WO2002057449A1 - Nouveau gene tifa - Google Patents

Nouveau gene tifa Download PDF

Info

Publication number
WO2002057449A1
WO2002057449A1 PCT/JP2002/000262 JP0200262W WO02057449A1 WO 2002057449 A1 WO2002057449 A1 WO 2002057449A1 JP 0200262 W JP0200262 W JP 0200262W WO 02057449 A1 WO02057449 A1 WO 02057449A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
tifa
polynucleotide
compound
activity
Prior art date
Application number
PCT/JP2002/000262
Other languages
English (en)
Japanese (ja)
Inventor
Jun-Ichiro Inoue
Original Assignee
Mochida Pharmaceutical Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mochida Pharmaceutical Co., Ltd. filed Critical Mochida Pharmaceutical Co., Ltd.
Publication of WO2002057449A1 publication Critical patent/WO2002057449A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to a novel TRAF binding factor, in particular, to a TRAF Interacting protein with a Forkhead—Associated domain (hereinafter sometimes referred to as TIFA). More specifically, a peptide or polypeptide having all or a part of the amino acid sequence of TIFA, a polynucleotide encoding the peptide or polypeptide, a recombinant vector containing the polynucleotide, a recombinant vector containing the polynucleotide, A transformant transformed in step 1, a method for producing a peptide or polypeptide using the transformant, an antibody against the peptide or polypeptide, a method for identifying a compound using the same, a method for identifying the identified compound, Active P and harmful compounds or active and activating compounds acting on the polypeptide or the polynucleotide, a pharmaceutical composition related thereto and a method for producing the same, and a therapeutic method using the pharmaceutical composition
  • TNF tumor necrosi sf actor receptor suha.
  • the stimulatory response mediated by the family or ⁇ ⁇ / IL-1 (intel l euki n-1) receptor family plays an important role in biological reactions such as immunity, inflammation, apoptosis and allergic reactions. It has become clear. These reactions are triggered by the binding of each ligand to the receptor, and the signal is transmitted into the cell, which appears as a corresponding response.However, molecules involved in the signal transduction mechanism and signal transduction in the cell Has not been fully elucidated. Recently developed yeast two-hybrid cDNA screening The establishment of the method has made a great contribution to the study of signal transduction where the interaction between protein and protein is a point, but the TNF receptor superfamily and To ⁇ 1/1 L-
  • the present method has been used to identify one molecule of the TRAF (tumor necrosisfactorrrececeptor—as sociated factor) protein family involved in signal transduction from the 1 receptor family.
  • TRAF tumor necrosisfactorrrececeptor
  • Ding 1 ⁇ proteins include TRAF 1 and TRAF 2 previously identified from 1 "-1I, TRAF3 identified from CD40, TRAF4, CD40 identified as a breast cancer cell-specific expression gene and lymphotoxin /?
  • TRAF 5 which binds to the receptor
  • TRAF 6 which is thought to transmit CD40 and IL-1 RI signals.
  • the function is partially speculated as follows: The activation of NF- ⁇ B is induced by forced expression of TRAF 2, 5, and 6 molecules.
  • TRAF1 and TRAF3 suppresses the activation of NF- ⁇ B.
  • TRAF 2 is involved in signal transduction from type I and type I TNFRs, but its effect is to block the pathway from TNF to caspase, and suppress cell death.
  • TRAF 6 molecule is essential for osteoclast differentiation and gain of function, and K0 mice of this molecule show bone dysplasia.
  • NF- ⁇ activates the entire immune system widely, regulation of NF- ⁇ : ⁇ activation is physiologically important, and this regulatory system may be a target for drugs in the treatment of various diseases.
  • the proliferation signal from CD40 is constantly contained and is self-reactive.
  • NF- ⁇ through TRAF 2, 5, or 6 molecule is used. Activation may be involved.
  • septic shock, acute hepatitis, osteoporosis, etc. may be related to the TRAF 6 molecule.
  • NIK NF—; trB Ind ucing Kinase
  • I KK I- ⁇ Kinase
  • Phosphorylates I promotes I1 ⁇ 2B decomposition
  • This route is common for TRAFs 2, 5, and 6, and the analysis is relatively advanced.
  • the pathways from the TRAF2, 5, and 6 molecules to NIK are largely unknown, and have not yet been fully elucidated.
  • TRAF-mediated signal transduction Studies are underway to elucidate the mechanisms of TRAF-mediated signal transduction, but the presence of several proteins associated with TRAF molecules has recently been identified. For example, by screening using the yeast tw oh ybrid system using TRAF3 and TRAF2 as baits, TANK (TR AF—family member—associated NF1 ⁇ 2B acitivator) and I—TR AF (TRAF—interacti) ng protein) has been found. TANK and I-TRAF are the same substance and are associated with known TRAF molecules other than TRAF 4 via the TRAF_C domain. Also, TRIP (TRAF-interacting protein) has been screened by TRAF1-based yeast two-hybrid system.
  • TRIP-1 interacts with TRAF1 and TRAF2 in animal cells, it activates TNF- ⁇ or CD30-induced NF- ⁇ Functional findings have shown that it suppresses IL-11 but not IL-11 mediated activation.
  • the Peg3 protein also known as the product of the so-called genomic imprinting gene, is also known to interact with TRAF2, and overexpression of Peg3 can induce NF-II: B activation. It has been reported.
  • Casper which has sequence similarity to caspase 8, is also a molecule that interacts with the TRAF molecule, and has been reported to interact with TRAF 1 and TRAF 2 via the TRAF-N domain. Casper leads apoptosis, but this reaction competes with c-IAP. This c-IAP has also been reported to be a molecule that interacts with TRAF 2 through the TRAF-N domain It is suggested that the molecule interacting with the F molecule causes cell death and is involved in the control mechanism of cell survival.
  • TRAF2 RIP molecule
  • T6BP Interaction between T6BP and TRAF6 occurs through the coiled-coil region of T6BP and the N-terminal Ringfinger and Zinccfger domains of TRAF6.
  • IL-11 signal transmission involves a TRAF6-mediated mechanism
  • T6BP does not affect the activation of NF-; ⁇ B or JK during IL-11 stimulation, which is a typical TRAF6-mediated signal response.
  • the functional aspects of T6BP are not clear.
  • the present invention relates to a novel TRAF-binding factor, in particular, a TRAF-interacting protein forkhead-associated domain (hereinafter sometimes referred to as TIFA), a polynucleotide encoding the same, and a substance related thereto.
  • TRAF-binding factor in particular, a TRAF-interacting protein forkhead-associated domain (hereinafter sometimes referred to as TIFA), a polynucleotide encoding the same, and a substance related thereto.
  • TIFA TRAF-interacting protein forkhead-associated domain
  • One of the purposes is to clarify and make these applications possible.
  • the present inventors succeeded in cloning a novel molecule that binds to TRAF 6 by a two-hybrid screening method using mouse TRAF 6 as a bait, and at least NF-;
  • the present inventors have found that the present invention has a function relating to sexualization, and completed the present invention.
  • DISCLOSURE OF THE INVENTION The present
  • ⁇ ⁇ a polypeptide having at least about 70% homology on the amino acid sequence with the polypeptide of 1 or 2 and having TRAF binding activity;
  • ⁇ ⁇ a polypeptide having a mutation such as deletion, substitution, addition or insertion of one or several amino acids in the amino acid sequence and having an activity of binding to TRAF;
