WO2003022202A2 - Compositions and methods for treatment of cancer - Google Patents

Compositions and methods for treatment of cancer Download PDF

Info

Publication number
WO2003022202A2
WO2003022202A2 PCT/IL2002/000765 IL0200765W WO03022202A2 WO 2003022202 A2 WO2003022202 A2 WO 2003022202A2 IL 0200765 W IL0200765 W IL 0200765W WO 03022202 A2 WO03022202 A2 WO 03022202A2
Authority
WO
WIPO (PCT)
Prior art keywords
ndv
strain
glycoprotein
viral
lentogenic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2002/000765
Other languages
English (en)
French (fr)
Other versions
WO2003022202A3 (en
WO2003022202A9 (en
Inventor
Zichria Zakay-Rones
Amos Panet
Charles Irving
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yissum Research Development Co of Hebrew University of Jerusalem
OVCURE Inc
Original Assignee
Yissum Research Development Co of Hebrew University of Jerusalem
OVCURE Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yissum Research Development Co of Hebrew University of Jerusalem, OVCURE Inc filed Critical Yissum Research Development Co of Hebrew University of Jerusalem
Priority to AU2002341356A priority Critical patent/AU2002341356B2/en
Priority to CA002458543A priority patent/CA2458543A1/en
Priority to IL16081602A priority patent/IL160816A0/xx
Priority to EP02775172A priority patent/EP1424897A4/en
Priority to JP2003526332A priority patent/JP2005508158A/ja
Publication of WO2003022202A2 publication Critical patent/WO2003022202A2/en
Priority to US10/800,256 priority patent/US7223389B2/en
Anticipated expiration legal-status Critical
Publication of WO2003022202A3 publication Critical patent/WO2003022202A3/en
Publication of WO2003022202A9 publication Critical patent/WO2003022202A9/en
Priority to US11/561,510 priority patent/US7615209B2/en
Priority to US12/580,722 priority patent/US20100113335A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/768Oncolytic viruses not provided for in groups A61K35/761 - A61K35/766
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18132Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011Details
    • C12N2760/18011Paramyxoviridae
    • C12N2760/18111Avulavirus, e.g. Newcastle disease virus
    • C12N2760/18161Methods of inactivation or attenuation
    • C12N2760/18164Methods of inactivation or attenuation by serial passage

Definitions

  • the present invention relates to lentogenic strains of Newcastle Disease virus that have oncolytic activities, and the use of such viruses and/or isolated proteins derived from all strains of the NDV virus in the treatment of cancer.
  • Viruses are known to exert an oncolytic effect on malignant cells and the use of oncolytic viruses as therapeutic agents has been reported (Csatary et al. Cancer Detect Prev (1993) 17(6):619-27; Csatary et al. Anticancer Research (1999) 19(lB):635-8 and for review see Sinkovics J of Clinical Virology (2000) 16: 1-15).
  • Oncolytic viruses for example the avian virus Newcastle Disease Virus (NDV), have been shown to be cytolytic to tumor cells in vivo and in vitro (Reichard et al. JSurg Res (1992) 52(5):448-53; Bar Eli et al. J Cancer Res Clin Oncol (1996) 122: 1-7 and Tsadok-David et al. (1995) J Cancer Research Clinical Oncology 121:169-1 ).
  • NDV Newcastle Disease Virus
  • the Newcastle disease virus is an avian RNA paramyxovirus that causes Newcastle disease in different avian species (dependent on the virulence of the virus strain and on the age of the individual bird), but that is considered minimally pathogenic in humans.
  • NDV is an enveloped virus containing a linear, non-segmented, single-strand, negative sense RNA genome.
  • the virion consists of a coiled nucleocapsid containing single stranded RNA and 6 structural polypeptides (M.W. 20,000-80,000).
  • the nucleocapsids are coated with protein and lipid envelopes.
  • the matrix protein (M) located in the inner surface of the viral envelope, is involved in viral assembly and interacts with both the viral membrane and the nucleocapsid proteins.
  • HN hemagglutinin- neurammidase
  • F fusion glycoprotein
  • the HN glycoprotein is involved in the binding of the virus to cellular receptors. Monoclonal antibodies raised against this protein were shown to neutralize NDV infectivity.
  • the F protein which is first expressed as an inactive precursor (F0) and then cleaved post-translationally to produce two disulfide linked polypeptides (FI and F2), is involved in penetration of NDV into host cells by facilitating fusion of the viral envelope with the host plasma cell membrane. Antisera to the F protein inhibited hemolysis and virus-induced cell fusion.
  • EP Patent 227414 to Bingham et al. discloses the cDNA sequence encoding the F and HN polypeptides of NDV Beaudette C strain and envisages the use of this nucleotide sequence for the preparation of labelled probes, which will be utilized for diagnosis of NDV in poultry as well as for the preparation of the F and HN polypeptides.
  • the state of proteolytic cleavage of the surface glycoproteins F and HN is responsible for the virulence of the different NDV strains.
  • F0 of virulent strains is cleaved to FI and F2 in a wide range of host cells, whereas F0 of avirulent strains is cleaved only in few host cells. Accordingly, these differences are expressed in the classification of the different strains of NDV as velogenic (highly pathogenic), mesogenic (intermediate in pathogenicity) and lentogenic (apathogenic) strains.
  • NDV oncolytic virus
  • neoplastic cells The effect of oncolytic viruses on neoplastic cells is attributed by some to the enhancement of the sensitivity of the neoplastic cells to the cytolytic activity of tumor necrosis factors and to the immune stimulatory properties of these viruses.
  • NDV in animals induces locally chemoldnes and cytokines such as tumor necrosis factor alpha that affect T cell recruitment and activation (Schirrmacher et al. (1998) Semin Oncol 25(6):677-96 and Schirrmacher et al. (1999) Int J Oncol 14(2):205-15).
  • WO 00/62735 of Pro- Virus discloses the use of any interferon sensitive strain of virus for killing neoplastic cells that are deficient in the interferon response.
  • the Pro-Virus disclosure supplies a catalog of viral strains including three mesogenic strains of NDV (MK107, NJ Roakin, and Connecticut-70726) shown to be useful for treatment of human tumor xenografts in athymic mice. NDV administration to these mice caused tumor regression, which was attributed to more efficient and selective replication of NDV in tumor cells versus normal cells. The differential sensitivity of tumor cells to killing by NDV was disclosed to be correlated to an inability of the cells to manifest interferon-mediated antiviral response.
  • the above patent application claims methods of infecting neoplasms or tumors and methods of treating neoplasms or tumors by interferon-sensitive, replication competent RNA or DNA viruses
  • NDV is used in the preparation of an autologous tumor cell vaccine for humans (reviewed in Schirrmacher et al. (1998) Semin Oncol 25(6):677-96).
  • lentogenic strains of NDV are used for cancer therapy, or that surface glycoproteins derived from different strains of NDV, namely, velogenic, mesogenic or lentogenic strains, may have oncolytic properties and be useful in the treatment of cancer.
  • compositions and methods of the invention utilize oncolytic properties of viruses and/or of viral proteins for the killing of neoplastic cells.
  • present invention provides compositions and methods for treatment of cancer that avoid contacting a patient with pathogenic strains of viruses.
  • the present invention provides a clonal lentogenic oncolytic strain of NDV, denoted herein HUJ, useful in treating cancer.
  • the present invention provides a pharmaceutical composition comprising at least one lentogenic oncolytic strain of NDV for treatment of cancer.
  • the present invention further provides a pharmaceutical composition comprising at least one lentogenic oncolytic strain of NDV further comprising a suitable carrier.
  • the HUJ strain of NDV (which is further described below) is utilized in the treatment of cancer. More preferably, the composition comprises 10 6 -10 12 egg infectious dose
  • EID 50 50% per each treatment dose of the HUJ NDV strain.
  • the treatment with the HUJ NDV will fall within the range of 20 EID 5 o/cell to 2000 EIDso/cell treated.
  • the composition of the invention contains at least one isolated viral glycoprotein or a subunit or analog thereof having oncolytic activity.
  • the viral glycoprotein is derived from NDV.
  • the composition comprises at least the F glycoprotein of NDV.
  • F protein as used herein includes both F and F0.
  • the composition comprises the F glycoprotein and the hemagglutinin activity containing subunit of the HN glycoprotein of NDV.
  • the composition comprises the F glycoprotein and the HN glycoprotein of NDV.
  • HN protein as used herein includes both HN and its precursor HNO, which is cleaved at its C-terminus to yield active HN.
  • the viral glycoproteins utilized in this embodiment are non-infectious and can, therefore, be the product of any suitable strain of NDV.
  • velogenic strains of NDV are used, alternatively and preferably, mesogenic strains, alternatively and preferably lentogenic strains.
  • the composition may comprise any combination of viral proteins or subunits or analogs thereof having oncolytic activity or a combination of whole lentogenic oncolytic NDV viruses and viral proteins or subunits or analogs thereof having oncolytic activity.
  • the present invention further provides methods for treatment of cancer utilizing the pharmaceutical compositions described above.
  • the treatment for cancer utilizes at least one isolated polynucleotide encoding at least one viral polypeptide or an analog or subunit thereof having oncolytic activity
  • the treatment for cancer utilizes isolated polynucleotide encoding the F protein of NDV.
  • the isolated polynucleotide encoding for the HN protein of NDV is utilized.
  • a combination of the isolated polynucleotides encoding the F and HN glycoproteins are used.
  • the proteins F and HN are glycoproteins.
  • the polynucleotides of the invention encode the polypeptide portion thereof, i.e., that portion which is subsequently glycosylated in vivo.
  • the F polypeptide is also processed in vivo by cleavage into the two shorter polypeptides FI and F2. Accordingly, the invention encompasses a polynucleotide encoding FI and F2 polypeptides as separate molecules or as a single disulfide bridged molecule or their bioprecursor F0 polypeptide.
  • an isolated polynucleotide encoding an F and/or HN polypeptide of NDV RNA, a bioprecursor of a said polypeptide or any active fragment of said polypeptide or an artificial polynucleotide complementary to the polynucleotide encoding an F and/or HN polypeptide of NDV RNA.
  • the invention further includes a host cell transfected or infected with recombinant polynucleotides as defined above.
  • the polynucleotides of the invention may be used as intermediates in the production of polypeptides by recombinant DNA technology. It is contemplated, therefore, that an expression vector of the invention containing an appropriate promoter and the polynucleotides of the invention, expressed for example in yeast or bacteria will give rise to the appropriate encoded polypeptides.
  • the vector may be a viral vector.
  • a lentogenic strain of NDV preferably the HUJ strain, is used in the preparation of a composition for the treatment of cancer.
  • a viral glycoprotein or a subunit or analog thereof is used in the preparation of a composition for cancer treatment.
  • the NDV coat glycoproteins are used.
  • the method of the invention for treatment of cancer includes the step of administering to a patient a therapeutically effective amount of a composition comprising as an active ingredient a lentogenic oncolytic strain of NDV, preferably the HUJ strain, and/or at least one isolated viral protein as described above.
  • the composition may be administered to the patient through any suitable route.
  • One particularly preferred embodiment utilizes injection of the composition directly into a tumor or adjacent to the tumor.
  • compositions and methods of the invention provide a treatment for cancer that does not share the risks that may be involved in the use of live velogenic (highly pathogenic) or even mesogenic (intermediate in pathogenicity) strains of viruses.
  • Figure 1 is a graph showing the results of a representative experiment of the cytotoxic effect of two NDV strains (HUJ and MTH) on Daudi cells in culture;
  • Figure 2 is a graph showing apoptosis of Daudi cells in culture following interaction with two NDV strains (HUJ and MTH);
  • Figures 3 A and 3B depict graphs showing thermostability of hemagglutinin activity at 56°C, for two NDV strains (HUJ and MTH) in two experiments;
  • Figure 4 is a picture of an SDS Polyacrylamide gel after electrophoresis of NDV virion proteins (strains HUJ and MTH);
  • Figures 5A and 5B show graphs of viability and mortality of Daudi cells after incubation with NDV strains (Roakin and B-1) or with surface glycoproteins (RHN and BHN) extracted from these strains;
  • Figure 6 depicts a graph showing the inhibition of cellular DNA synthesis in Daudi cells (D-2) in response to their incubation in the presence of NDV strains (Roakin and B-1) or in the presence of the surface glycoproteins (RHN and BHN) extracted from these strains;
  • FIG. 7 depicts the Cr 51 release from NDV infected cells
  • Figures 8A, B and C depict graphs showing the effect of NDV propagated in tissue culture or in embryonated eggs on Daudi cells: the effect on the total number of cells (Fig. 8A), percentage of dead cells following infection (Fig. 8B) and the effect of treatment with trypsin on the cytotoxic activity of the NDV (Fig. 8C); and
  • Figure 9 shows a histogram of the F glycoprotein activity as indicated by hemolysis of erythrocytes.
  • Figure 10 shows the predicted amino acid sequence of the F and HN polypeptides.
  • compositions and methods for treatment of cancer that utilize the oncolytic properties of certain viruses and isolated viral components.
  • the disclosed compositions and methods provide, for the first time, safe, effective and reliable means to treat cancer in an individual in need thereof.
  • the present invention thus provides compositions and methods for treatment of cancer using lentogenic oncolytic strain of non-human virus, the Newcastle Disease virus (NDV). It further provides methods for treatment of cancer comprising isolated viral proteins or subunits or analogs thereof having oncolytic activity as well as isolated polynucleotides or constructs containing same, which encode for the viral proteins.
  • the polynucleotides or constructs containing same may include any vector polynucleotide, including viral vector polynucleotide.
  • the present invention provides host cells containing the polynucleotides, constructs containing same, and the vector polynucleotides as described above, which will also be used for treatment of cancer.
  • the present invention further provides treatment of cancer using combination of any of the above.
  • a modified lentogenic NDV strain denoted herein as HUJ is disclosed below. It is desirable to obtain a clonal virus to ensure or increase its homogeneity. Clonal virus can be produced according to any method available to the skilled artisan, for example by limiting dilution or by plaque purification. According to an embodiment of the invention, a clonal HUJ strain prepared by limiting dilution is used in the preparation of a composition for the treatment of cancer, with or without an appropriate carrier such as human serum albumin (HSA) or any suitable adjuvant,. All types of cancers may be included in the scope of the present invention. As a non limiting example, the following cancers can be treated according to the present invention: glioblastoma, lung carcinoma, breast cancer, prostate, melanoma, leukemia and sarcomas.
  • HSA human serum albumin
  • the present invention provides compositions and methods for treatment of cancer utilizing at least one isolated viral proteins having oncolytic activity, preferably the F and HN glycoproteins of NDV.
  • the F and HN glycoproteins were shown to play an important role in viral infectivity. However, nowhere in the prior art is it suggested that isolated F and HN proteins have oncolytic activities.
  • the present invention provides, for the first time, direct evidence of the oncolytic effect of isolated viral proteins.
  • viral proteins preferably, the F and/or HN glycoproteins of NDV or analogs or subunits of these glycoproteins or mixtures thereof, are used in the preparation of a composition for the treatment of cancer.
  • oncolytic activity includes cytotoxic effect in vitro and/or in vivo to tumor cells without any effect to normal cells.
  • the cytotoxic effect under in vitro conditions is detected by various means as known in prior art, for example, by staining with a selective stain for dead cells, by inhibition of DNA synthesis or by apoptosis.
  • protein analog includes peptides or polypeptides having the functionality of viral counterparts (i.e. fusion, hemagglutinin, and neuraminidase proteins, etc.) and not necessarily having the same sequence, secondary or tertiary structure as the viral counterparts.
  • truncated or altered protems displaying the oncolytic activity as the natural viral proteins may be used in the composition and method of the present invention.
  • the fusion, hemagglutination and neuraminidase activities of the F and HN glycoproteins of NDV may be responsible for the oncolytic effect of the isolated proteins.
  • the present invention encompasses other viral proteins exhibiting other activities that may be responsible for the oncolytic effect of isolated viruses.
  • the proteins can be used in a composition with an adjuvant such as alum hydroxide, emulsions or submicron emulsions (for example, US 5,576,016, 5,662,932, 5,716,637, 5,961,970) or other known pharmaceutical carriers such as human serum albumin.
  • compositions and methods for treatment of cancer comprising isolated polynucleotides and constructs containing same encoding the F and HN proteins of the HUJ strain of NDV.
  • the nucleotide sequence encoding the F protein of HUJ was found to be almost identical (3 nucleotide difference) to the LaSota strain. Therefore, the present invention encompasses the use of isolated polynucleotide sequences encoding the F protein of other lentogenic strains.
  • the surface glycoproteins may be obtained from any naturally occurring strain of NDV.
  • the glycoproteins are obtained from a velogenic or a mesogenic NDV strain, such as the Roakin/46 VR 109 (RO) strain from the American type collection.
  • the glycoproteins may be obtained from genetically or otherwise engineered virus strains.
  • the glycoproteins may be obtained from an expression system exemplified by, but not limited to, a mammalian expression system, an insect expression system or a bacterial expression system.
  • synthetic proteins or recombinant viral protems such as HN or F, may be used in the present invention.
  • compositions may be in any form suitable for administration to a patient, such as a suspension, an emulsion, a spray, a solution or any other formulation according to principles well known in the art.
  • the compositions of the invention may be adapted for any suitable route of administration, including but not limited to intravenous, oral, buccal, intranasal, inhalation, topical application to a mucosal membrane or injection, including intradermal, intrathecal, intracisternal, intralesional or any other type of injection.
  • the method of the invention for treatment of cancer includes the step of administering to a patient a therapeutically effective amount of HUJ NDV.
  • the HUJ NDV may be administered to the patient through any suitable route, as described above.
  • One particularly preferred embodiment utilizes injection of the HUJ strain or a composition comprising the HUJ strain and/or at least one viral glycoprotein as described above directly into a tumor or adjacent to the tumor.
  • the method of the invention for treatment of cancer includes the step of administering to a patient (through any suitable route, as described above) a therapeutically effective amount of at least one viral glycoprotein of NDV or a subunit or analog thereof having oncolytic activity.
  • the viral glycoprotein may include at least the F glycoprotein of NDV, the HN glycoprotein of NDV or the F glycoprotein and the HN glycoprotein of NDV.
  • Treatment of patients with cancer can be systemic, where the above compositions or even isolated whole viruses and/or isolated proteins are adniinistered to the patient.
  • the form of admmistration may be intravenous, oral, buccal, intranasal, inhalation, topical application to a mucosal membrane, or injection, including intradermal, intrathecal, intracisternal, intralesional or any other type of injection.
  • lentogenic NDV viruses such as the HUJ strain
  • viral proteins as described above or compositions according to the invention
  • the form of local administration is by injection, for example, intralesional injection.
  • the isolated polynucleotides of the present invention are used in the production of at least one viral polypeptide or an analog or subunit thereof having oncolytic activity by recombinant DNA technology in cells transfected with these polynucleotides.
  • the polynucleotides may also consist of an expression vector, for example a viral vector, to achieve the polypeptide expression.
  • the methods for expression of viral NDV proteins are disclosed in EP 227414 to Bingham and are fully incorporated herein.
  • polynucleotide includes single-stranded and double-stranded DNA, RNA and chemically or biosynthesized nucleotide polymers of varying lengths from 16 nucleotides upwards.
  • the term "artificial” as used herein signifies the intervention of man, by any means, in the production of the polynucleotide.
  • the invention includes recombinant molecules. These can be broadly defined as consisting of vector polynucleotides and polynucleotide foreign thereto, the foreign polynucleotide consisting of or including a polynucleotide of the invention as defined above.
  • the polynucleotide is DNA and the invention includes particularly DNA wherein the vector is a cloning vector or an expression vector.
  • the expression vector can be, for example, a prokaryotic cell expression vector or eukaryotic cell expression vector.
  • vector herein also includes shuttle vectors.
  • the polynucleotide will additionally contain a signal sequence of the kind effective for translation and other processing of the mRNA into the desired viral proteins.
  • the present invention provides the isolated polynucleotides encoding viral protems having oncolytic activity, preferably, the F and HN glycoproteins, which are introduced into host cells as to be expressed by the cells and/or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect.
  • the oligonucleotide molecule may be linked to a group, which includes partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups such as carboxylic acid groups, ester groups, and alcohol groups.
  • ohgonucleotides may be linked to peptide structures, which are preferably membranotropic peptides. Such modified ohgonucleotides penetrate membranes more easily, which is critical for their function and may, therefore, significantly enhance their activity.
  • additives may be selected.
  • Such agents are generally agents that will enhance cellular uptake of double-stranded DNA molecules.
  • certain lipid molecules have been developed for this purpose, including the transfection reagents DOTAP (Boehringer Mannheim), Lipofectin, Lipofectam, and Transfectam, which are available commercially.
  • Another way of enhancing membrane permeability is by conjugating ohgonucleotides to molecules that are known to bind to cell surface receptors.
  • suitable groups for forming conjugates are sugars, vitamins, hormones, cytokines, transferrin, asialoglycoprotein, and the like molecules.
  • Low et al U.S. Patent 5,108,921 describes the use of these molecules for the purpose of enhancing membrane permeability of peptides, proteins and ohgonucleotides, and the preparation of said conjugates.
  • the virus was derived from naturally lentogenic Bl strain of NDV obtained as ATCC VI 88.
  • the virus was passaged four times in hen's eggs to prepare a research stock.
  • the infected allantoic fluid from the fourth passage (E4 stock) was stored at -70°C.
  • the infected allantoic fluid from the E4 stock underwent 50 regular passages in 10-11 day old embryonated eggs.
  • the allantoic fluid was labeled "NDV lento" and was divided into vials stored at -80°C.
  • the "NDV lento" was cloned in 10-11 days old embryonated eggs by limiting dilution.
  • Allantoic fluid from the egg infected with the highest dilution was labeled "NDV lento (cloned)" and was stored at - 70°C.
  • Studies of the cytotoxicity of the "NDV lento (cloned)" strain were carried out in Daudi cells and normal human cells. The strain was shown to be oncolytic and was renamed “NDV HUT'.
  • the intracerebral pathogenicity index (ICPI) of the "NDV HUJ " strain was tested in 1 day old chicks and was shown to be 0.0, indicating that the virus can be classified as lentogenic, non-virulent, non-pathogenic.
  • the HUJ strain was compared to MTH-68 H strain of NDV, which is an attenuated strain obtained by serial passages through eggs (allantoic fluid), manufactured in Hungary by Phylaxia-Sanofi (Csatary et al. Anticancer Research (1999) 19(lB):635-8). Allantoic fluid containing virus and virus purified on sucrose gradients, were compared. Preparation of the HUJ strain for in vitro studies: Serial passages were carried out at limiting dilutions in 10-11 day old chicken embryonated eggs. Allantoic fluid from the highest dilution (in which only 1/6 eggs is virus positive) was collected and further passaged in serial dilutions.
  • the virus was concentrated by centrifugation from infected allantoic fluid at 18,000 rpm in a Sorvall (RC-5) centrifuge using a SS-34 rotor, for 60 min at 4°C.
  • the concentrated virus (100 ml - containing 32,000 HA units) was then purified by centrifugation for 90 min at 24000 rpm through a sucrose gradient (10-60%) with an ultra centrifuge in a SW-27 rotor.
  • the bands containing virus were collected, pelleted in an SW-27 rotor for 60 min at 24,000 rpm, resuspended, and the purified virus suspension was passed through Millipore filters, aliquoted in 0.5 ml and kept at -70°C until use. It will be appreciated by persons skilled in the art that other methods of virus concentration and purification may be used for obtaining the results above.
  • HUJ strain also referred to as "NDV lento (clone)" was further cloned twice by limiting dilution in 10-11 day old embryonated SPF (specific pathogens free) eggs (obtained from ALPES (Aves Libres de Pat ⁇ genos Especificos S.A. de C.V), Pueblo, Mexico, a subsidiary of SPAFAS Charles River Lab.) to produce a Virus Master Seed Bank consisting of 220 tubes. The tubes are stored at -80°C and contain the harvested allantoic fluid frozen without any further purification.
  • SPF specific pathogens free
  • One tube from the Master seed bank is expanded into a Virus Working Seed Bank consisting of 300 tubes following the same procedure as used in the production of the master bank.
  • the working bank tubes are stored at - 80°C.
  • the tubes contain the harvested allantoic fluid frozen without any further purification.
  • the starting material for the virus production is a vial of the NDV HUJ Working Bank and 10-11 day old embryonated SPF eggs.
  • the total amount of virus obtained from a particular harvest was determined by the number of eggs harvested, the volume of the allantoic fluid harvested and the titer. Starting with about 450 eggs, 150 - 300 eggs were harvested. The yield of harvested fluids was about 8-10 ml per egg and the volumes of collected fluids from individual harvests varied from 1000 to 3280 ml. Titers ranged from 10 93 /ml to 10 ⁇ 2 /ml EID 50 and the total amount of virus in crude bulk harvests ranged from 6.4xl0 12 to 1.6xl0 13 EID 50 . The total amount of virus in the five crude bulk harvests was 5.8xl0 13 EID50 at the time of harvesting. The virus was then concentrated by high speed centrifugation and purified in sucrose gradients as follows:
  • Clarified crude bulk virus after having been stored at 4-7°C for between 1-6 weeks was re-clarified by low speed centrifugation (3000 m 30 min). Aliquots of re-clarified bulk from each harvest were taken and stored at -80°C for further testing and additional aliquots were taken for in-process sterility testing. The re-clarified bulk was then centrifuged at high speed 12,500 m for 1.5 hrs at 4°C and the pelleted virus was re-suspended in Gibco Dulbeco PBS. Titers were determined to obtain total recovery.
  • a total of 12,260ml of reclarified bulk fluids from five harvests were concentrated to a total of 100 ml of resuspended pelleted virus with a 50% average yield based on EID 50 titers, ranging from 29% to 82% yields for individual harvests. Sterility was tested on aliquots from each tube of resuspended concentrated virus. All samples of the concentrated virus passed sterility testing. For purification, the concentrated virus was centrifuged at ultra-high speed in a 20/40/60% sucrose gradient at 22,000 ⁇ m for 2.5 hrs at 4°C. In a typical ultracentrifuge tube, approximately 8 ml of concentrated virus is layered on top of 24 ml of sucrose gradient.
  • the purified virus is recovered as a band of approximately 4.7 ml.
  • the band of concentrated virus is suspended in approximately 10 ml of sterile saline, whose pH had been adjusted to 7.6-7.8 by addition of autoclaved solution of disodium phosphate prepared in water for infusion.
  • Sucrose solutions were prepared by dissolving endotoxin-free sucrose in Gibco Dulbeco PBS and autoclaving.
  • Clinical dosages were prepared from combined harvests of purified virus by diluting the viral suspension with sterile saline to achieve a concentration of approximately lxl0 10 EiD 5 o /ml.
  • the nucleotide sequences determined for the F and HN genes of NDV HUJ-master bank and purified virus can be compared to related nucleotide sequence of the LaSota strain of Newcastle disease virus, which consists of 15186 base pairs of linear RNA.
  • Viral RNA was extracted from the Newcastle disease virus HUJ master seed using the QIAGEN QIAamp viral RNA kit according to the manufacturer's instructions.
  • a single stranded DNA copy of the viral RNA template was prepared using a standard protocol for production of cDNA from RNA template using reverse transcriptase. Briefly, two reaction mixtures were prepared.
  • One mixture comprised 6.5 ⁇ l of dH 2 0 and l ⁇ l of the primer MSF1 (see below).
  • the other mixture comprised 4.0 ⁇ l of 5x RT buffer (reverse transcriptase buffer), 4.0 ⁇ l dH 2 0, l.O ⁇ l 40mM NTPs (nucleotide triphosphates), 0.5 ⁇ l MMLV-RT (enzyme) and 0.5 ⁇ l RNAsin (RNAse inhibitor).
  • a volume of 2.5 ⁇ l of RNA was added to the 7.5 ⁇ l of mix one, centrifuged briefly, heated at 95 °C for two minutes and placed on ice.
  • a volume of lO ⁇ l of mix two was added to the RNA/primer solution and incubated at 37 °C for 1 hour.
  • the cDNA produced was used to prepare three overlapping PCR DNA fragments for each gene.
  • the sequences of these primers in the viral genome are given below.
  • Each PCR reaction mixture comprised 25 ⁇ l PCR Ready mix x2 (AB gene Co ⁇ .), 18 ⁇ l DH 2 0, and l ⁇ l of l ⁇ l of forward primer and l ⁇ l of reverse primer.
  • the components were mixed, spun briefly and 5 ⁇ l appropriate cDNA added before thermal cycling. Cycling parameters were 94 °C for 10 minutes (one cycle), 94 °C (1 minute), 50 °C (1 minute) and 72 °C (3 minutes) for 29 cycles and 72 °C for 5 minutes.
  • reaction mixtures were electrophoresed on an agarose gel and visualized using a UV transilluminator.
  • DNA fragments size was estimated by comparing with marker DNA and fragments were purified. DNA fragments were excised from the gel and purified using the Qiaquic gel extraction kit (Qiagen cat no. 28706).
  • Qiaquic gel extraction kit Qiagen cat no. 28706
  • a reaction mix was prepared comprising terminator ready reaction mix (4 ⁇ l; Applied Biosystems Co ⁇ ), the PCR product (2-4 ⁇ l depending on its concentration), sequencing primer (1.6 ⁇ l) and deionised water to bring the total volume to lO ⁇ l. The mixture was then incubated in a PCR machine using the program 'BIGD'. The sequenced products were precipitated by adding l ⁇ l of 25mM glycogen and 52 ⁇ l of 2M sodium acetate pH 4.5.
  • the mix was vortexed, left for 10 minutes and then centrifuged at 13,000 ⁇ m for 30 minutes.
  • the liquid was aspirated off leaving behind a pellet, which was rinsed by the addition of 150 ⁇ l of 80%) ethanol.
  • the alcohol was removed and the sample centrifuged again before removing any remaining alcohol with a 10 pipette.
  • the pellet was dried by heating on a block at 95 °C for 2 minutes, resuspended in 15 ⁇ l TSR, vortexed and then centrifuged (pulse) before heating again at 95 °C for 2 minutes and chilling on ice.
  • samples were transferred to ABI tubes and then into the genetic analyzer (ABI PRISMTM 310 genetic analyzer). Data from the automated sequencer was edited using DNASTAR/SeqMan to obtain a consensus sequence. Sequences were aligned with the published sequence of a similar virus, for example Bl or LaSota, .
  • PCR and sequencing primers were the following:
  • Biological assay The hemagglutination and infectivity titers of the HUJ virus were determined by the routinely used methods (Sever JL. 1962 J. Immunol. 80:320-329 for hemagglutination). Infectivity was determined by inoculation of serial dilutions into the allantoic sac of embryonated eggs and checking the fluids for hemagglutination 72 hrs post inoculation. The virus titer, defined as 50% endpoint egg infectious dose (EID 50 ) was calculated by the method of Reed and Muench (Reed LJ Muench HA 1938, Amer. J Hyg 27:493-497). Stocks were prepared and stored at -70°C.
  • the amino acid sequence has the fusion protein cleavage site motif from amino acid #109 to #119 of SGGGRQGRLIG inferred from the nucleotides sequence starting at nucleotide 370, which is characteristic of lentogenicity.
  • the 3358 nucleotides of the virus from the Master Virus Bank matched those of the La Sota strain of NDV (gi:3386504), except for nucleotide positions 111, 1006 and 1648 in the F gene. Sequence of the F Gene of the Virus after virus Purification on a Sucrose Gradient:
  • Each reaction mixture comprised of 25 ⁇ l RT-PCR Ready mix x2, 8 ⁇ l RNA, 5 ⁇ l of each forward and reverse sequencing primer and 7 ⁇ l DDH20.
  • the components were well mixed and spun briefly prior to subjection to the RT-PCR reaction (48°C for 45 minutes for the RT reaction). Cycling parameters for the PCR were 94°C for 2 minutes (one cycle), 94°C (30 seconds), 60 °C (1 minute) and 68°C (2 minutes) for 40 cycles and 68 °C for 7 minutes.
  • the PCR reaction mixes were loaded on 1% agarose gel and visualized using a UV Tran illuminator. Band size was estimated by comparing with DNA marker. DNA fragments were excised from the gel and purified using the Mini-elute Gel extraction kit (Qiagen). Each fragment was resuspended in ddH20. The DNAs were subjected to Sequencing analysis.
  • NDV-4 GAATTGACTACAGTATTCGG (5189 FORWARD) NDV-5 G C G C G T C C A T G A T T GA (6406 reverse)
  • the 1504 nucleotide sequence of the purified virus, corresponding to 178 to 1680 of the HUJ virus from the Master Virus Bank, that covers most of the F gene was found to be identical to the nucleotide sequence of the HUJ virus from the Master Virus Bank. This indicated that the identity of the virus had not changed in this region during the production process. It also provides confirmatory evidence for the relevant sequence.
  • Neuraminidase Reciprocal titer of the dilution of hemagglutination (HA) and Neuraminidase (NA) activities. Neuraminidase is determined according to Aymard-Henry M et al 1973 Bull Wld Org 48: 199-202 and Warren LJ J Biol Chem 1959 234:1971-1975. This assay measures the free sialic acid liberated by the viral enzyme neuraminidase from a substrate (fetuine).
  • Fusion activity was determined by chicken erythrocyte hemolysis as described in the literature (Nishikawa K et al 1986 J. Viral 60: 987-993). The results indicated that virus dilutions of 1:32-1:64 caused hemolysis, suggesting that fusion activity was similar for the two NDV strains. 3 ⁇ Cytotoxic (oncolytic) effect
  • Virus (20-200 EID S Q /cell) was incubated with Daudi cells for different time intervals. At the end of the incubation, samples were checked for viability by staining with erythrosine B, a selective stain for dead cells (Hanks JH and Wallace J 1958 Proc Expel Biol Med 98 188). A graphic presentation of the results is shown in Fig. 1.
  • Apoptosis of Daudi cells following treatment by NDV Daudi cells were incubated in the presence of either MTH or HUJ strains (100
  • E ⁇ D 5 o/cel ⁇ E ⁇ D 5 o/cel ⁇ for the indicated time periods.
  • Apoptosis was determined by a colorimetric assay using MTT tetrazolium (Mosmann T 1983, J of immunol. Methods 65: 55-63). MTT is a color reaction expressed by OD indicating apoptosis of cells. The intensity of OD measured at 570 nm correlate directly with cell viability. Higher OD indicates higher viability and lower % of dead cells.
  • treatment that includes locally administering HUJ NDV to a tumor would preferably consist of estimating the number of cells in the tumor or estimating the size of a tumor and administering HUJ NDV strain in the range of 20 EIDso/cell to 2000 EIDso/cell, or an equivalent amount of surface glycoproteins, according to the invention.
  • Systemic treatment of a patient would preferably consist of administering at least one dose of 10 6 -10 12 EID so of HUJ NDV strain, or an equivalent amount of surface glycoproteins, according to the invention.
  • Thermostability of hemagglutinin activity at 56°C The hemagglutinin thermostability of the MTH and HUJ strains was determined at 56°C using chicken erythrocytes according to the method of F.M. Burnet as described in "The affinity of Newcastle disease virus to the influenza virus group. Aust. J. Exp. Biol. Med. 1942, 20, 320-328.
  • NDV strains are known to be sensitive to the ⁇ inhibitors non-specific inhibitors in normal sera. Assays with horse sera that contain ⁇ inhibitors indicated that the HUJ strain is less sensitive to inhibitors than the MTH strain.
  • the mean death time (MDT) of embryos indicates the virulence of the virus.
  • the MDT was determined by the inoculation of SPF chicken eggs with serial dilutions of the cloned viruses using the method described in Manual of Standards for Diagnostic Tests and Vaccines, 4 th edition, 2000. Death of embryos was determined in the different dilutions and the MDT (the mean death time of embryos infected with the highest dilution causing 100% death) was determined.
  • the MDT of the original Hungarian MTH strain was shown to be less than 65 hours.
  • the MDT of HUJ was >96 h, which is typical for lentogenic viruses.
  • the MDT of chick embryos infected with virus from the virus working seed bank derived from the virus master seed bank was greater than 100 hrs.
  • Replication of the virus without trypsin indicates elevated virulence. It may indicate that the amino acid residues at the trypsin cleavage sites of the surface glycoproteins are multi basic (arginine or lysine).
  • the MTH strain replicates to similar titers with or without trypsin, unlike the HUJ strain that replicates to a much higher level in the presence of trypsin (10 3' — 10 ' TC ⁇ DSO )- This would clearly indicate that the MTH strain is more pathogenic than the HUJ virus, which probably has one basic amino acid residue at the cleavage site.
  • NDV strains are similar serologically.
  • polyclonal rabbit anti NDV hyperimmune sera to the Israel mesogenic strain previously isolated by the inventors, both strains were similarly inhibited (HI titer 1:1280) (see Table 6).
  • human sera obtained from MTH- treated cancer patients had higher antibody titers to the homologous MTH strain than to the HUJ strain as shown in Table 6 rows I, ⁇ , ⁇ i in the inhibition of hemolysis, hemagglutination and neuraminidase.
  • an immune rabbit serum that had similar HI antibody titer to both NDV strains, demonstrated different antibody titers to other viral activities (hemolysis and neuraminidase).
  • Reciprocal titers The assays were conducted according to Sever Aymard-Henry and Nishikawa.
  • Surface glycoproteins obtained from a mesogenic strain (Roakin) were more effective than those origmating from a lentogenic strain
  • surface glycoproteins can be obtained by several other known methods and using other detergents.
  • HN Hemagglutimn-Neuraminidase
  • F Fusion
  • Table 7 the biological properties of the glycoprotein fractions originating from a mesogenic (RHN) and a lentogenic (BHN) strain, are depicted.
  • the infectivity of the two purified virus preparations from which the surface glycoproteins were extracted was 10 9 ' 3 EID5o/0.2ml. No infectivity was recorded in the soluble fraction containing the surface glycoproteins obtained from Roakin or B-1 strains, RHN and BHN, respectively.
  • Protein concentration ( ⁇ g/ml) was similar in the two virus suspensions before extraction. After extraction, similar protein concentration, although lower as expected, was obtained in the two surface glycoprotein fractions of the two strains.
  • Hemagglutination activity of the surface glycoproteins fraction was similar to the original whole virus preparation. Neuraminidase activity, however, declined to 33 and 50% of the full value of intact virus suspension in Roakin and B-1 glycoproteins fractions, respectively. Hemolytic activity was high in the intact virus preparations while only a small portion of this activity (6%) was retained in the isolated surface glycoprotein fractions. Table 7
  • Adso ⁇ tion of RHN and B-HN virus to Daudi cells was monitored by an indirect immunofluorescence using diluted virus specific antiserum (chicken or rabbit) and fluorescein- conjugated goat anti chicken or anti rabbit IgG. Over 90 % of the cells demonstrated intensive staining 60 minutes after virus interaction. The number of the viable and dead Daudi cells after incubation with the different viral preparations was determined at different periods of time (in hours Figs. 5A and 5B).
  • BHN fraction on the other hand, displayed different levels of activity on individual isolates of target cancer cells.
  • the BHN fraction was comparatively ineffective on Daudi D- 1 cell isolate and the percentage of death was similar to control cells.
  • D-2 an additional isolate of Daudi cells was used (D-2) it exhibited a very high sensitivity, 100% of cells were killed by RHN fraction and 74% by the BHN fraction within 72 h (Figs. 5A and 5B). The subsequent experiments were carried out with the D-2 line.
  • the inhibitory effect is NDV virus specific, as pretreatment of viral preparations (intact virus or isolated surface glycoproteins) with specific antiserum abolished cytotoxicity.
  • the release was elevated further to 60, 85, 23, and 18% at 4h post interaction with RO, B-1, RHN and BHN, respectively.
  • a total release (100%) resulted from the interaction with the intact virions, 65% release was recorded as a result of interaction with RHN and only 36% release was found in cells interacted with BHN.
  • no elevation in membrane permeability and no cell damages was observed.
  • the lentogenic strain that has one glutamine residue in the cleavage site of F0 and of HNO, is insensitive to the proteases of the CF.
  • Cultivation of the virus in CF in the presence of trypsin (CFT), or treatment of the purified virus preparation with trypsin (NDVT) restored virus activity as detected by cell death (66% and 93% cell death, respectively).
  • CFT trypsin
  • NDVT trypsin
  • Neuraminidase and hemagglutinin activities are similar in treated and non-treated virus preparation as demonstrated by a hemagglutination test, viral adso ⁇ tion on cells using fluorescent staining and a neuraminidase assay.
  • the fusion glycoprotein of the CF grown virus is almost completely inactive, as indicated by lack of hemolysis of red blood cells (in 1:2 dilution only 31% hemolysis was recorded in comparison to 71% hemolysis in 1 :32 dilution of egg grown virus). Trypsin elevated activity to 58% and 64% hemolysis in 1:16 dilution of CFT and NDVT, respectively (Tables 9, and 4 and Fig. 9).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Oncology (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/IL2002/000765 2001-09-12 2002-09-12 Compositions and methods for treatment of cancer Ceased WO2003022202A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU2002341356A AU2002341356B2 (en) 2001-09-12 2002-09-12 Compositions and methods for treatment of cancer
CA002458543A CA2458543A1 (en) 2001-09-12 2002-09-12 Compositions and methods for treatment of cancer
IL16081602A IL160816A0 (en) 2001-09-12 2002-09-12 Compositions and methods for treatment of cancer
EP02775172A EP1424897A4 (en) 2001-09-12 2002-09-12 COMPOSITIONS AND METHOD FOR THE TREATMENT OF CANCER
JP2003526332A JP2005508158A (ja) 2001-09-12 2002-09-12 癌治療のための組成物および方法
US10/800,256 US7223389B2 (en) 2001-09-12 2004-03-11 Compositions and methods for treatment of cancer
US11/561,510 US7615209B2 (en) 2001-09-12 2006-11-20 Compositions of NDV and methods of use thereof for treatment of cancer
US12/580,722 US20100113335A1 (en) 2001-09-12 2009-10-16 Compositions and methods for treatement of cancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IL145397 2001-09-12
IL14539701A IL145397A0 (en) 2001-09-12 2001-09-12 Compositions and methods for treatment of cancer

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/800,256 Continuation US7223389B2 (en) 2001-09-12 2004-03-11 Compositions and methods for treatment of cancer

Publications (3)

Publication Number Publication Date
WO2003022202A2 true WO2003022202A2 (en) 2003-03-20
WO2003022202A3 WO2003022202A3 (en) 2004-03-18
WO2003022202A9 WO2003022202A9 (en) 2004-04-22

Family

ID=11075779

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2002/000765 Ceased WO2003022202A2 (en) 2001-09-12 2002-09-12 Compositions and methods for treatment of cancer

Country Status (7)

Country Link
US (2) US7223389B2 (enExample)
EP (1) EP1424897A4 (enExample)
JP (1) JP2005508158A (enExample)
AU (1) AU2002341356B2 (enExample)
CA (1) CA2458543A1 (enExample)
IL (1) IL145397A0 (enExample)
WO (1) WO2003022202A2 (enExample)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7767200B2 (en) 2005-07-14 2010-08-03 Wellstat Biologics Corporation Cancer treatment using viruses, fluoropyrimidines and camptothecins
US8377450B2 (en) 2009-11-30 2013-02-19 United Cancer Research Institute Clone of Newcastle disease virus, its manufacture and its application in the medical treatment of cancer
US9844574B2 (en) 2004-04-27 2017-12-19 Wellstat Biologics Corporation Cancer treatment using viruses and camptothecins

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2819185A1 (fr) * 2001-01-08 2002-07-12 Oreal Composition cosmetique de texture pateuse a pulverulente et son utilisation en cosmetique
US20090175826A1 (en) * 2006-06-05 2009-07-09 Elankumaran Subbiah Genetically-engineered newcastle disease virus as an oncolytic agent, and methods of using same
US20100297072A1 (en) * 2009-05-19 2010-11-25 Depinho Ronald A Combinations of Immunostimulatory Agents, Oncolytic Virus, and Additional Anticancer Therapy
SG181680A1 (en) * 2009-12-14 2012-07-30 Agency Science Tech & Res A detector module, a method for controlling the detector module and a detection system
RU2482129C2 (ru) * 2010-11-11 2013-05-20 Никита Юрьевич Силко Штамм вируса болезни ньюкасла для создания на его основе кандидатного противоракового препарата и изучения механизмов онколизиса
WO2014011072A1 (ru) * 2012-07-11 2014-01-16 Zabelin Vladimir Arkad Evich Штамм-продуцент вируса болезни ньюкасла ndv/anas crecca/omsk/9/2010, используемый для создания на его основе кандидатного противоракового препарата
WO2015023285A1 (en) * 2013-08-15 2015-02-19 Xia Xueliang James Biomarkers for use in colorectal cancer
RU2562115C1 (ru) * 2014-11-13 2015-09-10 Федеральное государственное автономное образовательное учреждение высшего образования "Новосибирский национальный исследовательский государственный университет"(Новосибирский государственный университет, НГУ) Штамм вируса болезни ньюкасла для изучения онколитических свойств и механизмов онколизиса для создания прототипного противоопухолевого препарата
CN104531866B (zh) * 2014-12-24 2017-02-22 北京丽阳吉诺科技有限公司 用于结肠直肠癌中使用的生物标志物
JOP20190256A1 (ar) 2017-05-12 2019-10-28 Icahn School Med Mount Sinai فيروسات داء نيوكاسل واستخداماتها
US12391957B2 (en) 2018-08-17 2025-08-19 Icahn School Of Medicine At Mount Sinai Recombinant Newcastle disease viruses and uses thereof for the prevention of RSV disease or human metapneumovirus disease
CN114774373B (zh) * 2022-04-27 2024-07-05 北京市农林科学院 信鸽新城疫病毒基因工程改造弱毒株及其制备方法和应用

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5124148A (en) * 1988-04-27 1992-06-23 United Cancer Research Institute Method for treating viral diseases with attenuated virus
US5215745A (en) * 1988-04-27 1993-06-01 United Cancer Research Institute Method for treating viral diseases with attenuated virus
US5118502A (en) * 1989-06-20 1992-06-02 The University Of Georgia Research Foundation, Inc. Naturally attenuated newcastle disease vaccine and method of using the same
AU672359B2 (en) * 1991-03-07 1996-10-03 Virogenetics Corporation Genetically engineered vaccine strain
US5602023A (en) * 1992-03-24 1997-02-11 Csatary; Laszlo K. Pharmaceutical product containing live, stabilized virus for the therapy of viral and malignant diseases and process for preparing the same
PT1486211E (pt) * 1993-04-30 2009-02-02 Wellstat Biologics Corp Composições para tratamento do cancro utilizando vírus
DE69632235T2 (de) * 1995-10-18 2004-08-26 Akzo Nobel N.V. Newcastle-Krankheitsvirus-Kombinationsimpfstoff
FR2749323B1 (fr) * 1996-06-04 1998-07-10 Pasteur Merieux Serums Vacc Pseudo-particules virales utiles en tant que vecteur de delivrance d'acide nucleique
FR2751225B1 (fr) * 1996-07-19 1998-11-27 Rhone Merieux Formule de vaccin polynucleotidique aviaire
US20030044384A1 (en) * 1997-10-09 2003-03-06 Pro-Virus, Inc. Treatment of neoplasms with viruses
EP0974660A1 (en) * 1998-06-19 2000-01-26 Stichting Instituut voor Dierhouderij en Diergezondheid (ID-DLO) Newcastle disease virus infectious clones, vaccines and diagnostic assays
DE60239394D1 (de) * 2001-05-11 2011-04-21 Wellstat Biologics Corp Onkolytische virustherapie

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9844574B2 (en) 2004-04-27 2017-12-19 Wellstat Biologics Corporation Cancer treatment using viruses and camptothecins
US7767200B2 (en) 2005-07-14 2010-08-03 Wellstat Biologics Corporation Cancer treatment using viruses, fluoropyrimidines and camptothecins
US8377450B2 (en) 2009-11-30 2013-02-19 United Cancer Research Institute Clone of Newcastle disease virus, its manufacture and its application in the medical treatment of cancer

Also Published As

Publication number Publication date
US7223389B2 (en) 2007-05-29
US20050031642A1 (en) 2005-02-10
CA2458543A1 (en) 2003-03-20
EP1424897A2 (en) 2004-06-09
US20100113335A1 (en) 2010-05-06
JP2005508158A (ja) 2005-03-31
IL145397A0 (en) 2002-06-30
WO2003022202A3 (en) 2004-03-18
AU2002341356B2 (en) 2007-11-15
EP1424897A4 (en) 2009-06-17
WO2003022202A9 (en) 2004-04-22

Similar Documents

Publication Publication Date Title
US20100113335A1 (en) Compositions and methods for treatement of cancer
Yusoff et al. Newcastle disease virus: macromolecules and opportunities
Takakuwa et al. Potentially virulent Newcastle disease viruses are maintained in migratory waterfowl populations
JP2024161055A (ja) 安定化されたnaを有する組換えインフルエンザウイルス
AU2002341356A1 (en) Compositions and methods for treatment of cancer
JP2022527235A (ja) インフルエンザウイルスにおける付加的遺伝子に遺伝的安定性を付与する突然変異
CN111944767A (zh) 以减毒的新城疫病毒为特征的组合物和用于治疗瘤形成的使用方法
KR101548436B1 (ko) 개과 동물의 호흡기 질병 조절을 위한 물질들 및 방법들
EP3773607A1 (en) Increased activity of oncolytic newcastle disease virus
CN102459578A (zh) 基于在北美狗中循环的犬瘟热病毒的免疫原性组合物、疫苗和诊断方法
Ferreira et al. Protection conferred by commercial NDV live attenuated and double recombinant HVT vaccines against virulent California 2018 Newcastle disease virus (NDV) in chickens
CN115317600A (zh) 口蹄疫疫苗
Wakamatsu et al. The effect on pathogenesis of Newcastle disease virus LaSota strain from a mutation of the fusion cleavage site to a virulent sequence
CN107586759A (zh) 一种重组新城疫病毒的构建方法及应用
Stettler et al. Determinants of persistence in canine distemper viruses
Rota et al. Comparison of the immune response to variant influenza type B hemagglutinins expressed in vaccinia virus
KR101390554B1 (ko) 신규한 개 인플루엔자 바이러스(h3n2), 이를 포함하는 백신 조성물 및 h3n2 바이러스 검정 키트
CN102559612B (zh) 表达尼帕脑炎病毒G蛋白的重组新城疫病毒LaSota疫苗株
CN113736749B (zh) 一株禽流感病毒毒株及其应用
CN118421571A (zh) 表达尼帕病毒囊膜糖蛋白的嵌合型vsv重组病毒及其应用
US5550017A (en) Anti-paramyxovirus screening method and vaccine
KR101908905B1 (ko) 인플루엔자 바이러스의 h9 및 h5의 다중 아형에 대한 교차 면역반응을 형성하는 신규한 재조합 인플루엔자 바이러스 및 이를 포함하는 백신
Yu et al. Generation and biological assessment of recombinant avian metapneumovirus subgroup C (aMPV-C) viruses containing different length of the G gene
CN110628724A (zh) 一种三型副流感病毒野毒株及其应用
PT1780216E (pt) Coronavírus canino pantrópico

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 160816

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 10800256

Country of ref document: US

Ref document number: 2003526332

Country of ref document: JP

Ref document number: 2458543

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2002775172

Country of ref document: EP

Ref document number: 2002341356

Country of ref document: AU

COP Corrected version of pamphlet

Free format text: PAGES 1/13-12/13, DRAWINGS, REPLACED BY NEW PAGES 1/13-12/13

WWP Wipo information: published in national office

Ref document number: 2002775172

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2002341356

Country of ref document: AU

Date of ref document: 20020912

Kind code of ref document: B