WO2003002611A2 - Fusionsproteine, verfahren zu deren herstellung und deren verwendung - Google Patents

Fusionsproteine, verfahren zu deren herstellung und deren verwendung Download PDF

Info

Publication number
WO2003002611A2
WO2003002611A2 PCT/EP2002/007191 EP0207191W WO03002611A2 WO 2003002611 A2 WO2003002611 A2 WO 2003002611A2 EP 0207191 W EP0207191 W EP 0207191W WO 03002611 A2 WO03002611 A2 WO 03002611A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
fusion protein
nucleotide
affinity
fusion
Prior art date
Application number
PCT/EP2002/007191
Other languages
English (en)
French (fr)
Other versions
WO2003002611A3 (de
Inventor
Friedrich Wilhelm Herberg
Bastian Zimmermann
Original Assignee
Biaffin Gmbh & Co Kg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biaffin Gmbh & Co Kg filed Critical Biaffin Gmbh & Co Kg
Priority to EP02751093A priority Critical patent/EP1409552A2/de
Publication of WO2003002611A2 publication Critical patent/WO2003002611A2/de
Publication of WO2003002611A3 publication Critical patent/WO2003002611A3/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the invention relates to new fusion proteins containing at least one nucleotide-binding domain, their use and a method for their production. These fusion proteins containing at least one nucleotide-binding domain are preferably used in analysis and in protein biochip technology.
  • Genome and proteome research identify a large number of proteins that are involved in certain cellular processes, but without being able to directly elucidate their mode of action.
  • the identification of binding partners and the characterization of their binding properties is a first step towards understanding the function of proteins.
  • the biomolecular interaction analysis (B1A, [1]) enables the interaction of biomolecules to be characterized in a highly reproducible and real-time manner.
  • the binding properties of two interaction partners allow precise statements about the rate of complex formation and the duration of the binding by the separate determination of association and dissociation constants. This enables considerably more precise statements to be made about the function of a component depending on modifications such as mutations, isoforms or post-translational modifications (eg phosphorylation).
  • Prerequisites for such investigations are high-purity protein fractions, which can be immobilized in a highly reproducible and reversible manner on suitable sensor surfaces. So far, various methods have been used in the prior art which do not always lead to the desired success.
  • a simple way to covalently immobilize proteins on sensor surfaces is to chemically link functional groups of the ligand to be coupled (NH 2 , SH, CHO, COOH) to a surface functionalized with adequate chemical groups (e.g. a carboxymethylated dextran mat ⁇ ' x).
  • the major disadvantage of this method is the formation of a heterogeneous population of ligands with different degrees of steric hindrance.
  • a directional coupling, for example to make certain functional domains of a macromolecule accessible to an interaction, cannot be guaranteed, so that reproducible measurements are difficult.
  • fusion fractions eg glutathione-S-transferase or ß-lacamase
  • This fusion protein contains at least one nucleotide-binding domain (hereinafter fusion protein according to the invention).
  • fusion protein encompasses such commercially valuable enzymes: catalase, laccase, phenol oxidase, oxidase, oxidoreductases, cellulase xylanase, peroxidase, lipase, hydrolase, esterase, cutinase, protease and other proteolytic enzymes, aminopeptidase , Carboxypeptidase, phytase, lyase, pectinase and other pectinolytic enzymes, amylase glucoamylase, ⁇ -galactosidase, ß-galactosidase, ⁇ -glucosidase, ß-glucosidase, mannosidase, isomerase, invertase, transferase, kinases, and ribinuclease, and other ribonuclease Nucleases, which
  • nucleotide-binding domain encompasses any domain of a protein or peptide which interacts physically and / or chemically with nucleotides, nucleotide analogs or nucleotide derivatives (together hereinafter “nucleotide derivatives”) and preferably has (binding) affinity or coupling.
  • the invention also relates left capable nucleotide derivatives on surfaces whose backbone of sugars such as not limited to ribose, 2 'deoxy-ribose, cyclized derivatives and others, a nucleobase, such as adenine, guanine, thymine, cytosine, uracil, xanthine, whose ring positions with at least one radical such as C1-C18 alkyl, cycloalkyl, alkylene or aryl, halogen, perfluoroalkyl, hydroxyl, amine, Thio. Nitrile, carboxyl, carboamide, and heterocycles, are substituted, and consist of at least one phosphate residue.
  • a nucleobase such as adenine, guanine, thymine, cytosine, uracil, xanthine
  • ring positions with at least one radical such as C1-C18 alkyl, cycloalkyl, alkylene
  • the substitutions of the natural nucleotides should on the one hand enable the desired different binding behavior of the fusion protein of the invention on surfaces (for example residues D and E on R1 or R2 in FIG. 2D), and on the other hand with suitable linkers (preferably alkyl residues, preferably C1-C18 of different lengths) at least one amino and / or thio group, for example residues A to C on R1 or R2 in FIG. 2D) enable the coupling to surfaces.
  • suitable linkers preferably alkyl residues, preferably C1-C18 of different lengths
  • cAMP analogs which contain substitutions according to the invention, in particular in the 2, 6 and / or 8 position of the adenosine residue in the cAMP backbone, which lead to optimized binding behavior on surfaces (affinity modification) for immobilization, are also the subject of the invention.
  • cAMP derivatives such as 6AHA-8PIP-cPuMP: N6- (6-aminohexylamino) -8- Pipe ⁇ ' dinpurinribose-3', 5'-cyclomo ⁇ ophosphate; 8AHDAA-cAMP: 8- (17-amino-9-aza-heptadecyl) adenosine-3 ' , 5 ' -cyclomonophosphate; 8-AHA-cAMP: 8- (6-aminohexylamino) adenosine-3 ' , 5 ' -cyclomonophosphate; 6- AEA-8-PIP-cPuMP: N6- (2-aminoethylamino) -8-piperidinepur ⁇ ribose-3 ' , 5 ' - cyclomonophosphate; 6-AHA-8-PIP-cPuMP: N6- (6-aminohexylamino)
  • affinity-determining nucleotide derivatives individually or in a mixture, can be present on surfaces according to the invention.
  • the invention therefore relates to such nucleotide derivatives on whose nucleobase at least one linker for coupling to surfaces and possibly further substituents for affinity modification are contained.
  • the variation of the strength of the coupling or affinity on surfaces is made possible by different binding kinetics of the fusion protein according to the invention to different nucleotide derivatives.
  • a particularly advantageous property of the fusion protein according to the invention is that, with different nucleotide derivatives, it shows both transient kinetics, which are necessary for affinity chromatography, and kinetics with a very slow dissociation rate, which are very suitable for stable coupling (specific application examples are shown below ).
  • the invention relates to a method for producing the fusion protein according to the invention.
  • the nucleic acid sequence of a nucleotide-binding domain is ligated in a suitable expression vector to any amino acid sequence to be expressed, optionally at the C- or N-terminal (step 1, FIG. 1).
  • the fusion protein according to the invention (step 2, FIG. 1) produced in heterologous or homologous expression systems binds to highly efficient cleaning with transient binding kinetics to at least one nucleotide derivative which is coupled to suitable surfaces such as affinity matrices (preferably chemically activated agaroses and sepharoses) (step 3 in FIG. 1).
  • suitable surfaces such as affinity matrices (preferably chemically activated agaroses and sepharoses)
  • the purified fusion protein can then be stably and reversibly immobilized on another, high-affinity nucleotide derivative on further surfaces, not finally functionally named, such as biosensors, ELISA, protein biochips, microtiter plates and microarrays (step 4 in FIG. 1).
  • the regeneration of the surfaces can be carried out very easily with low concentrations of surface-active substances (detergents such as SDS) or chaotropic salts (e.g. guanidinium hydrochloride) without reducing the coupling efficiency of the surfaces.
  • detergents such as SDS
  • chaotropic salts e.g. guanidinium hydrochloride
  • the regeneration of a surface is ensured by adding a further nucleotide derivative with an even higher binding affinity to the fusion protein according to the invention.
  • an affinity matrix is selected with at least one nucleotide derivative to which one or more fusion proteins according to the invention have a fast association and relative bind faster dissociation kinetics. With such a transient binding kinetics, it is possible to quantitatively elute the fusion protein according to the invention from the matrix after washing steps with a suitable nucleotide in excess.
  • the fusion protein according to the invention which is now obtained in a highly pure form, can be coupled directly on the surface of a further matrix after removal of the nucleotide necessary for the elution.
  • a stable coupling of the fusion protein is now desirable.
  • a suitable nucleotide derivative that has been suitably immobilized on the surface, kinetics with fast association, but this time only little dissociation, are possible, which leads to the desired firm binding of the fusion protein.
  • the immobilized fusion protein can now e.g. Interaction analysis or screening with other binding partners can be carried out without any problems.
  • the manufacture of the surfaces contained in this invention, which can be modified with the corresponding nucleotide derivatives, is technically easy to solve.
  • the nucleotide derivatives (for examples see FIG. 2D) preferably each contain linker sequences with a functional group (eg -NH2), via which they are chemically coupled to the surfaces.
  • linker sequences with a functional group eg -NH2
  • various stationary phases for chromatography applications including the modern "monolith” phases [9], microfiltration membranes [10] or affinity microparticles [11]
  • the term surface therefore encompasses any solid phase, preferably made of glass, metal, ceramic, porcelain, also of a porous nature, such as silica gel, Sepharose, agarose and other affinity matrices, preferably materials suitable for chromatography, preferably for affinity chromatography.
  • surfaces of biosensors, ELISA, protein biochips, microtiter plates (in particular corrugated plates with 96, 384, 1536 and more cells) and microarrays are also included in a functional design.
  • Such surfaces according to the invention can also be suitably treated, for example with silica, polyacrylamide and many more
  • the invention also relates to an assay containing one or more fusion proteins according to the invention, in particular an assay for biomolecular interaction analysis, i.e. for the standardized measurement of the binding kinetics of the fusion proteins according to the invention, preferably e.g. using surface plasmon resonance technology on Biacore® devices, for protein-protein, protein-antibody, protein-cofactor, protein-DNA, protein-RNA, protein-target, protein-drug, etc. -interactions and protein-membrane, protein - Line interactions, the fusion proteins according to the invention being suitably immobilized on a surface [1, 12].
  • an assay for biomolecular interaction analysis i.e. for the standardized measurement of the binding kinetics of the fusion proteins according to the invention, preferably e.g. using surface plasmon resonance technology on Biacore® devices, for protein-protein, protein-antibody, protein-cofactor, protein-DNA, protein-RNA, protein-target, protein-drug, etc. -interaction
  • the invention therefore relates to a protein biochip or microarray containing one or more fusion proteins according to the invention, the fusion proteins according to the invention being suitably immobilized on a surface.
  • any arrangement of biomolecules, low molecular weight compounds and an is under an assay, array (also test system) or protein biochip (eg WO 00/04382 or WO 99/33289) or one or more fusion proteins according to the invention understood on a surface, which are accessible to an evaluating analysis, preferably using methods of mass spectrometry, fluorimetry and / or antibody screening, and which allow the identification and characterization of substances of interest [13].