  • a method of identifying a compound that inhibits or enhances expression, comprising screening a polypeptide or polynucleotide under conditions that allow the interaction between the compound and the polypeptide or polynucleotide.
  • the interaction of the compound with the compound to be evaluated is a detectable signal in response to the interaction of the compound with the polypeptide or polynucleotide.
  • the interaction is a detectable signal in response to the interaction of the compound with the polypeptide or polynucleotide.
  • the second component that can be provided
  • detecting the presence or absence or a change in the signal caused by the interaction of the compound with the polypeptide or polynucleotide thereby providing
  • a method comprising determining whether the compound interacts with the polypeptide or polynucleotide to activate or inhibit its activity, (13) identified by the method of 11 or 12 above.
  • FIG. 1 is a diagram showing Northern routing showing the expression level of TIF AmR ⁇ in mice.
  • FIG. 2 shows the results of an experiment in which the binding of TIFA to various TRAFs was confirmed by immunoprecipitation.
  • FIG. 3 is a graph showing the results of examining the effect of TIFA on NF-IB activation by a function confirmation experiment using a luciferase reporter.
  • FIG. 4 is a diagram showing the nucleotide sequence of cDNA of human TIFA and the amino acid sequence encoded thereby.
  • FIG. 5 shows the nucleotide sequence of the cDNA of mouse TIFA and the amino acid sequence encoded thereby.
  • FIG. 6 is a continuation of FIG. 5 and shows the nucleotide sequence of the mouse DNA DNA and the amino acid sequence encoded thereby.
  • FIG. 7 is a graph showing electrophoresis by SDS-PAGE showing concentration-dependent promotion of phosphorylation of GST-c-Jun by addition of pME-FLAG-TIFA.
  • FIG. 8 is a diagram showing Western blotting for confirming the binding site of TIF A to TRA F6.
  • FIG. 9 is a diagram showing wesin blotting for confirming the binding site between TIFAs.
  • FIG. 10 is a diagram showing Western blotting for confirming the binding site of TRAF6 to TIFA.
  • FIG. 11 is a graph showing the effect of each region of TIFA on NF-NF: B activation using various mutants of TIFA.
  • FIG. 12 is a graph showing the effect of each region of TIFA on NF- ⁇ : B activity using various mutants of TIFA. '
  • FIG. 13 is a graph showing the inhibition of the function of ⁇ I ⁇ / ⁇ by the expression of TRAF6 dominant negative (DN).
  • FIG. 14 is a graph showing the inhibition of the function of TRAF6 due to the expression of a TIFA dominant negative (DD) body.
  • FIG. 15 is a graph showing the effect of TIFA dominant negative (DN) on IL-13 activation of NF-—B.
  • FIG. 16 is a graph showing the effect of TIF A dominant negative (DN) on NF-3 ⁇ 4B activation by TN FcH.
  • the TIFA provided in the present invention is obtained by obtaining its cDNA from a cDNA library as a substance having a novel amino acid sequence.
  • the presence of mRNA in the spleen, heart, brain, liver, lung, kidney, testis, and muscle of the TIFA of the present invention was confirmed by Northern plotting.
  • the TIFA of the present invention has the following properties or activities. Binds to TRAF, preferably TRAF1, TRAF2 or TRAF6. Also, it binds to the ⁇ -terminal region of 6 !.
  • the binding to TRAF 6 involves the C-terminal region (C domain) of TIFA, and particularly the 01u residue at position 178 is important.
  • NF- « ⁇ activation involves TIFA FHA domain and C domain are involved, Ser at position 50, Ser at position 66, and Guu residue at position 178.
  • FHA protein-associated domain
  • SEQ ID NO: 1 amino acid sequence of SEQ ID NO: 1 in the sequence listing. From the vicinity of the 47th V to the vicinity of the 103rd L, and in mice, the 47th V is added to the amino acid sequence of SEQ ID NO: 2 in the sequence listing.
  • this region corresponds to the region including the portion from near to the 103rd L.
  • Phosphor rooster change protein, peptide or amino acid (eg, phosphoserine, phosphothreonine, etc.) via FHA It also binds between TI FA molecules, including the FHA domain and the C domain. Involvement.
  • the TIFA of the present invention is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or 2 in human or mouse, in humans or mice.
  • the polypeptide or peptide of the present invention is selected from a polypeptide that is at least a part of the polypeptide described in SEQ ID NO: 1 or 2 in the sequence listing, or a polypeptide or peptide containing the same. You.
  • the polypeptide or peptide of the present invention is obtained by combining the polypeptide of SEQ ID NO: 1 or 2 with about 40% or more, preferably about 70% or more, more preferably about 80% on the amino acid sequence. %, More preferably about 90%, particularly preferably about 95% or more.
  • TRAF for example, an activity capable of binding to TRAF1, TRAF2, or TRAF6 and Z or NF—the activity of regulating (promoting or inhibiting) B activity, particularly the activity of is there.
  • the above activity can be determined by a known method, for example, immunoprecipitation for TRAF binding activity, and repo overnight assay using luciferase or the like for NF-1 ⁇ 2B regulatory activity, specifically described in Examples. Can be detected or measured by the method used. Specific examples of these polypeptides are given in the examples.
  • the polypeptide or peptide of the present invention includes a polypeptide or a peptide having a partial sequence of the polypeptide set forth in SEQ ID NO: 1 or 2 in the Sequence Listing, such as a reagent, a standard, or an immunogen.
  • Also available as With its smallest unit Comprises an amino acid sequence consisting of 8 or more amino acids, preferably 10 or more amino acids, more preferably 12 or more, still more preferably 15 or more consecutive amino acids, and is preferably immunologically Polypeptides or peptides that can be identified as such are the subject of the present invention. These peptides can be used alone or as a carrier (for example, molysin or ovalbumin, etc.) as a reagent or standard, or as an antigen for producing an antibody specific to TIFA as described below. Although they can be used in combination, those to which other kinds of proteins or substances are bound are also included in the scope of the present invention.
  • amino acids having mutations such as deletion, substitution, addition or insertion of several amino acids are preferably 1 to 30, more preferably 1 to 20, still more preferably 1 to 10, particularly preferably 1 to 10.
  • a polypeptide or peptide consisting of a noic acid sequence is also provided.
  • the means for deletion, substitution, addition, or insertion are known per se. For example, site-directed mutagenesis, homologous recombination, primer extension, or polymerase chain amplification (PCR) can be used alone or separately.
  • the FHA region is considered to be an important part for the expression or regulation of the activity, and it is preferable that the region containing these is well maintained on the primary sequence and / or the three-dimensional structure in order to maintain the TIFA activity.
  • the polypeptide or peptide of the present invention is included in the scope of the present invention regardless of the presence or absence of a sugar chain. Examples of specific mutant polypeptides are given in the Examples.
  • Regions or domains are provided, as well as polypeptides with altered strength or specificity of activity. These also may be, for example, as TIF A activity-like substances (eg, polypeptides comprising the FA—C domain) or TIFA antagonists (eg, polypeptides comprising the C domain or FA domain), or It is useful in screening for a substance that regulates, for example.
  • TIF A activity-like substances eg, polypeptides comprising the FA—C domain
  • TIFA antagonists eg, polypeptides comprising the C domain or FA domain
  • homologous gene products of animal species other than human and mouse are naturally included in the scope of the present invention.
  • another protein such as alkaline phosphatase is added to the N-terminal or C-terminal side.
  • Monoclonal immunoglobulin Fc fragments such as galactosidase and IgG or peptides such as FLAG-tag (Asp Tyr Lys Asp Asp Asp Asp Lys) (Biotechnol ogy, 6, 1205-1210, 1988) It is easy for those skilled in the art to add indirectly using a genetic technique or the like via a linker peptide or the like, and a polypeptide or the like to which these other substances are bound is also included in the scope of the present invention. Is done.
  • the polynucleotide of the invention and its complement are A polynucleotide encoding the amino acid sequence of the polypeptide or peptide, for example, the amino acid sequence shown in SEQ ID NO: 1 or 2 in the sequence listing, and a complementary strand to the polynucleotide.
  • SEQ ID NOs: 3 and 4 in the Sequence Listing showing preferred polynucleotides are nucleotide sequences deduced as coding regions of human or mouse TIFA, respectively.
  • the present invention relates to a polynucleotide encoding the amino acid sequence of the polypeptide or the peptide of the present invention, for example, a nucleotide encoding the amino acid sequence of SEQ ID NO: 1 or 2 in the sequence listing, preferably SEQ ID NO: 3, 4 or Provided is a polynucleotide that hybridizes to a polynucleotide represented by the nucleotide sequence of No. 5 or a region corresponding to the complementary strand thereof, preferably under stringent conditions, under selective conditions. The method of hybridization is described, for example, in Sambrook et al.
  • the selective hybridization condition means that a desired nucleic acid, for example, a nucleic acid having a desired homology with a specific probe (for example, a nucleic acid encoding the TIFA of the present invention of SEQ ID NO: 3, 4 or 5) is selected.
  • a specific probe for example, a nucleic acid encoding the TIFA of the present invention of SEQ ID NO: 3, 4 or 5
  • Conditions that specifically or specifically hybridize and do not hybridize to other unrelated nucleic acids eg, nucleic acids of lower homology.
  • the octopus temperature is used as an indicator of the stability of a double-stranded molecule (hybrid) of a nucleic acid. This is based on the length of the strand, the base length, and the chemical conditions (ionic strength, chemical strength, etc.). In general, hybridization is carried out at a temperature of Tm or less. Empirical empirical formulas have been obtained for the Tm values of hybrids of perfect complementarity with DNA, RNA or oligonucleotide probes (Human Molecular Genetics, Tom Strachan. and Andrew P.
  • Tm (° C) 4 (G + when the probe is smaller than 50 nucleotides).
  • C) +2 (A + T) [A, T, G, and C are the numbers of each base in the probe].
  • n is the base pair Duplex length
  • Tm is reduced by 1 ° C for each 1% unpaired base, so adjust the hybridization temperature accordingly.
  • An indication of the hybridization temperature is, for example, 55 ° C, preferably 40 ° C, more preferably 25 ° C, still more preferably 10 ° C, and particularly preferably 5 ° C lower than the Tm of the perfect complementarity hybrid.
  • a filter eg, a nylon membrane or a nitrocellulose filter
  • 3 XSSC Standard Sample Plate: 1 xSSC is 0%). Wash with 15M NaC 1, 0.011 5M sodium citrate), then 5X SSCP containing 50% formamide, 5X Denhalt's solution, 0.1% SDS, 25 OsZml of denatured salmon sperm DNA (1 xSSCP is, 0. 1 5M NaCl, 0.
  • the polynucleotide of the present invention comprises 10 or more consecutive nucleotides, preferably 15 or more, more preferably 20 or more, and still more preferably 25 or more, corresponding to an arbitrary or specific region of the designated base sequence. Includes polynucleotides and oligonucleotides consisting of the above nucleotides and their homologous chains.
  • polynucleotides may be used as a nucleic acid encoding TIFA, for example, as a probe or primer for detecting the gene or mRNA, or for regulating gene expression in the production of the polypeptide or the like of the present invention. It is useful as an antisense oligonucleotide. In that sense, the polynucleotides and oligonucleotides of the present invention include those corresponding to untranslated regions as well as translated regions. For example, in order to specifically inhibit the expression of TIFA by antisense, for example, it is assumed that a nucleotide sequence of a region unique to TIFA other than a motif sequence region such as FHA is used.
  • the use of motif sequences could simultaneously suppress the expression of multiple similar proteins including TIFA.
  • determination of the nucleotide sequence encoding TIFA or a polypeptide having a similar activity is performed, for example, by using a known protein expression system to confirm the expressed protein.
  • the activity can be determined by screening and using the physiological activity, for example, the activity of binding to TRAF, as an index.
  • a cell-free protein expression system for example, ribosome technology derived from embryos, rabbit reticulocytes, etc. can be used (Nature, 179, 160-161, 195). 7).
  • the polynucleotide of the present invention can be applied to gene therapy in a condition requiring modulation of TIFA activity.
  • the present invention also provides a gene recombination technique using a host known per se, such as Escherichia coli, yeast, Bacillus subtilis, insect cells, and mammalian cells.
  • a host known per se such as Escherichia coli, yeast, Bacillus subtilis, insect cells, and mammalian cells.
  • Peptides and polypeptides comprising the TIFA of the invention and its derivatives can be provided.
  • a specific cell was used, but it is needless to say that the present invention is not limited to this. Transformation is performed by a known method, for example, by using a plasmid, chromosome, virus, or the like as a replicon to transform a host.
  • a more preferable system is an integration method into a chromosome in consideration of the stability of the gene, but a simpler method is the use of an autonomous replication system using an extranuclear gene.
  • the vector is selected according to the type of the selected host, and includes a gene sequence to be expressed and a gene sequence carrying information on replication and control as components. Combinations are classified according to prokaryotic cells and eukaryotic cells, and promoters, ribosome binding sites, terminators, signal sequences, enhancers, and the like can be used in combination by a method known per se. In a specific embodiment of the present invention, a mammalian cell and yeast expression system was used, but is not limited thereto.
  • the transformant is cultured under conditions suitable for the culture conditions of each host known per se.
  • Culturing may be performed using the activity of peptides and polypeptides composed of TIFA and its derived products expressed as an index, but may be performed by subculturing using the amount of transformants in the soil as an index. It may be produced by a customer. (Recovery of TIFA and its derivatives)
  • the recovery of peptides and polypeptides consisting of TIFA and its derivatives from the culture medium can be performed using molecular sieves, ion column chromatography, affinity chromatography, etc., using the activity of TIFA, for example, the activity of binding to TRAF, as an index. It can also be purified or recovered by means of fractionation of ammonium sulfate, alcohol, etc. based on the solubility difference.
  • a method is used in which an antibody against the amino acid sequence is prepared based on the information on the amino acid sequence, and the antibody is specifically adsorbed and collected using a polyclonal antibody or a monoclonal antibody.
  • Antibodies are prepared by selecting antigenic determinants of peptides or polypeptides comprising the TIFA of the present invention and its derivatives.
  • the antigen may be TIFA or a fragment thereof and is composed of at least 8, preferably at least ⁇ 10, more preferably at least 12, and even more preferably ⁇ 15 amino acids.
  • a region consisting of a sequence unique to TIFA other than a motif region such as FHA may be used.
  • This amino acid sequence does not necessarily need to be homologous to SEQ ID NO: 1 or 2 in the sequence listing, and is preferably a site that is exposed to the outside in the three-dimensional structure of the protein. It is also effective that the amino acid sequence has a continuous position.
  • the antibody is not particularly limited as long as it immunologically binds or recognizes a peptide or polypeptide consisting of TIFA and its derivative.
  • the presence or absence of this binding or recognition is determined, for example, by a known antigen-antibody binding reaction.
  • a peptide or polypeptide comprising the TIFA of the present invention and a derivative thereof is used alone or in the presence of an adjuvant in the presence or absence of an adjuvant to produce a body fluid. It is performed by inducing immunity such as sexual response and Z or cellular response.
  • the carrier itself has deleterious effects on the host. Otherwise, there is no particular limitation, and examples thereof include cellulose, polymerized amino acids, albumin and the like.
  • a mouse, a rat, a heron, a sheep, a goat, a horse, and the like are preferably used.
  • the polyclonal antibody is obtained by a known antibody recovery method from serum.
  • a preferable means is an immunoaffinity mouth method.
  • antibody-producing cells for example, spleen or lymph node-derived
  • a permanently proliferating cell for example, P 3 X 6 Hybridomas are prepared by fusion with 3 Ag 8 strains such as myeloma B-cells).
  • a hybridoma producing an antibody that specifically recognizes the TIFA of the present invention is selected, and the antibody is recovered from the culture solution of the hybridoma.
  • a polyclonal antibody or a monoclonal antibody that can suppress TIFA activity is particularly preferred, and can control the activity of TIFA, for example, is involved in the NF-3 ⁇ 4B5 tongue signal. The activity can be easily controlled.
  • Peptides or polypeptides comprising TIFA and its derivatives comprising TIFA and its derivatives, polynucleotides encoding them and their complementary chains, cells transformed based on their amino acid sequences and base sequences, or cells transformed therefrom
  • Antibodies that immunologically recognize the protein synthesis system used and the peptide or polypeptide consisting of TIFA and its derivatives can be used alone or in combination of two or more to produce peptides, polypeptides or polynucleotides consisting of TIFA and its derivatives.
  • the present invention provides an effective means for a method of identifying or screening a modulator or modulator of activity against, for example, an activity inhibitor or an activator.
  • nucleotide sequence of the amino acid sequence or nucleotide sequence of the polypeptide of the present invention is stored.
  • a computer-readable storage medium storing the same.
  • selection of antagonists by drug design based on the three-dimensional structure of peptides or polypeptides using a computer selection of expression regulators at the gene level using a protein synthesis system, antibody recognition using antibodies Substance selection and the like can be used in a drug screening system known per se.
  • the above-mentioned regulation includes inhibition, antagonism, activation, activity promotion, activity activation and the like.
  • a peptide or polypeptide comprising the TIFA of the present invention and a derivative thereof, or a polynucleotide or a transformant of the present invention comprises a compound between a screening compound and such a peptide or polypeptide.
  • the conditions that allow the interaction of the signal are selected, and a system that uses a signal (marker 1) that can detect the presence or absence of this interaction is introduced.
  • the presence or absence of this signal (marker 1) or By detecting a change in the amount of the signal, a compound that activates or inhibits the activity of the peptide and polypeptide comprising the TIFA of the present invention and a derivative thereof, or inhibits or inhibits the expression of the polynucleotide of the present invention.
  • Compounds that promote it can be identified.
  • a system using a signal the binding between the polypeptide of the present invention and another protein (for example, a D, preferably a D6, and particularly a D-C domain) is measured.
  • a system for measuring the activity of the polypeptide of the present invention for example, an activity involved in NF- ⁇ activation or a system for measuring the expression level of a polynucleotide.
  • the specificity of the action of the compound can be confirmed by combining with various TRAF expression systems and comparing the reactions in each system.
  • each transformant may be replaced with a cell line in which the expression of the corresponding gene has been confirmed, etc.
  • the nucleotide or polynucleotide of the present invention or the peptide or polypeptide of the present invention Transgenic animals containing peptides (especially mice, Rat, pig, and mammal).
  • cells or animals in which all or at least a part of the original TIFA gene has been mutated, particularly deleted, such as knockout animals (particularly mammals such as mice, rats, pigs, and maggots) can be used. Can be made. These cells or animals are also useful in the above-mentioned screening and the like, and are included in the present invention.
  • the compounds thus identified are candidates for inhibitors or antagonists, antagonists, activators, accelerators or activators of the activity or action of peptides and polypeptides consisting of TIFA and its derivatives. Available. It can also be used as a candidate compound for expression inhibitors, expression antagonists, expression activators, expression promoters, and expression activators for TIFA and its derivatives at the gene level. These compounds can be used as modulators or modulators of the activity, action or function of TRAF, TIFA or NF- to prevent and / or treat various pathological symptoms associated with them.
  • the candidate compound thus selected can be prepared as a pharmaceutical composition by selecting in consideration of the balance between biological utility and toxicity.
  • an antibody that immunologically recognizes a polypeptide itself can be used as a disease diagnostic means such as a diagnostic marker or a reagent, or inhibits, antagonizes, activates, or promotes the expression, activity, function or action of TIFA. It can be used as a medicament such as a therapeutic agent utilizing the activity, action or function to activate.
  • a known formulation means such as a peptide or polypeptide, a protein, a polynucleotide, and an antibody may be introduced according to each subject.
  • the above-mentioned pharmaceutical thread is the peptide or polypeptide of the present invention, , A vector, a transformant, an antibody, or the above-mentioned compound of the present invention.
  • the drug can be used to treat diseases associated with TIFA, DAF RAF or NF-;, especially TIF ⁇ , such as autoimmune disease, shock (such as septic shock) and bone disease (such as osteopathy). Or it is useful for prevention.
  • a diagnostic means it is useful as a diagnostic means for a disease associated with the expression or activity of a peptide or polypeptide comprising the TIFA of the present invention and its derivative, and the diagnosis is carried out, for example, by a nucleic acid sequence encoding the peptide. Using the interaction or reactivity with the peptide to determine the amount of the corresponding nucleic acid sequence and / or determining the biodistribution of the peptide in an individual; and / or The determination is performed by determining the presence of, the amount present in a sample derived from an individual, or the amount of activity. That is, TIFA is tested as a diagnostic marker.
  • the measurement may be carried out using a known antigen-antibody reaction system, enzyme reaction system, PCR reaction system, or the like. Further, detecting a single nucleotide polymorphism (SNP) by a known method is also a useful diagnostic means.
  • SNP single nucleotide polymorphism
  • Example 1 Obtaining DNA Encoding Mouse TIFA
  • Screening was performed by yeast two-hybrid screening method in order to clone the cDNA of a protein that binds to mouse TRAF6. That is, first 7 a cZ N H is 3 and e 2 gene in yeast is incorporated as reporter one coater gene, form that combines TR AF 6 transcription factor GAL 4 DNA binding region on a yeast expression base Kuta one The gene was constructed and introduced. Subsequently, a cDNA library was constructed on the expression rooster vector, in which the ACTIPETA domain of GAL4, which is a transcription factor, and the cDNA product were fused and expressed. Then, screening was performed using the index of change in yeast expression form as an index when binding between TRAF6 and the cDNA expression product was observed. The details are described below. Preparation of c DNA library
  • RNA was extracted from bone marrow cells prepared from the femurs of five ICR mice (8 weeks old) according to a conventional method, and poly-A-RNA was extracted from the cells using Rigo dT-Latex (Daiichi Pure Chemicals). did. Using this poly A-RNA, Hybri ZAP-2.1 XR Library Construction on Kit (Stratagene), and HybriZAP-2.1 XR cDNA Synthetics is Kit (Stratagene), Thus, a cDNA library was synthesized.
  • a predetermined First Strand synthesis reaction reagent containing polyA-RNA5 X9 equivalent, the Xho I linker primer attached to the kit, and 5-methy 1 dCTP is used.
  • the mixture was mixed and allowed to stand at room temperature for 10 minutes.
  • 1.5 ⁇ L of MMLV-RT 50 ⁇ / ( ⁇ L) was added to this reaction system, mixed gently, and reacted at 37 ° C for 1 hour.
  • the pellet (pellet) was dissolved in a 9 ⁇ L EcoRI adapter and incubated at 4 ° C for 30 minutes. Was added, followed by the addition of 4 DN A1 igase (4 U / L), followed by overnight reaction at 8 ° C.
  • the ligation reaction of this EcoRI adapter was carried out at 70 ° C. for 30 minutes. After stopping, bring to room temperature Add 10 mM ATP2 / and a phosphorylation terminator for phosphorylation of the EcoRI adapter end, and add 1 ⁇ _ of T4 pol ynucl eotide kinase (10 U / ⁇ ⁇ ), . C was anti-ifced for 30 minutes.
  • the expression vector in which the cDNA encoding FLAG-tag is encoded on the plasmid pME18S at the full length of mouse TRAF6, and the N-terminal of the mouse is expressed in pME-FLAG-TRAF6 were digested with restriction enzymes EcoR I and Stu I according to a conventional method to prepare a cDNA fragment encoding mouse TRAF6 full-length protein.
  • pGBT9 vector The Yuichi plasmid (CI ontech) was digested with EcoRI and SmaI, and the cDNA fragment (EcoRI-StuI) encoding the full-length mouse TRAF6 protein prepared above was ligated.
  • E. coli DH5 strain was transformed to obtain a transformant. Plasmids were recovered from the transformed Escherichia coli by a conventional method and used as a Bait vector (pGBT9-TRAF 6). In this expression vector, gene expression occurs in a form in which the DNA binding domain of GAL4 protein and the full-length protein of TRAF6 are fused. Transformation and Screening
  • the yeast strain PJ69-4A (Genetics 144: 1425-1436 (1996)) has the 1 ac Z, f / 7s3, and de2 genes integrated into its genome, When the GA L4DN A binding domain / TRAF 6 fusion protein and the GAL 4 active domain Zc DNA expression product fusion protein are combined, they can grow on a medium lacking histidine and adenine, and are positive for one galactosidase activity.
  • PG BT9—TRAF 6 was introduced into the Toriken mother PJ 69-4A strain by the lithium acetate method, and then spread on Trp-free SC ⁇ ya at 30 ° C for 3 days.
  • the 3 ⁇ 10 6 clone of the cDNA library described above was introduced into the yeast by the lithium acetate method, and SC / —His / ⁇ T r ⁇ / —L eu / Seed on -Ad e medium and cultured for 7 days at 30. C.
  • the emerged colonies were shaken on SCZ-His / -Trp / -Leu ⁇ ⁇ ground (2 mL) ⁇
  • the yeast cells are disrupted with a glass bead s, and the lysate O OyOtL contains ON ACL (2 mg / mL) 160 ACL, which is a substrate for yS-Gal.
  • the plasmid having the cDNA (SEQ ID NO: 5) inserted in ⁇ uescript was named pB1uescript-mTIFA.
  • the obtained plasmid was placed on January 1, 2001 at 1-3 1-3 Higashi, Tsukuba City, Ibaraki Prefecture, Japan. Biotechnology Industrial Technology Research Institute) (Accession No. FERM P-18154). This was followed by the international approval of the deposit of microorganisms in the patent procedure at the Patent Organism Depositary at the National Institute of Advanced Industrial Science and Technology at 1-1-1 Tsukuba East, Ibaraki, Japan. It was transferred to the International Deposit under the Budapest Treaty on February 27, 2001 and given the accession number FERM BP-7842.
  • Example 2 Northern blotting (gene expression profiling)
  • Northern blotting was performed to analyze the expression level of TIFA in each tissue.
  • a probe was prepared using a portion corresponding to the coding region of the cDNA sequence of mouse TIFA.
  • primer A containing an initiation codon (sequence: 5, -GCCTCGA GATGTCCACCTTTGAAGACGCTG—3 ') and primer B containing a termination codon (sequence: 5'-GCGCGGCCGCTCACAGTTCGTT TTC ATCC ATTTC-3') as a template
  • mouse TIFA A PGR reaction was performed at the following temperature and time using the plasmid (pBluescript-mTIFA) into which the cDNA was inserted.
  • the obtained amplified fragment was extracted, treated with restriction enzymes XhoI / NotI, and introduced into plasmid pME-FLAG to prepare an expression plasmid pME-FLAG-mTIFA.
  • This plasmid was prepared in a large amount and treated again with the restriction enzymes XhoI / NotI to obtain a DNA fragment encoding TIFA, which was labeled. Labeling was performed using Megaprime DNA labeling system (Amersham Pharmacia Biotech).
  • the DNA obtained above and the random primer are mixed, treated at 100 ° C for 3 minutes, transferred to ice water and quenched, and then added with buffer 1, [Hi-32P] d CTP, and K 1 enow DNA synthase. Gently mixed.
  • RNA messenger RNA
  • mRNA messenger RNA
  • mRNA messenger RNA
  • mice brain, spleen, lung, liver, skeletal muscle, kidney, and testis tissues, each of which is blocked by 2 / Ug (MTN Blots Mouse Clontech)
  • 2 / Ug MTN Blots Mouse Clontech
  • the probe obtained above was treated at 100 ° C for 3 minutes, transferred to ice water and quenched, added to a 5 mL hybridization solution, and added to the membrane.
  • the membrane was incubated for 1 hour at 68 ° C and the probe was hybridized to RNA. After the hybridization, the membrane was washed with a washing solution having a composition of 2XSSC and 0.05% SDS at room temperature for 40 minutes. Subsequently, washing was performed at 50 ° C. for 40 minutes with a washing solution having a composition of 0.1 ⁇ SSC and 0.1% SDS. Wrap the washed membrane in a wrap and adhere to the X-ray film. The samples were exposed to light for 1 week in the C dip-fridge and developed.
  • a plasmid vector that expresses the cDNA cDNA which is a fusion protein in which My c epitope tag (amino acid sequence: MEQKL I SEEDL) and mouse TIFA are linked under the control of the S Ra promoter based on the plasmid pME 18 S pME—My c — MTIFA was prepared.
  • a suspension of Protein G-Sepharose was added to the cell lysate 3 OOAtU prepared in the previous section, and the mixture was inverted and stirred at 4 ° C for 30 minutes. Then, after centrifugation at 5,000 xG for 5 minutes, the supernatant was collected and added to the mouse anti-FLAG antibody (X Bear (1) and 10 L of Rotating G-sepharose suspension were added, and the mixture was stirred at 4 ° C for 1 hour with ## j. After the treatment, the immune complex / resin was washed with a NE buffer and collected.
  • the membrane was subjected to a blocking treatment using a PBS-T buffer containing 3% skim milk, followed by a primary antibody reaction with a mouse anti-My'c antibody (diluted at 1000: SantaCruz), and further with an HRP-labeled anti-mouse I 9
  • a secondary antibody reaction with an antibody was performed. After washing the membrane thoroughly with PBS-T, detection by ECL (Amersham Pharmacia Biotech) was completed.o
  • mice TIFA protein was detected, and was particularly remarkable in TRAFs 2 and 6. This revealed that the mouse TIFA protein binds to TRAF1, 2, and 6 molecules (Fig. 2). On the other hand, under the same conditions, mouse TIFA protein was not detected in experiments using crushed cells of cells expressing both TRAF3 or TRAF5, and it was considered that TRAF3 and 5 molecules did not bind to mouse TIFA protein. .
  • Example 4 Function confirmation experiment using Lucifera reporter
  • NF-NF — K ⁇ ⁇ ⁇ responsive elements are connected in series as a reporter gene, and the HSV-TK promoter sequence is connected downstream of them, and a reporter gene that expresses the luciferase gene under their control.
  • Tarplasmid 3x «BLuc was used.
  • NF— «as a negative control B-response 3XM-B uc was used that introduced a mutation in the sequence and did not respond to NF-B.
  • transfect 293T cells 5 ⁇ 10 5
  • transformation was performed using 3 XM3 ⁇ 4BLuc1 Ong and ⁇ —Myc—mTIFA with varying concentrations from 3 ng to 3 ⁇ g. Twenty-four hours before the gene transfer, 5 ⁇ 10 5 293 T cells were seeded on a 6 cm plate. The cells were cultured at 37 ° C. in a 5% C02 environment.
  • PCR was performed again using the obtained reaction solution as a template.
  • the primers were hETIFA-S 1 (sequence; AAG AAT T CA TGA CCA GTT TTG AAG ATG CTG) with Eco RI site and Xhol site attached to both ends of the amplification region, respectively.
  • h XT I FA-F 1 (sequence; A AC TCG AGT CAT G AC TCA T TT TCA TC) was used, and the other reaction conditions were the same as before.
  • the obtained fragment was extracted, treated with restriction enzyme EcoRI / XhoI, introduced into the EcoRI / XhoI site of plasmid pBLuescriptltlSK +, and the plasmid pBLuescript— hTI FA was prepared.
  • the nucleotide sequence was determined by a conventional method, the nucleotide sequence of SEQ ID NO: 3 was confirmed.
  • a at the start codon was base number 1 and T at base number 498 was C.
  • C at base number 300 was T as well as the base position.
  • the deduced amino acid sequences were the same in each case.
  • the obtained plasmid pBluescript® hTIFA was released on January 5, 2001 at the Institute of Biotechnology, Ministry of Economy, Trade and Industry (METI) at 1-3 1-3 Tsukuzuhigashi, Ibaraki, Japan. Deposited at the National Institute of Advanced Industrial Science and Technology (AIST) (accession number FERM P-18153). This was followed by international approval for the deposit of microorganisms in the patent procedure at the National Institute of Advanced Industrial Science and Technology Terakyo Biological Depositary located at 1-1-1 Tsukuba East East, Ibaraki Prefecture, Japan. International deposit under the Budapest Treaty December 27, 2001 Transferred as of date with accession number F ERM BP-7841.
  • a cDNA having the nucleotide sequence of SEQ ID NO: 3 has been inserted into the plasmid. Furthermore, this plasmid was treated with the restriction enzyme XhoI / No11 to obtain a DNA fragment encoding hTIFA, which was introduced into the plasmid pME-FLAG and expressed in the plasmid pME-FLAG-hTIFA. Was prepared.
  • Example 6 Function estimation
  • TIFA protein The function of TIFA protein was deduced from the amino acid sequence.
  • a motif search was performed on the protein using a database (PROS I TE MOT IF, PROS I TE PROF I LE, PR I NTS).
  • the protein is structurally similar to the forkhead-as-sociated (FHA) domain from the 47th V to the 103rd L in the amino acid sequence of SEQ ID NO: 1 or 2. It is suggested that there is great similarity.
  • FHA domain which was discovered as a motif for eukaryotic nuclear proteins, is also conserved in prokaryotes.
  • Rad53p a yeast protein
  • this protein is a kinase that controls the cell cycle and has the property of binding to phosphorylated peptides.
  • the FHA domain has a function to bind to the phosphorylated peptide of Rad53p (Moeccu! ArCell, Vol. 4 pp387-394, 1999).
  • some FHA domains of other proteins have a function of binding to a phosphorylated peptide similarly to that of Rad53p. Having an FHA domain strongly suggests that TIFA may be involved in intracellular signal transduction via phosphorylation.
  • the TRAF molecule itself is not expected to transmit signals by phosphorylation.
  • the TI FA molecule binds to phosphorylated proteins, strongly suggesting that the TI FA molecule may be involved in the signaling by transferring phosphate downstream of the signal transmission from the TAF molecule. This fact is strongly suggested by the fact that overexpression of the transcription factor NF-II: B has confirmed the activation and suppression of B.
  • Plasmid pEF-His-JNK which expresses Jun-N-Terminal kinase (hereinafter referred to as JN), which is connected to the histidine tag, under the control of the fermentation factor-promoter.
  • JN Jun-N-Terminal kinase
  • a region containing the coding sequence of His-JNK was excised from His-JNK (Oncogene 1996; 12 (3): 641-50), and a plasmid having an elonge-gene factor-1 promoter (Nucleic Acids Res 1990; 18: 5322).
  • 1 O / Lt g from 0.01 to 1 Oy g from pME-F to AG-mTIFA (In Examples 7 to 15, mouse TIFA (mTIFA) was used unless otherwise specified.
  • MT IFA may be referred to as TIFA) and transfection was performed on 5 ⁇ 10 5 cells by the calcium phosphate method.
  • 19 or 109 pME-FLAG-TRAF6 was used as a control instead of pME-FLAG-mTIFA.
  • the ⁇ nutrient solution was removed, and the cells were washed with PBS.
  • 400 L of TNE buffer was added to solubilize the cells, and the cells were scraped using a scraper and collected in a 1.5 mL tube. This was left on ice for 15 ⁇ , then rotated for 15 5 and stirred. Thereafter, centrifugation was performed at 14000 Xg for 15 minutes, and the supernatant was recovered.
  • an anti-T7 antibody for recognizing histidine was added, followed by 20 L of ProteinG-Sepharose suspension, followed by ttU stirring at 4 ° C for 30 minutes. After the treatment, centrifugation was performed at 14,000 9 for 15 minutes to recover the immune complex Z resin. Wash the immune complex / resin three times with TNE buffer and add Kinase Buffer (2 OmM HEP ES-KOH, pH 7.9 20 mM MgCl 2 150 mM NaC ⁇ 0.5 mM Na F 0.1 mM Na 2 VO 3 2 OmM Glceropho sphate 2 mM DTT).
  • Kinase Buffer OmM HEP ES-KOH, pH 7.9
  • the remaining sample was supplemented with 92.5 kBq (2.5 C i) ⁇ 32 P—ATP and 2 g GST—c—j un (Cel 1 Signal Engineering) 30. C Treated for 20 minutes. After adding 20 ⁇ l_ of 3 ⁇ sample buffer to the sample and boiling for 3 minutes, SDS-PAG was performed on a 10% acrylamide gel. The gel was dried with a gel dryer and subjected to radiography.
  • each domain of mouse TIFA is defined as follows (see also the schematic diagram of FIG. 8).
  • TIFAI FA in order to determine the binding region of the TRAF6 protein with TIFA, a vector that encodes a fusion protein of the FLAG tag peptide and various partially deleted mutants of mouse TRAF6 was selected. Produced.
  • the expression vectors and the proteins encoded thereby are abbreviated as shown in Table 3 below (see also the schematic diagram of FIG. 10).
  • the amino acid number follows the known amino acid number of mouse TRAF 6 (J. Biol. Chem. Vol. 271, No. 46, pp. 28745-28748, 1996). Table 3
  • TIFA to TRAF 6 The binding site of TIFA to TRAF 6 was confirmed. 5yctg of each of the plasmids encoding the mTIFA mutant prepared in Example 8 and pME-FLAG-TRAF65 / g were mixed and transfected into 293T cells by the calcium phosphate method. Project. After culturing for 40 hours, TNE buffer was added to solubilize the cells. After solubilization, centrifugation was performed, and the supernatant was collected. Protein G—Separose suspension was added thereto, and the mixture was stirred with a car. Then, after centrifugation, the supernatant was collected, and a glutathione-separation suspension was added thereto, and the mixture was inverted and stirred.
  • the protein / resin complex was washed with a TNE buffer, centrifuged, and the precipitate was collected. After suspending the protein in a 2X sample buffer equivalent to the protein / resin complex and decomposing the immunocomplex by a manual process, SDS-PAGE was performed on an acrylamide gel. After electrophoresis, it was transferred to a PVDF membrane. After the transfer, the membrane was blocked, then a primary antibody reaction with an anti-FLAG antibody (1000 dilution: Sigma), and further with an HRP-labeled anti-mouse Ig antibody (Amersham Pharmacia Biotech) A secondary antibody reaction was performed. After the membrane was sufficiently washed with PBS-T, detection was performed using ECL Western Blotting Detection Formulation (Amersham Pharmacy Abyssai Tech).
  • TRAF transmits a signal through multimerization suggests that TIFA may also multimerize.
  • Each plasmid 5Atg encoding a mutant of mTIFA prepared in Example 8 was mixed with pME-FLAG-mTIFA5, and gene transfer was performed by the calcium phosphate method in the same manner as in Example 9, and anti-GS antibody An immunoprecipitation experiment was performed, and detection was performed using an anti-FLAG antibody.
  • Each of Brasmid 5 encoding the mutant of TRAF 6 prepared in Example 8 was mixed with PME-Myc-mTIFA 5 ⁇ 9, and gene transfer was performed by the calcium phosphate method in the same manner as in Example 9.
  • An immunoprecipitation experiment was performed with a LAG antibody, and detection was performed with an anti-Myc antibody.
  • NF-II Three NF-II-response elements are connected in series as a B repo overnight gene, and the HSV-II-promoter sequence is connected downstream of them. The luciferase gene is expressed under their control. The reporter plasmid 3 ⁇ ⁇ B Luc was used. As a negative control, 3XM3 ⁇ 4B Luc which was mutated into the NF- ⁇ B responsive sequence and did not respond to NF- ⁇ B was used.
  • This reporter plasmid 1 Ong and prepared in Example 8 The expression plasmid containing the TIFA mutant gene was transfected into 293T cells (5 ⁇ 10 5 cells) using the calcium phosphate method using 10 ng and 1 O 9 of each. 36 hours after the transformation, the cells were washed once with PBS, and ⁇ cultured cell lysate LC (manufactured by Toyo Inki) was added, and treated for 15 minutes at room temperature to dissolve. Dissolve the lysate at 15000 rpm for 2 minutes 4. After centrifugation at C, only the supernatant was obtained as an enzyme source. 100 liters of Pitka Gene luminescent substrate (manufactured by Toyo Ink Co., Ltd.) was added to each of the solutions, and the amount of luminescence was measured over a luminometer.
  • ⁇ cultured cell lysate LC manufactured by Toyo Inki
  • the mutant E178A failed to bind TIFA to the TRAF6 molecule, but also failed to activate NF- ⁇ , indicating that this residue is important for signal transduction. . It was also found that the I domain of T IF ⁇ ⁇ ⁇ ⁇ was relatively unimportant for T IF A signaling.
  • Example 13 TIFA by Expression of TRAF6 Dominant Negative (DN) Body
  • TRAF 6 on NF-1 ⁇ 2B activity was confirmed by expressing the NF- «B reporter gene and pME-GST-C in the same cells.
  • 10 ng of 3 ⁇ ⁇ B Luc and the expression plasmid pME—GST—C (from 1 g to 1 Og) prepared in Example 8 were transfected into 293T cells by the calcium phosphate method.
  • the cells were spiked with ⁇ 1.50 ng / mL or TN Fa to 20 ng / mL in a ⁇ nutrient solution of the cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Transplantation (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un polypeptide sélectionné dans le groupe suivant comprenant : (1) un polypeptide comprenant une séquence d'acides aminés représentée par SEQ ID NO :1 ou 2 dans le listage des séquences ; (2) un polypeptide comprenant au moins un fragment ou une partie du polypeptide défini dans le point (1); (3) un polypeptide semblable à celui défini dans les points (1) ou (2); (4) un polypeptide ayant une séquence d'acides aminés présentant une homologie d'au moins 70 % par rapport à la séquence d'acides aminés du polypeptide défini dans les points (1) ou (2) et ayant une activité lui permettant de se fixer sur TRAF ; et (5) un polypeptide ayant une séquence d'acides aminés dérivée d'une séquence d'acides aminés semblable à celle définie ci-dessus, par délétion, substitution, addition ou insertion d'un ou de plusieurs acides aminés, et ayant une activité lui permettant de se fixer sur TRAF ; et un polynucléotide codant ce polypeptide sélectionné.
PCT/JP2002/000262 2001-01-19 2002-01-16 Nouveau gene tifa WO2002057449A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2001012268 2001-01-19
JP2001-012268 2001-01-19
JP2001190351 2001-06-22
JP2001-190351 2001-06-22

Publications (1)

Publication Number Publication Date
WO2002057449A1 true WO2002057449A1 (fr) 2002-07-25

Family

ID=26608011

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2002/000262 WO2002057449A1 (fr) 2001-01-19 2002-01-16 Nouveau gene tifa

Country Status (1)

Country Link
WO (1) WO2002057449A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003082917A1 (fr) * 2002-04-02 2003-10-09 The Institute Of Physical And Chemical Research Nouveau polypeptide et acide nucleique le codant
EP3204014A4 (fr) * 2014-10-10 2018-05-30 The Governing Council of the University of Toronto Procédés de modulation des réponses du système immunitaire

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000055350A1 (fr) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. Sequences et polypeptides geniques associes au cancer chez l'homme

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000055350A1 (fr) * 1999-03-12 2000-09-21 Human Genome Sciences, Inc. Sequences et polypeptides geniques associes au cancer chez l'homme

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BONALDO M.F. ET AL.: "Normalization and subtraction: Two approaches to facilitate gene discovery", GENOME RES., vol. 6, no. 9, 1996, pages 791 - 806, XP002039972 *
CARNINCI P. ET AL.: "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes", GENOME RES., vol. 10, no. 10, 2000, pages 1617 - 1630, XP002944079 *
HILLIER L. ET AL.: "Generation and analysis of 280,000 human expressed sequence tags", GENOME RES., vol. 6, no. 9, 1996, pages 807 - 828, XP000914615 *
ISHIDA T. ET AL.: "Identification of TRAF6, a novel tumor necrosis factor receptor-associated factor protein that mediates signaling from an amino-terminal domain of the CD40 cytoplasmic region", J. BIOL. CHEM., vol. 271, no. 46, 1996, pages 28745 - 28748, XP002129047 *
LEE S.Y. ET AL.: "TRAF-interacting protein (TRIP): A novel component of the tumor necrosis factor receptor (TNFR)-and CD30-TRAF signaling complexes that inhibits TRAF2-mediated NF-kappaB activation", J. EXP. MED., vol. 185, no. 7, 1997, pages 1275 - 1285, XP002951069 *
LING L. ET AL.: "T6BP, a TRAF6-interacting protein involved in IL-1 signaling", PROC. NATL. ACAD. SCI. USA, vol. 97, no. 17, 2000, pages 9567 - 9572, XP002951068 *
ROTHE M. ET AL.: "I-TRAF is a novel TRAF-interacting protein that regulates TRAF-mediated signal transduction", PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 8241 - 8246, XP000608730 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003082917A1 (fr) * 2002-04-02 2003-10-09 The Institute Of Physical And Chemical Research Nouveau polypeptide et acide nucleique le codant
EP3204014A4 (fr) * 2014-10-10 2018-05-30 The Governing Council of the University of Toronto Procédés de modulation des réponses du système immunitaire
US10238738B2 (en) 2014-10-10 2019-03-26 The Governing Council Of The University Of Toronto Methods of modulating immune system responses

Similar Documents

Publication Publication Date Title
US20020102569A1 (en) Diagnostic marker for cancers
US20040166501A1 (en) Receptors and membrane-associated proteins
KR20170138410A (ko) 비-천연 세마포린 3 및 이의 의학적 용도
AU2001263952B2 (en) Tumour suppressor and uses thereof
JP2005519584A5 (fr)
AU2001263952A1 (en) Tumour suppressor and uses thereof
TW202237642A (zh) 對冠狀病毒具有特異性的抗原結合多肽及其用途
US20120141505A1 (en) Cd19-ligand and use
JP2004533222A (ja) 免疫グロブリンスーパーファミリータンパク質
EP1263939B1 (fr) Proteine kinase 18477 et utilisations de celle-ci
AU710551B2 (en) Nucleic acid encoding a nervous tissue sodium channel
JP2002529051A (ja) ヘルペスウイルス侵入メディエーター関連タンパク質ファミリーの新規分子およびその使用
JP2000505652A (ja) 新規ＣＲＥＢａイソフォーム
WO2002057449A1 (fr) Nouveau gene tifa
JP2003530071A (ja) 細胞内シグナル伝達分子
US5846822A (en) Nucleic acid molecules encoding PP32: a newly identified CD45-associated protein
US6444430B1 (en) Ndr2-related proteins
JP2001157590A (ja) 紫外線照射仲介皮膚損傷に関連する遺伝子およびポリヌクレオチド並びにそれらの使用
WO1997031110A1 (fr) Molecule de la famille des genes de transfert f, polynucleotide codant pour cette molecule et anticorps actif contre cette molecule
WO2002064786A1 (fr) Nouveau gene tcif
US20030073162A1 (en) Signal peptide-containing proteins
JP2005511028A (ja) 疾患検出および治療用分子
JP2003532424A (ja) Ｒｈ１１６ポリペプチドとその断片、および前記ポリペプチドをコードするポリヌクレオチドと治療の用途
JP3665071B2 (ja) 新規なリセプター型チロシンキナーゼ
WO2004094598A2 (fr) Procedes d'utilisation pour de nouveaux polypeptides humains codes par des polynucleotides

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP