09 2000-09-13 Thomas Jefferson University Compounds and methods for site-directed mutations in eukaryotic cells
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5595756A (en) 1993-12-22 1997-01-21 Inex Pharmaceuticals Corporation Liposomal compositions for enhanced retention of bioactive agents
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5820873A (en) 1994-09-30 1998-10-13 The University Of British Columbia Polyethylene glycol modified ceramide lipids and liposome uses thereof
US5591721A (en) 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US5512295A (en) 1994-11-10 1996-04-30 The Board Of Trustees Of The Leland Stanford Junior University Synthetic liposomes for enhanced uptake and delivery
US5792747A (en) 1995-01-24 1998-08-11 The Administrators Of The Tulane Educational Fund Highly potent agonists of growth hormone releasing hormone
US5756122A (en) 1995-06-07 1998-05-26 Georgetown University Liposomally encapsulated nucleic acids having high entrapment efficiencies, method of manufacturer and use thereof for transfection of targeted cells
ATE247971T1 (de) 1995-08-01 2003-09-15 Novartis Erfind Verwalt Gmbh Liposomale oligonukleotidzusammensetzungen
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
US5858397A (en) 1995-10-11 1999-01-12 University Of British Columbia Liposomal formulations of mitoxantrone
US5994316A (en) 1996-02-21 1999-11-30 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
US5877309A (en) * 1997-08-13 1999-03-02 Isis Pharmaceuticals, Inc. Antisense oligonucleotides against JNK
AU9063398A (en) 1997-09-12 1999-04-05 Exiqon A/S Oligonucleotide analogues
CA2375467C (en) 1999-07-19 2013-10-29 The University Of British Columbia Antisense therapy for hormone-regulated tumors
US8025587B2 (en) 2008-05-16 2011-09-27 Taylor Made Golf Company, Inc. Golf club
US8935416B2 (en) 2006-04-21 2015-01-13 Fortinet, Inc. Method, apparatus, signals and medium for enforcing compliance with a policy on a client computer
US9209196B2 (en) 2011-11-30 2015-12-08 Sharp Kabushiki Kaisha Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device
US9400902B2 (en) 2012-05-22 2016-07-26 Trimble Navigation Limited Multi-modal entity tracking and display
US10867398B2 (en) 2017-11-21 2020-12-15 Reliance Core Consulting LLC Methods, systems, apparatuses and devices for facilitating motion analysis in an environment

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8835401B2 (en) 2002-01-17 2014-09-16 The University Of British Columbia Treatment of cancer by inhibition of IGFBPs and clusterin
US7973017B2 (en) 2002-01-17 2011-07-05 The University Of British Columbia Treatment of cancer by inhibition of IGFBP's and clusterin
US8252765B2 (en) 2002-01-17 2012-08-28 The University Of British Columbia Treatment of cancer by inhibition of IGFBPs and clusterin
US8470796B2 (en) 2002-01-17 2013-06-25 The University Of British Columbia Treatment of cancer by inhibition of IGFBPs and clusterin
US8541390B2 (en) 2002-01-17 2013-09-24 The University Of British Columbia Treatment of cancer by inhibition of IGFBPs and clusterin
EP1664271B1 (en) * 2003-08-18 2011-06-08 Isis Pharmaceuticals, Inc. Modulation of diacylglycerol acyltransferase 2 expression
US7932234B2 (en) 2003-10-01 2011-04-26 The University Of British Columbia Bispecific oligonucleotide for the treatment of CNS malignancies
US8168610B2 (en) 2003-10-01 2012-05-01 The University Of British Columbia Bispecific oligonucleotide for the treatment of CNS malignancies
WO2005030260A1 (en) * 2003-10-01 2005-04-07 The University Of British Columbia Bispecific oligonucleotide for the treatment of cns malignancies
JP2010207232A (ja) * 2004-01-20 2010-09-24 Isis Parmaceuticals Inc グルココルチコイドレセプター発現の調節
EP2222851B1 (en) * 2007-11-20 2017-06-28 Ionis Pharmaceuticals, Inc. Modulation of cd40 expression
USRE47320E1 (en) 2007-11-20 2019-03-26 Ionis Pharmaceuticals, Inc. Modulation of CD40 expression
EP2806900B1 (en) 2012-01-27 2021-12-15 BioMarin Technologies B.V. Rna modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy

Also Published As

Publication number Publication date
CA2463521C (en) 2011-03-29
EP2270230B1 (en) 2014-03-26
EP1442140B1 (en) 2011-07-13
EP1442140A2 (en) 2004-08-04
EP2270230A2 (en) 2011-01-05
EP1442140A4 (en) 2005-08-10
HUP0402327A3 (en) 2010-01-28
KR20050035150A (ko) 2005-04-15
WO2003030826A3 (en) 2003-08-07
US20030087857A1 (en) 2003-05-08
HU228976B1 (en) 2013-07-29
CA2463521A1 (en) 2003-04-17
IL161277A0 (en) 2004-09-27
KR100622275B1 (ko) 2006-09-18
US6750019B2 (en) 2004-06-15
JP2005506066A (ja) 2005-03-03
US20050049211A1 (en) 2005-03-03
EP2270230A3 (en) 2011-04-20
HUP0402327A2 (hu) 2005-02-28

Similar Documents

Publication Publication Date Title
WO2003023005A2 (en) Antisense modulation of pka regulatory subunit rii alpha expression
WO2003052072A2 (en) Antisense modulation of estrogen receptor alpha expression
WO2003066805A2 (en) Antisense modulation of complement component c3 expression
WO2003000656A2 (en) Antisense modulation of transforming growth factor beta receptor ii expression
WO2003008545A2 (en) Antisense modulation of glioma-associated oncogene-2 expression
WO2003053341A2 (en) Antisense modulation of ship-1 expression
EP2270230B1 (en) Antisense modulation of insulin-like growth factor binding protein 5 expression
EP1404699A2 (en) Antisense modulation of src-c expression
WO2003027327A1 (en) Antisense modulation of interleukin 8 expression
WO2003044167A2 (en) Antisense modulation of human fxr expression
WO2003040161A2 (en) Antisense modulation of activating transcription factor 3 expression
WO2002088163A1 (en) Antisense modulation of interferon gamma receptor 2 expression
WO2002068590A2 (en) Antisense modulation of recql expression
WO2003033659A2 (en) Antisense modulation of matrix metalloproteinase 1 expression
EP1451363A2 (en) Antisense modulation of thyroid hormone receptor interactor 6 expression
WO2003012033A2 (en) Antisense modulation of short heterodimer partner-1 expression
WO2002092855A1 (en) Antisense modulation of helicase-moi expression
WO2002088391A1 (en) Antisense modulation of bifunctional apoptosis regulator expression
WO2003008544A2 (en) Antisense modulation of transforming growth factor-beta 3 expression
WO2003041657A2 (en) Antisense modulation of vitamin d nuclear receptor expression
EP1451353A2 (en) Antisense modulation of phospholipase a2 group v expression
WO2003028637A2 (en) Antisense modulation of sphingosine-1-phosphate lyase expression
WO2002090591A1 (en) Antisense modulation of interleukin 12 p40 subunit expression
WO2003051308A2 (en) Antisense modulation of tfap2c expression
WO2003008549A2 (en) Antisense modulation of glioma-associated oncogene-3 expression

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG UZ VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 161277

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 532210

Country of ref document: NZ

Ref document number: 2463521

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003533860

Country of ref document: JP

Ref document number: 1020047005328

Country of ref document: KR

Ref document number: 1020047005267

Country of ref document: KR

Ref document number: 1020047005263

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2002800945

Country of ref document: EP

Ref document number: 2002334895

Country of ref document: AU

WWR Wipo information: refused in national office

Ref document number: 1020047005267

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 1020047005267

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2002800945

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10491712

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1020047005328

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 1020047005328

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 2002334895

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 194383

Country of ref document: IL

Ref document number: 194382

Country of ref document: IL