  • screening methods and corresponding devices are also included according to the invention.
  • the invention therefore also relates to a method for producing a biosensor, assay, ELISA, array or protein biochip, in which a.) At least one fusion protein according to the invention is immobilized on a surface containing at least one affinity-determining nucleotide derivative, b.) With at least one composition containing at least a test compound (such as, for example, serum, mixtures of substances and others) and, if appropriate, further auxiliaries and additives are added, and c.) is detected using a suitable detection system.
  • a test compound such as, for example, serum, mixtures of substances and others
  • the method according to the invention allows the search for one or more, identical or different test compounds.
  • the fusion protein according to the invention contains the regulatory subunits of the cAMP-dependent protein kinase [14, 15] as the nucleotide-binding domain. Domains A and B of the regulatory subunits with their cAMP-binding property are particularly preferred. For example, for the isolated B domain of the regulatory subunit of the cAMP-dependent protein kinase bRl ⁇ 1-251 (for the production of the expressed protein bRl ⁇ 1-251 see example 1, construct without a fusion component as a reference) using the surface plasmon resonance sensor technology [1] binding kinetics dependent on the nucleotide derivative can be observed (see FIG. 2A).
  • nucleotide derivatives directly influence the binding properties of domains A and B.
  • Specific nucleotide derivatives for the A domain are, for transient kinetics, for example 8-AHA-cAMP (8- (6-aminohexylamino) adenosine-3 ' , 5 ' -cyclomonophosphate) or 6-AEA-8-PIP-cPuMP (N6- (2-aminoethylamino) -8-piperidine purine ribose-3 ' , 5 ' -cyclomonophosphate) and for stable kinetics e.g. 6-AHA-8-PIP-cPuMP (N6- (6-aminohexylamino) -8-piperidinepurinribose-3 ' , 5 ' -cyclomonophosphate).
  • the nucleotide derivatives 6-AHDAA-8-PlP-cPuMP N6- (17-amino-9-aza-heptadecyl) -8-piperidinpurinribose-3 ' , 5 ' -cyclomonophosphate) or 6-AEA-8-pCPT-cPuMP (N6- (2-aminoethylamino) -8- (4-chlorophenylthio) purinribose-3 ' , 5 ' -cyclomonophosphate) is an alternative for transient kinetics, while for example 6-AHDAA -8th- pCPT-cPuMP (N6- (17-Amino-9-Aza-He ⁇ tadecyl) -8- (4-chlorophenylthio) - purinribose-3 ' , 5 ' -cyclomonophosphate) or 6-AHA-8-pCPT-cPuMP
  • a corresponding fusion protein according to the invention can preferably be produced with the nucleic acid sequence of the nucleotide-binding domains A (SEQ ID 1) and B (SEQ ID 2) and cloned into a suitable expression vector (see Example 1). Further modifications (e.g. mutations) can be introduced to optimize binding.
  • the fusion protein according to the invention preferably has the amino acid sequence of the nucleotide-binding domain according to SEQ ID 1 or SEQ ID 2.
  • the fusion protein according to the invention in particular the nucleotide-binding domain, can also have one or more amino acid deletions, amino acid exchanges or amino acid additions or insertions for the purpose of optimizing the coupling to the nucleotide derivatives as long as the function of the fusion protein according to the invention is not significantly impaired thereby.
  • such functional variants should also be included.
  • the fusion protein according to the invention can also contain foreign protein sequences (e.g. as an extended fusion protein).
  • nucleic acids preferably DNA sequences, sequences complementary to these sequences, and fragments thereof comprising functional variants
  • SEQ ID 1 coding for a protein according to SEQ ID 1 with the function of a nucleotide-binding domain, specifically preferably domain A of the regulatory subunit of the cAMP-dependent protein kinase from bovine bRI ⁇ I-134, ⁇ 245-379, or SEQ ID 2 with the function of a nucleotide-binding domain and preferably domain B of the regulatory subunit of the cAMP-dependent protein kinase from bovine bRI ⁇ I-251 [15].
  • DNA sequences are also taken into account according to the invention which hybridize with the sequences complementary to SEQ ID 1 or SEQ ID 2 and are capable of coding preferably a fusion protein according to the invention; and DNA sequences that are degenerate in their genetic code with respect to the sequences mentioned.
  • DNA sequences according to the invention can be linked to other DNA sequences, in particular auxiliary sequences, which enable expression of the protein in a desired host organism.
  • auxiliary sequences Such sequences are known in the prior art. These are, for example, regulatory sequences such as promoter sequences, Shine-Dalgamo sequences, transcription termination signals, polyadenylation signals or enhancer elements. In this way, the fusion protein according to the invention can be obtained inexpensively in large quantities (for example with CHO cells or the like).
  • auxiliary sequences which allow ligation with other desired nucleic acid sequences. Such sequences are known in the prior art. These are polylinkers or spacers (see example 1).
  • epitopic auxiliary sequences can be inserted to demonstrate screening success.
  • nucleic acids are preferably understood to mean DNA sequences, but other nucleic acid analogs are not excluded.
  • the invention therefore also relates to recombinant nucleic acids which contain the DNA sequences according to the invention.
  • the recombinant nucleic acids can either be introduced directly into the desired host organism or first inserted into vectors with which the host organisms are subsequently transformed in a manner known per se.
  • vectors are also the subject of the invention.
  • the vectors customary in the prior art, for example plasmids, bacteriophages or viruses, can be used as vectors.
  • Preferred vectors are expression vectors.
  • the nucleic acid according to the invention is therefore contained in a vector, preferably in an expression vector (see Example 1).
  • the invention also relates to host organisms which contain the recombinant DNA molecules or vectors according to the invention.
  • Suitable host organisms are, for example, prokaryotic or eukaryotic microorganisms, for example bacteria such as Escherichia coli or yeast cells, baculovirus / Sf9 cells, but also human cell lines, which are preferably used for overexpression of any desired fusion protein according to the invention. If necessary, further fusion components can be discharged to improve the solubility or localization of the recombinant fusion protein according to the invention in the periplasm [16] or even in the medium [17, 18].
  • prokaryotic or eukaryotic microorganisms for example bacteria such as Escherichia coli or yeast cells, baculovirus / Sf9 cells, but also human cell lines, which are preferably used for overexpression of any desired fusion protein according to the invention. If necessary, further fusion components can be discharged to improve the solubility or localization of the recombinant fusion protein according to the invention in the periplasm [16] or even in the medium [17, 18].
  • DNA sequences according to the invention or fragments thereof can be used to find homologous DNA sequences in different organisms which have a similar or the same function as the fusion protein according to the invention, containing in particular a nucleotide-binding domain (so-called probe).
  • peptide libraries can be produced by the DNA sequences according to the invention or fragments thereof, it being possible, for example, from a total of nucleic acids, preferably cDNA banks or other genomic banks, to clone them into such expression vectors according to the invention and to express them in whole or in part (So-called expression libraries; see also Cahill et al. WO 99/57311 and WO 99/57312).
  • the fusion protein according to the invention and the DNA sequences coding for this protein can furthermore advantageously be used as diagnostics.
  • FIG. 1 functioning of the “nucleotag expression system”
  • FIG. 2 biomolecular interaction analysis; Biacore® binding kinetics of the B domain of the regulatory subunit of the cAMP-dependent protein kinase bRl ⁇ 1-251 (FIG. 2A) and the Fusion protein bRl ⁇ 1 -251 with PKI (Fig. 2B) on two different cAMP derivatives
  • 6AHA-8PIP-cPuMP N6- (6-aminohexylamino) -8- piperidine purine ribose-3 ', 5'-cyclomonophosphate;
  • R1 is -NH 2
  • C 8-AHA cAMP 8- (6-aminohexylamino) adenosine-3 ', 5' - cyclo monophosphate;
  • R1 -NH2
  • R2 B 6-AEA-8-PIP-cPuMP: N6- (2-aminoethylamino) -8- piperidine purine ribose-3 ', 5'-cyclomonophosphate;
  • SEQ ID 1 Nucleotide-binding domain A of the regulatory subunit of cAMP-dependent protein kinase from bovine bRl ⁇ 1-134, ⁇ 245-379 in DNA sequence (333 nucleotides) and amino acid sequence (111 amino acids)
  • SEQ ID 2 Nucleotide-binding domain B of the regulatory subunit of the cAMP-dependent protein kinase from bovine bRl ⁇ 1-251 in DNA sequence (387 nucleotides) and amino acid sequence (129 amino acids)
  • a blunt-end PCR fragment of the complete B domain of the regulatory subunit I of the cAMP-dependent protein kinase PKA from bovine (bRI ⁇ I -251, SEQ ID 2) is cloned into the vector pLEX 5BA restricted with Xmnl [19] [15] , Short primers produced using synthetic double-stranded oligonucleotides are inserted directly behind this sequence, which, with the newly introduced singular restriction sites, enable the further cloning of any fusion proteins in all three possible reading frames.
  • the gene for the protein kinase inhibitor PKI as test fusion protein was cloned into this vector construct via Ndel and Hindlll.
  • the E.coli bacteria transformed with the fusion vector from Example 1 in 2x YT medium are induced at 37 ° C. at an OD560 of 0.6 with 1 mM IPTG and left in the warm air shaker for a further 3 hours.
  • the bacterial sediment is in a 4-fold volume of lysis buffer (20 mM phosphate buffer pH 6.8, 100 mM NaCl, 2 mM EDTA, 2 mM EGTA, 5 mM ⁇ -mercaptoethanol, 2 mM benzamidine, 0.5 ⁇ g / ml leupeptin, 10 ⁇ g / ml TLCK , 10 ⁇ g / ml TPCK) digested with a french press.
  • This crude lysate is applied to a column equilibrated with affinity buffer (20 mM phosphate buffer pH 6.8, 100 mM NaCl, 2 mM EDTA, 2 mM EGTA, 5 mM ⁇ -mercaptoethanol) with 6-AHA-8-PIP-cPuMP agarose (structure see FIG 2D) plotted. After washing with 1 M NaCI in affinity buffer, the high-purity fusion protein is eluted with 200 ⁇ M cAMP.
  • the 6-AHA-8-PIP-cPuMP agarose can be regenerated with 3 M guanidinium hydrochloride.
  • a second affinity chromatography with fresh bacterial lysate shows only a slight decrease in the capacity of the column material with otherwise unchanged binding and elution behavior.
  • Figure 3 documents the successful purification of the fusion protein.
  • cAMP nucleotide analogs 8-AHDAA-cAMP and 6-AHA-8PIP-cPuMP (structures see Figure 2D) in 2 mM solution (20% DMSO in 100 mM boric acid pH 9.0) after the Standard protocol of amide coupling (see Biacore® Amine Coupling Kit) immobilized.
  • the affinity chromatography eluate is exchanged with a fast-desalting FPLC column (Pharmacia) for running buffer (20 mM MOPS, pH 7.0, 150 mM NaCl, 0.002% Tween 20).
  • the binding domain does not influence the function of the fusion protein: an injection of the natural target protein of the inhibitor, the catalytic subunit of the protein kinase C ⁇ , shows a binding of the C subunit to the kinase inhibitor PKI immobilized on the sensor surface via the Nuleotag (see FIG. 2C) ,
  • a complete regeneration of the sensor surfaces after each measurement is possible by a short injection with 3 M guanidinium hydrochloride.
  • a 1 mM cAMP or 0.1% SDS solution is also suitable for regeneration.
  • BIAcore a microchip-based system for analyzing the formation of macromolar complexes. Structure 3,331-333
  • Pugsley AP (1993): The Complete General Secretory Pathway in Gram-Negative Bacteria. Microbiol. Rev. 57, 50-108 Perez-Perez J., Marquez G .. Barbero J..L. and Gutjerrez J. (1994): Increasing the Efficiency of Protein Export in Escherichia coli. Bio / Technology 12, 178-80

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to novel fusion proteins that contain at least one nucleotide-binding domain, especially with SEQ ID 1 or SEQ ID 2, to the use thereof and to a method for producing them. Preferably, the fusion proteins containing at least one nucleotide-binding domain are used in analytics and protein biochip technology.

Description

Beschreibung
Fusionsproteine, Verfahren zu deren Herstellung und deren Verwendung
Die Erfindung betrifft neue Fusionsproteine enthaltend mindestens eine nukleotidbindende Domäne, deren Verwendung und ein Verfahren zu deren Herstellung. Bevorzugt werden diese Fusionsproteine enthaltend mindestens eine nukleotidbindende Domäne in der Analytik und in der Protein-Biochiptechnologie eingesetzt.
Genom- und Proteomforschung identifizieren eine Vielzahl von Proteinen, die an bestimmten zellulären Prozessen beteiligt sind, ohne jedoch direkt ihren Wirkmechanismus aufklären zu können. Die Identifizierung von Bindungspartnern und die Charakterisierung deren Bindungseigenschaften ist ein erster Schritt zum Verständnis der Funktion von Proteinen.
Die biomolekulare Interaktionsanalyse (B1A, [1]) erlaubt die Charakterisierung der Wechselwirkung von Biomolekülen hochreproduzierbar und in Echtzeit. Die Bindungseigenschaften zweier Interaktionspartner lassen durch die getrennte Bestimmung von Assoziations- und Dissoziationskonstanten präzise Aussagen über die Geschwindigkeit der Komplexbildung und die Dauer der Bindung zu. Dadurch lassen sich erheblich genauere Aussagen über die Funktion einer Komponente abhängig von Modifikationen wie Mutationen, Isoformen oder posttranslationalen Modifikationen (z.B. Phosphorylierungen) erzielen. Voraussetzung für derartige Untersuchungen sind hochreine Proteinfraktionen, die sich hochreproduzierbar und reversibel an geeignete Sensoroberflächen stabil immobilisieren lassen. Bisher werden im Stand der Technik verschiedene Methoden angewandt, die nicht immer zum gewünschten Erfolg führen.
Eine einfache Möglichkeit, Proteine kovalent an Sensoroberflächen zu immobilisieren, besteht in der chemischen Verknüpfung funktioneller Gruppen des zu koppelnden Liganden (NH2, SH, CHO, COOH) an eine mit adäquaten chemischen Gruppen funktionalisierte Oberfläche (z.B. eine carboxymethylierte Dextranmatπ'x). Der große Nachteil dieser Methode besteht in der Bildung einer heterogenen Population von Liganden mit unterschiedlichem Grad sterischer Hinderung. Eine gerichtete Kopplung, um z.B. bestimmte funktionelle Domänen eines Makromoleküls einer Wechselwirkung zugänglich zu machen, kann nicht gewährleistet werden, so dass reproduzierbare Messungen erschwert werden.
Andere Kopplungsvarianten mit einem Fusionsanteil am interessierenden Protein gestatten zwar eine gerichtete Bindung an die Sensoroberfläche, haben aber meist andere Nachteile [2,3]. Zunächst muss gewährleistet sein, dass der Fusionsanteil die Funktion des Proteins nicht wesentlich beeinflusst. Kleine Fusionsanteile, wie das bekannte Poly-Histidin-Tag (EP 253303 und EP 282042), welches sich die Protein-Metaüchelat- Wechselwirkung zunutze macht, haben meist nur einen geringen Einfluss auf die Sekundärstruktur des Proteins, sind aber aufgrund ihrer Ladung und der verhältnismäßig geringen Größe häufig nicht frei zugänglich, was sich in einer ineffizienten Kopplungseffektivität mit nur geringer Selektivität und geringer Affinität und einer für eine stabile Kopplung relativ ungünstigen, schnellen Dissoziationskinetik niederschlägt [4,5]. Weitere bekannte kurze Fusionsanteile (Strep-Tag mit 10 Aminosäuren [6], S-Tag mit 15 Aminosäuren oder Calmodulin-BP mit 26 Aminosäuren [7]) weisen zwar höhere Bindungsaffinitäten auf, jedoch sind einige Fusionsanteile anfälliger für Proteasen, so dass der Fusionsaπteil während der Aufreinigung oder der Kopplung an Sensoroberflächen (un)spezifisch abgespalten wird. Hierdurch wird nicht nur die Kopplungseffizienz stark beeinträchtigt, die Reinheit des Fusionsproteins wird durch die Degradationsprodukte stark verringert.
Wird zur Immobilisierung eines Fusionsproteins die starke Affinität der Streptavidin-Biotin-Bindung verwendet, ist diese Kopplung praktisch irreversibel, wodurch eine Regeneration beispielsweise einer Chipoberfläche unmöglich wird, wenn das Fusionsprotein einmal gebunden hat.
Größere Fusionsanteile (z.B. Glutathion-S-Transferase oder ß-Lacta- mase) können die Sekundärstruktur des Proteins nachhaltig beeinflussen. Bei hohen Expressionsraten kann die Löslichkeit eines Proteins mit Fusionsanteil herabgesetzt werden, so dass Einschlusskörper (inclusion bodies) entstehen können. Die denaturierten Proteine müssen dann in einem aufwendigen Verfahren durch Einwirkung chaotroper Agenzien in ihre native Struktur zurückgefaltet werden. Durch Fehifaltungen entstehen hohe Verluste an funktioneil intaktem Protein, wodurch insbesondere die Analysenergebnisse auf Protein-Biochips wesentlich verfälscht werden können [8]. Bei keinem der beschriebenen Systeme im Stand der Technik ist die Kombination von Reinigung und Kopplung auf Oberflächen zufriedenstellend gelöst. Die Aufgabe der Erfindung besteht daher in der Bereitstellung neuartiger nukleotidbindender Fusionsproteine und deren Verwendung. Dieses Fusionsprotein enthält mindestens eine nukleotidbindende Domäne (nachstehend erfindungsgemäßes Fusionsprotein).
Im Rahmen dieser Erfindung umfasst der Begriff „Fusionsprotein", nicht abschließend aufgezählt, solche kommerziell wertvolle Enzyme: Katalase, Laccase, Phenoloxidase, Oxidase, Oxidoreductases, Cellulase Xylanase, Peroxidase, Lipase, Hydrolase, Esterase, Kutinase, Protease und andere proteolytische Enzyme, Aminopeptidase, Carboxypeptidase, Phytase, Lyase, Pectinase und andere pectinolytische Enzyme, Amylase Glucoamylase, α-Galactosidase, ß-Galactosidase, α-Glucosidase, ß- Glucosidase, Mannosidase, Isomerase, Invertase, Transferase, Kinasen, Ribonuclease, Chitinase, and Deoxyribonuclease und andere Nucleasen; welche nach bekannten Methoden im Stand der Technik aus dem erfindungsgemäßen Fusionsprotein erhalten oder gewonnen werden können.
Der Begriff „nukleotidbindende Domäne" erfasst jedwede Domäne eines Proteins oder Peptids, welches mit Nukleotiden, Nukleotidanaloga oder Nukleotidderivaten (gemeinsam im folgenden „Nukleotidderivate") in physikalische und / oder chemische Wechselwirkung tritt und vorzugsweise eine (Bindungs-)Affinität oder Kopplung aufweist.
Daher betrifft die Erfindung ebenfalls linkerfähige Nukleotidderivate an Oberflächen, deren Grundgerüst aus Zucker wie nicht abschließend Ribose, 2'-Deoxy-Ribose, zyklisierte Derivate und andere, einer Nukleobase, wie Adenin, Guanin, Thymin, Cytosin, Uracil, Xanthin, dessen Ringpositionen mit mindestens einem Rest wie C1 -C18 Alkyl-, Cycloalkyl, Alkylen oder Aryl, Halogen-, Perfluoralkyl-, Hydroxyl-, Amin-, Thio-. Nitril-, Carboxyl-, Carboamid-, und Heterozyklen, substituiert sind, und aus mindestens einem Phosphatrest bestehen.
Erfindungsgemäß sollen die Substitutionen der natürlichen Nukleotide zum einen das gewünschte unterschiedliche Bindungsverhalten des erfindungsgemäßen Fusionsproteins auf Oberflächen (z.B. Reste D und E an R1 oder R2 in Figur 2D), ermöglichen und andererseits über geeignete Linker (vorzugsweise Alkylreste, vorzugsweise C1-C18 unterschiedlicher Länge mit mindestens einer Amino- und / oder Thiogruppe, z.B. Reste A bis C an R1 oder R2 in Figur 2D) die Kopplung an Oberflächen ermöglichen.
Bevorzugt sind weiterhin cAMP-Analoga, die erfindungsgemäße Substitutionen insbesondere in der 2, 6, und/oder 8-Position des Adenosinrestes im cAMP-Grundgerüst enthalten, die zu optimiertem Bindungsverhalten auf Oberflächen (Affinitätsmodifikation) zur Immobilisation führen, sind ebenfalls Gegenstand der Erfindung.
In einer bevorzugten Ausführungsform handelt es sich daher um cAMP- Derivate wie 6AHA-8PIP-cPuMP: N6-(6-Aminohexylamino)-8- Pipeπ'dinpurinribose-3',5'-cyclomoπophosphat; 8AHDAA-cAMP: 8-(17- Amino-9-Aza-Heptadecyl)-Adenosin-3',5'-cyclomonophosphat; 8-AHA- cAMP: 8-(6-Aminohexylamino)adenosin-3',5'-cyclomonophosphat; 6- AEA-8-PIP-cPuMP: N6-(2-Aminoethylamino)-8-Piperidinpuriπribose-3',5'- cyclomonophosphat; 6-AHA-8-PIP-cPuMP: N6-(6-Aminohexylamino)-8- Pipeπdinpuhnribose-3',5'-cyclomonophosphat; 6-AHDAA-8-PIP-cPuMP: N6-(17-Amino-9-Aza-Heptadecyl)-8-Piperidinpurinribose-3',5'- cyclomoπophosphat; 6-AEA-8-pCPT-cPuMP: N6-(2-Aminoethylamino)-8- (4-Chlorophenylthio)purinribose-3',5'-cyclomonophosphat, 6-AHDAA-8- pCPT-cPuMP: N6-(17-Amino-9-Aza-Heptadecyl)-8-(4-Chlorophenylthio)- purinhbose-3',5'-cyclomonophosphat; 6-AHA-8-pCPT-cPuMP (N6-(6- Aminohexylamino)-8-(4-Chlorophenylthio)purinribose-3',5'- cyclomonophosphat; veranschaulicht in Figur 2.
Solche affinitätsbestimmenden Nukleotidderivate, einzeln oder in Mischung, können erfindungsgemäß auf Oberflächen enthalten sein.
Daher betrifft die Erfindung solche Nukleotidderivate an dessen Nukleobase mindestens einen Linker zur Kopplung auf Oberflächen und ggfs. weitere Substituenten zur Affinitätsmodifizierung enthalten sind.
Erfindungsgemäß ist die Variation der Stärke der Kopplung bzw. Affinität auf Oberflächen ermöglicht durch unterschiedliche Bindungskinetiken des erfindungsgemäßen Fusionsproteins an verschiedenen Nukleotidderivaten. Eine besonders vorteilhafte Eigenschaft des erfindungsgemäßen Fusionsproteins ist, dass es mit verschiedenen Nukleotidderivaten sowohl transiente Kinetiken, die für die Affinitätschromatographie notwendig sind, als auch Kinetiken mit sehr langsamer Dissoziationsgeschwindigkeit, die sich sehr gut für eine stabile Kopplung eignen, zeigt (spezifische Anwendungsbeispiele sind unten aufgezeigt).
Des weiteren betrifft die Erfindung ein Verfahren zur Herstellung des erfinduπgsgemäßen Fusionsproteins. Die Nukleinsäuresequenz einer nukleotidbindenden Domäne wird in einem geeigneten Expressionsvektor an jede beliebige zu exprimierende Aminosäuresequenz, wahlweise C- oder N-terminal, ligiert (Schritt 1 , Figur 1 ).
Das in heterologen oder homologen Expressionssystemen hergestellte erfindungsgemäße Fusionsprotein (Schritt 2, Figur 1 ) bindet zur hocheffizienten Reinigung mit transienter Bindungskinetik an mindestens ein Nukleotidderivat, das an geeigneten Oberflächen wie zum Beispiel Affinitätsmatrices (vorzugsweise chemisch aktivierte Agarosen und Sepharosen) gekoppelt ist (Schritt 3 in Figur 1 ).
Das gereinigte Fusionsprotein kann anschließend an einem anderen, hochaffinen Nukleotidderivat auf weiteren Oberflächen, nicht abschließend funktionell benannt, wie Biosensoren, ELISA, Protein- Biochips, Mikrotiterplatten und Mikroarrays stabil und reversibel immobilisiert werden (Schritt 4 in Figur 1 ).
Auf diese Weise wird erstmals ermöglicht, ein erfindungsgemäßes Fusionsprotein per Affinitätschromatographie schnell und spezifisch in einem Schritt aufzureinigen und ggfs. ohne weitere Modifikationen stabil und aktiv an eine beliebige Oberfläche zur weiteren Analyse zu koppeln (Schritt 5 in Figur 1 ).
Die Regeneration der Oberflächen kann aufgrund der Stabilität der Nukleotide sehr einfach mit geringen Konzentrationen an oberflächenaktiven Substanzen (Detergenzien wie z.B. SDS) oder chaotropen Salzen (z.B. Guanidiniumhydrochlorid) durchgeführt werden, ohne dass die Kopplungseffizienz der Oberflächen nachlässt.
Alternativ ist die Regeneration einer Oberfläche durch Zugabe eines weiteren Nukleotidderivates mit noch höherer Bindungsaffinität zum erfindungsgemäßen Fusionsprotein gewährleistet.
Für die Aufreinigung des Fusionsproteins wird eine Affinitätsmatrix mit mindestens einem Nukleotidderivat gewählt, an welches ein oder mehrere erfindungsgemäße Fusionsproteine mit schneller Assoziations- und relativ schneller Dissoziationskinetik binden. Bei einer solchen transienten Bindungskinetik ist es möglich, das erfindungsgemäße Fusionsprotein von der Matrix nach Waschschritten mit einem geeigneten Nukleotid im Überschuss quantitativ zu eluieren.
Das nunmehr hochrein erhaltene erfindungsgemäße Fusionsprotein kann nach Entfernung des für die Elution notwendigen Nukleotids direkt auf der Oberfläche einer weiteren Matrix gekoppelt werden. Für Untersuchungen auf Oberflächen, wie Sensoroberflächen oder Protein-Biochips, ist nunmehr eine stabile Kopplung des Fusionsproteins erwünscht. Durch die Wahl eines geeigneten Nukleotidderivates, welches auf der Oberfläche geeignet immobilisiert wurde, ist eine Kinetik mit schneller Assoziation, diesmal aber nur geringer Dissoziation möglich, was zur gewünschten festen Bindung des Fusionsproteins führt. Am immobilisierten Fusionsprotein können nun z.B. Interaktionsanalysen oder Screening mit weiteren Bindungspartnern problemlos durchgeführt werden.
Die Herstellung der in dieser Erfindung enthaltenen Oberflächen, die mit den entsprechenden Nukleotidderivaten modifiziert werden können, ist technisch einfach lösbar. Die Nukleotidderivate (Beispiele siehe Figur 2D) enthalten vorzugsweise jeweils Linkersequenzen mit einer funktionellen Gruppe (z.B. -NH2), über die sie chemisch an die Oberflächen gekoppelt werden. Zur Reinigung der Fusionsproteine lassen sich verschiedene stationäre Phasen für Chromatographieanwendungen (auch die modernen „Monolith"-Phasen [9], Mikrofiltrationsmembranen [10] oder Affinitätsmikropartikel [11]) ebenso mit Nukleotidderivaten modifizieren wie Oberflächen für Protein-Biochips oder Biosensoren für die dauerhafte Immobilisierung der Fusionsproteiπe. Im Rahmen dieser Erfindung umfasst daher der Begriff Oberfläche jedwede feste Phase, vorzugsweise aus Glas, Metall, Keramik, Porzellan, auch poröser Natur wie Silicagel, Sepharose, Agarose und andere Affinitätsmatrices vorzugsweise zur Chromatographie geeigneten Materialen und zwar vorzugsweise zur Affinitätschromatographie. Des weiteren sind in einer funktionellen Auslegung Oberflächen von Biosensoren, ELISA, Protein-Biochips, Mikrotiterplatten (insbesondere Wellplatten mit 96, 384, 1536 und mehr Zellen) und Mikroarrays mit umfasst. Solche erfindungsgemäßen Oberflächen können ebenfalls geeignet behandelt sein, beispielsweise mit Silica, Polyacrylamid u.v.a.
Insbesondere betrifft die Erfindung ebenfalls einen Assay enthaltend ein oder mehrere erfindungsgemäße Fusionsproteine, insbesondere einen Assay für die biomolekulare Interaktionsanalyse, also zur standardisierten Vermessung der Bindungskinetiken der erfindungsgemäßen Fusionsproteine, vorzugsweise z.B. mittels Surface Plasmon Resonance- Technologie auf BiacoreΘ-Geräten, für Protein-Protein, Protein- Antikörper, Protein-Kofaktor, Protein-DNA, Protein-RNA, Protein-Target, Protein-Drug, etc. -Wechselwirkungen sowie Protein-Membran, Protein- Zeil Interaktionen wobei die erfindungsgemäßen Fusionsproteine auf einer Oberfläche geeignet immobilisiert sind [1 ,12].
Des weiteren betrifft die Erfindung daher einen Protein-Biochip oder Mikroarray enthaltend ein oder mehrere erfindungsgemäße Fusionsproteine, wobei die erfindungsgemäßen Fusionsproteine auf einer Oberfläche geeignet immobilisiert sind.
Im Rahmen dieser Erfindung wird unter Assay, Array (auch Testsystem) oder Protein-Biochip (z.B. WO 00/04382 oder WO 99/33289) jedwede Anordnung von Biomolekülen, niedermolekularen Verbindungen und ein oder mehrere erfindungsgemäße Fusionsproteine auf einer Oberfläche verstanden, die einer auswertenden Analyse, vorzugsweise mit Methoden der Massenspektrometrie, Fluorimetrie und/oder Antikörperscreening, zugänglich sind und eine Identifikation und Charakterisierung interessierender Stoffe erlauben [13]. Insofern sind ebenfalls Screening- Methoden und entsprechende Vorrichtungen erfindungsgemäß mit umfasst.
Zum Nachweis eines Screening-Erfolges können die bekannten Nachweismethoden mittels Antikörper und andere bekannte Verfahren (z.B. FRET aus WO 97/29373 und WO 98/15830) verwendet werden.
Daher betrifft die Erfindung ebenfalls ein Verfahren zur Herstellung eines Biosensors, Assay, ELISA, Arrays oder Protein-Biochip, wobei a.) mindestens ein erfindungsgemäßes Fusionsprotein auf einer Oberfläche enthaltend mindestens ein affinitätsbestimmendes Nukleotidderivat immobilisiert wird, b.) mit mindestens einer Zusammensetzung enthaltend mindestens eine Testverbindung (wie z.B. Serum, Substanzgemische und andere) und ggfs. weitere Hilfs- und Zusatzstoffe versetzt wird und c.) mit Hilfe eines geeigneten Nachweissystems delektiert wird.
Das erfindungsgemäße Verfahren gestattet die Suche nach einer oder mehreren, gleichen oder verschiedenen Testverbindungen.
In einer besonderen Ausführungsform enthält das erfiπdungsgemäße Fusionsprotein als nukleotidbindende Domäne die regulatorischen Untereinheiten der cAMP-abhängigen Proteinkinase [14, 15]. Insbesondere die Domänen A und B der regulatorischen Untereinheiten mit ihrer cAMP-bindenden Eigenschaft sind besonders bevorzugt. So konnte beispielsweise für die isolierte B-Domäne der regulatorischen Untereinheit der cAMP-abhängigen Proteinkinase bRlαΔ1-251 (zur Herstellung des exprimierten Proteins bRlαΔ1-251 siehe Beispiel 1 , Konstrukt ohne Fusionsanteil als Referenz) mit der Oberflächenplasmon- Resonanz Sensor-Technologie [1] eine vom Nukleotidderivat abhängige Bindungskinetik beobachtet werden (siehe Figur 2A). Mit dem cAMP- Analogon 6-AHA-8-PIP-cPuMP (N6-(6-Aminohexylamino)-8- Piperidinpurinribose-3',5'-cyciomonophosphat, diese und alle folgenden Strukturen siehe Figur 2D) erhält man eine für die Aufreinigung von Fusionsproteinen optimale transiente Bindung (schnelle Assoziation und schnelle Dissoziation, die bei Zusatz von unmodifiziertem cAMP vollständig ist), während für die stabile Kopplung des Proteins eine Oberfläche mit 8-AHDAA-cAMP (8-(17-Amino-9-Aza-Heptadecyl)- Adenosin-3',5'-cyclomonophosphat) besonders bevorzugt ist (schnelle Assoziation mit einer sehr langsamen Dissoziation).
Variationen des Nukleotidderivates beeinflussen direkt die Bindungseigenschaften der Domänen A und B. Spezifische Nukleotidderivate für die A-Domäne (SEQ ID 1 ) sind für eine transiente Kinetik z.B 8-AHA- cAMP (8-(6-Aminohexylamino)adenosin-3',5'-cyclomonophosphat) oder 6-AEA-8-PIP-cPuMP (N6-(2-Aminoethylamino)-8-Piperidinpurinribose- 3',5'-cyclomonophosphat) und für eine stabile Kinetik z.B. 6-AHA-8-PIP- cPuMP (N6-(6-Aminohexylamino)-8-Piperidinpurinribose-3',5'-cyclomono- phosphat).
Für die B-Domäne (SEQ ID 2) stellen die Nukleotidderivate 6-AHDAA-8- PlP-cPuMP (N6-(17-Amino-9-Aza-Heptadecyl)-8-Piperidinpurinribose- 3',5'-cyclomonophosphat) oder 6-AEA-8-pCPT-cPuMP (N6-(2-Amino- ethylamino)-8-(4-Chlorophenylthio)purinribose-3',5'-cyclomonophosphat) eine Alternative für eine transiente Kinetik dar, während z.B. 6-AHDAA-8- pCPT-cPuMP (N6-(17-Amino-9-Aza-Heρtadecyl)-8-(4-Chlorophenylthio)- purinribose-3',5'-cyclomonophosphat) oder 6-AHA-8-pCPT-cPuMP (N6- (6-Aminohexylamino)-8-(4-Chlorophenylthio)purinribose-3',5'-cyclomono- phosphat) für die stabile Immobilisierung, beispielsweise auf Chipoberflächen, dienen können.
Aufgrund dieser Eigenschaften lässt sich vorzugsweise mit der Nukleinsäuresequenz der nύkleotidbindenden Domänen A (SEQ ID 1) und B (SEQ ID 2) ein entsprechendes erfindungsgemäßes Fusionsprotein herstellen und in einen geeigneten Expressionsvektor einklonieren (siehe Beispiel 1 ). Weitere Modifikationen (z.B. Mutationen) können zur Bindungsoptimierung eingeführt werden.
Bevorzugt besitzt das erfindungsgemäße Fusionsprotein die Aminosäuresequenz der nukleotidbindenden Domäne gemäß SEQ ID 1 oder SEQ ID 2.
Das erfindungsgemäße Fusionsprotein, insbesondere die nukleotidbindende Domäne, kann jedoch auch eine oder mehrere Aminosäuredeletionen, Aminosäureaustausche oder Aminosäureadditionen oder -Insertionen aufweisen, zwecks Optimierung der Kopplung an die Nukleotidderivate, solange die Funktion des erfindungsgemäßen Fusionsprσteins dadurch nicht wesentlich beeinträchtigt wird. Insofern sollen ebenfalls solche funktioneile Varianten mit erfasst sein. Beispielsweise kann das erfindungsgemäße Fusionsprotein ebenfalls fremde Proteinsequenzen enthalten (z.B. als erweitertes Fusionsprotein).
Ein weiterer Gegenstand sind die für diese erfindungsgemäßen Fusionsproteine nukleotidbindenden Domänen, deren codierende Nukleinsäuren, vorzugsweise DNA-Sequenzen, zu diesen Sequenzen komplementäre Sequenzen, sowie Fragmente davon umfassend funktioneile Varianten (nachstehend erfindungsgemäße Nukleinsäuren oder DNA-Sequenzen), wie beispielsweise SEQ ID 1 codierend für ein Protein gemäß SEQ ID 1 mit der Funktion einer nukleotidbindenden Domäne und zwar vorzugsweise der Domäne A der regulatorischen Untereinheit der cAMP-abhängigen Proteinkinase aus dem Rind bRIαΔI- 134, Δ245-379, oder SEQ ID 2 mit der Funktion einer nukleotidbindenden Domäne und zwar vorzugsweise der Domäne B der regulatorischen Untereinheit der cAMP-abhängigen Proteinkinase aus dem Rind bRIαΔI- 251 [15].
Daher sind auch solche DNA-Sequenzen erfindungsgemäß berücksichtigt, die mit den zu SEQ ID 1 oder SEQ ID 2 komplementären Sequenzen hybridisieren und befähigt sind, vorzugsweise ein erfindungsgemäßes Fusionsprotein zu codieren; sowie DNA-Sequenzen, die in ihrem genetischen Code bezüglich der genannten Sequenzen degeneriert sind.
Diese erfindungsgemäßen DNA-Sequenzen können mit anderen DNA- Sequenzen, insbesondere Hilfssequenzen, die die Expression des Proteins in einem gewünschten Wirtsorganismus ermöglichen, verknüpft werden. Solche Sequenzen sind im Stand der Technik bekannt. Es handelt sich hierbei beispielsweise um regulatorische Sequenzen wie Promotorsequenzen, Shine-Dalgamo-Sequenzen, Transkriptions- terminationssignale, Polyadenylierungssignale oder Enhancer-Elemente. Auf diese Weise läßt sich das erfindungsgemäße Fusionsprotein kostengünstig in großen Mengen gewinnen (z.B. mit CHO-Zellen oder ähnliches). Diese erfindungsgemäßen DNA-Sequenzen können mit anderen DNA- Sequenzen, insbesondere Hilfssequenzen, die die Ligation mit anderen gewünschten Nukleinsäuresequenzen erlauben, verknüpft werden. Solche Sequenzen sind im Stand der Technik bekannt. Es handelt sich hierbei um Polylinker oder Spacer (siehe Beispiel 1 ). Ferner können zum Nachweis eines Screening-Erfolges epitopische Hilfssequenzen insertiert werden.
Im Rahmen dieser Erfindung wird unter Nukleinsäuren vorzugsweise DNA - Sequenzen verstanden, andere Nukleinsäureanaloga sind jedoch nicht ausgeschlossen.
Gegenstand der Erfindung sind daher ebenfalls rekombinante Nukleinsäuren, die die erfindungsgemäßen DNA-Sequenzen enthalten.
Die rekombinanten Nukleinsäuren können entweder direkt in den gewünschten Wirtsorganismus eingeschleust werden oder zuerst in Vektoren eingebaut werden, mit denen die Wirtsorganismen anschließend in an sich bekannter Weise transformiert werden. Solche Vektoren sind ebenfalls Gegenstand der Erfindung. Als Vektoren können die im Stand der Technik üblichen Vektoren, beispielsweise Plasmide, Bakteriophagen oder Viren, verwendet werden. Bevorzugte Vektoren sind Expressionsvektoren.
In einer weiteren Ausführungsform ist die erfindungsgemäße Nukleinsäure daher in einem Vektor, vorzugsweise in einem Expressionsvektor enthalten (siehe Beispiel 1 ). Ebenfalls Gegenstand der Erfindung sind Wirtsorganismen, die die erfindungsgemäßen rekombinanten DNA-Moleküle oder Vektoren enthalten.
Geeignete Wirtsorganismen sind beispielsweise prokaryontische oder eukaryontische Mikroorganismen, beispielsweise Bakterien wie Escherichia Coli oder Hefezellen, Baculovirus/Sf9-Zellen, aber auch humane Zellinien, die vorzugsweise zur Überexpression jedes gewünschten erfindungsgemäßen Fusionsproteins eingesetzt werden. Bei Bedarf können weitere Fusionsanteile für eine Ausschleusung zur verbesserten Löslichkeit oder Lokalisation des rekombinanten erfindungsgemäßen Fusionsproteins ins Periplasma [16] oder sogar ins Medium sorgen [17,18].
Die erfindungsgemäßen DNA-Sequenzen oder Fragmente davon können dazu verwendet werden, homologe DNA-Sequenzen in verschiedenen Organismen aufzufinden, die eine ähnliche oder gleiche Funktion wie das erfindungsgemäße Fusionsprotein, enthaltend insbesondere eine nukleotidbindende Domäne, besitzen (sogenannte Sonde).
Des weiteren können durch die erfindungsgemäßen DNA-Sequenzen oder Fragmente davon Peptidbibliotheken hergestellt werden, wobei beispielsweise aus einer Gesamtheit von Nukleinsäuren, vorzugsweise cDNA-Banken oder andere genomische Banken, diese in solche erfindungsgemäße Expressionsvektoren einkloniert werden und in ihrer Gesamtheit oder Teile davon exprimiert werden können (sogenannte Expression Libraries; siehe auch Cahill et al. WO 99/57311 und WO 99/57312). Das erfindungsgemäße Fusionsprotein und die für dieses Protein codierenden DNA-Sequenzen lassen sich ferner vorteilhaft als Diagnostika verwenden.
Die nachfolgenden Beispiele, Figuren, wichtigsten Sequenzen dienen zur näheren Erläuterung der Erfindung, ohne sie auf diese Beispiele und Figuren einzuschränken.
Beschreibung der Figuren und Beispiele: Fig.1 : Funktionsweise des „Nucleotag-Expressionssystems" Fig.2: Biomolekulare Interaktionsanalyse; Biacore®-Bindungskinetiken der B-Domäne der regulatorischen Untereinheit der cAMP- abhängigen Proteinkinase bRlαΔ1-251 (Fig.2A) und des Fusionsproteins bRlαΔ1 -251 mit PKI (Fig.2B) an zwei verschiedene cAMP-Derivate
Die Funktionalität der PKI im Fusionsprotein wurde durch eine Injektion von Cα überprüft (Fig.2C)
Die Strukturformeln der cAMP-Derivate ergeben sich aus einer Kombination des cAMP-Grundgerüstes mit jeweils 2 verschiedenen Resten A bis E bzw. R=-NH2 an die Positionen R1 und R2 (Fig.2D)
6AHA-8PIP-cPuMP: N6-(6-Aminohexylamino)-8- Piperidinpurinribose-3',5'-cyclomonophosphat; R1 =B, R2=D 8AHDAA-CAMP: 8-(17-Amino-9-Aza-Heptadecyl)-Adenosin-3',5'- cyclomonophosphat; R1 —NH2, R2=C 8-AHA-cAMP: 8-(6-Aminohexylamino)adenosin-3',5'- cyclomonophosphat; R1 =-NH2, R2=B 6-AEA-8-PIP-cPuMP: N6-(2-Aminoethylamino)-8- Piperidinpurinribose-3',5'-cyclomonophosphat; R1 =A, R2=D 6-AHA-8-PIP-cPuMP: N6-(6-Aminohexylamino)-8- Piperidinpuπnribose-3',5'-cyclomonophosphat; R1=B, R2=D 6-AHDAA-8-PIP-cPuMP: N6-(17-Amino-9-Aza-Heptadecyl)-8- Piperidinpurinribose-3',5'-cyclomonophosphat; R1=C, R2=D 6-AEA-8-pCPT-cPuMP: N6-(2-Aminoethylamino)-8-(4-Chloro- phenylthio)purinribose-3',5'-cyclomonophosphat, R1=A, R2=E 6-AHDAA-8-pCPT-cPuMP: N6-(17-Amino-9-Aza-Heptadecyl)-8- (4-Chlorophenylthio)purinribose-3',5'-cyclomonophosphat; R1 =C, R2=E
6-AHA-8-pCPT-cPuMP (N6-(6-Aminohexylamino)-8-(4-Chloro- phenylthio)purinribose-3',5'-cyclomonophosphat; R1 =B, R2=E Fig.3: Proteingel der Affinitätschromatographie des Fusionsproteins bRlαΔ1-251/PKl mit 6-AHA-8-PIP-cPuMP-Agarose 600 μl Bakterienlysat des Fusionsproteins wurden auf 200 μl gepackte Säulenmatrix aus 6-AHA-8-PIP-cPuMP-Agarose gegeben. Je 200 μl Volumen wurden aufgefangen und ein entsprechendes Aliquot auf dem Proteingel analysiert. Die spezifische Elution des Fusionsproteins findet vollständig bereits bei 200 μM cAMP im Elutionspuffer statt (mit 1 mM cAMP eluiert kein weiteres Fusionsprotein, auf der Agarosematrix bleibt nur ein unspezifisches 38 kD Protein gebunden, welches sich mit 3 M Guanidiniumhydrochlorid herunterwaschen lässt): Probe 1 Proteinlysat Auftrag auf Agarose
Proben 2-4 Durchfluß Proteinlysat
Proben 5-6 Wasch mit Laufpuffer
Proben 7-9 Wasch mit 1 M NaCI
Proben 10-12 Wasch mit Laufpuffer Proben 13-15 Elution mit 200 μM cAMP Proben 16-17 Wasch mit Laufpuffer Proben 18-20 Elution mit 1 mM cAMP Probe 21 Aliquot der Agarosematrix nach der
Affinitätschromatographie Probe 22 Aliquot der Agarosematrix nach Regeneration mit 3 M Guanidiniumhydrochlorid
SEQ ID 1: Nukleotidbindende Domäne A der regulatorischen Untereinheit der cAMP-abhängigen Proteinkinase aus dem Rind bRlαΔ1-134, Δ245-379 in DNA- Sequenz (333 Nukleotide) und Aminosäuresequenz (111 Aminosäuren)
atg ctg ttt tca cat ctt gat gat aac gag aga agt gac att ttt M L F S H L D D N E R S D I F
gac gcc atg ttc ccg gtt tcc ttt att gct gga gag act gtt att D A M F P V S F I A G E T V I
cag cag ggt gac gaa ggg gat aac ttc tac gtg att gac caa gga Q Q G D E G D N F Y V I D Q G
gag atg gac gtc tat gtc aac aat gaa tgg gca acc agt gtt ggg E M D V Y V N N E W A T S V G
gaa gga ggg agc ttc ggg gag ctt gct ctg att tac ggg act cct E G G S F G E L A L I Y G T P
cga gcg gcc act gtc aag gcc aag acg aac gtg aaa ctg tgg ggc R A A T V K A K T N V K G
att gac egg gac agc tac aga agg atc ctc atg gga agc acg ctg I D R D S Y R R I L M G S T L aga aag egg aag atg tat R K R K M Y
SEQ ID 2: Nukleotidbindende Domäne B der regulatorischen Untereinheit der cAMP-abhängigen Proteinkinase aus dem Rind bRlαΔ1-251 in DNA-Sequenz (387 Nukleotide) und Aminosäuresequenz (129 Aminosäuren)
atg tct att tta gaa tct ctg gac aag tgg gag cgt ctc acg gta M S I L E S L D K E R T V
gct gat gca ttg gaa cca gtc cag ttt gaa gac ggg cag aag att A D A L E P V Q F E D G K I
gtg gta cag ggg gag ccg ggt gat gag ttc ttc att att tta gag V V Q G E P G D E F F I I L E
ggc tca gcc geg gtg ctg cag egg cgc tca gag aac gaa gag ttt G S A A V L Q R R S E N E E F
gtg gaa gtg gga agg ttg ggg cet tca gac tac ttc ggc gag atc V E V G R L G P S D Y F G E I
gct ctg ctg atg aac egg cec cgt gca gcc acc gtg gtg gcc cgt A L L M N R P R A A T V V A R
ggc ccg ctg aag tgc gtc aag ctg gac egg ccg egg ttc gag cgc G P L K C V K L D R P R F E R
gtt ctc ggc ccg tgc tec gac atc ctc aag cgc aac atc cag cag V L G P C S D I L K R N I Q Q tac aac agc ttc gtg tcc ctg tct gtc Y N S F V S L S V
Allgemeine gentechnische Maßnahmen (Hybridisierungen etc.) können Sambrook et al., Molecular Cloning, A Laboratory Manual, 2. Aufl., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) entnommen werden.
Beispiel 1 :
Klonierung des Expressionsvektors für ein Fusionsprotein aus bRIαΔI -
251 (nukleotidbindende Domäne B) und PKI
In den mit Xmnl restringierten Vektor pLEX 5BA [19] wird ein blunt-end PCR-Fragment der kompletten B-Domäne der regulatorischen Untereinheit I der cAMP-abhängigen Proteinkinase PKA aus dem Rind (bRIαΔI -251 , SEQ ID 2) kloniert [15]. Direkt hinter diese Sequenz werden per synthetischen Doppelstrang-Oligonukleotiden hergestellte kurze Primer eingefügt, die mit den neu eingeführten singulären Restriktionsschnittstellen die weitere Klonierung beliebiger Fusionsproteine in allen drei möglichen Leserahmen ermöglichen.
Durch diese Prozedur wurde der Polylinker des pLEX 5BA-Vektors komplett durch folgende Sequenz (SEQ ID 3) ersetzt:
GAA27Aatgtctattttagaatctctggacaagtgggagcgtctcacggtag c gatgcattggaaccagtccagtttgaagacgggcagaagattgtggtac agggggagccgggtgatgagttcttcattattttagagggctcagccgcgg tgctgcagcggcgctcagagaacgaagagtttgtggaagtgggaaggttgg ggccttcagactacttcggcgagatcgctctgctgatgaaccggccccgtg cagccaccgtggtggcccgtggcccgctgaagtgcgtcaagctggaccggc cgcggttcgagcgcgttctcggcccgtgctccgacatcctcaagcgcaaca tccagcagtacaacagcttcgtgtccctgtctgtcGCr27Ca*gaattcccg ggtaccatggccggcatatgcagatctcaAGCrr
Fette kursive Großbuchstaben: alter Polylinker des pLEX-Vektors Normale Großbuchstaben: SEQ ID 2, bRIαΔI -251 (B-Domäne) Normale Kleinbuchstaben: neuer Poiylinker per Oligo mit den verschachtelten, singulären Schnittstellen für die Restriktionsenzyme EcoRI, Aval, Smal, Xmal, Kpnl, Ncol, Styl, Nael, Ndel, Bglll, Hindlll * hier können per PCR-Mutagenese weitere Nukleotide für die Leserahmenverschiebung eingefügt werden
In dieses Vektorkonstrukt wurde über Ndel und Hindlll das Gen für den Proteinkinaseinhibitor PKI als Testfusionsprotein einkloniert.
Beispiel 2:
Expression des Fusionsproteins und dessen Einschritt-Aufreinigung per
Affinitätschromatographie Die mit dem Fusionsvektor aus Beispiel 1 transformierten E.coli Bakterien in 2x YT Medium werden bei 37°C bei einer OD560 von 0.6 mit 1 mM IPTG induziert und für weitere 3 Stunden im Warmluftschüttler belassen. Nach der Ernte wird das Bakteriensediment im 4fachen Volumen Lysepuffer (20 mM Phosphatpuffer pH 6.8, 100 mM NaCI, 2 mM EDTA, 2 mM EGTA, 5 mM ß-Mercaptoethanol, 2 mM Benzamidin, 0.5 μg/ml Leupeptin, 10 μg/ml TLCK, 10 μg/ml TPCK) mit einer french-press aufgeschlossen.
Dieses Rohlysat wird auf eine mit Affinitätspuffer (20 mM Phosphatpuffer pH 6.8, 100 mM NaCI, 2 mM EDTA, 2 mM EGTA, 5 mM ß- Mercaptoethanol) äquilibrierte Säule mit 6-AHA-8-PIP-cPuMP-Agarose (Struktur siehe Figur 2D) aufgetragen. Nach dem Waschen mit 1 M NaCI in Affinitätspuffer eluiert man das hochreine Fusionsprotein mit 200 μM cAMP.
Die 6-AHA-8-PIP-cPuMP-Agarose kann mit 3 M Guanidiniumhydrochlorid regeneriert werden. Eine zweite Affinitätschromatographie mit frischem Bakterienlysat zeigt nur eine geringfügige Abnahme der Kapazität des Säulenmaterials bei ansonsten unverändertem Bindungs- und Elutionsverhalten.
Die erfolgreiche Reinigung des Fusionsproteins dokumentiert Figur 3.
Beispiel 3:
Bindungsstudien mit dem auf Sensorchips immobilisierten Fusionsprotein
Auf einem Biacore® CM5-Chip werden die cAMP-Nukleotidanaloga 8- AHDAA-cAMP und 6-AHA-8PIP-cPuMP (Strukturen siehe Abbildung 2D) in 2 mM Lösung (20 % DMSO in 100 mM Borsäure pH 9.0) nach dem Standardprotokoll der Amidkopplung (siehe Biacore® Amine Coupling Kit) immobilisiert.
Um das kompetierende cAMP aus der Proteinfraktion zu entfernen, tauscht man das Eluat der Affinitätschromatographie mit einer Fast- Desalting-FPLC-Säule (Pharmacia) gegen Laufpuffer (20 mM MOPS, pH 7.0, 150 mM NaCI, 0.002 % Tween 20) aus.
Bindungsexperimente des Fusionsproteins zeigen ein nahezu identisches Verhalten und vergleichbare Assoziations- und Dissoziationsgeschwindigkeiten mit denen der reinen B-Domäne von Rlα, das Fusionsprotein ändert nur geringfügig die Eigenschaften der nukleotidbindenden Domäne (siehe Figur 2A und 2B).
Im Gegenzug beeinflusst die Bindungsdomäne das Fusionsprotein in seiner Funktion nicht: eine Injektion des natürlichen Zielproteins des Inhibitors, der katalytischen Untereinheit der Proteinkinase Cα, zeigt eine Bindung der C-Untereinheit an den über den Nuleotag an der Sensoroberfläche immobilisierten Kinaseinhibitor PKI (siehe Figur 2C).
Eine vollständige Regeneration der Sensoroberflächen nach jeder Messung ist durch eine kurze Injektion mit 3 M Guanidiniumhydrochlorid möglich. Eine 1 mM cAMP- oder eine 0.1 %ige SDS-Lösung sind zur Regeneration ebenfalls geeignet.
Literatur
Szabo A., Stolz L. und Granzow R. (1995) : Surface Plasmon Resonance and its use in Biomolecular Interaction Analysis (BIA). Curr Opin Struct Biol. 5,699-705 Flaschel E. und Friehs K. (1993) : Improvement of Downstream Processing of Recombinant Proteins by Means of Genetic Engineering Methods. Biotech. Adv. 11,31-78
Nilsson J., Stuhl S., Lundeberg J., Uhlen M:, und Nygren P.-A. (1997) : Affinity Fusion Strategies for Detection. Purification and Immobilization of Recombinant Proteins. Protein Expression Purif. 11,1-16
Poppenborg L., Friehs K. und Flascher E. (1997) : The green fluorescent protein is a versatile reporter for bioprocess monitoring, J. Biotech. 58,79- 88
Flaschel E., Poppenborg L., Neitzel R., Miksch G. und Friehs K. (1998) : Affinitätstrennverfahren zur Gewinnung rekombinanter Proteine. BioTec 9(5/6),26-29.
Schatz P J. (1993) : Use of Peptide Libraries to Map the Substrate Specificity of a Peptide-Modifying Enzyme; A 13 Residue Consensus Peptide Specifies Biotinylation in Escherichia coli. Bio/Technology 11,1138-43
Neri D., de Lalla O, Petrul H., Neri P. und Winter G. (1995) : Calmodulin as a Versatile Tag for Antibody Fragments. Bio/Technology 13,373-7
Fischer E.F. (1994) : Renaturation of Recombinant Proteins Produced as Inclusion Bodies. Biotech. AαV.72,89-101
Ming F. und Howell J.A. (1994) : Operational properties of an inverted matrix cellulose CM ion-exchanger. Bio. sep. 4,63-70 Serafica G.C., Pimbley J. und Beifort G. (1994) : Protein Fractionation Using Fast Flow Immobiiized Metal Chelate Affinity Membranes. Biotechnol. Bioeng. 43,21-36 .
Matoba S., Tsuneda S., Saito K. und Sugo T. (1995) : Highly Efficient Enzyme Recovery Using a Porous Membrane with Immobiiized Tentacle PolymerChains. BiolTechnology 13,795-7
Raghaven M und Bjorkman P. J. (1995) : BIAcore: a microchip-based syste for analysing the formation of macromolar complexes. Structure 3,331-333
Weinberger S. R., Morris T. S. und Pawlak M. (2000) :Recent trents in protein biochip technology. Pharmacogenetics λ, 395-416
Su Y. , Dostmann W.R., Herberg F.W., Durick K., Xuong N.H., Ten Eyck L., Taylor S.S. und Varughese K.I. (1995) : Regulatory subunit of protein kinase A: structure of deletion mutant with cAMP binding domains. SCIENCE 269, 807-813
Lee D. C, Carmichael D. F., Krebs E. G. und McKnight G. S.. (1983) :
Isolation of a cDNA clone for the Type I Regulatory Subunit of Bovine cAMP-Dependent Protein Kinase. Proc Natl. Acad. Sei USA 17,114-119
Wickner, W . T. (1994) : How ATP Drives Proteins Across Membranes. SCIENCE 266, 1197-8
Pugsley A.P. (1993) : The Complete General Secretory Pathway in Gram-Negative Bacteria. Microbiol. Rev. 57, 50-108 Perez-Perez J., Marquez G.. Barbero J..L. und Gutjerrez J. (1994) : Increasing the Efficiency of Protein Export in Escherichia coli. Bio/Technology 12, 178-80
Brunner M. und Bujard H. (1987) : Promotor Recognition and Promotor Strength in the Escherichia Coli System. EMBO Journal 6,3139-3144

Claims

Patentansprüche
1. Fusionsprotein enthaltend mindestens eine nukleotidbindende Domäne SEQ ID No. 1 oder SEQ ID No. 2, Teile oder eine funktioneile Variante davon.
2. Nukleinsäuren codierend für ein Fusionsprotein nach Anspruch 1 enthaltend mindestens eine Nukleinsäure codierend für eine nukleotidbindende Domäne SEQ ID No. 1 oder SEQ ID No. 2, Teile oder einer funktioneilen Variante davon und ggfs. weiteren Hilfssequenzen, insbesondere Polylinker, Spacer, und Epitop-Sequenzen.
3. Fusionsprotein enthaltend mindestens eine nukleotidbindende Domäne, dadurch gekennzeichnet, dass dieses auf einer Oberfläche enthaltend mindestens ein affinitätsbestimmendes Nukleotidderivat immobilisiert ist.
4. Fusionsprotein nach Anspruch 3, wobei das Nukleotidderivat an dessen Nukleobase mindestens einen Linker zur Kopplung auf Oberflächen und ggfs. weitere Substituenten zur Affinitätsmodifizierung enthält.
5. Fusionsprotein nach Anspruch 3 oder 4, wobei die Oberfläche eine feste Phase aus Glas, Metall, Keramik, Porzellan, Silicagel, Sepharose, Agarose und andere Affinitätsmatrices ist.
6. Nukleinsäuren codierend für ein Fusionsprotein nach einem der Ansprüche 3 bis 5 enthaltend mindestens eine Nukleinsäure codierend für eine nukleotidbindende Domäne oder eine funktioneile Variante davon und ggfs. weitere Hilfssequenzen, insbesondere Polylinker, Spacer, und Epitop-Sequenzen.
7. Expressionsvektor enthaltend mindestens eine Nukleinsäure nach Anspruch 2 oder 6.
8. Wirtsorganismus enthaltend mindestens einen Expressionsvektor nach Anspruch 7 oder mindestens eine Nukleinsäure nach Anspruch 2 oder 6.
9. Fusionsprotein erhalten aus einem Wirtsorganismus nach Anspruch 8.
10. Peptidbibliothek erhalten aus mindestens einem Expressionsvektor nach Anspruch 7.
11. Peptidbibliothek nach Anspruch 10, wobei diese aus einer oder mehreren cDNA Banken und / oder genomische Banken generiert wird.
12. Biosensor, Assay, ELISA, Array oder Protein-Biochip enthaltend mindestens ein Fusionsprotein nach einem der Ansprüche 1 bis 5.
13. Verfahren zur Herstellung eines Biosensors, Assay, ELISA, Arrays oder Protein-Biochip nach Anspruch 12, wobei
(a) mindestens ein Fusionsprotein nach einem der vorhergehenden Ansprüche auf einer Oberfläche enthaltend mindestens ein affinitätsbestimmendes Nukleotidderivat immobilisiert wird,
(b) mit mindestens einer Zusammensetzung enthaltend mindestens eine Testverbindung und ggfs. weitere Hilfs- und Zusatzstoffe versetzt wird und
(c) mit Hilfe eines geeigneten Nachweissystems detektiert wird.
14. Affinitätsmatrix enthaltend mindestens ein Nukleotidderivat nach Anspruch 4.
15. Verfahren zur Herstellung von Fusionsproteinen nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass ein solches Fusionsprotein über eine Oberfläche enthaltend mindestens ein Nukleotidderivat aufgereinigt wird und ggfs. durch Zugabe eines geeigneten Nukleotidderivates im Überschuss eluiert wird.
16. Verfahren zur Variation der Bindungsaffinität an einer Oberfläche enthaltend mindestens ein Nukleotidderivat, wobei ein Fusionsprotein nach einem der Ansprüche 1 bis 5 zu einer gewünschten Bindungsaffinität mit einem Nukleotidderivat nach Anspruch 4 ausgewählt wird.
17. Verwendung eines Assay nach Anspruch 12 und 13 zur Durchführung von Interaktionsanalysen für Protein-Protein, Protein-Antikörper, Protein- Kofaktor, Protein-DNA, Protein-RNA, Protein-Target, Protein-Drug - Wechselwirkungen sowie Protein-Lipid, Protein-Membran, Protein-Zeil Interaktionen.
18. Verwendung eines Fusionsproteins nach Anspruch 1 bis 5 zur Durchführung einer Affinitätchromatographie auf einer Affinitätsmatrix nach Anspruch 14.
19. Verwendung eines Fusionsproteins nach Ansprüchen 1 bis 5 oder einer Peptidbibliothek nach einem der Ansprüche 10 oder 11 oder einem Biosensor, Assay, ELISA, Array oder Protein-Biochip nach Anspruch 12 zur auswertbaren Analyse oder Identifikation, insbesondere mit Methoden der Massenspektrometrie, Fluorimetrie und / oder Antikörperscreening.
PCT/EP2002/007191 2001-06-29 2002-06-29 Fusionsproteine, verfahren zu deren herstellung und deren verwendung WO2003002611A2 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP02751093A EP1409552A2 (de) 2001-06-29 2002-06-29 Fusionsproteine, verfahren zu deren herstellung und deren verwendung

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10131181.8 2001-06-29
DE2001131181 DE10131181A1 (de) 2001-06-29 2001-06-29 Verfahren zur Herstellung nukleotidbindender Fusionsproteine, deren Aufreinigung und Kopplung an Oberflächen

Publications (2)

Publication Number Publication Date
WO2003002611A2 true WO2003002611A2 (de) 2003-01-09
WO2003002611A3 WO2003002611A3 (de) 2003-11-06

Family

ID=7689764

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/007191 WO2003002611A2 (de) 2001-06-29 2002-06-29 Fusionsproteine, verfahren zu deren herstellung und deren verwendung

Country Status (3)

Country Link
EP (1) EP1409552A2 (de)
DE (1) DE10131181A1 (de)
WO (1) WO2003002611A2 (de)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3951744A (en) * 1973-07-23 1976-04-20 Boehringer Mannheim G.M.B.H. Purification of dehydrogenases
WO1993000444A1 (en) * 1991-06-28 1993-01-07 City Of Hope Biotinylated photoaffinity nucleotide analogues - synthesis and application
WO1993003157A1 (en) * 1991-07-29 1993-02-18 Dana Farber Cancer Institute Plasmids for the rapid preparation of modified proteins

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3951744A (en) * 1973-07-23 1976-04-20 Boehringer Mannheim G.M.B.H. Purification of dehydrogenases
WO1993000444A1 (en) * 1991-06-28 1993-01-07 City Of Hope Biotinylated photoaffinity nucleotide analogues - synthesis and application
WO1993003157A1 (en) * 1991-07-29 1993-02-18 Dana Farber Cancer Institute Plasmids for the rapid preparation of modified proteins

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BAUBICHON-CORTAY, H. ET AL.: "Overexpression and purification of the carboxyl-terminal nucleotide-binding domain from mouse P-glycoprotein" THE JOURNAL OF BIOLOGICAL CHEMISTRY, Bd. 269, Nr. 37, 1994, Seiten 22983-22989, XP002242034 *
DATABASE SWALL [Online] 21. Juli 1986 (1986-07-21) "cAMP-dependent protein kinase type I-alpha regulatory chain; bos taurus" retrieved from EBI Database accession no. P00514 XP002242036 *
HERBERG, F.W. AND ZIMMERMANN, B. : "Protein Phosphorylation (2nd Edition): Analysis of protein kinase interactions using biomolecular interaction analysis" 1999 , OXFORD UNIVERSITY PRESS , OXFORD, UK XP001147937 pages 335-371; especially section 3 Abbildungen 6,8,9 Seite 349, Zeile 2 Seite 361, Zeile 7,8 Seite 362, Absatz 1 *
JOHANSON, R. ET AL.: "Purification of cyclic AMP- and cyclic GMP-dependent protein kinases from rat skeletal muscle" JOURNAL OF CYCLIC NUCLEOTIDE AND PROTEIN PHOSPHORYLATION RESEARCH, Bd. 11, Nr. 6, 1987, Seiten 411-420, XP009010753 *
SCOTT, S.-P. ET AL.: "A functioning chimera of the cyclic nucleotide-binding domain from the bovine retinal rod ion channel and the DNA-binding domain from the catabolite gene-activating protein" BIOCHEMISTRY, Bd. 40, 2001, Seiten 7464-7473, XP002242035 *

Also Published As

Publication number Publication date
DE10131181A1 (de) 2003-01-30
WO2003002611A3 (de) 2003-11-06
EP1409552A2 (de) 2004-04-21

Similar Documents

Publication Publication Date Title
EP0282042B1 (de) Neue Fusionsproteine und deren Reinigung
Sellers et al. Changing Fos oncoprotein to a Jun-independent DNA-binding protein with GCN4 dimerization specificity by swapping" leucine zippers"
Tian et al. A splicing enhancer complex controls alternative splicing of doublesex pre-mRNA
EP0471701B2 (de) Neue proteine mit tnf-hemmender wirkung und ihre herstellung
US8524475B1 (en) Polypeptides having colanic acid-degrading activity
de la Brousse et al. Molecular and genetic characterization of GABP beta.
WO2000075308A1 (de) Muteine des bilin-bindungsproteins
Xue A CELD‐fusion method for rapid determination of the DNA‐binding sequence specificity of novel plant DNA‐binding proteins
JPH09508283A (ja) イソプロパノール含有水溶液を用いる核酸のトランスフェクション効率の増強
Jiang et al. Methods for proteomic analysis of transcription factors
KR20170026521A (ko) 단백질의 정제를 위한 방법 및 시약
Ivanov et al. Human ribosomal protein S26 suppresses the splicing of its pre-mRNA
US20140093888A1 (en) Highly pure plasmid dna preparations
Cerritelli et al. Purification and characterization of T7 head-tail connectors expressed from the cloned gene
Benfante et al. Sequence-directed curvature of repetitive AluI DNA in constitutive heterochromatin of Artemia franciscana
WO2003002611A2 (de) Fusionsproteine, verfahren zu deren herstellung und deren verwendung
DE202019005825U1 (de) Biologische Synthese von Aminosäureketten zur Herstellung von Peptiden und Proteinen
KR19990063834A (ko) 단형 케모킨 베타-8
JP4809242B2 (ja) 新規なｃｃ−ケモカイン結合タンパク質
Mignotte et al. Mitochondrial DNA-binding proteins that bind preferentially to supercoiled molecules containing the D-loop region of Xenopus laevis mtDNA
CN111065735B (zh) 用于纯化硫酸酯酶蛋白的方法
JP2552942B2 (ja) ヒトｂーＦＧＦ受容体遺伝子
EP1069136B1 (de) Verfahren zur rekombinanten Herstellung von Ribonukleoproteinen
DE4041464A1 (de) 5-ht(pfeil abwaerts)1(pfeil abwaerts)-rezeptor
CN115851748A (zh) β2-MG截短体的制备方法及应用

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2002751093

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 2002751093

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP