WO2004094598A2 - Procedes d'utilisation pour de nouveaux polypeptides humains codes par des polynucleotides - Google Patents
Procedes d'utilisation pour de nouveaux polypeptides humains codes par des polynucleotides Download PDFInfo
- Publication number
- WO2004094598A2 WO2004094598A2 PCT/US2004/011912 US2004011912W WO2004094598A2 WO 2004094598 A2 WO2004094598 A2 WO 2004094598A2 US 2004011912 W US2004011912 W US 2004011912W WO 2004094598 A2 WO2004094598 A2 WO 2004094598A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- polypeptide
- nucleic acid
- antibody
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention is related generally to novel polynucleotides and novel polypeptides encoded thereby, their compositions, antibodies directed thereto, and other agonists or antagonists thereto.
- the polynucleotides and polypeptides are useful in diagnostic, prophylactic, and therapeutic applications for a variety of diseases, disorders, syndromes, and conditions, as well as in discovering new diagnostics, prophylactics, and therapeutics for such diseases, disorders, syndromes, and conditions (hereinafter disorders).
- the present invention also relates to methods of modulating biological activities through the use of the novel polynucleotides and novel polypeptides of the invention and through the use of agonists and antagonists, such as antibodies, thereto.
- This application also relates to the field of polypeptides that are associated with regulating cell growth and differentiation, that are over-expressed in cancer, and/or that can be associated with proliferation or inhibition of cancer growth, including hematopoietic cancers such as leukemias, lymphomas, and solid cancers such as pancreatic cancer, tracheal cancer, and lung cancer, for example, adenocarcinomas and/or squamous cell carcinomas.
- hematopoietic cancers such as leukemias, lymphomas, and solid cancers such as pancreatic cancer, tracheal cancer, and lung cancer, for example, adenocarcinomas and/or squamous cell carcinomas.
- These polypeptides may also be associated with other conditions, such as inflammatory, immune, and metabolic disorders such as type II diabetes, as well as bone disorders, central nervous system (CNS) disorders, and microbial infections, including viral, bacterial, fungal, and parasitic disorders.
- CNS central nervous system
- This application further relates to modulators of biological activity that can specifically bind to these polynucleotides or polypeptides, or otherwise specifically modulate their activity. For example, they can directly or indirectly induce antibody- dependent cellular cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), endocytosis, apoptosis, or recruitment of other cells to effect cell activation, cell inactivation, cell growth or differentiation or inhibition thereof, and cell killing.
- ADCC antibody- dependent cellular cytotoxicity
- CDC complement-dependent cytotoxicity
- endocytosis endocytosis, apoptosis, or recruitment of other cells to effect cell activation, cell inactivation, cell growth or differentiation or inhibition thereof, and cell killing.
- sequences of the invention encompass a variety of different types of nucleic acids and polypeptides with different structures and functions. They can encode or comprise polypeptides belonging to different protein families ("Pfam").
- the "Pfam” system is an organization of protein sequence classification and analysis, based on conserved protein domains; it can be publicly accessed in a number of ways, for example, at http://pfam.wustl.edu.
- Protein domains are portions of proteins that have a tertiary structure and sometimes have enzymatic or binding activities; multiple domains can be connected by flexible polypeptide regions within a protein.
- Pfam domains can comprise the N-terminus or the C-terminus of a protein, or can be situated at any point in between.
- the Pfam system identifies protein families based on these domains and provides an annotated, searchable database that classifies proteins into families (Bateman et al., 2002).
- Sequences of the invention can encode or be comprised of more than one Pfam. Sequences encompassed by the invention include, but are not limited to, the polypeptide and polynucleotide sequences of the molecules shown in the Sequence Listing and corresponding molecular sequences found at all developmental stages of an organism. Sequences of the invention can comprise genes or gene segments designated by the Sequence Listing, and their gene products, i.e., RNA and polypeptides.
- variants of those set forth in the Sequence Listing that are present in the normal physiological state, e.g., variant alleles such as SNPs, splice variants, as well as variants that are affected in pathological states, such as disease-related mutations or sequences with alterations that lead to pathology, and variants with conservative amino acid changes.
- Sequences of the invention are categorized below; any given sequence can belong to one or more than one category.
- Secreted proteins also referred to as secreted factors or secreted polypeptides, as used herein, include polypeptides, or active portions thereof, that are produced by cells and exported extracellularly; extracellular fragments of transmembrane proteins that are proteolytically cleaved; and extracellular fragments of cell surface receptors, which fragments may be soluble.
- HG1009657P1 is a 551 amino-acid-residue polypeptide comprising a cytochrome p450 Pfam domain that is 94% homologous over the length of the polypeptide (i.e., 94% of the 551 amino acid residues are identical) to human cytochrome p450, family 26, subfamily C, polypeptide 1.
- the secreted proteins of the present invention include those in the Sequence Listing with a Tree Vote of 0.5 or higher; the Tree Vote is an internal designation, as described, infra.
- compositions of the present invention will have in common the ability to act as ligands for binding to receptors on cell surfaces in ligand/receptor interactions, to bind to ligands, soluble or otherwise, to inhibit ligand/receptor interactions, to trigger certain intracellular responses, such as inducing signal transduction to activate cells or inhibit cellular activity, to induce cellular growth, proliferation, or differentiation, to induce the production of other factors that, in turn, mediate such activities, or to inhibit cell activation or signaling.
- the cell types having cell surface receptors responsive to secreted proteins are many and various, including, any cell type of any tissue origin or developmental state, for example, stem cells; and progenitor cells; precursor and mature cells of the hematopoietic, hepatic, neural, lung, heart, thymic, splenic, epithelial, pancreatic, adipose, gastrointestinal, colonic, renal, optic, olfactory, bone, and musculoskeletal lineages.
- the hematopoietic cells can be precursor or mature red blood cells or white blood cells, including cells of the B lymphocytic (B cell), T lymphocytic (T cell), monocytic, dendritic, megakaryocytic, natural killer (NK), macrophagic, eosinophilic, and basophilic lineages.
- B cell B lymphocytic
- T cell T lymphocytic
- NK natural killer
- macrophagic eosinophilic
- basophilic lineages eosinophilic, and basophilic lineages.
- the cell types responsive to secreted proteins also include normal cells and cells implicated in disorders or other pathological conditions.
- Certain of the secreted proteins can stimulate T or B cell growth or differentiation by interacting with precursor T or B cells or hematopoietic progenitor cells, or bone marrow stem cells.
- certain secreted proteins of the present invention can maintain stem cells, progenitor cells or precursor cells in an undifferentiated state.
- certain secreted proteins of the present invention can regulate bone growth by stimulation or inhibition thereof, secretion of insulin, glucose metabolism, cell proliferation, response to microbial infection, and regeneration of tissues including neural, muscular, and epithelial.
- certain secreted proteins of the present invention can induce apoptosis, such as in cancer cells or inflammatory cells.
- p450 cytochrome p450
- Cytochrome P450 domains are involved in the oxidative degradation of various compounds, including environmental toxins and mutagens (Degtyarenko and Archakov 1993).
- Certain of the secreted proteins of the present invention have a LBP/BPI/CETP family, N-terminal domain, and/or a LBP/BPI/CETP family, C- terminal domain, for example, HG1009765P1, which is a 1126 amino acid residue polypeptide that is 50% homologous over the length of the polypeptide with human antimicrobial peptide RY2G5; likely ortholog of rat probable ligand-binding protein RY2G5; long palate, lung, and nasal epithelium carcinoma associated 4 protein.
- This polypeptide possesses the functional domain and properties of a lipid binding serum glycoprotein.
- These families of proteins comprise lipopolysaccharide binding proteins, bactericidal permeability-increasing proteins, cholesteryl ester transfer proteins, and phospholipid transfer proteins. Proteins in these families share biochemical and structural similarities and serve a wide range of physiological functions (Yamashita et al., 2000). Transmembrane Proteins and Related Polypeptides
- Transmembrane proteins extend into or through the cell membrane's lipid bilayer; they can span the membrane once, or more than once. Transmembrane proteins that span the membrane once are “single transmembrane proteins” (STM), and transmembrane proteins that span the membrane more than once are “multiple transmembrane proteins” (MTM). Examples of transmembrane proteins include the receptors, e.g., insulin receptors, adenylate cyclases, and ion exchangers.
- a single transmembrane protein typically has one transmembrane (TM) domain, spanning a series of consecutive amino acid residues, numbered on the basis of distance from the N-terminus, with the first amino acid residue at the N- terminus as number 1.
- TM transmembrane
- a multi-transmembrane protein typically has more than one TM domain, each spanning a series of consecutive amino acid residues, numbered in the same way as the STM protein.
- Transmembrane proteins having part of their molecules on either side of the bilayers, have many and widely variant biological functions. They transport molecules, e.g., ions or proteins across membranes, transduce signals across membranes, act as receptors, and function as antigens. Transmembrane proteins are often involved in cell signaling events; they can comprise signaling molecules, or can interact with signaling molecules.
- tyrosine kinases can be transmembrane receptor proteins. Abnormalities of receptor tyrosine kinases are associated with human cancers; tumor cells are known to use receptor tyrosine kinases in transduction pathways to achieve tumor growth, angiogenesis and metastasis.
- transmembrane proteins or polypeptides like the secreted polypeptides, also have many different functional domains, and belong to a wide variety of Pfam families.
- kinases for example, receptor tyrosine kinase family members
- receptor tyrosine kinases are often associated with human cancers.
- tumor cells are known to use receptor tyrosine kinases in transduction pathways to achieve tumor growth, angiogenesis and metastasis. Therefore, receptor tyrosine kinases represent pivotal targets in cancer therapy.
- a number of small molecule receptor tyrosine kinase inhibitors have been synthesized, are in clinical trials, are being analyzed in animal models, or have been marketed.
- Inhibitory mechanisms include ligand-dependent down regulation, e.g., by the adaptor Cbl (Brunelleschi et al., 2002).
- transmembrane proteins of the present invention have a p450 Pfam domain, which was described, supra, for example HG1009657P1, also described supra as a secreted protein, is also a transmembrane protein. These designations are consistent with a transmembrane protein with an extracellular fragment that is cleaved and secreted.
- Adh_short domains are found in a large family of proteins that includes short-chain dehydrogenases and reductase enzymes; most family members function as NAD- or NADP-dependent oxidoreductases (Jornvall et al. 1995).
- This polypeptide possesses the functional domain and properties of a YT521-B-like protein, which is a tyrosine-phosphorylated nuclear protein that functions in a signal transduction pathway to influence splice site selection.
- YT521-B interacts with the nuclear transcriptosomal component scaffold attachment factor B, and a 68-kDa src substrate which is associated during mitosis (Hartmann AM et al., 1999).
- Transmembrane proteins that are differentially expressed on the surface of cancer cells are desirable targets for production of antibodies, e.g., diagnostic antibodies or therapeutic antibodies, such as antibodies that mediate ADCC or CDC to effect tumor cell killing.
- Transmembrane proteins with extracellular fragments that can be cleaved can be useful as secreted proteins to effect ligand/receptor binding so as to mediate intracellular responses, such as signal transduction.
- Transmembrane proteins that act as receptors, and possess a ligand binding extracellular portion exposed on a cell surface and an intracellular portion that interacts with other cellular components upon activation can be also be useful as transmembrane proteins to mediate intracellular responses, such as signal transduction.
- Other Proteins and Related Polypeptides are also be useful as transmembrane proteins to mediate intracellular responses, such as signal transduction.
- the invention also encompasses proteins and related polypeptides that are neither secreted proteins, nor transmembrane proteins. These polypeptides possess the functional domains and properties of their Pfam domains.
- DAGKcat diacylglycerol kinase catalytic domain
- integrase DNA binding domain
- rnaseH Pfam domain
- rve integrase core
- Integrase_Zn integr
- the present invention features an isolated polynucleotide that encodes a polypeptide.
- the polypeptide has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%), at least about 97%, at least about 98%, or at least about 99% amino acid sequence identity with an amino acid sequence derived from a polynucleotide sequence chosen from at least one nucleotide sequence according to SEQ ID NO: 1 - 123.
- the polypeptide has an amino acid sequence chosen from at least one amino acid sequence according to SEQ ID NO: 124 - 246.
- the polypeptide has at least one activity associated with the naturally occurring encoded polypeptide.
- the polypeptide includes a signal peptide.
- the polypeptide comprises a mature form of a protein, from which the signal peptide has been cleaved.
- the polypeptide is a signal peptide.
- the invention provides fragments of a polypeptide chosen from at least one amino acid sequence according to SEQ ID NO: 124 - 246, where each fragment is an extracellular fragment of the polypeptide, or an extracellular fragment of the polypeptide minus the signal peptide.
- the invention provides an N-terminal fragment containing a Pfam domain and a C-terminal fragment containing a Pfam domain and either or both may be biologically active.
- the polypeptides function as secreted proteins. In some embodiments, the polypeptides function as single-transmembrane proteins. In some embodiments, the polypeptides function as multiple-transmembrane proteins. In some embodiments, the polypeptides function as kinases, ligases, .
- nuclear hormone receptors phosphatase, proteases, phosphodiesterases, immunoglobulins, receptors, function as growth factors, cytokines, immune cells, antigens, GTPase activating proteins, binding proteins, ribosylation factors, glycosyltransferases, heat- shock proteins, membrane transport proteins, leucine zippers, zinc fingers, and/or embryonic stem cell-related peptides.
- the polypeptides function in pathological states. In some embodiments, the polypeptides function as one or more of these.
- the polypeptides function as serine proteases, band 7 proteins, nucleotide transferases, metalloproteases, cytochromes, SH3 -binding polypeptides, collagens, von Willebrand factor, dehydrogenases, pyridoxal-5 - phosphate-dependent enzymes, endopeptidases, transposases, and/or GTPases.
- the present invention features an isolated polynucleotide that hybridizes under stringent hybridization conditions to a coding region of at least one nucleotide sequence shown in SEQ ID NO: 1 - 123, or a complement thereof.
- the present invention features an isolated polynucleotide that shares at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%), at least about 95%, at least about 97%, at least about 98%, at least about 99% nucleotide sequence identity with a nucleotide sequence of the coding region of at least one sequence shown in SEQ ID NO: 1 - 732, or a complement thereof.
- a subject polynucleotide has the nucleotide sequence shown in at least one of SEQ ID NO: 1 - 732, or a coding region thereof.
- the present invention also features a vector, e.g., a recombinant vector, that includes a subject polynucleotide, and a promoter the drives its expression.
- This vector can transform a host cell, and the present invention further features such host cells, e.g., isolated in vitro host cells, and in vivo host cells, that comprise a polynucleotide of the invention, or a recombinant vector of the invention.
- the present invention further features a library of polynucleotides, wherein at least one of the polynucleotides comprises the sequence information of a polynucleotide of the invention.
- the library is provided on a nucleic acid array.
- the library is provided in computer- readable format.
- the present invention features a pair of isolated nucleic acid molecules, each from about 10 to about 200 nucleotides in length.
- the first nucleic acid molecule of the pair comprises a sequence of at least 10 contiguous nucleotides having 100% sequence identity to at least one nucleic acid sequence shown in SEQ ID NO: 1 - 123.
- the second nucleic acid molecule of the pair comprises a sequence of at least 10 contiguous nucleotides having 100% sequence identity to the reverse complement of at least one nucleic acid sequence shown in SEQ ID NO: 1 - 123.
- the sequence of said second nucleic acid molecule is located 3 'of the nucleic acid sequence of the first nucleic acid molecule shown in SEQ ID NO: 1 - 123.
- the pair of isolated nucleic acid molecules are useful in a polymerase chain reaction or in any other method known in the art to amplify a nucleic acid that has sequence identity to the sequences shown in SEQ ID NO: 1 - 123, particularly when cDNA is used as a template.
- the invention features a method of determining the presence of a polynucleotide substantially identical to a polynucleotide sequence shown in the Sequence Listing, or a complement of such a nucleotide by providing its complement, allowing the polynucleotides to interact, and determining whether such interaction has occurred.
- the invention further features methods of regulating the expression of the subject polynucleotides and encoded polypeptides.
- the invention provides a method of inhibiting transcription or translation of a first polynucleotide encoding a first polypeptide of the invention by providing a second polynucleotide that hybridizes to the first polynucleotide, and allowing the first polynucleotide to contact and bind to the second polynucleotide.
- the second polynucleotide can be chosen from an antisense molecule, a ribozyme, and an interfering RNA (RNAi) molecule.
- the present invention further features an isolated polypeptide, e.g., an isolated polypeptide encoded by a polynucleotide, and biologically active fragments of such polypeptide.
- the polypeptide is a fusion protein.
- the polypeptide has one or more amino acid substitutions, and/or insertions and/or deletions, compared with at least one sequence shown in SEQ ID NO: 124 - 246.
- the polypeptide has an amino acid sequence derived from at least one nucleotide sequence shown in SEQ ID NO: 1 - 123.
- the polypeptide has an amino acid sequence substantially identical to at least one sequence shown in SEQ ID NO: 124 - 246.
- the invention also provides a method of making a polypeptide of the invention by providing a nucleic acid molecule that comprises a polynucleotide sequence encoding a polypeptide of the invention, introducing the nucleic acid molecule into an expression system, and allowing the polypeptide to be produced.
- the method involves in vitro cell-free transcription and/or translation.
- the expression system can comprise a cell-free expression system, such as an E. coli system, a wheat germ extract system, a rabbit reticulocyte system, or a frog oocyte system.
- the expression system can comprise a prokaryotic or eukaryotic cell, for example, a bacterial cell expression system, a fungal cell expression system, such as yeast or Aspergillus, a plant cell expression system, e.g., a cereal plant, a tobacco plant, a tomato plant, or other edible plant, an insect cell expression system, such as SF9 of High Five cells, an amphibian cell expression system, a reptile cell expression system, a crustacean cell expression system, an avian cell expression system, a fish cell expression system, or a mammalian cell expression system, such as one using Chinese Hamster Ovary (CHO) cells.
- a prokaryotic or eukaryotic cell for example, a bacterial cell expression system, a fungal cell expression system, such as yeast or Aspergillus, a plant cell expression system, e.g., a cereal plant, a tobacco plant, a tomato plant, or other edible plant, an insect cell expression system, such as SF9 of High Five
- the method involves culturing a subject host cell under conditions such that the subject polypeptide is produced by the host cells; and recovering the subject polypeptide from the culture, e.g., from within the host cells, or from the culture medium.
- the polypeptide can be produced in vivo in a multicellular animal or plant, comprising a polynucleotide encoding the subject polypeptide.
- the present invention further features a non-human animal injected with at least one polynucleotide comprising at least one nucleotide sequence chosen from SEQ ID NO: 1 - 123, and/or at least one polypeptide comprising at least one amino acid sequence chosen form SEQ ID NO: 124 - 246.
- the present invention further features an antibody that specifically recognizes, binds to, interferes with, or modulates the biological activity of a subject polypeptide or a fragment thereof.
- the polypeptide can be a secreted protein, single- transmembrane protein, multiple-transmembrane protein, cytoplasmic protein or extracellular protein, or fragment thereof.
- the fragment can be an extracellular fragment of a subject polypeptide, or an extracellular fragment of a subject polypeptide minus the signal peptide.
- the present invention further features an antibody that specifically inhibits binding of a polypeptide to its ligand or substrate. It also features an antibody that specifically inhibits binding of a polypeptide as a substrate to another molecule.
- Another aspect of the present invention features a library of antibodies or fragments thereof, wherein at least one antibody or fragment thereof specifically binds to at least a portion of a polypeptide comprising an amino acid sequence according to SEQ ID NO: 124 - 246, and/or wherein at least one antibody or fragment thereof interferes with at least one activity of such polypeptide or fragment thereof.
- the antibody library comprises at least one antibody or fragment thereof that specifically inhibits binding of a subject polypeptide to its ligand or substrate, or that specifically inhibits binding of a subject polypeptide as a substrate to another molecule.
- the present invention also features corresponding polynucleotide libraries comprising at least one polynucleotide sequence that encodes an antibody or antibody fragment of the invention.
- the library is provided on a nucleic acid array or in computer-readable format.
- An antibody of the present invention may comprise a monoclonal antibody, polyclonal antibody, single chain antibody, intrabody, and active fragments of any of these.
- the active fragments include variable regions from either heavy chains or light chains.
- the antibody can comprise the backbone of a molecule with an immunoglobulin domain, e.g., a fibronectin backbone, a T-cell receptor backbone, or a CTLA4 backbone.
- the present invention further features a targeting antibody, a neutralizing antibody, a stabilizing antibody, an enhancing antibody, an antibody agonist, an antibody antagonist, an antibody that promotes cellular endocytosis of a target antigen, a cytotoxic antibody, and an antibody that mediates antibody dependent cellular cytotoxicity (ADCC).
- the antibody that mediates ADCC can have a cytotoxic component, e.g., a radioisotope, a radioactive molecule, a microbial toxin, a plant toxin, a chemotherapeutic agent, or a chemical substance, such as doxorubicin or cisplatin.
- the invention also features an inhibitory antibody, functioning to specifically inhibit the binding of a cognate polypeptide to its ligand or its substrate, or to specifically inhibit the binding of a cognate peptide as the substrate of another molecule.
- the antibodies of the present invention also encompass a human antibody, a non-human primate antibody, a monkey antibody, a non-primate animal antibody, e.g., a rodent antibody, rat antibody, a mouse antibody, a hamster antibody, a guinea pig antibody, a chicken antibody, a cattle antibody, a sheep antibody, a goat antibody, a horse antibody, porcine antibody, a cow antibody, a rabbit antibody, a cat antibody, or a dog antibody. It also features a humanized antibody, a primatized antibody, and a chimeric antibody.
- the antibodies of the invention can be produced in vitro or in vivo.
- the present invention features an antibody produced in a cell-free expression system, a prokaryote expression system or a eukaryote expression system, as described herein.
- the invention further provides a host cell that can produce an antibody of the invention or a fragment thereof.
- the antibody may also be secreted by the cell.
- the host cell can be a hybridoma, or a prokaryotic or eukaryotic cell.
- the invention also provides a bacteriophage or other virus particle comprising an antibody of the invention, or a fragment thereof.
- the bacteriophage or other virus particle may display the antibody or fragment thereof on its surface, and the bacteriophage itself may exist within a bacterial cell.
- the antibody may also comprise a fusion protein with a viral or bacteriophage protein.
- the invention further provides transgenic multicellular organisms, e.g., plants or non-human animals, as well as tissues or organs, comprising a polynucleotide sequence encoding a subject antibody or fragment thereof.
- the organism, tissues, or organs will generally comprise cells producing an antibody of the invention, or a fragment thereof.
- the present invention features a method of making an antibody by immunizing a host animal.
- a polypeptide or a fragment thereof, a polynucleotide encoding a polypeptide, or a polynucleotide encoding a fragment thereof is introduced into an animal in a sufficient amount to elicit the generation of antibodies specific to the polypeptide or fragment thereof, and the resulting antibodies are recovered from the animal.
- the polypeptide can be encoded by a nucleic acid molecule comprising a nucleotide sequence chosen from at least one polynucleotide sequence according to SEQ ID NO: 1 - 123.
- the polypeptide may comprise at least one amino acid sequence chosen from SEQ ID NO: 124 - 246.
- the invention thus also provides a non-human animal comprising an antibody of the invention.
- the animal can be a non-human primate, (e.g., a monkey) a rodent (e.g., a rat, a mouse, a hamster, a guinea pig), a chicken, cattle (e.g., a sheep, a goat, a horse, a pig, a cow), a rabbit, a cat, or a dog.
- a non-human primate e.g., a monkey
- rodent e.g., a rat, a mouse, a hamster, a guinea pig
- a chicken e.g., cattle (e.g., a sheep, a goat, a horse, a pig, a cow), a rabbit, a cat, or a dog.
- cattle e.g., a sheep, a goat, a horse, a pig, a cow
- the present invention also features a method of making an antibody by isolating a spleen from an animal injected with a polypeptide or a fragment thereof, a polynucleotide encoding a polypeptide, or a polynucleotide encoding a fragment thereof, and recovering antibodies from the spleen cells.
- Hybridomas can be made from the spleen cells, and hybridomas secreting specific antibodies can be selected.
- the present invention further features a method of making a polynucleotide library from spleen cells, and selecting a cDNA clone that produces specific antibodies, or fragments thereof.
- the cDNA clone or a fragment thereof can be expressed in an expression system that allows production of the antibody or a fragment thereof, as provided herein.
- the invention also provides a method for determining the presence or measuring the level of a polypeptide that specifically binds to an antibody of the invention. This method involves allowing the antibody to interact with a sample, and determining whether interaction between the antibody and any polypeptide in the sample has occurred. Antibodies that specifically bind to at least one subject polypeptide are useful in diagnostic assays, e.g., to detect the presence of a subject polypeptide. Similarly, the invention features a method of determining the presence of an antibody to a polypeptide of the invention, by providing the polypeptide, allowing the antibody and the polypeptide to interact, and determining whether interaction has occurred.
- the present invention further features a method of identifying an agent that modulates the level of a subject polypeptide (or an mRNA encoding a subject polypeptide) in a cell.
- the method generally involves contacting a cell (e.g., a eukaryotic cell) that produces the subject polypeptide with a test agent; and determining the effect, if any, of the test agent on the level of the polypeptide in the cell.
- a cell e.g., a eukaryotic cell
- the present invention further features a method of identifying an agent that modulates biological activity of a subject polypeptide.
- the methods generally involve contacting a subject polypeptide with a test agent; and determining the effect, if any, of the test agent on the activity of the polypeptide.
- the polypeptide is expressed on a cell surface.
- the agent or modulator is an antibody, for example, where an antibody binds to the polypeptide or affects its biological activity.
- the present invention further features biologically active agents (or modulators) identified using a method of the invention.
- the present invention also features a method of modulating biological activity using an agent selectable by the above methods.
- the method of modulating biological activity comprises contacting the agent with a first human or a non-human host cell, thereby modulating the activity of the first host cell or a second host cell.
- contacting the agent with the first human or non-human host cell results in the recruitment of a second host cell.
- the agent may be an antibody or antibody fragment of the invention.
- the modulation can comprise directly enhancing cell activity, indirectly enhancing cell activity, directly inhibiting cell activity, or indirectly inhibiting cell activity.
- the cell activity that is modulated can include transcription, translation, cell cycle control, signal transduction, intracellular trafficking, cell adhesion, cell mobility, proteolysis, ion transport, water transport, DNA repair, hydrolysis, lipase activity, polymerization using an RNA temple or a DNA template, and nuclease activity.
- the modulation can result in cell death or apoptosis, or inhibition of cell death or apoptosis, as well as cell growth, cell proliferation, or cell survival, or inhibition of cell growth, cell proliferation, or cell survival; as well as mucosal preservation, inhibition of eicosanoid synthesis, or resistance to infection by viruses.
- Either the first or the second host cell can be a human or a non- human host cell.
- Either the first or the second host cell can be an immune cell, e.g., a T cell, B cell, NK cell, dendritic cell, macrophage, muscle cell, stem cell, skin cell, fat cell, blood cell, brain cell, bone marrow cell, endothelial cell, retinal cell, bone cell, kidney cell, pancreatic cell, liver cell, spleen cell, prostate cell, cervical cell, ovarian cell, breast cell, lung cell, liver cell, soft tissue cell, colorectal cell, other cell of the gastrointestinal tract, or a cancer cell.
- an immune cell e.g., a T cell, B cell, NK cell, dendritic cell, macrophage, muscle cell, stem cell, skin cell, fat cell, blood cell, brain cell, bone marrow cell, endothelial cell, retinal cell, bone cell, kidney cell, pancreatic cell, liver cell, spleen cell
- the invention also provides a method of diagnosing cancer, proliferative, inflammatory, immune, viral, bacterial, or metabolic disorder in a patient, by allowing an antibody specific for a polypeptide of the invention to contact a patient sample, and detecting specific binding between the antibody and any antigen in the sample to determine whether the subject has cancer, proliferative, inflammatory, immune, viral, bacterial, or metabolic disorder.
- the invention further provides a method of diagnosing cancer, proliferative, inflammatory, immune, viral, bacterial, or metabolic disorder in a patient, by allowing a polypeptide of the invention to contact a patient sample, and detecting specific binding between the polypeptide and any interacting molecule in the sample to determine whether the subject has cancer, proliferative, inflammatory, immune, viral, bacterial, or metabolic disorder.
- the invention also features a method of providing a polynucleotide, a polypeptide, or an agent of the invention, such as an antibody, to a subject by oral, buccal, nasal, rectal, intraperitoneal, intradermal, transdermal, intratracheal, intrathecal, or parenteral administration, or otherwise by implantation or inhalation.
- a polynucleotide, polypeptide or agent can be administered intranasally, intravenously, intra-arterially, intracardiacally, subcutaneously, intraperitoneally, transdermally, intraventricularly, or intracranially.
- the invention also provides a method for formulating a polynucleotide, polypeptide, or modulator composition, such as an antibody composition, for delivery by any of the routes of administration provided above, for example, for treatment of disorders.
- a polynucleotide, polypeptide, or modulator composition such as an antibody composition
- the parenteral delivery can be via inhalation or implantation.
- the parenteral delivery can also be oral, intranasal, intraventricular, or intracranial.
- the present invention also features a pharmaceutical composition
- a pharmaceutical composition comprising a polynucleotide, polypeptide, or modulator of the invention and a carrier.
- the carrier can be a pharmaceutically acceptable carrier.
- the modulator can be obtainable by any methods of the invention, for example, the modulator can be an antibody or a fragment thereof.
- oral formulations, preparations for injection, aerosol formulations, and suppositories can be prepared, each comprising the polynucleotide, polypeptide, or modulator composition.
- nucleic acid compositions comprising polynucleotide sequences encoding the subject antibodies, or fragments thereof, can be prepared for administration to a subject.
- the invention also features a non-human animal injected with the polynucleotide, polypeptide, or modulator composition, for example the antibody composition.
- the animal can be a non-human primate, (e.g., a monkey) a rodent (e.g., a rat, a mouse, a hamster, a guinea pig), a chicken, cattle (e.g., a sheep, a goat, a horse, a pig, a cow), a rabbit, a cat, or a dog.
- the invention provides a method of treating a disorder in a subject needing or desiring such treatment, comprising administering a polynucleotide, polypeptide, or modulator of the invention to the subject.
- the subject can be a human or a non-human animal.
- the disorder can be cancer, proliferative, inflammatory, immune, metabolic, ulcerative, bacterial, or viral disorders.
- the method of treatment may comprise administering an antibody composition with a first antibody that specifically binds to a first epitope of a first polypeptide or a fragment thereof, or that interferes with at least one activity of the first polypeptide or a fragment thereof, wherein the first polypeptide is encoded by a nucleic acid molecule comprising a nucleotide sequence chosen from SEQ ID NO: 1 - 123, or any nucleic acid of the present invention.
- the first polypeptide may comprise an amino acid sequence chosen from SEQ ID NO: 124 - 1464.
- this method further comprises using a second antibody that binds specifically to or interferes with the activity of a second epitope of the first polypeptide or to a first epitope of a second polypeptide.
- the second polypeptide can be encoded by a nucleic acid molecule comprising a nucleotide sequence chosen from SEQ ID NO: 1 - 123, or any nucleic acid of the present invention.
- the second polypeptide may comprise an amino acid sequence chosen from SEQ ID NO: 124 - 246.
- the antibody binds, or interferes with the activity of, at least one polypeptide fragment, wherein the fragment is an extracellular fragment of the polypeptide, or an extracellular fragment of the polypeptide minus the signal peptide, for the treatment, for example, of proliferative disorders, such as cancer.
- the modulator may bind to a cell surface molecule that is over-expressed in the disorder.
- the modulator may be linked to an antibody of the invention.
- the antibody can be capable of initiating antibody dependent cell cytotoxicity, e.g., where the antibody is in turn coupled to cytotoxic agents. This method is applicable when the disorder is cancer, another proliferative disorder, inflammatory, immune, bone, CNS, bacterial, viral, or metabolic disorder, and the cell surface molecule is over-expressed in a cancer cell, diseased cell, or virus-infected cell.
- the cell surface molecule can be a single-transmembrane-related protein, a multiple-transmembrane-related protein, a secreted protein, a cytoplasmic protein, or an extracellular protein, that is over-expressed in cancer, proliferative, inflammatory, immune, bacterial, viral, or metabolic disorders.
- the invention also provides a method for prophylactic or therapeutic treatment of a subject needing or desiring such treatment by providing a vaccine, that can be administered to the subject.
- the vaccine may comprise one or more of a polynucleotide, polypeptide, or modulator of the invention, for example an antibody vaccine composition, a polypeptide vaccine composition, or a polynucleotide vaccine composition, useful for treating cancer, proliferative, inflammatory, immune, metabolic, bacterial, or viral disorders.
- the vaccine can be a cancer vaccine, and the polypeptide can concomitantly be a cancer antigen.
- the vaccine may be an anti- inflammatory vaccine, and the polypeptide can concomitantly be an inflammation- related antigen.
- the vaccine may be a viral vaccine, and the polypeptide can concomitantly be a viral antigen.
- the vaccine comprises a polypeptide fragment, comprising at least one extracellular fragment of a polypeptide of the invention, and/or at least one extracellular fragment of a polypeptide of the invention minus the signal peptide, for the treatment, for example, of proliferative disorders, such as cancer.
- the vaccine comprises a polynucleotide encoding one or more such fragments, administered for the treatment, for example, of proliferative disorders, such as cancer. Further, the vaccine can be administered with or without an adjuvant.
- the invention provides a method for gene therapy by providing a polynucleotide comprising a nucleic acid molecule encoding a polypeptide, such as an antibody of the invention, and administering the polynucleotide to a subject needing or desiring such treatment.
- kits comprising one or more of a polynucleotide, polypeptide, or modulator composition, such as an antibody composition, which may include instructions for its use.
- a polynucleotide, polypeptide, or modulator composition such as an antibody composition
- kits are useful in diagnostic applications, for example, to detect the presence and/or level of a polypeptide in a biological sample by specific antibody interaction.
- the invention provides novel polynucleotides, related novel polypeptides such as secreted polypeptides, transmembrane polypeptides, and other polypeptides, i.e., cytoplasmic and luminal polypeptides, and active fragments thereof, as well as novel nucleic acid compositions encoding these polypeptides, compositions comprising the related polypeptides, and methods for their use.
- related novel polypeptides such as secreted polypeptides, transmembrane polypeptides, and other polypeptides, i.e., cytoplasmic and luminal polypeptides, and active fragments thereof, as well as novel nucleic acid compositions encoding these polypeptides, compositions comprising the related polypeptides, and methods for their use.
- the present invention also provides for vectors, host cells, and methods for producing the polynucleotides and polypeptides of the invention in these vectors and host cells, and in cell-free systems.
- the present invention further provides for antisense molecules that are capable of regulating the expression of the polynucleotides or polypeptides herein.
- modulators including antibodies, that bind specifically to the polypeptides or modulate the activity of the polypeptides, are also provided.
- the present polynucleotides, polypeptides, and modulators find use in therapeutic agent screening/discovery applications, such as screening for receptors or competitive ligands, for use, for example, as small molecule therapeutic drugs. Also provided are methods of modulating a biological activity of a polypeptide and methods of treating associated disease conditions, particularly by administering modulators of the present polypeptides, such as small molecule modulators, antisense molecules, and specific antibodies.
- polypeptides, polynucleotides, and modulators find use in a number of diagnostic, prophylactic, and therapeutic applications.
- the polynucleotides and polypeptides of the invention can be detected by methods provided herein; these methods are useful in diagnosis, and can be accomplished by the use of diagnostic kits.
- polynucleotides and polypeptides of the invention are useful for treating a variety of disorders, including proliferative disorders such as cancer, inflammatory disorders such as ulcerative colitis, immune disorders such as autoimmune diseases, e.g., multiple sclerosis, diseases caused by infectious and parasitic microorganisms including, for example, bacteria, fungi, prions, or viruses, metabolic disorders such as diabetes and obesity, central nervous system disorders such as Alzheimer's and Parkinson's, and bone and cartilage disorders such as osteoporosis and achondroplasia (Braunwald et al, 2001).
- proliferative disorders such as cancer
- inflammatory disorders such as ulcerative colitis
- immune disorders such as autoimmune diseases, e.g., multiple sclerosis
- diseases caused by infectious and parasitic microorganisms including, for example, bacteria, fungi, prions, or viruses
- metabolic disorders such as diabetes and obesity
- central nervous system disorders such as Alzheimer's and Parkinson's
- bone and cartilage disorders such as osteoporos
- polynucleotides and polypeptides of the invention, and related compositions will inhibit or modulate the replication, differentiation, signaling, or other function of a pathologically important cell of the system involved in the disorder to be treated.
- a polynucleotide or polypeptide composition of the invention can treat an immune disorder by modulating the replication, differentiation, signaling, or other function of a pathologically important cell of the immune system, such as a B-lymphocyte, T-lymphocyte, mast cell, dendritic cell, macrophage, neutrophil, basophil, or eosinophil.
- therapeutic vaccines in the form of nucleic acid or polypeptide vaccines, such as cancer vaccines, where the vaccines can be administered alone, such as naked DNA, or can be facilitated, such as via viral vectors, microsomes, or liposomes.
- Therapeutic antibodies include those that are administered alone or in combination with cytotoxic agents, such as radioactive or chemotherapeutic agents.
- Each sequence shown in Tables 1-4 is identified by a Five Prime Therapeutics, Inc. (FP) identification number (FP ID).
- Table 1 correlates the Five Prime Therapeutics, Inc. identification number (FP ID) of each nucleotide and polypeptide with the Sequence Listing.
- Each FP ID corresponds to two SEQ ID NOS.
- the first, SEQ ID NO. (NI) corresponds to the nucleotide coding sequence that encodes the polypeptide of the invention.
- the second, SEQ ID NO. (PI) corresponds to the amino acid sequence of the polypeptide of the invention.
- SEQ ID NOS. 1-123 correspond to the NI coding sequences and SEQ ID NOS. 124-246 correspond to the PI polypeptide sequences.
- Table 2 specifies the result of the algorithm described above that predicts whether the claimed FP sequence is secreted (Tree Vote).
- the signal peptide coordinates (Signal Peptide Coords.) are listed in terms of the amino acid residues beginning with "1" at the N-terminus of the polypeptide.
- the Mature Protein Coords refer to the coordinates of the amino acid residues of the mature polypeptide after cleavage of the signal peptide.
- Table 2 also specifies the coordinates of an alternative fo ⁇ n of the mature protein (Alternate Mature Protein Coords.).
- transmembrane coordinates refer to the transmembrane segments of the molecule and are listed in terms of the amino acid residues beginning with "1 " at the N-terminus of the polypeptide.
- non-transmembrane coordinates refer to the amino acids that are not located in the membrane; these can include extracellular, cytoplasmic, and luminal sequences, and are listed in terms of the amino acid residues beginning with "1" at the N-terminus of the polypeptide.
- Table 3 specifies the predicted number of amino acid residues in each FP protein of the invention (Predicted Protein Length). Table 3 describes the characteristics of the protein in the public National Center for Information Biotechnology (NCBI) database displaying the greatest degree of similarity to each claimed sequence. The corresponding NCBI protein is described by its NCBI accession number (Top Hit Accession ID) and by the NCBI's annotation of that sequence (Top Hit Annotation). The percent identity of the Five Prime protein with the corresponding NCBI protein is listed (Top Hit %ID (relative to prediction)). The number of amino acids in this NCBI protein is specified (Length of Top Hit).
- Table 3 also describes the characteristics of the human protein in the NCBI database with the greatest degree of similarity to the claimed sequences.
- the corresponding NCBI protein is described by its NCBI accession number (Top Human Hit Accession ID), and by the NCBI's annotation of that sequence (Top Human Hit Annotation).
- the percent identity of the Five Prime protein with the NCBI protein is listed (Top Human Hit %ID (relative to prediction)).
- the number of amino acids in the NCBI protein is specified (Length of Top Human Hit).
- Table 4 lists the protein family or families (Pfam) of certain of the polypeptides of the invention. It also lists the coordinates at which each Pfam sequence can be found (Coordinates). Definitions
- Related sequences include nucleotide and amino acid sequences that are involved in the function of their referent.
- receptor-related sequences include all sequences that are involved in receptor function. This includes, but is not limited to, sequences that are involved in receptor synthesis, receptor regulation, receptor effector function, and receptor degradation.
- Related sequences also encompass complementary nucleic acid sequences, and biologically active fragments of nucleic acid and amino acid sequences.
- polynucleotide refers to polymeric forms of nucleotides of any length.
- the polynucleotides can contain deoxyribonucleotides, ribonucleotides, and/or their analogs or derivatives.
- nucleic acids can be naturally occurring DNA or RNA, or can be synthetic analogs, as known in the art.
- the terms also encompass genomic DNA, genes, gene fragments, exons, introns, regulatory sequences or regulatory elements (such as promoters, enhancers, initiation and termination regions, other control regions, expression regulatory factors, and expression controls), DNA comprising one or more single-nucleotide polymorphisms (SNPs), allelic variants, isolated DNA of any sequence, and cDNA.
- SNPs single-nucleotide polymorphisms
- allelic variants isolated DNA of any sequence
- cDNA cDNA.
- the terms also encompass mRNA, tRNA, rRNA, ribozymes, splice variants, antisense RNA, antisense conjugates, RNAi, and isolated RNA of any sequence.
- the terms also encompass recombinant polynucleotides, heterologous polynucleotides, branched polynucleotides, labeled polynucleotides, hybrid DNA/RNA, polynucleotide constructs, vectors comprising the subject nucleic acids, nucleic acid probes, primers, and primer pairs.
- the polynucleotides can comprise modified nucleic acid molecules, with alterations in the backbone, sugars, or heterocyclic bases, such as methylated nucleic acid molecules, peptide nucleic acids, and nucleic acid molecule analogs, which may be suitable as, for example, probes if they demonstrate superior stability and/or binding affinity under assay conditions.
- Analogs of purines and pyrimidines, including radiolabeled and fluorescent analogs, are known in the art.
- the polynucleotides can have any three-dimensional structure, and can perform any function, known or as yet unknown.
- the terms also encompass single-stranded, double-stranded and triple helical molecules that are either DNA, RNA, or hybrid DNA/RNA and that may encode a full-length gene or a biologically active fragment thereof.
- Biologically active fragments of polynucleotides can encode the polypeptides herein, as well as anti-sense and RNAi molecules.
- the full length polynucleotides herein may be treated with enzymes, such as Dicer, to generate a library of short RNAi fragments which are within the scope of the present invention.
- novel polynucleotides herein include those shown in the Tables, SEQ ID NO: 1 - 732, as well as those that encode the polypeptides of SEQ ID NO: 733 - 1464, and biologically active fragments thereof.
- the polynucleotides also include modified, labeled, and degenerate variants of the nucleic acid sequences, as well as nucleic acid sequences that are substantially similar or homologous to nucleic acids encoding the subject proteins.
- a "biologically active" entity, or an entity having "biological activity,” is one having structural, regulatory, or biochemical functions of a naturally occurring molecule or any function related to or associated with a metabolic or physiological process.
- Biologically active polynucleotide fragments are those exhibiting activity similar, but not necessarily identical, to an activity of a polynucleotide of the present invention.
- the biological activity can include an improved desired activity, or a decreased undesirable activity.
- an entity demonstrates biological activity when it participates in a molecular interaction with another molecule, or when it has therapeutic value in alleviating a disease condition, or when it has prophylactic value in inducing an immune response to the molecule, or when it has diagnostic value in determining the presence of the molecule, such as a biologically active fragment of a polynucleotide that can be detected as unique for the polynucleotide molecule, or that can be used as a primer in PCR.
- nucleic acid sequence refers to all nucleic acid sequences that can be directly translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from a reference nucleic acid sequence.
- gene or “genomic sequence” as used herein is an open reading frame encoding specific proteins and polypeptides, for example, an mRNA, cDNA, or genomic DNA, and also may or may not include intervening introns, or adjacent 5' and 3 'non-coding nucleotide sequences involved in the regulation of expression up to about 20 kb beyond the coding region, and possibly further in either direction.
- a gene can be introduced into an appropriate vector for extrachromosomal maintenance or for integration into a host genome.
- transgene as used herein is a nucleic acid sequence that is incorporated into a transgenic organism.
- a “transgene” can contain one or more transcriptional regulatory sequences, and other sequences, such as introns, that may be useful for expressing or secreting the nucleic acid or fusion protein it encodes.
- cDNA as used herein is intended to include all nucleic acids that share the sequence elements of mature mRNA species, where sequence elements are exons and 3' and 5 'non-coding regions. Generally, mRNA species have contiguous exons, the intervening introns having been removed by nuclear RNA splicing to create a continuous open reading frame encoding a protein.
- splice variant refers to all types of RNAs transcribed from a given gene that when processed collectively encode plural protein isoforms.
- alternative splicing and related terms refer to all types of RNA processing that lead to expression of plural protein isoforms from a single gene. Some genes are first transcribed as long mRNA precursors that are then shortened by a series of processing steps to produce the mature mRNA molecule. One of these steps is RNA splicing, in which the intron sequences are removed from the mRNA precursor. A cell can splice the primary transcript in different ways, making different "splice variants," and thereby making different polypeptide chains from the same gene, or from the same mRNA molecule. Splice variants can include, for example, exon insertions, exon extensions, exon truncations, exon deletions, alternatives in the 5 'untranslated region and alternatives in the 3' untranslated region.
- Oligonucleotide may generally refer to polynucleotides of between about 5 and about 100 nucleotides of single-or double-stranded nucleic acids. For the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also known as oligomers or oligos and can be. isolated from genes, or chemically synthesized by methods known in the art.
- Nucleic acid composition is a composition comprising a nucleic acid sequence, including one having an open reading frame that encodes a polypeptide and is capable, under appropriate conditions, of being expressed as a polypeptide.
- the term includes, for example, vectors, including plasmids, cosmids, viral vectors (e.g., retrovirus vectors such as lentivirus, adenovirus, and the like), human, yeast, bacterial, PI -derived artificial chromosomes (HAC's, YAC's, BAC's, PAC's, etc), and mini-chromosomes, in vitro host cells, in vivo host cells, tissues, organs, allogenic or congenic grafts or transplants, multicellular organisms, and chimeric, genetically modified, or transgenic animals comprising a subject nucleic acid sequence.
- vectors including plasmids, cosmids, viral vectors (e.g., retrovirus vectors such as lentivirus, a
- an "isolated,” “purified,” or “substantially isolated” polynucleotide, or a polynucleotide in “substantially pure form,” in “substantially purified form,” in “substantial purity,” or as an “isolate,” is one that is substantially free of the sequences with which it is associated in nature, or other nucleic acid sequences that do not include a sequence or fragment of the subject polynucleotides.
- substantially free is meant that less than about 90%, less than about 80%, less than about 70%, less than about 60%, or less than about 50% of the composition is made up of materials other than the isolated polynucleotide.
- the isolated polynucleotide is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or at least about 99%> free of the materials with which it is associated in nature.
- an isolated polynucleotide may be present in a composition wherein at least about 50%, at least about 60%), at least about 70%, at least about 80%, at least about 90%, at least about 95%o, at least about 97%, at least about 99% of the total macromolecules (for example, polypeptides, fragments thereof, polynucleotides, fragments thereof, lipids, polysaccharides, and oligosaccharides) in the composition is the isolated polynucleotide. Where at least about 99% of the total macromolecules is the isolated polynucleotide, the polynucleotide is at least about 99% pure, and the composition comprises less than about 1%» contaminant.
- the total macromolecules for example, polypeptides, fragments thereof, polynucleotides, fragments thereof, lipids, polysaccharides, and oligosaccharides
- an "isolated,” “purified” or “substantially isolated” polynucleotide, or a polynucleotide in “substantially pure form,” in “substantially purified form,” in “substantial purity,” or as an “isolate,” also refers to recombinant polynucleotides, modified, degenerate and homologous polynucleotides, and chemically synthesized polynucleotides, which, by virtue of origin or manipulation, are not associated with all or a portion of a polynucleotide with which it is associated in nature, are linked to a polynucleotide other than that to which it is linked in nature, or do not occur in nature.
- the subject polynucleotides are generally provided as other than on an intact chromosome, and recombinant embodiments are typically flanked by one or more nucleotides not normally associated with the subject polynucleotide on a naturally-occurring chromosome.
- polypeptide refers to a polymeric form of amino acids of any length, which can include naturally-occurring amino acids, coded and non-coded amino acids, chemically or biochemically modified, derivatized, or designer amino acids, amino acid analogs, peptidomimetics, and depsipeptides, and polypeptides having modified, cyclic, bicyclic, depsicyclic, or depsibicyclic peptide backbones.
- the term includes single chain protein as well as multimers.
- the term also includes conjugated proteins, fusion proteins, including, but not limited to, GST fusion proteins, fusion proteins with a heterologous amino acid sequence, fusion proteins with heterologous and homologous leader sequences, fusion proteins with or without N-terminal methionine residues, pegolyated proteins, and immunologically tagged proteins. Also included in this term are variations of naturally occurring proteins, where such variations are homologous or substantially similar to the naturally occurring protein, as well as corresponding homologs from different species. Variants of polypeptide sequences include insertions, additions, deletions, or substitutions compared with the subject polypeptides. The term also includes peptide aptamers.
- novel polypeptides herein include amino acid sequences encoded by an open reading frame (ORF) as shown in SEQ ID NO: 124 - 246, described in greater detail below, including the full length protein and fragments thereof, particularly biologically active fragments and/or fragments corresponding to functional domains, e.g., a signal peptide or leader sequence, an enzyme active site, including a cleavage site and an enzyme catalytic site, a domain for interaction with other protein(s), a domain for binding DNA, a regulatory domain, a consensus domain that is shared with other members of the same protein family, such as a kinase family or an immunoglobulin family; an extracellular domain that may act as a target for antibody production or that may be cleaved to become a soluble receptor or a ligand for a receptor; an intracellular fragment of a transmembrane protein that participates in signal transduction; a transmembrane domain of a transmembrane protein that may facilitate water or
- a “biologically active” entity, or an entity having “biological activity,” is one having structural, regulatory, or biochemical functions of a naturally occurring molecule or any function related to or associated with a metabolic or physiological process.
- Biologically active polypeptide fragments are those exhibiting activity similar, but not necessarily identical, to an activity of a polypeptide of the present invention.
- the biological activity can include an improved desired activity, or a decreased undesirable activity.
- an entity demonstrates biological activity when it participates in a molecular interaction with another molecule, or when it has therapeutic value in alleviating a disease condition, or when it has prophylactic value in inducing an immune response to the molecule, or when it has diagnostic value in determining the presence of the molecule.
- a biologically active polypeptide or fragment thereof includes one that can participate in a biological reaction, for example, as a transcription factor that combines with other transcription factors for initiation of transcription, or that can serve as an epitope or immunogen to stimulate an immune response, such as production of antibodies, or that can transport molecules into or out of cells, or that can perform a catalytic activity, for example polymerization or nuclease activity, or that can participate in signal transduction by binding to receptors, proteins, or nucleic acids, activating enzymes or substrates.
- a transcription factor that combines with other transcription factors for initiation of transcription, or that can serve as an epitope or immunogen to stimulate an immune response, such as production of antibodies, or that can transport molecules into or out of cells, or that can perform a catalytic activity, for example polymerization or nuclease activity, or that can participate in signal transduction by binding to receptors, proteins, or nucleic acids, activating enzymes or substrates.
- a “signal peptide,” or a “leader sequence,” comprises a sequence of amino acid residues, typically, at the N terminus of a polypeptide, which directs the intracellular trafficking of the polypeptide.
- Polypeptides that contain a signal peptide or leader sequence typically also contain a signal peptide or leader sequence cleavage site. Such polypeptides, after cleavage at the cleavage sites, generate mature polypeptides, for example, after extracellular secretion or after being directed to the appropriate intracellular compartment.
- Depsipeptides are compounds containing a sequence of at least two alpha-amino acids and at least one alpha-hydroxy carboxylic acid, which are bound through at least one normal peptide link and ester links, derived from the hydroxy carboxylic acids.
- Linear depsipeptides can comprise rings formed through S-S bridges, or through an hydroxy or a mercapto group of an hydroxy-, or mercapto- amino acid and the carboxyl group of another amino- or hydroxy-acid but do not comprise rings formed only through peptide or ester links derived from hydroxy carboxylic acids.
- Cyclic depsipeptides are peptides containing at least one ring formed only through peptide or ester links, derived from hydroxy carboxylic acids.
- an "isolated,” “purified,” or “substantially isolated” polypeptide, or a polypeptide in “substantially pure form,” in “substantially purified form,” in “substantial purity,” or as an “isolate,” is one that is substantially free of the materials with which it is associated in nature or other polypeptide sequences that do not include a sequence or fragment of the subject polypeptides.
- substantially free is meant that less than about 90%, less than about 80%, less than about 70%, less than about 60%), or less than about 50% of the composition is made up of materials other than the isolated polypeptide.
- the isolated polypeptide is at least about 50%), at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%>, or at least about 99% free of the materials with which it is associated in nature.
- an isolated polypeptide may be present in a composition wherein at least about 50%o, at least about 60%, at least about 70%, at least about 80%>, at least about 90%, at least about 95%, at least about 97%>, or at least about 99% of the total macromolecules (for example, polypeptides, fragments thereof, polynucleotides, fragments thereof, lipids, polysaccharides, and oligosaccharides) in the composition is the isolated polypeptide.
- the polypeptide is at least about 99%o pure, and the composition comprises less than about 1%> contaminant.
- an "isolated,” “purified,” or “substantially isolated” polypeptide, or a polypeptide in “substantially pure form,” in “substantially purified form,” in “substantial purity,” or as an “isolate,” also refers to recombinant polypeptides, modified, tagged and fusion polypeptides, and chemically synthesized polypeptides, which by virtue or origin or manipulation, are not associated with all or a portion of the materials with which they are associated in nature, are linked to molecules other than that to which they are linked in nature, or do not occur in nature.
- a hydrophobic polypeptide is a polypeptide having one or more hydrophobic domain. Hydrophobic polypeptides do not interact effectively with water; they are, in general, poorly soluble or insoluble in water. Hydrophobic domains comprise one or more amino acids that have aliphatic side chains, which are insoluble or only slightly soluble in water. Examples of hydrophobic polypeptides are alanine, valine, leucine, isoleucine, and methionine, which are nonpolar, and phenylalanine, tyrosine, and tryptophan, which have large, bulky aromatic side groups.
- bicyclic refers to a peptide with two ring closures formed by covalent linkages between amino acids.
- a covalent linkage between two nonadjacent amino acids constitutes a ring closure, as does a second covalent linkage between a pair of adjacent amino acids which are already linked by a covalent peptide linkage.
- the covalent linkages forming the ring closures can be amide linkages, i.e., the linkage formed between a free amino on one amino acid and a free carboxyl of a second amino acid, or linkages formed between the side chains or "R" groups of amino acids in the peptides.
- bicyclic peptides can be "true” bicyclic peptides, i.e., peptides cyclized by the formation of a peptide bond between the N-terminus and the C-terminus of the peptide, or they can be "depsi-bicyclic" peptides, i.e., peptides in which the terminal amino acids are covalently linked through their side chain moieties.
- Detection methods of the invention can be qualitative or quantitative.
- the terms “detection,” “identification,” “determination,” and the like refer to both qualitative and quantitative determinations, and include “measuring.”
- detection methods include methods for detecting the presence and/or level of polynucleotide or polypeptide in a biological sample, and methods for detecting the presence and/or level of biological activity of polynucleotide or polypeptide in a sample.
- array or “microarray” may be used interchangeably and refers to a collection of plural biological molecules such as nucleic acids, polypeptides, or antibodies, having locatable addresses that may be separately detectable.
- microarray encompasses use of sub microgram quantities of biological molecules.
- the biological molecules may be affixed to a substrate or may be in solution or suspension.
- the substrate can be porous or solid, planar or non-planar, unitary or distributed, such as a glass slide, a 96 well plate, with or without the use of microbeads or nanobeads.
- microarray includes all of the devices referred to as microarrays in Schena, 1999; Bassett et al., 1999; Bowtell, 1999; Brown and Botstein, 1999; Chakravarti, 1999; Cheung et al, 1999; Cole et al.j 1999; Collins, 1999; Debouck and Goodfellow, 1999; Duggan et al., 1999; Hacia, 1999; Lander, 1999; Lipshutz et al., 1999; Southern, et al., 1999; Schena, 2000; Brenner et al, 2000; Lander, 2001; Steinhaur et al., 2002; and Espejo et al, 2002.
- Nucleic acid microarrays include both oligonucleotide arrays (DNA chips) containing expressed sequence tags ("ESTs") and arrays of larger DNA sequences representing a plurality of genes bound to the substrate, either one of which can be used for hybridization studies.
- Protein and antibody microarrays include arrays of polypeptides or proteins, including but not limited to, polypeptides or proteins obtained by purification, fusion proteins, and antibodies, and can be used for specific binding studies (Zhu and Snyder, 2003; Houseman et al., 2002; Schaeferling et al., 2002; Weng et al., 2002; Winssinger et al., 2002; Zhu et al., 2001; Zhu et al. 2001; and MacBeath and Schreiber, 2000).
- a "nucleic acid hybridization reaction” is one in which single strands of DNA or RNA randomly collide with one another, and bind to each other only when their nucleotide sequences have some degree of complementarity.
- the solvent and temperature conditions can be varied in the reactions to modulate the extent to which the molecules can bind to one another.
- Hybridization reactions can be performed under different conditions of "stringency.”
- the "stringency” of a hybridization reaction as used herein refers to the conditions (e.g., solvent and temperature conditions) under which two nucleic acid strands will either pair or fail to pair to form a "hybrid" helix.
- T m is the temperature in degrees Celsius at which 50% of a polynucleotide duplex made of complementary strands of nucleic acids that are hydrogen bonded in an anti-parallel direction by Watson-Crick base pairing dissociate into single strands under conditions of the hybridization reaction.
- a "buffer” is a system that tends to resist change in pH when a given increment of hydrogen ion or hydroxide ion is added. Buffered solutions contain conjugate acid-base pairs. Any conventional buffer can be used with the inventions herein including but not limited to, for example, Tris, phosphate, imidazole, and bicarbonate.
- A"crystal is a solid of regular shape that forms when an element or compound forms slowly enough that the individual molecules occupy regular positions with respect to one another.
- a crystal structure is the configuration in which the atoms of a crystal are arranged.
- the crystal structure of a protein can affect its physical properties. Protein crystals can, in some instances, display biological activity, indicating that the protein have crystallized in their biologically active configuration. For example, enzyme crystals may display catalytic activity towards a substrate.
- a "library" of polynucleotides comprises a collection of sequence information of a plurality of polynucleotide sequences, which information is provided in either biochemical form (e.g., as a collection of polynucleotide molecules), or in electronic form (e.g., as a collection of polynucleotide sequences stored in a computer-readable form, as in a computer-based system, a computer data file, and/or as part of a computer program).
- a "library" of polypeptides comprises a collection of sequence information of a plurality of polypeptide sequences, which information is provided in, e.g., a collection of polypeptide sequences stored in a computer-readable form, as in a computer-based system, a computer data file, and/or as part of a computer program.
- Media refers to a manufacture, other than an isolated nucleic acid molecule, that contains the sequence information of the present invention. Such a manufacture provides the genome sequence or a subset thereof in a form that can be examined by means not directly applicable to the sequence as it exists in a nucleic acid, e.g., with computer-readable media comprising data storage structures. Such media include, but are not limited to: magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD- ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media.
- “Recorded” refers to a process for storing information on computer readable media, using any such methods as known in the art.
- a computer-based system refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention.
- the minimum hardware of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means.
- CPU central processing unit
- the data storage means can comprise any manufacture comprising a recording of the present sequence information as described above, or a memory access means that can access such a manufacture.
- Search means refers to one or more programs implemented on the computer-based system, to compare a target sequence or target structural motif, or expression levels of a polynucleotide in a sample, with the stored sequence information.
- a variety of known algorithms are publicly known and commercially available, e.g., MacPattern (EMBL), BLAST, BLASTN and BLASTX (NCBI), gapped BLAST, BLAZE, the Wise package, FASTX, Clustalw, FASTA, FASTA3, AlignO, TCoffee, BestFit, FastDB, and TeraBLAST (TimeLogic, Crystal Bay, Nevada).
- Search means can be used to identify fragments or regions of the genome that match a particular target sequence or target motif, for example, based on sequence similarity, for example, to identify open reading frames (ORFs) within the genome that contain homology to ORFs from other organisms.
- ORFs open reading frames
- sequence similarity means the exact match-up of two or more nucleotide sequences or two or more amino acid sequences, where the nucleotide or amino acids being compared are the same.
- similarity means the exact match-up of two or more nucleotide sequences or two or more amino acid sequences, where the nucleotide or amino acids being compared are either the same or possess similar chemical and/or physical properties.
- sequences can be aligned in a number of different ways and sequence similarity can be determined in a number of different ways.
- the bases or amino acid residues of one sequence can be aligned to a gap in the other sequence, or they can be aligned only to another base or amino acid residue in the other sequence.
- a gap can range anywhere from one nucleotide, base, or amino acid residue to multiple exons in length, up to any number of nucleotides or amino acid residues.
- sequences can be aligned such that nucleotides (or bases) align with nucleotides, nucleotides align with amino acid residues, or amino acid residues align with amino acid residues.
- a "target sequence” can be any polynucleotide or amino acid sequence of six or more contiguous nucleotides or two or more amino acids, for example, from about 5 or from about 10 to about 100 amino acids, or from about 15 or from about 30 to about 300 nucleotides.
- a variety of comparing means can be used to accomplish comparison of sequence information from a sample (e.g., to analyze target sequences, target motifs, or relative expression levels) with the data storage means.
- any one of the publicly available homology search programs can be used as the search means for the computer based systems of the present invention to accomplish comparison of target sequences and motifs.
- Computer programs to analyze expression levels in a sample and in controls are also known in the art.
- a "target sequence” includes an "antibody target sequence,” which refers to an amino acid sequence that can be used as an immunogen for injection into animals for production of antibodies or for screening against a phage display or antibody library for identification of binding partners.
- a "target structural motif,” or “target motif,” refers to any rationally selected sequence or combination of sequences in which the sequence(s) are chosen based on a three-dimensional configuration that is formed upon the folding of the target motif, or on consensus sequences of regulatory or active sites.
- target motifs include, but are not limited to, enzyme active sites and signal sequences.
- Nucleic acid target motifs include, but are not limited to, hairpin structures, promoter sequences, and other expression elements such as binding sites for transcription factors.
- a “matrix” is a geometric network of antibody molecules and their antigens, as found in immunoprecipitation and flocculation reactions. An antibody matrix can exist in solution or on a solid phase support.
- Antibody binding to such epitope on a polypeptide can be stronger than binding of the same antibody to any other epitopes, particularly other epitopes that can be present in molecules in association with, or in the same sample as the polypeptide of interest.
- adjusting the binding conditions can result in antibody binding almost exclusively to the specific epitope and not to any other epitopes on the same polypeptide, and not to any other polypeptide, which does not comprise the epitope.
- Antibodies that bind specifically to a subject polypeptide may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest). Such weak binding, or background binding, is readily discernible from the specific antibody binding to a subject polypeptide, e.g., by use of appropriate controls.
- antibodies of the invention bind to a specific polypeptide with a binding affinity of 10 "7 M or greater (e.g., 10 "8 M, 10 "9 M, 10 "10 , 10 "11 , etc.).
- host cell includes an individual cell, cell line, cell culture, or in vivo cell, which can be or has been a recipient of any polynucleotides or polypeptides of the invention, for example, a recombinant vector, an isolated polynucleotide, antibody or fusion protein.
- Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology, physiology, or in total DNA, RNA, or polypeptide complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change.
- Host cells can be prokaryotic or eukaryotic, including mammalian, insect, amphibian, reptile, crustacean, avian, fish, plant and fungal cells.
- a host cell includes cells transformed, transfected, transduced, or infected in vivo or in vitro with a polynucleotide of the invention, for example, a recombinant vector.
- a host cell which comprises a recombinant vector of the invention may be called a "recombinant host cell.”
- biological sample encompasses a variety of sample types obtained from an individual, including biological fluids such as blood, serum, plasma, urine, cerebrospinal fluid, tears, saliva, lymph, dialysis fluid, lavage fluid, semen, and other liquid samples or tissues of biological origin. It includes tissue samples and tissue cultures or cells derived therefrom and the progeny thereof, including cells in culture, cell supernatants, and cell lysates.
- tissue culture derived fluids tissue biopsy samples, tumor biopsy samples, stool samples, and fluids extracted from physiological tissues.
- Cells dissociated from solid tissues, tissue sections, and cell lysates are included.
- the definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as polynucleotides or polypeptides. Also included in the term are derivatives and fractions of biological samples.
- a biological sample can be used in a diagnostic, monitoring, or screening assay.
- the terms "individual,” “host,” “patient,” and “subject,” used interchangeably herein, refer to a mammal, including, but not limited to, murines, simians, humans, felines, canines, equines, bovines, porcines, ovines, caprines, mammalian farm animals, mammalian sport animals, and mammalian pets.
- mammals or “mammalian,” are used broadly to describe organisms which are within the class mammalia, including the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice, guinea pigs, and rats), and other mammals, including cattle, goats, sheep, cows, horses, rabbits, and pigs, and primates (e.g., humans, chimpanzees, and monkeys).
- carnivore e.g., dogs and cats
- rodentia e.g., mice, guinea pigs, and rats
- other mammals including cattle, goats, sheep, cows, horses, rabbits, and pigs, and primates (e.g., humans, chimpanzees, and monkeys).
- agent refers to a substance that binds to or modulates a level or activity of a subject polypeptide or a level of mRNA encoding a subject protein or nucleic acid, or that modulates the activity of a cell containing the subject protein or nucleic acid.
- agent modulates a level of mRNA encoding a subject protein
- agents include ribozymes, antisense, and RNAi molecules.
- agents include antibodies specific for the subject polypeptide, peptide aptamers, small molecules, agents that bind a ligand-binding site in a subject polypeptide, and the like.
- Antibody agents include antibodies that specifically bind a subject polypeptide and activate the polypeptide, such as receptor-ligand binding that initiates signal transduction; antibodies that specifically bind a subject polypeptide and inliibit binding of another molecule to the polypeptide, thus preventing activation of a signal transduction pathway; antibodies that bind a subject polypeptide to modulate transcription; antibodies that bind a subject polypeptide to modulate translation; as well as antibodies that bind a subject polypeptide on the surface of a cell to initiate antibody-dependent cytotoxicity ("ADCC”) or to initiate cell killing or cell growth.
- Small molecule agents include those that bind the polypeptide to modulate activity of the polypeptide or cell containing the polypeptide in a similar fashion.
- agent also refers to substances that modulate a condition or disorder associated with a subject polynucleotide or polypeptide. Such agents include subject polynucleotides themselves, subject polypeptides themselves, and the like. Agents may be chosen from amongst candidate agents, as defined below.
- Candidate agents can be small organic compounds having a molecular weight of more than about 50 and less than about 2,500 daltons.
- Candidate agents can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and can include at least an amine, carbonyl, hydroxyl or carboxyl group, and can contain at least two of the functional chemical groups.
- the candidate agents can comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
- Candidate agents are also found among biomolecules, including oligonucleotides, polynucleotides, and fragments thereof, depsipeptides, polypeptides and fragments thereof, oligosaccharides, polysaccharides and fragments thereof, lipids, fatty acids, steroids, purines, pyrimidines, derivatives thereof, structural analogs, modified nucleic acids, modified, derivatized or designer amino acids, or combinations thereof.
- an "agent which modulates a biological activity of a subject polypeptide” describes any substance, synthetic, semi-synthetic, or natural, organic or inorganic, small molecule or macromolecular, pharmaceutical or protein, with the capability of altering a biological activity of a subject polypeptide or of a fragment thereof, as described herein.
- a plurality of assay mixtures is run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
- one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
- the biological activity can be measured using any assay known in the art.
- An agent which modulates a biological activity of a subject polypeptide increases or decreases the activity at least about 10%, at least about 15%>, at least about 20%, at least about 25%, at least about 50%, at least about 100%, or at least about 2-fold, at least about 5-fold, or at least about 10-fold or more when compared to a suitable control.
- agonist refers to a substance that mimics the function of an active molecule.
- Agonists include, but are not limited to, drugs, hormones, antibodies, and neurotransmitters, as well as analogues and fragments thereof.
- Antagonist refers to a molecule that competes for the binding sites of an agonist, but does not induce an active response. Antagonists include, but are not limited to, drugs, hormones, antibodies, and neurotransmitters, as well as analogues and fragments thereof.
- receptor refers to a polypeptide that binds to a specific extracellular molecule and may initiate a cellular response.
- ligand refers to any molecule that binds to a specific site on another molecule.
- modulate encompasses an increase or a decrease, a stimulation, inhibition, or blockage in the measured activity when compared to a suitable control.
- Modulation of expression levels includes increasing the level and decreasing the level of an mRNA or polypeptide encoded by a polynucleotide of the invention when compared to a control lacking the agent being tested.
- agents of particular interest are those which inhibit a biological activity of a subject polypeptide, and/or which reduce a level of a subject polypeptide in a cell, and or which reduce a level of a subject mRNA in a cell and/or which reduce the release of a subject polypeptide from a eukaryotic cell.
- agents of interest are those that increase a biological activity of a subject polypeptide, and/or which increase a level of a subject polypeptide in a cell, and/or which increase a level of a subject mRNA in a cell and/or which increase the release of a subject polypeptide from a eukaryotic cell.
- An agent that "modulates the level of expression of a nucleic acid" in a cell is one that brings about an increase or decrease of at least about 1.25-fold, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, or more in the level (i.e., an amount) of mRNA and/or polypeptide following cell contact with a candidate agent compared to a control lacking the agent.
- Modulating a level of active subject polypeptide includes increasing or decreasing activity of a subject polypeptide; increasing or decreasing a level of active polypeptide protein; increasing or decreasing a level of mRNA encoding active subject polypeptide, and increasing or decreasing the release of subject polypeptide for a eukaryotic cell.
- an agent is a subject polypeptide, where the subject polypeptide itself is administered to an individual.
- an agent is an antibody specific for a subject polypeptide.
- an agent is a chemical compound such as a small molecule that may be useful as an orally available drug.
- Such modulation includes the recruitment of other molecules that directly effect the modulation.
- an antibody that modulates the activity of a subject polypeptide that is a receptor on a cell surface may bind to the receptor and fix complement, activating the complement cascade and resulting in lysis of the cell.
- over-expressed refers to a state wherein there exists any measurable increase over normal or baseline levels.
- a molecule that is over-expressed in a disorder is one that is manifest in a measurably higher level compared to levels in the absence of the disorder.
- a "stem cell” is a pluripotent or multipotent cell with the ability to self-renew, to remain undifferentiated, and to become differentiated. Stem cells can divide without limit, at least for the lifetime of the animal in which they naturally reside. Stem cells are not terminally differentiated, i.e., they are not at the end of a pathway of differentiation. When a stem cell divides, each daughter cell can either remain a stem cell or it can embark on a course that leads to terminal differentiation.
- An "embryonic stem cell” is a stem cell that is present in or isolated from an embryo.
- An “adult stem cell” is a stem cell that is present in or isolated from an adult. Either can be pluripotent, having the capacity to differentiate into each and every cell present in the organism, or multipotent, with the ability to differentiate into more than one cell type.
- Embryonic stem cells derived from the inner cell mass of the embryo can act as pluripotent cells when placed into host blastocysts.
- Adult stem cells are more frequently multipotent than pluripotent; examples of multipotent adult stem cells include hematopoeitic stem cells, peripheral nervous system stem cells, central nervous system stem cells, myogenic stem cells, and mesenchymal stem cells.
- a "mesenchymal stem cell” is an adult pluripotent stem cell progenitor of multiple mesenchymal lineages, including bone, cartilage, muscle, fat tissue, marrow stroma, and astrocytes.
- Mesenchyme is embryonic tissue of mesodermal origin, i.e., tissue that derives from the middle of three germ layers. The mesenchyme is populated by mesenchymal cells, which are typically stellate or fusiform in shape. The embryonic mesoderm gives rise to the musculoskeletal, blood, vascular, and urogenital systems, as well as connective tissue, i.e., the dermis.
- a "hematopoeitic” cell is a cell involved in the process of hematopoeisis, i.e., the process of forming mature red and white blood cells from precursor cells.
- hematopoeisis takes place in the bone marrow.
- hematopoeisis takes place at different sites during different stages of development; primitive blood cells arise in the yolk sac, and later, blood cells are formed in the liver, spleen, and bone marrow.
- Hematopoeisis undergoes complex regulation, including regulation by hormones, e.g., erythropoietin; growth factors, e.g., colony stimulating factors; and cytokines, e.g., interleukins. While the B- lymphocytic component of white blood cells matures in the bone marrow, the T- lymphocytic component of white blood cells matures in the thymus.
- hormones e.g., erythropoietin
- growth factors e.g., colony stimulating factors
- cytokines e.g., interleukins
- “Differentiation” is a progressive developmental change to a more specialized form or function.
- Cell differentiation is the process a cell undergoes as it matures to become an overtly specialized cell type. Differentiated cells have distinct characteristics, perform specific functions, and are less likely to divide than their less differentiated counterparts.
- An "undifferentiated” cell e.g., an immature, embryonic, or primitive cell, typically has a non-specific appearance, may perform multiple, nonspecific activities, and may perform poorly, if at all, in functions typically performed by differentiated cells.
- Dedifferentiation is a process by which a mature cell returns to a less mature state.
- a “dedifferentiated cell” is one that has fewer characteristics of differentiation than it possesses at an earlier point in time.
- a “dedifferentiated state” is one in which a mature cell has returned or is returning to a less differentiated state, e.g., as in some cancers.
- a “differentiation factor” is a factor that induces a cell to undergo a change in the direction of an overtly specialized cell type.
- An “anti-differentiation factor” is a factor that prevents or inhibits a cell from undergoing a change in the direction toward an overtly specialized cell type.
- a "co-factor” is a molecule that acts in concert with another substance to bring about certain effects.
- a "lymphokine” is a cytokine produced by a leukocyte, which acts upon another cell. Examples include interleukins, interferon-alpha, tumor necrosis factor-alpha, and granulocyte/monocyte colony-stimulating factor.
- an "anti-inflammatory molecule” is a molecule that can diminish, eliminate, or prevent a response to injury or infection.
- an antihistamine can counteract the effect of the inflammatory mediator histamine.
- an "anti-cancer molecule” is a molecule that can diminish, eliminate, or prevent the effects of cancer. It includes pharmaceuticals and antibodies.
- An "apoptotic molecule” is a molecule that induces a cell to move towards apoptosis, or programmed cell death. Normally functioning cells undergo apoptosis when their age or their state of health so dictates. Apoptosis is an active process requiring metabolic activity by the dying cell, often characterized by cleavage of the DNA into fragments. Cells that die by apoptosis do not generally elicit the inflammatory response associated with necrosis. Cancer cells do not typically undergo normal apoptosis.
- First and second therapeutic molecules working in "conjunction” means they work in association with one another to achieve a therapeutic effect.
- First and second heterologous nucleic acid sequences that "interact" with one another means they have an effect on one another such that one of the sequences influences the other. Either may act upon the other, or both may act upon each other.
- a "promoter” is a region of DNA that binds RNA polymerase before initiating the transcription of DNA into RNA.
- the nucleotide at which transcription begins is designated +1; nucleotides are numbered from this reference point. Negative numbers indicate upstream nucleotides and positive numbers indicate downstream nucleotides.
- the promoter directs the RNA polymerase to bind to DNA, to open the DNA helix, and to begin RNA synthesis. Some promoters are "constitutive,” and direct transcription in the absence of regulatory influences. Some promoters are “tissue specific,” and initiate transcription exclusively or selectively in one or a few tissue types. Some promoters are "inducible,” and effect gene transcription under the influence of an inducer. Induction can occur, e.g., as the result of a physiologic response, a response to outside signals, or as the result of artificial manipulation.
- a "knockout" mouse is a mouse in which a normal functional gene has been replaced by a non-functional form of the gene, and the function of that particular gene is eliminated. They are typically produced by transplanting embryonic stem cells heterozygous for a knockout mutation in a gene of interest and homozygous for a marker gene, e.g., black coat color into the blastocoel cavity of embryos that are homozygous for an alternate marker, e.g., white coat color. The early embryos then are implanted into a pseudopregnant female. Some of the resulting progeny are chimeras, indicated by the phenotype produced by the marker, e.g., a black and white coat.
- a marker gene e.g., black coat color
- Chimeric mice are backcrossed to mice with the alternate marker.
- Progeny from this mating that display the marker present in the mice with the gene of interest e.g., black coat
- Intercrossing these heterozygous mice produces mice homozygous for the disrupted allele, i.e., "knockout” mice (Capecchi, 1989).
- Gene "knockout” produces model systems for studying inherited human diseases, investigating the nature of genetic diseases and the efficacy of different types of treatment, and for developing effective gene therapies to cure these diseases.
- a "knockout" line of mutant mice homozygous for a null allele of the cystic fibrosis transmembrane regulator gene demonstrates symptoms similar to those of humans with cystic fibrosis. These mice provide a model system for studying this genetic disease and developing effective therapies.
- a "transgenic mouse” is a mouse that has stably incorporated one or more genes from another cell or organism and can pass them on to successive generations.
- Transgenic mice with an exogenous DNA sequence of interest integrated into its DNA are typically produced by injecting DNA containing a gene of interest into one of the two pronuclei (the male and female haploid nuclei contributed by the parents) of a fertilized mouse egg before they fuse.
- the injected DNA is randomly integrated into the chromosomes of the diploid zygote. Injected eggs then are transferred to foster mothers in which normal cell growth and differentiation occurs.
- Some of the progeny will contain the exogenous DNA, and breeding and backcrossing can produce pure transgenic strains homozygous for the transgene (Brinster et al., 1981).
- Transgenic mice are useful for studying various aspects of normal mammalian biology, and also provide a model system for studying disease processes. For example, many forms of cancer are promoted by normal cellular myc genes acting in a dominant fashion owing to their misregulated activity. Transgenic mice carrying the myc gene develop normally, and form tumors at a high frequency in a subset of cells that express the transgene.
- a "therapeutic factor" encoded by a first heterologous nucleic acid sequence of a modified mesenchymal cell is a factor, excluding a cell survival factor (Mangi et al, 2003; WO 03/073998), that is preventative, palliative, curative, or otherwise useful in treating or ameliorating, or preventing the recurrence of a disease, disorder, syndrome or condition, and is not an anti-cancer agent.
- Telomerase is a DNA polymerase enzyme that selectively elongates DNA from the telomere, i.e., the end of a chromosome.
- Telomeric DNA contains multiple, e.g., hundreds, of tandem repeats of a hexanucleotide sequence.
- One strand of telomeric DNA is G-rich at the 3' end, and slightly longer than the other strand.
- Telomeric DNA can form large duplex loops, wherein the single-stranded region at the very end of the structure loops back to form a DNA duplex with another part of the repeated sequence, displacing a part of the original telomeric duplex. This looplike structure is formed and stabilized by specific telomere-binding proteins. These structures protect and mask the end of the chromosome.
- the telomeric looplike structures are generated by telomerase.
- the telomerase enzyme contains an RNA molecule that serves as the template for elongating the G-rich strand of telomeric DNA. Thus, the enzyme carries the information necessary to generate the telomere sequences.
- Telomerases also have a protein component, which is related to reverse transcriptases. Telomerases can influence cell aging, and play a role in cellular cancer biology.
- TNF Tumor necrosis factor
- TNF Tumor necrosis factor
- TNF encompasses a family of receptor ligands that display pleiotropic effects on normal and malignant cells. Natural induction of TNF is protective, but its overproduction may be detrimental and even lethal to the host. TNF elicits a variety of responses in different cell types. TNF was originally characterized as an antitumor agent and a cytotoxic factor for malignant cells. It subverts the electron transport system of mitochondria to produce oxygen radicals, which can kill malignant cells lacking protective enzymes. TNF also plays a role in the defense against viral, bacterial, and parasitic infections, and in mediating autoimmune responses (Fiers, 1991). TNF inhibitors have been used to treat psoriasis (Weinberg and Saini, 2003).
- Treatment refers to obtaining a desired pharmacologic and/or physiologic effect, covering any treatment of a pathological condition or disorder in a mammal, including a human.
- the effect may be prophylactic in terms of completely or partially preventing a disorder or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disorder and/or adverse affect attributable to the disorder.
- treatment includes (1) preventing the disorder from occurring or recurring in a subject who may be predisposed to the disorder but has not yet been diagnosed as having it, (2) inhibiting the disorder, such as arresting its development, (3) stopping or terminating the disorder or at least symptoms associated therewith, so that the host no longer suffers from the disorder or its symptoms, such as causing regression of the disorder or its symptoms, for example, by restoring or repairing a lost, missing or defective function, or stimulating an inefficient process, or (4) relieving, alleviating, or ameliorating the disorder, or symptoms associated therewith, where ameliorating is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, such as inflammation, pain, and/or tumor size.
- a parameter such as inflammation, pain, and/or tumor size.
- a "pharmaceutically acceptable carrier,” “pharmaceutically acceptable diluent,” or “pharmaceutically acceptable excipient,” or “pharmaceutically acceptable vehicle,” used interchangeably herein, refer to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any conventional type.
- a pharmaceutically acceptable carrier is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- the carrier for a formulation containing polypeptides would not normally include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
- Suitable carriers include, but are not limited to, water, dextrose, glycerol, saline, ethanol, and combinations thereof.
- the carrier can contain additional agents such as wetting or emulsifying agents, pH buffering agents, or adjuvants which enhance the effectiveness of the formulation.
- Adjuvants of the invention include, but are not limited to Freunds's, Montanide ISA Adjuvants [Seppic, Paris, France], Ribi's Adjuvants (Ribi ImmunoChem Research, Inc., Hamilton, MT), Hunter's TiterMax (CytRx Corp., Norcross, GA), Aluminum Salt Adjuvants (Alhydrogel - Superfos of Denmark/ Accurate Chemical and Scientific Co., Westbury, NY), Nitrocellulose- Adsorbed Protein, Encapsulated Antigens, and Gerbu Adjuvant (Gerbu Biotechnik GmbH, Gaiberg, Germany/C-C Biotech, Poway, CA).
- Topical carriers include liquid petroleum, isopropyl palmitate, polyethylene glycol, ethanol (95%), polyoxyethylene monolaurate (5%) in water, or sodium lauryl sulfate (5%) in water.
- Other materials such as anti-oxidants, humectants, viscosity stabilizers, and similar agents can be added as necessary.
- Percutaneous penetration enhancers such as Azone can also be included.
- “Pharmaceutically acceptable salts” include the acid addition salts (formed with the free amino groups of the polypeptide) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, mandelic, oxalic, and tartaric. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, and histidine.
- inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, mandelic, oxalic, and tartaric.
- Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine
- compositions for oral administration can fonn solutions, suspensions, tablets, pills, capsules, sustained release formulations, oral rinses, or powders.
- unit dosage fonn refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of compounds of the present invention calculated in an "effective amount,” that is, a dosage sufficient to produce the desired result or effect in association with a pharmaceutically acceptable carrier.
- effective amount that is, a dosage sufficient to produce the desired result or effect in association with a pharmaceutically acceptable carrier.
- the specifications for the novel unit dosage forms of the present invention depend on the particular compound employed, the host, and the effect to be achieved, as well as the pharmacodynamics associated with each compound in the host.
- the present invention provides novel isolated polynucleotides encoding polypeptides and fragments thereof.
- the present invention also provides novel isolated polypeptides, fragments thereof, and compositions comprising same.
- the present invention further provides polynucleotide compositions that can be used to identify the polypeptides.
- the present invention provides recombinant vectors and host cells for use in gene expression, primer pairs for use in hybridizations, computer-based embodiments for use in bioinformatics, and transgenic animals and embryonic stem cell lines for use in mutating and regulating gene expression.
- This invention provides genes encoding proteins, the encoded proteins, and fragments and homologs thereof. It provides human polynucleotide sequences and the conesponding mouse polynucleotide sequences.
- the nucleic acids of the subject invention can encode all or a part of the subject proteins. Double or single stranded fragments can be obtained from the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, for example by restriction enzyme digestion or polymerase chain reaction (PCR) amplification.
- PCR polymerase chain reaction
- the use of the polymerase chain reaction has been described (Saiki et al., 1985) and cunent techniques have been reviewed (Sambrook et al., 1989; McPherson et al. 2000; Dieffenbach and Dveksler, 1995).
- DNA fragments will be of at least about 5 nucleotides, at least about 8 nucleotides, at least about 10 nucleotides, at least about 15 nucleotides, at least about 18 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, or at least about 50 nucleotides, at least about 75 nucleotides, or at least about 100 nucleotides.
- Nucleic acid compositions that encode at least six contiguous amino acids i.e., fragments of 18 nucleotides or more
- nucleic acid compositions encoding at least 8 contiguous amino acids are useful in directing the expression or the synthesis of peptides that can be used as immunogens (Lerner, 1982; Shinnick et al., 1983; Sutcliffe et al., 1983).
- a polynucleotide of the invention comprises a nucleotide sequence of at least about 5, at least about 8, at least about 10, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1000, at least about 1100, at least about 1200, at least about 1300, at least about 1400, at least about 1500, at least about 1600, at least about 1700, at least about 1800, at least about 1900, at least about 2000, at least about 2100, at least about 2200, at least about 2300, at least about 2400, at least about
- a polynucleotide of the invention has at least about 85%), at least about 90%, at least about 95%), at least about 96%, at least about 97%), at least about 98%, or at least about 99% nucleotide sequence identity with a nucleotide sequence, or a fragment thereof, of the coding region of any one of the sequences shown in SEQ ID NO: 1 - 732, or a complement thereof.
- sequence variants include naturally-occurring variants (e.g., SNPs, allelic variants, and homologs from other species), degenerate variants, variants associated with disease or pathological states, and variants resulting from random or directed mutagenesis, as well as from chemical or other modification.
- naturally-occurring variants e.g., SNPs, allelic variants, and homologs from other species
- degenerate variants e.g., SNPs, allelic variants, and homologs from other species
- variants associated with disease or pathological states e.g., allelic variants, and homologs from other species
- variants resulting from random or directed mutagenesis e.g., random or directed mutagenesis
- a polynucleotide of the invention comprises a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence of at least about 5, at least about 8, at least about 10, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1000 contiguous amino acids of at least one of the sequences shown in SEQ ID NO: 124-246 (e.g., a polypeptide encoded by at least one of the nucleotide sequences shown in SEQ ID NO: 1 - 123), up to and
- the present invention includes the present polynucleotide selected from SEQ ID NO: 1 - 123, which contain 300 bp of 5' terminus of a protein encoding polynucleotide sequence. Such a polynucleotide is useful for the purposes of clustering gene sequences to determine gene family.
- a polynucleotide of the invention hybridizes under stringent hybridization conditions to a polynucleotide having the coding region of any one of the sequences shown in SEQ ID NO: 1 - 123, or a complement thereof.
- polynucleotides of the invention include those that encode variants of the polypeptide sequences encoded by the polynucleotides of the Sequence Listing.
- these polynucleotides encode variant polypeptides that include insertions, additions, deletions, or substitutions compared with the polypeptides encoded by the nucleotide sequences shown in SEQ ID NO: 1 - 732.
- Conservative amino acid substitutions include serine/threonine, valine/leucine/isoleucine, asparagine/histidine/glutamine, glutamic acid/aspartic acid, etc. (Gonnet et al., 1992).
- nucleic acids of the invention include degenerate variants that can be translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from the nucleic acid sequences herein.
- synonymous codons include GGG, GGA, GGC, and GGU, each encoding glycine.
- the nucleic acids of the invention include single nucleotide polymorphisms (SNPs), which occur frequently in eukaryotic genomes (Lander, et al. 2001).
- SNPs single nucleotide polymorphisms
- the nucleotide sequence determined from one individual of a species can differ from other allelic forms present within the population.
- the nucleic acids of the invention include homologs of the polynucleotides.
- the source of homologous genes can be any species, e.g., primate species, particularly human; rodents, such as rats, hamsters, guinea pigs, and mice; rabbits, canines, felines; catties, such as bovines, goats, pigs, sheep, equines, crustaceans, birds, chickens, reptiles, amphibians, fish, insects, plants, fungi, yeast, nematodes, etc.
- homologs Among mammalian species, e.g., human and mouse, homologs have substantial sequence similarity, e.g., at least about 60%> sequence identity, at least about 75%o sequence identity, or at least about 80% sequence identity among nucleotide sequences. In many embodiments of interest, homology will be at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%o, at least about 98%>, where in certain embodiments of interest homology will be as high as about 99%.
- nucleic acids including alterations in the backbone, sugars or heterocyclic bases, have been shown to increase intracellular stability and binding affinity.
- backbone chemistry phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates.
- Achiral phosphate derivatives include 3 -0 -5'-S-phosphorothioate, 3 -S-5 -O- phosphorothioate, 3'-CH 2 -5 -O-phosphonate and 3 -NH-5 -O-phosphoroamidate.
- Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage.
- Sugar modifications are also used to enhance stability and affinity.
- the ⁇ -anomer of deoxyribose can be used, where the base is inverted with respect to the natural ⁇ -anomer.
- the 2 -OH of the ribose sugar can be altered to form 2 -O- methyl or 2 -O-allyl sugars, which provides resistance to degradation without comprising affinity.
- a genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It can further include the 3 ' and 5 ' untranslated regions found in the mature mRNA. It can further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, about 2 kb, and possibly more, of flanking genomic DNA at either the 5 'or 3' end of the transcribed region.
- the genomic DNA can be isolated as a fragment of 100 kbp or smaller; and substantially free of flanking chromosomal sequence.
- the genomic DNA flanking the coding region, either 3 'or 5', or internal regulatory sequences as sometimes found in introns contains sequences required for proper tissue and stage specific expression.
- Nucleic acid molecules of the invention can comprise heterologous nucleic acid molecules, i.e., nucleic acid molecules other than the subject nucleic acid molecules, of any length.
- the subject nucleic acid molecules can be flanked on the 5 ' and/or 3 ' ends by heterologous nucleic acid molecules of from about 1 nucleotide to about 10 nucleotides, from about 10 nucleotides to about 20 nucleotides, from about 20 nucleotides to about 50 nucleotides, from about 50 nucleotides to about 100 nucleotides, from about 100 nucleotides to about 250 nucleotides, from about 250 nucleotides to about 500 nucleotides, or from about 500 nucleotides to about 1000 nucleotides, or more in length.
- the subject polynucleotides include those that encode fusion proteins comprising the subject polypeptides fused to "fusion partners."
- the present soluble receptor or ligand can be fused to an immunoglobulin fragment, such as an Fc fragment for stability in circulation or to fix complement.
- an immunoglobulin fragment such as an Fc fragment for stability in circulation or to fix complement.
- Other polypeptide fragments that have equivalent capabilities as the Fc fragments can also be used herein.
- the isolated nucleic acids of the invention can be used as probes to detect and characterize gross alteration in a genomic locus, such as deletions, insertions, translocations, and duplications, e.g., applying fluorescence in situ hybridization (FISH) techniques to examine chromosome spreads (Andreeff et al., 1999).
- FISH fluorescence in situ hybridization
- the nucleic acids are also useful for detecting smaller genomic alterations, such as deletions, insertions, additions, translocations, and substitutions (e.g., SNPs).
- nucleic acid molecules When used as probes to detect nucleic acid molecules capable of hybridizing with nucleic acids described in the Sequence Listing, the nucleic acid molecules can be flanked by heterologous sequences of any length.
- a subject nucleic acid can include nucleotide analogs that incorporate labels that are directly detectable, such as radiolabels or fluorophores, or nucleotide analogs that incorporate labels that can be visualized in a subsequent reaction, such as biotin or various haptens. Haptens that are commonly conjugated to nucleotides for subsequent labeling include biotin, digoxigenin, and dinitrophenyl.
- Suitable fluorescent labels include fluorochromes e.g., fluorescein and its derivatives, e.g., fluorescein isothiocyanate (FITC6-carboxyfluorescein (6- FAM), 2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE), ), 6-carboxy- 2',4',7',4,7-hexachlorofluorescein (HEX), 5 -carboxy fluorescein (5-FAM); coumarin and its derivatives, e.g., 7-amino-4-methylcoumarin, aminocoumarin; bodipy dyes, such as Bodipy FL; cascade blue; Oregon green; rhodamine dyes, e.g., rhodamine, 6- carboxy-X-rhodamine (ROX), Texas red, phycoerythrin, and tetramethylrhodamine; eos
- Fluorescent labels also include a green fluorescent protein (GFP), i.e., a "humanized” version of a GFP, e.g., wherein codons of the naturally-occurring nucleotide sequence are changed to more closely match human codon bias; a GFP derived from Aequoria victoria or a derivative thereof, e.g., a "humanized” derivative such as Enhanced GFP, which are available commercially, e.g., from Clontech, Inc.; other fluorescent mutants of a GFP from Aequoria victoria, e.g., as described in U.S. Patent No.
- GFP green fluorescent protein
- Probes can also contain fluorescent analogs, including commercially available fluorescent nucleotide analogs that can readily be incorporated into a subject nucleic acid. These include deoxyribonucleotides and/or ribonucleotide analogs labeled with Cy3, Cy5, Texas Red, Alexa Fluor dyes, rhodamine, cascade blue, or BODIPY, and the like.
- Suitable radioactive labels include, e.g., 32 P, 35 S, or 3 H.
- probes can contain radiolabeled analogs, including those commonly labeled with 32 P or 35 S, such as ⁇ - 32 P-dATP, -dTTP, -dCTP, and dGTP; ⁇ - 35 S-GTP and ⁇ - 35 S- dATP, and the like.
- Nucleic acids of the invention can also be bound to a substrate.
- Subject nucleic acids can be attached covalently, attached to a surface of the support or applied to a derivatized surface in a chaotropic agent that facilitates denaturation and adherence, e.g., by noncovalent interactions, or some combination thereof.
- the nucleic acids can be bound to a substrate to which a plurality of other nucleic acids are concunently bound, hybridization to each of the plurality of the bound nucleic acids being separately detectable.
- the substrate can be porous or solid, planar or non-planar, unitary or distributed; and the bond between the nucleic acid and the substrate can be covalent or non-covalent.
- the substrate can be in the fonn of microbeads or nanobeads.
- Substrates include, but are not limited to, a membrane, such as nitrocellulose, nylon, positively-charged derivatized nylon; a solid substrate such as glass, amorphous silicon, crystalline silicon, plastics (including e.g., polymethylacrylic, polyethylene, polypropylene, polyacrylate, polymethylmethacrylate, polyvinylchloride, polytetrafluoroethylene, polystyrene, polycarbonate, polyacetal, polysulfone, cellulose acetate, or mixtures thereof).
- a membrane such as nitrocellulose, nylon, positively-charged derivatized nylon
- a solid substrate such as glass, amorphous silicon, crystalline silicon
- plastics including e.g., polymethylacrylic, polyethylene, polypropylene, polyacrylate, polymethylmethacrylate, polyvinylchloride, polytetrafluoroethylene, polystyrene, polycarbonate, polyacetal, polysulfone, cellulose acetate,
- the subject nucleic acids include antisense RNA, ribozymes, and RNAi. Further, The nucleic acids of the invention can be used for antisense or RNAi inhibition of transcription or translation using methods known in the art (Phillips, 1999a; Phillips, 1999b; Hartmann et al, 1999; Stein et al., 1998; Agrawal et al., 1998).
- the instant invention further provides host cells, e.g., recombinant host cells, that comprise a subject nucleic acid, host cells that comprise a recombinant vector, and host cells that secrete antibodies of the invention.
- Subject host cells can be cultured in vitro, or can be part of a multicellular organism. Host cells are described in more detail below.
- the instant invention further provides transgenic plants and non-human animals, as described in more detail below.
- the subject nucleic acids find use in the preparation of all or a portion of the polypeptides of the subject invention, as described above, using an expression system.
- an expression vector can be employed.
- the expression vector will provide a transcriptional and translational initiation region, which may be inducible, conditionally-active, or constitutive, or tissue-specific, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region.
- These control regions can be native to a gene encoding the subject peptides, or can be derived from heterologous or exogenous sources.
- the subject nucleic acids can also be provided as part of a vector (e.g., a polynucleotide construct comprising an expression cassette), a wide variety of which are known in the art.
- Vectors include, but are not limited to, plasmids; cosmids; viral vectors; human, yeast, bacterial, PI -derived artificial chromosomes (HAC's, YAC's, BAC's, PAC's, etc.), mini-chromosomes, and the like.
- Vectors are amply described in numerous publications well known to those in the art (Ausubel, et al.; Jones et al., 1998a; Jones et al., 1998b).
- Vectors can provide for nucleic acid expression, for nucleic acid propagation, or both.
- a recombinant vector or construct that includes a nucleic acid of the invention is useful for propagating a nucleic acid in a host cell; such vectors are known as "cloning vectors.”
- Vectors can transfer nucleic acid between host cells derived from disparate organisms; these are known in the art as “shuttle vectors.”
- Vectors can also insert a subject nucleic acid into a host cell's chromosome; these are known in the art as “insertion vectors.”
- Vectors can express either sense or antisense RNA transcripts of the invention in vitro (e.g., in a cell-free system or within an in vitro cultured host cell) or in vivo (e.g., in a multicellular plant or animal); these are known in the art as "expression vectors," which can be part of an expression system. Expression vectors can also produce a subject antibody.
- Vectors typically include at least one origin of replication, at least one site for insertion of heterologous nucleic acid (e.g., in the form of a polylinker with multiple, tightly clustered, single cutting restriction endonuclease recognition sites), and at least one selectable marker, although some integrative vectors will lack an origin that is functional in the host to be chromosomally modified, and some vectors will lack selectable markers.
- Vectors are transiently or stably be maintained in the cells, usually for a period of at least about one day, at least about several days to at least about several weeks.
- Promoters of the invention can be naturally contiguous or not naturally contiguous to the expressed nucleic acid molecule.
- the promoters can be inducible, conditionally active (such as the cre-lox promoter), constitutive, and/or tissue specific.
- the DNA of interest Prior to vector insertion, the DNA of interest will be obtained substantially free of other nucleic acid sequences.
- the DNA can be "recombinant,” and flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.
- Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous protein or RNA molecules.
- a selectable marker operative in the expression system or host can be present.
- Expression vectors can be used for the production of fusion proteins, where the fusion peptide provides additional functionality, i.e., increased protein synthesis, a leader sequence for secretion, stability, reactivity with defined antisera, or an enzyme marker, e.g., ⁇ -galactosidase.
- Expression vectors can be prepared comprising a transcription cassette comprising a transcription initiation region, the gene or fragment thereof, and a transcriptional termination region.
- DNA sequences that allow for the expression of functional epitopes or domains, at least about 5, at least about 8, at least about 10, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1000 amino acids in length, or any of the above-described fragments, up to and including the complete open reading frame of the gene.
- the cells containing the vector construct can be selected
- Host cells can comprise prokaryotes or eukaryotes that express proteins and polypeptides in accordance with conventional methods, the method depending on the purpose for expression.
- a unicellular organism such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, particularly mammals, e.g., COS 7 cells, can be used as the expression host cells.
- Specific expression systems of interest include plants, bacteria, yeast, insect cells, and mammalian cell-derived expression systems.
- Expression systems in plants include those described in U.S. Patent No. 6,096,546 and U.S. Patent No. 6,127,145.
- Expression systems in bacteria include those described by Chang et al., 1978; Goeddel et al., 1979; Goeddel et al., 1980; EP 0 036,776; U.S. Patent No. 4,551,433; DeBoer et al., 1983); and Siebenlist et al, 1980.
- Expression systems in yeast include those described by Hinnen et al., 1978; Ito et al., 1983; Kurtz et al., 1986; Kunze et al., 1985; Gleeson et al., 1986; Roggenkamp et al., 1986; Das et al., 1984; De Louvencourt et al., 1983; Van den Berg et al., 1990; Kunze et al., 1985; Cregg et al., 1985; U.S. Patent Nos.
- the insect cell expression system is useful not only for production of heterologous proteins intracellularly, but can be used for expression of transmembrane proteins on the insect cell surfaces.
- Such insect cells can be used as immunogen for production of antibodies, for example, by injection of the insect cells into mice or rabbits or other suitable animals, for production of antibodies.
- Mammalian expression systems include those described in Dijkema et al., 1985; Gonnan et al., 1982; Boshart et al., 1985; and U.S. Patent No. 4,399,216. Additional features of mammalian expression are facilitated as described in Ham and Wallace, 1979; Barnes and Sato, 1980 U.S. Patent Nos. 4,767,704, 4,657,866, 4,927,762, 4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985. Mammalian cell expression systems can also be used for production of antibodies.
- Cell-free systems can be also used to express the polypeptides of the invention.
- Cell-free systems of fractionated cell homogenates comprising the protein synthetic machinery, including ribosomes, transfer RNA and enzymatic components of the machinery, are routinely used by those of skill in the art to express polypeptides of interest.
- Isolated mRNA and DNA e.g., a gene cloned into a plasmid vector, or a PCR-generated DNA template, are examples of nucleic acids suitable as templates for expressing polypeptides in cell-free systems.
- the polypeptides can be expressed in bacterial systems, e.g., E.
- coli lysate rabbit reticulocyte lysate system, wheat germ extract system, frog oocyte lysate system, and the like which is conventional in the art. See, for example, WO 00/68412, WO 01/27260, WO 02/24939, WO 02/38790, WO 91/02076, and WO 91/02075.
- Wheat embryo and wheat germ (which is dried wheat embryo), and reticulo-lysate extract cell-free systems are eukaryotic, and, as such, are suitable for expressing eukaryotic proteins, as described in WO 00/68412, WO 01/27260, WO 02/08443, WO 02/095377, WO 02/18586, and WO 02/24939. They have the advantages of low cost, easy availability in large amounts, and the capacity to synthesize high-molecular weight polypeptides (Madin et al., 2000).
- the wheat embryo can be treated to substantially eliminate endogenous protein synthesis inhibitors, improving the synthetic capacity of the system (Madin et al., 2000; WO 00/68412).
- the robustness of the wheat germ cell-free system can be enhanced by the addition of an energy regenerating system, including an energy source (Madin et al., 2000; WO 00/68412).
- Recombinant genes encoding hydrophobic proteins of interest can be expressed in cell-free systems, e.g., wheat germ, E. coli, or rabbit reticulocyte lysates.
- Cell-free lysates can be prepared from wheat germ or wheat embryos by the methods of Doi et al., 2003; Miyamoto-Sato et al., 2003; Morita et al, 2003; WO 02/38790, WO 02/24939, Sawasaki et al., 2002a; Sawasaki et al., 2002b; WO 01/27260, WO 00/68412, Madin et al., 2000; Sawasaki et al., 2000; and/or ⁇ rickson and Blobel, 1983.
- Cell-free lysates can be prepared from E. coli by the methods of Chang et al., 1978; Goeddel et al., 1979; ⁇ P 0 036,776; U.S. Patent No. 4,551,433; DeBoer et al., 1983; and Siebenlist et al., 1980.
- Cell-free lysates can be prepared from rabbit reticulocytes by the methods of Dijkema et al., 1985; Gonnan et al., 1982; Boshart et al., 1985; and U.S. Patent No. 4,399,216. Additional features of mammalian expression are facilitated as described in Ham and McKeehan, 1979; Barnes and Sato, 1980; U.S. Patent Nos. 4,767,704, 4,657,866, 4,927,762, 4,560,655; WO 90/103430; WO 87/00195; and U.S. RE 30,985.
- the translation efficiency of a cell- free expression system is dependent in part on the translation efficiency of the mRNA.
- the efficiency of the mRNA employed in a wheat germ cell-free expression system was shown to be increased by constructing a plasmid with a template DNA for transcribing a protein translational template mRNA with high translation efficiency.
- the plasmid includes non-translated template DNA at the 5 ' and 3 ' ends of the mRNA template, improving the efficiency of translation of the mRNA sequence of interest (WO 01/27260; Madin et al., 2000).
- the translation efficiency of a cell-free expression system is also dependent in part on the availability of a continuous energy source.
- the robustness of a conventional wheat genn cell-free expression system was improved by supplying substrate molecules and energy sources, i.e., ATP or GTP to the reaction by allowing their free diffusion into the expression system, and by removing the by-products of the reaction from the expression system (WO 02/24939; Madin et al., 2000).
- Membrane proteins are commonly amphipathic molecules that have hydrophilic as well as hydrophobic, e.g., membrane spanning, regions. They may pose difficulties in studying with traditional methods because of their hydrophobic domains. Transmembrane and membrane-associated proteins are cellular targets for the majority of therapeutics in use today, including both small molecule drugs and protein pharmaceutical drugs and vaccines. Active therapeutic agents are also often amphipathic, and for the same reasons have also been difficult to study directly at the molecular level.
- NanodiscsTM (Nanodisc, Inc., Urbana-Champaign, IL) provide a means to generate soluble lipid bilayer membranes that incorporate membrane proteins on a nanometer scale.
- the structure of the NanodiscTM is a discoidal lipid bilayer sunounded at its edges by amphipathic ⁇ -helical proteins (WO 02/40501).
- the NanodiscsTM are stabilized by a synthetically engineered class of amphipathic membrane scaffold proteins that were optimized to promote the self-assembly of discoidal bilayers (Bayburt et al., 2002). These alpha-helical scaffold proteins sunound the edge of the NanodiscTM, providing stability to the bilayer. They can be engineered with tags or chemically reactive groups so that they can additionally serve as tools for observation, physical manipulation, or attachment to various matrices.
- NanodiscsTM are self-assembling discoidal nanoparticles. The assembly process begins with a mixture of saturated or unsaturated phospholipid molecules and membrane scaffold proteins in the presence of a detergent. The detergent is removed, fonning particles that preserve the phospholipid bilayer architecture and incorporate the target hydrophobic protein of interest.
- NanodiscsTM can be produced from a variety of phospholipids, for example, dipalmitoyl phosphatidlycholine and dimyristoyl phosphatidlycholine (Shaw et al., 2004).
- a synthetic bilayer made from a single type of phospholipid changes from a liquid state to a gel state at a characteristic freezing point. This change of state is called a phase transition.
- the breadth of the phase transitions of the phospholipids in the bilayer depends on the phospholipid composition.
- NanodiscsTM phase transitions of the same phospholipids incorporated into NanodiscsTM compared to phospholipid vesicles showed that the transitions were broader for the lipids in the NanodiscsTM than for the lipids in the vesicles. Also, the transition midpoint was shifted 3-4°C higher for lipids incorporated into NanodiscsTM. These characteristics of the NanodiscTM lipid bilayer mimic the characteristics of cellular membranes better than the vesicles, making NanodiscsTM a more native-like lipid environment in which to study membrane-associated proteins (Shaw et al., 2004).
- NanodiscsTM can also be produced from microsomal membranes, e.g., those prepared from baculovirus-infected Spodoptera frugiperda (Sf9) insect cells.
- Sf9 baculovirus-infected Spodoptera frugiperda
- Civjan et al. overexpressed an N-terminally anchored cytochrome P450 monoxygenase, and found that it was effectively dispersed, not aggregated, in bilayers containing biochemically defined lipid components.
- the cytochrome P450 monoxygenase target protein was suitable for sensitive high-throughput substrate binding analysis (Civjan et al., 2003).
- the oligomeric state of the target protein can be controlled during NanodiscTM assembly.
- the seven transmembrane receptor protein bacteriorhodopsin assumes a native trimeric state.
- the oligomeric form of bacteriorhodopsin could be controlled and determined by observation, e.g., spectroscopically (Bayburt and Sligar, 2003).
- NanodiscsTM can also be controlled by the assembly conditions (Bayburt and Sligar, 2003). By providing membrane scaffold proteins and phospholipids in excess, NanodiscsTM can be induced to self-assemble with controlled stoichiometry such that there is one target hydrophobic molecule per NanodiscTM.
- NanodiscsTM constructed with bacteriorhodopsin comprised approximately two membrane scaffold protein molecules and approximately 163 dimyristoylphosphatidylcholine molecules per bacteriorhodopsin molecule.
- NanodiscsTM provide integral membrane proteins in a functional, soluble, and monodisperse state in a native-like environment that maintains a spectrum of in vivo activities. Integral membrane proteins such as receptors, enzymes, and other macromolecular assemblies that represent important drug targets can be incorporated into NanodiscsTM and retain their physiologic activities.
- NanodiscsTM 93% of the bacteriopsin molecules incorporated into NanodiscsTM were shown to be functional with respect to cofactor binding, and to have a dissociation constant for all-trans-retinal that was very close to the value of the dissociation constant in the native state (Bayburt and Sligar, 2003).
- ayburt and Sligar 93% of the bacteriopsin molecules incorporated into NanodiscsTM were shown to be functional with respect to cofactor binding, and to have a dissociation constant for all-trans-retinal that was very close to the value of the dissociation constant in the native state.
- Hydrophobic proteins expressed on NanodiscsTM are suitable for use in biochemical studies, crystallographic studies, and high throughput screening.
- NanodiscsTM are water soluble; they can be handled and manipulated by techniques commonly used to work with proteins. NanodiscsTM have the advantage over liposomes that they lack a lumen, overcoming the orientation problem of the embedded membrane protein, because both the extracellular and cytoplasmic portions of the target molecules are accessible. Nanodiscs provide access to both sides of the bilayer structure, while liposomes permit access only to the outer surface. Thus, NanodiscsTM are useful for studying transmembrane protein function in solution. For example, they can be used to study transmembrane signaling.
- the invention provides a method of producing at least one hydrophobic polypeptide by providing a cell-free expression system, a first nucleic acid molecule encoding a first hydrophobic polypeptide and reagents for producing a NanodiscTM, combining the first nucleic acid molecule, the cell-free expression system, and the reagents for producing a NanodiscTM, and allowing the first hydrophobic polypeptide to be produced in or introduced into a NanodiscTM.
- This cell-free expression system allows for replication of the nucleic acid molecule. It can be a bacterial system, e.g., an E. coli lysate; a plant system, e.g., a wheat germ lysate; or a eukaryotic system, e.g., a rabbit reticulocyte lysate.
- This expression system can produce membrane proteins.
- This method can produce two or more hydrophobic polypeptides by providing a second, third, or fourth nucleic acid molecule encoding a second, third, or fourth hydrophobic polypeptide; combining the second, third, or fourth nucleic acid molecule with the first, second, or third nucleic acid molecule, the cell-free expression system, and the reagents for producing a NanodiscTM; and allowing the resulting hydrophobic polypeptides to be produced in or introduced into the NanodiscTM.
- This cell-free expression system allows for replication of the nucleic acid molecule. It can be a bacterial system, e.g., an E.
- This expression system can produce membrane proteins.
- This method can produce a NanodiscTM comprising the two or more hydrophobic polypeptides. It can produce two or more hydrophobic proteins that are part of a multi-protein complex, or that exist in the same NanodiscTM but are not part of a multiprotein complex. This method can produce first, second, third, or fourth, etc., nucleic acid molecules that are present in an equal molar ratio.
- NanodiscTM can also produce first, second, third, or fourth, etc., nucleic acid molecules that are present in different molar ratios. These proteins in the NanodiscTM can assume their native conformation and perform their native physiologic functions, both in isolation and as a part of protein complexes.
- the invention provides an apparatus for producing a plurality of hydrophobic polypeptides in a high throughput manner comprising means for providing a cell-free expression system for one or more components of a hydrophobic protein, means for introducing one or more nucleic acid molecules that encode one or more components of a hydrophobic protein into each cell-free expression system, means for introducing a NanodiscTM into each cell-free expression system, and means for incubating the cell-free expression system, the one or more nucleic acid molecules, and the NanodiscTM for each hydrophobic protein.
- This apparatus can further comprise means for separating the NanodiscTM containing the hydrophobic protein from the cell-free expression system.
- the invention provides a method of synthesizing a plurality of Nanodiscs 1 simultaneously and for synthesizing a series of a plurality of simultaneously-synthesized NanodiscsTM sequentially utilizing a dynamic system by providing the apparatus described above, operating the apparatus so as to produce a plurality of hydrophobic polypeptides in a cell-free expression system on a Nanodisc , operating the apparatus so as to separate the Nanodisc containing the hydrophobic protein from the cell-free expression system, and operating the apparatus so as to reposition the apparatus such that the means for providing a cell-free expression system, the means for introducing one or more nucleic acid molecules, the means for introducing a NanodiscTM into each cell-free expression system, and the means for incubating the cell-free expression system are in a position with respect to one another so that at least a second plurality of hydrophobic proteins can be produced in a cell-free system on a NanodiscTM.
- the invention provides a hydrophobic protein made by any of the above methods.
- the hydrophobic protein can be a membrane protein, e.g., a transmembrane protein with one or more hydrophobic transmembrane domains.
- the invention also provides a composition comprising a plurality of crystallized hydrophobic proteins.
- Protein crystallization requires large amounts of purified protein, and previous efforts to produce crystals of membrane proteins have been hampered by the difficulty of expressing hydrophobic proteins in their native state.
- the crystallized hydrophobic protein composition of the invention can comprise hydrophobic proteins produced by a cell-free expression system in a NanodiscTM and crystallized by any of the methods that are known to those skilled in the art (McRee, 1999).
- the composition of crystallized proteins can comprise a binding partner bound to the hydrophobic protein, e.g., a heavy metal or other binding partner used by those skilled in the art. Crystallized proteins can provide information about the three-dimensional structure of the proteins.
- the invention also provides a method of preparing a hydrophobic protein for determination of crystal structure by providing a composition of hydrophobic proteins made by any of the methods described above and allowing the composition to crystallize.
- the invention further provides a method for using a hydrophobic protein of the invention to determine its crystal structure.
- the invention provides a method of immunizing a non-human animal by injecting it with a hydrophobic protein made by any of the methods described above.
- the invention provides a method of screening for modulators of hydrophobic protein activity by providing a hydrophobic protein made by any of the methods described above, contacting the hydrophobic protein with a candidate modulator, and determining the ability of the candidate modulator to affect hydrophobic protein activity or to bind to the hydrophobic protein.
- This method provides a screen for modulators of membrane proteins.
- the modulators can be agonists, antagonists, antibodies, small molecule drugs, soluble receptors, peptide aptamers, and/or natural ligands.
- the resulting replicated nucleic acid, RNA, expressed protein or polypeptide is within the scope of the invention as a product of the host cell or organism.
- the gene conesponding to a selected polynucleotide can be regulated in the gene's native cell types.
- an endogenous gene of a cell can be regulated by an exogenous regulatory sequence inserted into the genome of the cell at a location that will enhance or reduce expression of the gene conesponding to the subject polypeptide.
- the regulatory sequence can be designed to integrate into the genome via homologous recombination, as disclosed in U.S. Patent Nos. 5,641,670 and 5,733,761, the disclosures of which are herein incorporated by reference.
- the invention provides isolated nucleic acids that, when used as primers in a polymerase chain reaction, amplify a subject polynucleotide, or a polynucleotide containing a subject polynucleotide.
- the amplified polynucleotide is from about 20 to about 50, from about 50 to about 75, from about 75 to about 100, from about 100 to about 125, from about 125 to about 150, from about 150 to about 175, from about 175 to about 200, from about 200 to about 250, from about 250 to about 300, from about 300 to about 350, from about 350 to about 400, from about 400 to about 500, from about 500 to about 600, from about 600 to about 700, from about 700 to about 800, from about 800 to about 900, from about 900 to about 1000, from about 1000 to about 2000, from about 2000 to about 3000, from about 3000 to about 4000, from about 4000 to about 5000, or from about 5000 to about 6000 nucleotides or more in length.
- the isolated nucleic acids themselves are from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 100, or from about 100 to about 200 nucleotides in length.
- the nucleic acids are used in pairs in a polymerase chain reaction, where they are refened to as "forward" and "reverse” primers.
- the invention provides a pair of isolated nucleic acid molecules, each from about 10 to about 200 nucleotides in length, the first nucleic acid molecule of the pair comprising a sequence of at least 10 contiguous nucleotides having 100% sequence identity to a nucleic acid sequence as shown in SEQ ID NO: 1 - 732 and the second nucleic acid molecule of the pair comprising a sequence of at least 10 contiguous nucleotides having 100%) sequence identity to the reverse complement of the nucleic acid sequence shown in SEQ ID NO: 1 - 123 , wherein the sequence of the second nucleic acid molecule is located 3 'of the nucleic acid sequence of the first nucleic acid molecule shown in SEQ ID NO: 1 - 123.
- the primer nucleic acids are prepared using any known method, e.g., automated synthesis, and can be chosen to specifically amplify a cDNA copy of an mRNA encoding a subject polypeptide.
- the first and/or the second nucleic acid molecules comprise a detectable label.
- the label can be a radioactive molecule, fluorescent molecule or another molecule, e.g., hapten, as described in detail above.
- the label can be a two stage system, where the amplified DNA is conjugated to another molecule, i.e., biotin, digoxin, or a hapten, that has a high affinity binding partner, i.e., avidin, antidigoxin, or a specific antibody, respectively, and the binding partner conjugated to a detectable label.
- the label can be conjugated to one or both of the primers.
- the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
- Conditions that increase stringency of both DNA/DNA and DNA/RNA hybridization reactions are widely known and published in the art. See, for example, Sambrook, 1989, and examples provided above. Examples of relevant conditions include (in order of increasing stringency): incubation temperatures of 25°C, 37°C, 50°C, and 68°C; buffer concentrations of 10 x SSC, 6 x SSC, 1 x SSC, 0.1 x SSC (where 1 x SSC is 0.15 M NaCl and 15 mM citrate buffer); and their equivalents using other buffer systems; formamide concentrations of 0%, 25%, 50%, and 75%; incubation times from 5 minutes to 24 hours; 1, 2, or more washing steps; wash incubation times of 1, 2, or 15 minutes; and wash solutions of 6 x SSC, 1 x SSC, 0.1 x SSC, or deionized water.
- high stringency conditions include hybridization in 50% formamide, 5X SSC, 0.2 ⁇ g/ ⁇ l poly(dA), 0.2 ⁇ g/ ⁇ l human cotl DNA, and 0.5% SDS, in a humid oven at 42°C overnight, followed by successive washes in IX SSC, 0.2%) SDS at 55°C for 5 minutes, followed by washing at 0.1X SSC, 0.2% SDS at 55°C for 20 minutes.
- high stringency conditions include hybridization at 50°C and O.lxSSC (15 mM sodium chloride/1.5 mM sodium citrate); overnight incubation at 42°C in a solution containing 50% formamide, 1 x SSC (150 mM NaCl, 15 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10%> dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°.
- High stringency conditions also include aqueous hybridization (e.g., free of formamide) in 6X SSC (where 20X SSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% sodium dodecyl sulfate (SDS) at 65°C for about 8 hours (or more), followed by one or more washes in 0.2 X SSC, 0.1% SDS at 65°C.
- Highly stringent hybridization conditions are hybridization conditions that are at least as stringent as any one of the above representative conditions.
- Other stringent hybridization conditions are known in the art and can also be employed to identify nucleic acids of this particular embodiment of the invention.
- Conditions of reduced stringency suitable for hybridization to molecules encoding structurally and functionally related proteins, or otherwise serving related or associated functions, are the same as those for high stringency conditions but with a reduction in temperature for hybridization and washing to lower temperatures (e.g., room temperature or about 22°C to 25°C).
- moderate stringency conditions include aqueous hybridization (e.g., free of formamide) in 6X SSC, 1% SDS at 65°C for about 8 hours (or more), followed by one or more washes in 2X SSC, 0.1%) SDS at room temperature.
- Low stringency conditions include, for example, aqueous hybridization at 50°C and 6xSSC (0.9 M sodium chloride/0.09 M sodium citrate) and washing at 25°C in lxSSC (0.15 M sodium chloride/0.015 M sodium citrate).
- the specificity of a hybridization reaction allows any single-stranded sequence of nucleotides to be labeled with a radioisotope or chemical and used as a probe to find a complementary strand, even in a cell or cell extract that contains millions of different DNA and RNA sequences. Probes of this type are widely used to detect the nucleic acids conesponding to specific genes, both to facilitate the purification and characterization of the genes after cell lysis and to localize them in cells, tissues, and organisms.
- a probe prepared from one gene can be used to find homologous evolutionary relatives - both in the same organism, where the relatives form part of a gene family, and in other organisms, where the evolutionary history of the nucleotide sequence can be traced.
- a person skilled in the art would recognize how to modify the conditions to achieve the requisite degree of stringency for a particular hybridization.
- the polynucleotide libraries of the invention generally comprise a collection of sequence information of a plurality of polynucleotide sequences, where at least one of the polynucleotides has a sequence shown in SEQ ID NO: 1 - 123.
- plurality is meant at least 2, at least 3, or at least all of the sequences in the Sequence Listing.
- the information may be provided in either biochemical form (e.g., as a collection of polynucleotide molecules), or in electronic form (e.g., as a collection of polynucleotide sequences stored in a computer-readable form, as in a computer-based system, a computer data file, and/or as a part of a computer program).
- the length and number of polynucleotides in the library will vary with the nature of the library, e.g., if the library is an oligonucleotide anay, a cDNA anay, or a computer database of the sequence information.
- sequence infonnation contained in either a biochemical or an electronic library of polynucleotides can be used in a variety of ways, e.g., as a resource for gene discovery, as a representation of sequences expressed in a selected cell type (e.g., cell type markers), or as markers of a given disorder or disease state.
- a disease marker is a representation of a gene product that is present in all cells affected by disease either at an increased or decreased level relative to a normal cell (e.g., a cell of the same or similar type that is not substantially affected by disease).
- a polynucleotide sequence in a library can be a polynucleotide that represents an mRNA, polypeptide, or other gene product encoded by the polynucleotide, that is either over-expressed or under-expressed in one cell compared to another (e.g., a first cell type compared to a second cell type; a normal cell compared to a diseased cell; a cell not exposed to a signal or stimulus compared to a cell exposed to that signal or stimulus; and the like).
- the nucleotide sequence information of the library can be embodied in any suitable form, e.g., electronic or biochemical forms.
- a library of sequence information embodied in electronic form comprises an accessible computer data file that may contain the representative nucleotide sequences of genes that are differentially expressed (e.g., over-expressed or under-expressed) as between, e.g., a first cell type compared to a second cell type (e.g., expression in a brain cell compared to expression in a kidney cell); a normal cell compared to a diseased cell (e.g., a non- cancerous cell compared to a cancerous cell); a cell not exposed to an internal or external signal or stimulus compared to a cell exposed to that signal or stimulus (e.g., a cell contacted with a ligand compared to a control cell not contacted with the ligand); and the like.
- Biochemical embodiments of the library include a collection of nucleic acid molecules that have the sequences of the genes in the library, where the nucleic acids can conespond to the entire gene in the library or to a fragment thereof, as described in greater detail below.
- the nucleic acid sequence information can be present in a variety of media.
- the nucleic acid sequences of any of the polynucleotides shown in SEQ ID NO: 1 - 123 can readily appreciate how any of the presently known computer readable mediums can be used to create a manufacture comprising a recording of the present sequence information.
- Any convenient data storage structure can be chosen, based on the means used to access the stored information.
- a variety of data processor programs and formats can be used for storage, e.g., word processing text file, database format, etc.
- electronic versions of the libraries of the invention can be provided in conjunction or connection with other computer-readable information and/or other types of computer-based files (e.g., searchable files, executable files, etc, including, but not limited to, for example, search program software, etc.).
- other computer-readable information e.g., searchable files, executable files, etc, including, but not limited to, for example, search program software, etc.
- nucleotide sequence By providing the nucleotide sequence in computer readable form in a computer-based system, the information can be accessed for a variety of purposes.
- Computer software to access sequence information is publicly available.
- Conventional bioinformatics tools can be utilized to analyze sequences to determine sequence identity, sequence similarity, and gap information.
- the gapped BLAST Altschul et al., 1990, Altschul et al., 1997), and BLAZE (Brutlag et al., 1993) search algorithms on a Sybase system, or the TeraBLAST (TimeLogic, Crystal Bay, Nevada) program optionally ranning on a specialized computer platform available from TimeLogic, can be used to identify open reading frames (ORFs) within the genome that contain homology to ORFs from other organisms.
- ORFs open reading frames
- Homology between sequences of interest can be determined using the local homology algorithm of Smith and Waterman, 1981, as well as the BestFit program (Rechid et al., 1989), and the FastDB algorithm (FastDB, 1988; described in Current Methods in Sequence Comparison and Analysis, Macromolecule Sequencing and Synthesis, Selected Methods and Applications, pp. 127-149, 1988, Alan R. Liss, Inc).
- Alignment programs that pennit gaps in the sequence include Clustalw (Thompson et al., 1994), FASTA3 (Pearson, 2000) AlignO (Myers and Miller, 1988), and TCoffee (Notredame et al., 2000).
- Other methods for comparing and aligning nucleotide and protein sequences include, for example, BLASTX (NCBI), the Wise package (Birney and Durbin, 2000), and FASTX (Pearson, 2000). These algorithms determine sequence homology between nucleotide and protein sequences without translating the nucleotide sequences into protein sequences.
- Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc.
- the reference sequence is usually at least about 18 nt long, at least about 30 nt long, or may extend to the complete sequence that is being compared.
- One parameter for determining percent sequence identity is the percentage of the alignment in the region of strongest alignment between a target and a query sequence. Methods for determining this percentage involve, for example, counting the number of aligned bases of a query sequence in the region of strongest alignment and dividing this number by the total number of bases in the region. For example, 10 matches divided by 11 total residues gives a percent sequence identity of approximately 90.9%.
- the length of the aligned region is typically at least about 55%, at least about 58%>, or at least about 60%> of the total sequence length, and can be as great as about 62%, as great as about 64%>, and even as great as about 66% of the total sequence length.
- the present invention includes human and mouse polynucleotide and polypeptide sequences that are at least about 95%, at least about 96%, at least about 97%, at least about 98%), or at least about 99% homologous to the sequences in the Sequence Listing, based on using the method of determining sequence identity with the insertion of gaps to detect the maximum degree of sequence identity. In other embodiments of interest, homology will be at least about 80%, at least about 85%, or as high as about 90%.
- a variety of structural formats for the input and output means can be used to input and output the infonnation in the computer-based systems of the present invention.
- One format for an output means ranks the relative expression levels of different polynucleotides. Such presentation provides a skilled artisan with a ranking of relative expression levels to determine a gene expression profile.
- the library of the invention also encompasses biochemical libraries of the polynucleotides shown in SEQ ID NO: 1 - 123, e.g., collections of nucleic acids representing the provided polynucleotides.
- the biochemical libraries can take a variety of forms, e.g., a solution of cDNAs, a pattern of probe nucleic acids stably associated with a surface of a solid support (i.e., an anay) and the like.
- nucleic acid anays in which one or more of the polynucleotide sequences shown in SEQ ID NO: 1 - 123 is represented on the anay.
- anay formats have been developed and are known to those of skill in the art.
- the anays of the subject invention find use in a variety of applications, including gene expression analysis, drug screening, mutation analysis, and the like, as disclosed in the herein-listed exemplary patent documents.
- analogous libraries of polypeptides are also provided, where the polypeptides of the library will represent at least a portion of the polypeptides encoded by a gene conesponding to one or more of the sequences shown in SEQ ID NO: 1 - 123.
- analogous libraries of antibodies are also provided, where the libraries comprise antibodies or fragments thereof that specifically bind to at least a portion of at least one of the subject polypeptides.
- antibody libraries may comprise antibodies or fragments thereof that specifically inhibit binding of a subject polypeptide to its ligand or substrate, or that specifically inhibit binding of a subject polypeptide as a substrate to another molecule.
- conesponding nucleic acid libraries are also provided, comprising polynucleotide sequences that encode the antibodies or antibody fragments described above.
- This invention provides novel polypeptides, and related polypeptide compositions.
- the novel polypeptides of the invention encompass proteins with amino acid sequences as shown in SEQ ID NO: 124 - 246, or encoded by the nucleic acids having nucleotide sequences shown in SEQ ID NO: 1 - 123.
- the subject polypeptides are human polypeptides, fragments thereof, variants (such as splice variants), homologs from other species, and derivatives thereof.
- a polypeptide of the invention has an amino acid sequence substantially identical to the sequence of any polypeptide encoded by a polynucleotide sequence shown in SEQ ID NO: 1 - 123.
- polypeptides may reside within the cell, or extracellularly. They may be secreted from the cell, reside in the cytoplasm, in the membranes, or in any of the intracellular organelles, including the nucleus, mitochondria, ribosomes, or storage granules. They may function as secreted proteins, single-transniembrane proteins, multiple-transmembrane proteins, cytoplasmic proteins, and/or extracellular proteins.
- the present novel polypeptide modulates the cells or tissues of animals, particularly humans, such as, for example, by stimulating, enhancing or inliibiting T or B cell function or the function of other hematopoeitic cells or bone manow cells; modulates adult or embryonic stem cell or precursor cell growth or differentiation; modulates cell function or activity of neuronal cells or other cells of the CNS, heart cells, liver cells, kidney cells, lung cells, pancreatic cells, gastrointestinal cells, spleen cells, breast cells, prostate cells, ovarian cells, and the like.
- a subject polypeptide is present as a multimer.
- Multimers include homodimers, homotrimers, homotetramers, and multimers that include more than four monomeric units.
- Multimers also include heteromultimers, e.g., heterodimers, heterotrimers, heterotetramers, etc. where the subject polypeptide is present in a complex with proteins other than the subject polypeptide.
- the multimer is a heteromultimer
- the subject polypeptide can be present in a 1:1 ratio, a 1 :2 ratio, a 2:1 ratio, or other ratio, with the other protein(s).
- polypeptides from other species are also provided, including mammals, such as: primates, rodents, e.g., mice, rats, hamsters, guinea pigs; domestic animals, e.g., sheep, pig, horse, cow, goat, rabbit, dog, cat; and humans, as well as non-mammalian species, e.g., avian, reptile and amphibian, insect, crustacean, fish, plant, fungus, and protozoa.
- mammals such as: primates, rodents, e.g., mice, rats, hamsters, guinea pigs; domestic animals, e.g., sheep, pig, horse, cow, goat, rabbit, dog, cat; and humans, as well as non-mammalian species, e.g., avian, reptile and amphibian, insect, crustacean, fish, plant, fungus, and protozoa.
- homolog is meant a protein having at least about 35%, at least about 40%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, or higher, amino acid sequence identity to the reference polypeptide, as measured with the "GAP" program (part of the Wisconsin Sequence Analysis Package available through the Genetics Computer Group, Inc. (Madison WI)), where the parameters are: Gap weight: 12; length weight:4.
- GAP Wisconsin Sequence Analysis Package available through the Genetics Computer Group, Inc.
- homology will be at least about 75%, at least about 80%, or at least 85%, where in certain embodiments of interest, homology will be as high as about 90%.
- polypeptides that are substantially identical to the at least one amino acid sequence shown in the Sequence Listing, or a fragment thereof, whereby substantially identical is meant that the protein has an amino acid sequence identity to the reference sequence of at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
- the proteins of the subject invention e.g., polypeptides encoded by the nucleotide sequences shown in SEQ ID NO: 1 - 123, and polypeptide sequences shown in SEQ ID NO: 124 - 246) have been separated from their naturally occurring environment and are present in a non-naturally occurring environment.
- the proteins are present in a composition where they are more concentrated than in their naturally occuning environment.
- purified polypeptides are provided.
- Fusion proteins can comprise a subject polypeptide, or fragment thereof, and a polypeptide other than a subject polypeptide ("the fusion partner") fused in-frame at the N-terminus and/or C-terminus of the subject polypeptide, or internally to the subject polypeptide.
- Fusion partners can also be those that are able to stabilize the present polypeptide, such as polyethylene glycol ("PEG") and a fragment of an immunoglobulin, such as the Fc fragment of IgG, IgE, IgA, IgM, and/or IgD.
- Detection methods are chosen based on the detectable fusion partner. For example, where the fusion partner provides an immunologically recognizable epitope, an epitope-specif ⁇ c antibody can be used to quantitatively detect the level of polypeptide.
- the fusion partner provides a detectable signal, and in these embodiments, the detection method is chosen based on the type of signal generated by the fusion partner. For example, where the fusion partner is a fluorescent protein, fluorescence is measured.
- the fusion partner is an enzyme that yields a detectable product
- the product can be detected using an appropriate means.
- ⁇ - galactosidase can, depending on the substrate, yield a colored product that can be detected with a spectrophotometer, and the fluorescent protein luciferase can yield a luminescent product detectable with a luminometer.
- a polypeptide of the invention comprises at least about 5, at least about 8, at least about 10, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1000 contiguous amino acid residues of at least one of the sequences according to SEQ ID NO: 124 - 246, up to and including the entire amino acid sequence.
- Fragments of the subject polypeptides, as well as polypeptides comprising such fragments, are also provided. Fragments of polypeptides of interest will typically be at least about 5, at least about 8, at least about 10, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250, or at least 300 aa in length or longer, where the fragment will have a stretch of amino acids that is identical to the subject protein of at least about 5, at least about 8, at least about 10, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, or at least about 50 aa in length.
- fragments exhibit one or more activities associated with a conesponding naturally occurring polypeptide. Fragments find utility in generating antibodies to the full-length polypeptide; and in methods of screening for candidate agents that bind to and/or modulate polypeptide activity. Specific fragments of interest include those with enzymatic activity, those with biological activity including the ability to serve as an epitope or immunogen, and fragments that bind to other proteins or to nucleic acids.
- the invention provides polypeptides comprising such fragments, including, e.g., fusion polypeptides comprising a subject polypeptide fragment fused in frame (directly or indirectly) to another protein (the "fusion partner"), such as the signal peptide of one protein being fused to the mature polypeptide of another protein.
- fusion proteins are typically made by linking the encoding polynucleotides together in a vector or cassette.
- immunologically detectable proteins
- Fusion partners can also be those that are able to stabilize the present polypeptide, such as polyethylene glycol ("PEG") and a fragment of an immunoglobulin, such as the Fc fragment of IgG, IgE, IgA, IgM, and/or IgD.
- PEG polyethylene glycol
- an immunoglobulin such as the Fc fragment of IgG, IgE, IgA, IgM, and/or IgD.
- Polypeptides of the invention can be obtained from naturally- occuning sources or produced synthetically.
- the sources of naturally occurring polypeptides will generally depend on the species from which the protein is to be derived, i.e., the proteins will be derived from biological sources that express the proteins.
- the subject proteins can also be derived from synthetic means, e.g., by expressing a recombinant gene encoding a protein of interest in a suitable system or host or enhancing endogenous expression, as described in more detail above. Further, small peptides can be synthesized in the laboratory by techniques well known in the art.
- the product can be recovered by any appropriate means known in the art.
- convenient protein purification procedures can be employed (e.g., see Guide to Protein Purification, Deuthscher et al., 1990). That is, a lysate can be prepared from the original source, (e.g., a cell expressing endogenous polypeptide, or a cell comprising the expression vector expressing the polypeptide(s)), and purified using HPLC, exclusion chromatography, gel electrophoresis, or affinity chromatography, and the like.
- the invention thus also provides methods of producing polypeptides.
- the methods generally involve introducing a nucleic acid construct into a host cell in vitro and culturing the host cell under conditions suitable for expression, then harvesting the polypeptide, either from the culture medium or from the host cell, (e.g., by disrupting the host cell), or both, as described in detail above.
- the invention also provides methods of producing a polypeptide using cell-free in vitro transcription/translation methods, which are well known in the art, also as provided above.
- polypeptides including polypeptide fragments, as targets for therapeutic intervention, including use in screening assays, for identifying agents that modulate polypeptide level and/or activity, and as targets for antibody and small molecule therapeutics,- for example, in the treatment of disorders.
- the present invention provides methods of producing a subject polypeptide and provides antibodies that specifically bind to a subject polypeptide.
- the present invention further provides screening methods for identifying agents that modulate a level or an activity of a subject polypeptide or polynucleotide.
- the present invention thus also provides agents that modulate a level or an activity of a subject polypeptide or polynucleotide, as well as compositions, including pharmaceutical compositions, comprising a subject agent.
- the present invention further provides methods for treating disorders such as, for example, cancer and other proliferative disorders, inflammatory and immune disorders, metabolic disorders, and bacterial or viral disorders.
- Formation of a binding complex between a subject polypeptide and an interacting polypeptide or other macromolecule can be detected using any known method. Suitable methods include: a yeast two-hybrid system (Zhu et al., 1997; Fields and Song, 1989; U.S. Pat. No. 5,283,173; Chien et al.
- FRET fluorescence resonance energy transfer
- BRET bioluminescence resonance energy transfer
- FRET fluorescence resonance energy transfer
- FRET fluorescence resonance energy transfer
- BRET bioluminescence resonance energy transfer
- fluorescence quenching assay fluorescence quenching assay
- fluorescence anisotropy assay Jameson and Sawyer, 1995
- an immunological assay and an assay involving binding of a detectably labeled protein to an immobilized protein.
- Immunological assays, and assays involving binding of a detectably labeled protein to an immobilized protein can be performed in a variety of ways.
- immunoprecipitation assays can be designed such that the complex of protein and an interacting polypeptide is detected by precipitation with an antibody specific for either the protein or the interacting polypeptide.
- FRET detects formation of a binding complex between a subject polypeptide and an interacting polypeptide. It involves the transfer of energy from a donor fluorophore in an excited state to a nearby acceptor fluorophore. For this transfer to take place, the donor and acceptor molecules must be in close proximity (e.g., less than 10 nanometers apart, usually between 10 and 100 A apart), and the emission spectra of the donor fluorophore must overlap the excitation spectra of the acceptor fluorophore.
- a fluorescently labeled subject protein serves as a donor and/or acceptor in combination with a second fluorescent protein or dye.
- Fluorescent proteins can be produced by generating a construct comprising a protein and a fluorescent fusion partner.
- GFP green fluorescent protein
- Fluorescent subject proteins can also be generated by producing the subject protein in an auxotrophic strain of bacteria which requires addition of one or more amino acids in the medium for growth.
- a subject protein-encoding construct that provides for expression in bacterial cells is introduced into the auxotrophic strain, and the bacteria are cultured in the presence of a fluorescent amino acid, which is incorporated into the subject protein produced by the bacterium.
- the subject protein is then purified from the bacterial culture using standard methods for protein purification.
- BRET is a protein-protein interaction assay based on energy transfer from a bioluminescent donor to a fluorescent acceptor protein.
- the BRET signal is measured by the ratio of the amount of light emitted by the acceptor to the amount of light emitted by the donor. The ratio of these two values increases as the two proteins are brought into proximity.
- the BRET assay has been described in the literature (U.S. Patent Nos. 6,020,192; 5,968,750; 5,874,304; Xu, et al. 1999).
- BRET assays can be performed by analyzing transfer between a bioluminescent donor protein and a fluorescent acceptor protein. Interaction between the donor and acceptor proteins can be monitored by a change in the ratio of light emitted by the bioluminescent and fluorescent proteins.
- the subject protein serves as donor and/or acceptor protein.
- Fluorescence anisotropy is a measurement of the rotational mobility of a multi-molecular complex. It can be used to generate information about the binding of one molecule to another, including the affinity and specificity of binding sites. It can be applied to polypeptides or nucleic acids of the present invention.
- Fluorescence quenching measurements are useful in detecting protein multimerization, such as where the subject protein interacts with at least a second protein and, for example, where multimerization interaction is affected by a test agent.
- multimerization refers to formation of dimers, trimers, tetramers, and higher multimers of the subject protein. Whether a subject protein forms a complex with one or more additional protein molecules can be determined using any known assay, including assays as described above for interacting proteins. Formation of multimers can also be detected using non-denaturing gel electrophoresis, where multimerized subject protein migrates more slowly than monomeric subject protein. Formation of multimers can also be detected using fluorescence quenching techniques.
- Formation of multimers can also be detected by analytical ultracentrifugation, for example through glycerol or sucrose gradients, and subsequent visualization of a subject protein in gradient fractions by Western blotting or staining of SDS-polyacrylamide gels. Multimers are expected to sediment at defined positions in such gradients. Formation of multimers can also be detected using analytical gel filtration, e.g., in HPLC or FPLC systems, e.g., on columns such as Superdex 200 (Pharmacia Amersham Inc.). Multimers run at defined positions on these columns, and fractions can be analyzed as above. The columns are highly reproducible, allowing one to relate the number and position of peaks directly to the multimerization status of the protein. 2. Detecting mRNA Levels and Monitoring Gene Expression
- the present invention provides methods for detecting the presence of mRNA in a biological sample.
- the methods can be used, for example, to assess whether a test compound affects gene expression, either directly or indirectly.
- the present invention provides diagnostic methods to compare the abundance of a nucleic acid with that of a control value, either qualitatively or quantitatively, and to relate the value to a normal or abnonnal expression pattern.
- Methods of measuring mRNA levels are known in the art (Pietu, 1996; Zhao, 1995; Soares, 1997; Raval, 1994; Chalifour, 1994; Stolz, 1996; Hong, 1982; McGraw, 1984; WO 97/27317). These methods generally comprise contacting a sample with a polynucleotide of the invention under conditions that allow hybridization and detecting hybridization, if any, as an indication of the presence of the polynucleotide of interest.
- Appropriate controls include the use of a sample lacking the polynucleotide mRNA of interest, or the use of a labeled polynucleotide of the same "sense" as a polynucleotide mRNA of interest.
- Detection can be accomplished by any known method, including, but not limited to, in situ hybridization, PCR, RT-PCR, and "Northern” or RNA blotting, or combinations of such techniques, using a suitably labeled subject polynucleotide.
- a variety of labels and labeling methods for polynucleotides are known in the art and can be used in the assay methods of the invention.
- a common method employed is use of microanays which can be purchased or customized, for example, through conventional vendors such as Affymetrix.
- the methods involve generating a cDNA copy of an mRNA molecule in a biological sample, and amplifying the cDNA using an isolated primer pairs as described above, i.e., a set of two nucleic acid molecules that serve as forward and reverse primers in an amplification reaction (e.g., a polymerase chain reaction).
- the primer pairs are chosen to specifically amplify a cDNA copy of an mRNA encoding a polypeptide.
- a detectable label can be included in the amplification reaction, as provided above.
- Methods using PCR amplification can be performed on the DNA from a single cell, although it is convenient to use at least about 10 5 cells.
- the present invention provides methods for monitoring gene expression.
- Methods for determining promoter or enhancer strength include quantifying the expressed natural protein, and inserting the variant control element into a vector with a quantitative reporter gene such as ⁇ -galactosidase, luciferase, or chloramphenicol acetyltransferase (CAT).
- a quantitative reporter gene such as ⁇ -galactosidase, luciferase, or chloramphenicol acetyltransferase (CAT).
- Biochemical studies can dete ⁇ nine whether a sequence polymorphism in a coding region or control region is associated with disease.
- Disease-associated polymorphisms can include deletion or truncation of the gene, mutations that alter expression level, or mutations that affect protein function, etc.
- a number of methods are available to analyze nucleic acids for the presence of a specific sequence, e.g., a disease associated polymorphism.
- Genomic DNA can be used when large amounts of DNA are available.
- the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis.
- Cells that express the gene provide a source of mRNA, which can be assayed directly or reverse transcribed into cDNA for analysis.
- the nucleic acid can be amplified by conventional techniques, i.e., PCR, to provide sufficient amounts for analysis. (Saiki et al., 1988; Sambrook et al., 1989, pp.14.2-14.33). Alternatively, various methods are known in the art that utilize oligonucleotide ligation as a means of detecting polymorphisms (Riley et al., 1990; Delahunty et al., 1996).
- the sample nucleic acid e.g., an amplified or cloned fragment, is analyzed by one of a number of methods known in the art.
- the nucleic acid can be sequenced by dideoxy nucleotide sequencing, or other methods, and the sequence of bases compared to a wild-type sequence.
- Hybridization with the variant sequence can also be used to determine its presence, e.g., by Southern blots, dot blots, etc.
- SSCP Single strand conformational polymorphism
- DGGE denaturing gradient gel electrophoresis
- heteroduplex analysis in gel matrices can detect variation as alterations in electrophoretic mobility resulting from conformational changes created by DNA sequence alterations.
- a polymorphism creates or destroys a recognition site for a restriction endonuclease
- the sample can be digested with that endonuclease, and the products fractionated according to their size to determine whether the fragment was digested. Fractionation can be performed by gel or capillary electrophoresis, for example with acrylamide or agarose gels.
- Screening for mutations in a gene can be based on the functional or antigenic characteristics of the protein. Protein truncation assays are useful in detecting deletions that might affect the biological activity of the protein. Various immunoassays designed to detect polymorphisms in proteins can be used in screening. Where many diverse genetic mutations lead to a particular disease phenotype, functional protein assays have proven to be effective screening tools. The activity of the encoded protein can be determined by comparison with the wild-type protein.
- the present invention provides methods for detecting the presence and/or biological activity of a subject polypeptide in a biological sample.
- the assay used will be appropriate to the biological activity of the particular polypeptide.
- the method will involve contacting the sample with an appropriate substrate, and detecting the product of the enzymatic reaction on the substrate.
- the assay detects protein-protein binding, protein-DNA binding, protein-carbohydrate binding, or protein-lipid binding, as appropriate, using well known assays.
- an appropriate assay is used, such as measurement of intracellular calcium ion concentration, measurement of membrane conductance changes, or measurement of intracellular potassium ion concentration.
- the present invention also provides methods for detecting the presence or measuring the level of a normal or abnormal polypeptide in a biological sample using a specific antibody.
- the methods generally comprise contacting the sample with a specific antibody and detecting binding between the antibody and molecules of the sample. Specific antibody binding, when compared to a suitable control, is an indication that a polypeptide of interest is present in the sample.
- Suitable controls include a sample known not to contain the polypeptide, and a sample contacted with a non-specific antibody, e.g., an anti-idiotype antibody.
- a variety of methods to detect specific antibody-antigen interactions are known in the art, e.g., standard immunohistological methods, immunoprecipitation, enzyme immunoassay, and radioimmunoassay.
- the specific antibody can be detectably labeled, either directly or indirectly, as described at length herein, and cells are permeabilized to stain cytoplasmic molecules. Briefly, antibodies are added to a cell sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes.
- the antibody may be labeled with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection..
- specific-binding pairs may be used, involving, e.g., a second stage antibody or reagent that is detectably-labeled, as described above. Such reagents and their methods of use are well known in the art
- a biological sample can be brought into contact with an immobilized antibody on a solid support or canier, such as nitrocellulose, that is capable of immobilizing cells, cell particles, or soluble proteins.
- the antibody can be attached (coupled) to an insoluble support, such as a polystyrene plate or a bead.
- an insoluble support such as a polystyrene plate or a bead.
- the support can then be washed with suitable buffers, followed by contacting with a detectably-labeled specific antibody.
- Detection methods are known in the art and will be chosen as appropriate to the signal emitted by the detectable label. Detection is generally accomplished in comparison to suitable controls, and to appropriate standards.
- the present invention further provides methods for detecting the presence and/or levels of enzymatic activity of a subject polypeptide in a biological sample.
- the methods generally involve contacting the sample with a substrate that yields a detectable product upon being acted upon by a subject polypeptide, and detecting a product of the enzymatic reaction.
- polypeptides that are subsets of the complete sequences of the subject proteins may be used to identify and investigate parts of the protein important for function.
- the present invention further includes methods for monitoring activity of a polypeptide through observation of phenotypic changes in a cell containing such polypeptide, such as growth or differentiation, or the ability of such a cell to secrete a molecule that can be detected, such as through chemical methods or through its effect on another cell, such as cell activation.
- the present invention provides screening methods for identifying agents that modulate the level of a mRNA molecule of the invention, agents that modulate the level of a polypeptide of the invention, and agents that modulate the biological activity of a polypeptide of the invention.
- the assay is cell-free; in others, it is cell-based.
- the screening assay is a binding assay, one or more of the molecules can be joined to a label, where the label can directly or indirectly provide a detectable signal.
- the invention encompasses endogenous polynucleotides of the invention that encode mRNA and/or polypeptides of interest. Again as discussed previously, the invention also encompasses exogenous polynucleotides that encode mRNA or polypeptides of the invention.
- the polynucleotide can reside within a recombinant vector which is introduced into the cell.
- a recombinant vector can comprise an isolated transcriptional regulatory sequence which is associated in nature with a nucleic acid, such as a promoter sequence operably linked to sequences coding for a polypeptide of the invention; or the transcriptional control sequences can be operably linked to coding sequences for a polypeptide fusion protein comprising a polypeptide of the invention fused to a polypeptide that facilitates detection.
- the candidate agent is combined with a cell possessing a polynucleotide transcriptional regulatory element operably linked to a polypeptide-coding sequence of interest, e.g., a subject cDNA or its genomic component; and determining the agent's effect on polynucleotide expression, as measured, for example by the level of mRNA, polypeptide, or fusion polypeptide
- a recombinant vector can comprise an isolated polynucleotide transcriptional regulatory sequence, such as a promoter sequence, operably linked to a reporter gene (e.g., ⁇ -galactosidase, CAT, luciferase, or other gene that can be easily assayed for expression).
- a reporter gene e.g., ⁇ -galactosidase, CAT, luciferase, or other gene that can be easily assayed for expression.
- the method for identifying an agent that modulates a level of expression of a polynucleotide in a cell comprises combining a candidate agent with a cell comprising a transcriptional regulatory element operably linked to a reporter gene; and determining the effect of said agent on reporter gene expression.
- agents that modulate mRNA levels can be used to identify agents that modulate mRNA levels, including, but not limited to, PCR with detectably-labeled primers.
- agents that modulate polypeptide levels can be identified using standard methods for determining polypeptide levels, including, but not limited to an immunoassay such as ELISA with detectably-labeled antibodies.
- a wide variety of cell-based assays can also be used to identify agents that modulate eukaryotic or prokaryotic mRNA and/or polypeptide levels. Examples include transformed cells that over-express a cDNA construct and cells transfonned with a polynucleotide of interest associated with an endogenously- associated promoter operably linked to a reporter gene.
- a control sample would comprise, for example, the same cell lacking the candidate agent. Expression levels are measured and compared in the test and control samples.
- the cells used in the assay are usually mammalian cells, including, but not limited to, rodent cells and human cells.
- the cells can be primary cell cultures or can be immortalized cell lines.
- Cell-based assays generally comprise the steps of contacting the cell with a test agent, forming a test sample, and, after a suitable time, assessing the agent's effect on macromolecule expression. That is, the mammalian cell line is transformed or transfected with a construct that results in expression of the polynucleotide, the cell is contacted with a test agent, and then mRNA or polypeptide levels are detected and measured using conventional assays
- a suitable period of time for contacting the agent with the cell can be determined empirically, and is generally a time sufficient to allow entry of the agent into the cell and to allow the agent to have a measurable effect on subject mRNA and/or polypeptide levels. Generally, a suitable time is between about 10 minutes and about 24 hours, including about 1 to about 8 hours. Alternatively, incubation periods may be between about 0.1 and about 1 hour, selected for example for optimum activity or to facilitate rapid high-throughput screening. Where the polypeptide is expressed on the cell surface, however, a shorter length of time may be sufficient. Incubations are performed at any suitable temperature, i.e., between about 4°C and about 40°C. The contact and incubation steps can be followed by a washing step to remove unbound components, i.e., a label that would give rise to a background signal during subsequent detection of specifically-bound complexes.
- one of the components can be bound to a solid support, and the remaining components contacted with the support bound component. Remaining components may be added at different times or at substantially the same time. Further, where the interacting protein is a second subject protein, the effect of the test agent on binding can be determined by determining the effect on multimization of the subject protein.
- the present invention further provides methods of identifying agents that modulate a biological activity of a polypeptide of the invention.
- the method generally comprises contacting a test agent with a sample containing a subject polypeptide and assaying a biological activity of the subject polypeptide in the presence of the test agent.
- An increase or a decrease in the assayed biological activity in comparison to the activity in a suitable control e.g., a sample comprising a subject polypeptide in the absence of the test agent
- the mixture of components is added in any order that provides for the requisite interaction..
- External and internal processes that can affect modulation of a macromolecule of the invention include, but are not limited to, infection of a cell by a microorganism, including, but not limited to, a bacterium (e.g., Mycobacterium spp., Shigella, or Chlamydid), a protozoan (e.g., Tr ⁇ panosoma spp., Plasmodium spp., or Toxoplasma spp.), a fungus, a yeast (e.g., Candida spp.), or a virus (including viruses that infect mammalian cells, such as human immunodeficiency virus, foot and mouth disease virus, Epstein-Ban virus, and viruses that infect plant cells); change in pH of the medium in which a cell is maintained or a change in internal pH; excessive heat relative to the normal range for the cell or the multicellular organism; excessive cold relative to the normal range for the cell or the multicellular organism; an effector molecule such as a hormone,
- a variety of other reagents can be included in the screening assay. These include salts, neutral proteins, e.g., albumin, detergents, and other compounds that facilitate optimal binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, or anti-microbial agents, etc., can be used.
- the present invention provides a method for identifying an agent, particularly a biologically active agent that modulates the level of expression of a nucleic acid in a cell, the method comprising: combining a candidate agent to be tested with a cell comprising a nucleic acid that encodes a polypeptide, and determining the agent's effect on polypeptide expression.
- Some embodiments will detect agents that decrease the biological activity of a molecule of the invention. Maximal inhibition of the activity is not always necessary, or even desired, in every instance to achieve a therapeutic effect. Agents that decrease a biological activity can find use in treating disorders associated with the biological activity of the molecule. Alternatively, some embodiments will detect agents that increase a biological activity. Agents that increase a biological activity of a molecule of the invention can find use in treating disorders associated with a deficiency in the biological activity. Agents that increase or decrease a biological activity of a molecule of the invention can be selected for further study, and assessed for physiological attributes, i.e., cellular availability, cytotoxicity, or biocompatibility, and optimized as required.
- physiological attributes i.e., cellular availability, cytotoxicity, or biocompatibility
- a candidate agent is assessed for any cytotoxic activity it may exhibit toward the cell used in the assay using well-known assays, such as trypan blue dye exclusion, an MTT ([3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl-2 H-tetrazolium bromide]) assay, and the like.
- MTT [3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl-2 H-tetrazolium bromide]
- candidate agents encompass numerous chemical classes, as described above.
- Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. Numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. For example, random peptide libraries obtained by yeast two-hybrid screens (Xu et al., 1997), phage libraries (Hoogenboom et al., 1998), or chemically generated libraries. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced, including antibodies produced upon immunization of an animal with subject polypeptides, or fragments thereof, or with the encoding polynucleotides.
- natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and can be used to produce combinatorial libraries.
- known pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, and amidification, etc, to produce structural analogs.
- the present invention provides methods for diagnosing disease states based on the detected presence and/or level of polynucleotide or polypeptide in a biological sample, and/or the detected presence and/or level of biological activity of the polynucleotide or polypeptide. These detection methods can be provided as part of a kit. Thus, the invention further provides kits for detecting the presence and/or a level of a polynucleotide or polypeptide in a biological sample and/or or the detected presence and/or level of biological activity of the polynucleotide or polypeptide. Procedures using these kits can be performed by clinical laboratories, experimental laboratories, medical practitioners, or private individuals.
- kits of the invention will comprise a molecule of the invention.
- the kits for detecting a polynucleotide will also comprise a moiety that specifically hybridizes to a polynucleotide of the invention.
- the polynucleotide molecule can be of any length. For example, it can comprise a polynucleotide of at least 6, at least 7, at least 8, or at least 9 contiguous nucleotides of a molecule of the invention.
- Kits of the invention for detecting a subject polypeptide will comprise a moiety that specifically binds to a polypeptide of the invention; the moiety includes, but is not limited to, a polypeptide-specific antibody.
- kits are useful in diagnostic applications.
- the kit is useful to determine whether a given DNA sample isolated from an individual comprises an expressed nucleic acid, a polymorphism, or other variant.
- Kits for detecting polynucleotides comprise a pair of nucleic acids in a suitable storage medium, e.g., a buffered solution, in a suitable container.
- the pair of isolated nucleic acid molecules serve as primers in an amplification reaction (e.g., a polymerase chain reaction).
- the kit can further include additional buffers, reagents for polymerase chain reaction (e.g., deoxynucleotide triphosphates (dNTP), a thermostable DNA polymerase, a solution containing Mg ions (e.g., MgCl 2 ), and other components well known to those skilled in the art for carrying out a polymerase chain reaction).
- dNTP deoxynucleotide triphosphates
- Mg ions e.g., MgCl 2
- the kit can further include instructions for use, which may be provided in a variety of forms, e.g., printed information, or compact disc, and the like.
- the kit may further include reagents necessary to extract DNA from a biological sample and reagents for generating a cDNA copy of an mRNA.
- the kit may optionally provide additional useful components, including, but not limited to, buffers, developing reagents, labels, reacting surfaces, means for detections, control samples, standards, and interpretive information.
- kits of the invention for detecting a polynucleotide, such as an mRNA encoding a polypeptide comprises a pair of nucleic acids that function as "forward" and “reverse” primers that specifically amplify a cDNA copy of the mRNA.
- the "forward" and “reverse” primers are provided as a pair of isolated nucleic acid molecules, each from about 10 to about 200 nucleotides in length, the first nucleic acid molecule of the pair comprising a sequence of at least about 10 contiguous nucleotides having 100% sequence identity to a nucleic acid sequence shown in from SEQ ID NO: 1 - 732, and the second nucleic acid molecule of the pair comprising a sequence of at least about 10 contiguous nucleotides having 100% sequence identity to the reverse complement of a nucleic acid sequence shown in SEQ ID NO: 1 - 732, wherein the sequence of the second nucleic acid molecule is located 3 'of the nucleic acid sequence of the first nucleic acid molecule.
- the primer nucleic acids are prepared using any known method, e.g., automated synthesis.
- one or both members of the pair of nucleic acid molecules comprise a detectable label.
- the kit can include one or more specific antibodies.
- the antibody specific to the polypeptide is detectably labeled.
- the antibody specific to the polypeptide is not labeled; instead, a second, detectably-labeled antibody is provided that binds to the specific antibody.
- the kit may further include blocking reagents, buffers, and reagents for developing and/or detecting the detectable marker.
- the kit may further include instructions for use, controls, and interpretive information.
- the kit provides for detecting enzymatic activity, it includes a substrate that provides for a detectable product when acted upon by a polypeptide of interest.
- the kit may further include reagents necessary to detect and develop the detectable marker.
- kits with unit doses of an active agent These agents are described in more detail below.
- the agent is provided in oral or injectable doses.
- kits will comprise containers containing the unit doses and an informational package insert describing the use and attendant benefits of the drugs in treating a condition of interest.
- Stem cells are pluripotent or multipotent cells that generate maturing cells in multiple differentiation lineages.
- Embryonic stem cells are pluripotent; they can differentiate into any of the cells present in the adult.
- Multipotent cells have the ability to differentiate into more than one cell type.
- Organ-specific stem cells are multipotent; they can differentiate into any of the cells of the organ they inhabit.
- both pluripotent and multipotent stem cells can maintain their pluripotency or multipotency while giving rise to differentiated progeny.
- stem cells can produce replicas of themselves which are pluri- or multipotent, and are also able to differentiate into lineage-restricted committed progenitor cells.
- hematopoeitic stem cells which are multipotent cells specifically able to form blood cells, can divide to produce replicate hematopoeitic stem cells. They can also divide to produce more highly differentiated cells, which are precursors of blood cells. The precursors differentiate, sometimes through several generations of cells, into blood cells.
- a hematopoetic stem cell can also divide into a cell with the capacity to form, for example, a relatively undifferentiated cell that is committed to differentiate into, i.e., granulocytes, erythrocytes, or another type of blood cell.
- Stem cells can also reproduce and differentiate in vitro.
- Embryonic stem cells have been directed to differentiate into cardiac muscle cells in vitro and, alternatively, into early progenitors of neural stem cells, and then into mature neurons and glial cells in vitro (Trounson, 2002).
- stem cell therapy offers several advantages over traditional cancer therapies (Weissman, 2000).
- One advantage of stem cell therapy exists when used in conjunction with radiation therapy.
- radiation therapy for cancer the dose of radiation necessary to kill the cancer cells in an organ can also be sufficient to destroy the healthy cells of the organ.
- stem cells are infused to repopulate the organ. In the ensuing weeks, as the cancer cells and healthy cells die, the stem cells replace the healthy cells.
- Another advantage of this approach compared to heterologous organ transplants, is that there is no risk of rejection, since stem cells do not provoke an immune response.
- a further advantage is that stem cells are inherently programmed to regulate their numbers and differentiation status, i.e., once provided to the patient, the necessary number will differentiate, and the rest will remain undifferentiated (Weissman, 2000).
- Stem cell therapy is also effective in treating autoimmune disease in humans.
- immunosuppression in conjunction with stem-cell transplantation has induced remission in patients with refractory, severe rheumatic autoimmune disease (Van Laar and Tyndall, 2003).
- Patients with rheumatoid arthritis, systemic lupus erythematosus, systemic sclerosis, and juvenile idiopathic arthritis have benefited from stem cell transplants (Van Laar and Tyndall, 2003).
- Preclinical studies also suggest the potential of stem cell transplantation for the treatment of neural and muscular injuries and diseases, including those of the central nervous system, peripheral nervous system, and skeletal, cardiac and smooth muscle (Deasy and Huard, 2002).
- mice Stem cells transplanted into the bone manow of mice migrate to the site of injured muscle and differentiate into new muscle cells.
- patients with myasthenia gravis, muscular dystrophies, amyotrophic lateral sclerosis, congestive heart failure, Parkinson's disease, and Alzheimer's disease may benefit from stem cell therapy (Henningson, 2003).
- stem cells derived from a patient with a genetic disease can provide a tool for studying that disease.
- a somatic cell i.e., a cell that is not in the oocyte or spermatocyte lineage
- This nuclear transplant procedure produces, at the blastocyst stage of development, embryonic stem cells with the same set of genes as the patient with the genetic disease. Studying these cells, and their progeny in vitro, permits analysis of a specific model of the disease. For example, placing stem cells derived from a patient with a genetic disease under the control of various stem cell regulatory factors can elicit abnormal responses from the affected stem cells compared to stem cells derived from a healthy individual's somatic nucleus.
- MSC mesenchymal stem cells
- MSCs derive from a common progenitor cell, the multipotent adult progenitor cell (MAPC), that gives rise to other lineages as different as endothelium, endoderm, and ectoderm.
- MSCs self-renew by proliferation while maintaining their stem cell phenotype and give rise to the differentiated stromal cells which belong to the osteogenic, chondrogenic, adipogenic, myogenic and fibroblastic lineages.
- MSCs can be identified by their expression of thy- 1 (CD90), endoglin (CD 105), vascular cell adhesion molecule 1 (VCAM-1) (CD 106), and hyaluronate receptor (CD44). MSC potential can be determined by the colony- forming unit fibroblast assay (CFU-F) (Jorgensen et al., 2003). They can be expanded in culture without losing their phenotype or multilineage potential (Jorgensen et al., 2003).
- CFU-F colony- forming unit fibroblast assay
- MSCs are present in tissues involved in autoimmune diseases. Since MSCs can target the affected organs in autoimmune diseases, they can be used as a vehicle to express therapeutic proteins (Jorgensen et al., 2003).
- MSCs have been demonstrated to be present in mesenchymal-derived tissue, such as injured synovium in the presence of chronic inflammation (Jorgensen et al., 2003).
- MSCs themselves display immunological properties; these properties can enhance their therapeutic potential (Jorgensen et al., 2003). For example, they suppress T-cell responses (Jorgensen et al., 2003).
- Systemically infused autologous MSCs delayed donor cell rejection from a control value of 7 days to a treated value of 11 days in a murine skin graft model (Jorgensen et al., 2003).
- MSCs can be used in different therapeutic strategies, either as immunosuppressive agents, or as genetically engineered vehicles for therapeutics. Since MSCs are not rejected, and they travel to injured mesenchymal tissues, they can be used as a means of transportation to deliver therapeutic proteins to a targeted area.
- the capacity of MSCs to adhere to matrix components favors their preferential homing to bone, lung, and cartilage when injected intravenously (Jorgensen et al. folk 2003). They also home preferentially to the bone manow.
- Cell mediated therapy offers the advantage that the autologous MCS can be used in treatment.
- MSCs have been genetically modified to express anti-inflammatory cytokines. They have been demonstrated to secrete several therapeutic heterologous proteins, such as human erythropoietin and factor IX (Jorgensen et al., 2003).
- Rat mesenchymal stem cells have been genetically engineered using ex vivo retroviral transduction to overexpress the prosurvival gene Aktl, a protein kinase that is the product of an oncogene (Mangi et al., 2003).
- Aktl protein kinase that is the product of an oncogene
- the exogenous proteins expressed by genetically altered mesenchymal stem cells can exert their therapeutic effect by targeting cells present in the environment of the stem cell. The altered stem cells can also respond to the exogenous protein that it secretes.
- mesenchymal stem cells that express bone-promoting osteogenic factors can express factors that promote bone growth and can also respond, differentiate, and participate in the bone formation process (Turgeman et al., 2002).
- Mesenchymal stem cells have also been used to repair defects in cartilage and ligaments (Pend and Huard, 2003), and express a furin-cleavable insulin gene (Sasaki et al., 2003).
- the invention further provides agents identified using a screening assay of the invention, and compositions comprising the agents, subject polypeptides, subject polynucleotides, recombinant vectors, and/or host cells, including pharmaceutical compositions for therapeutic administration.
- the subject compositions can be formulated using well-known reagents and methods. These compositions can include a buffer, which is selected according to the desired use of the agent, polypeptide, polynucleotide, recombinant vector, or host cell, and can also include other substances appropriate to the intended use. Those skilled in the art can readily select an appropriate buffer, a wide variety of which are known in the art, suitable for an intended use.
- compositions are provided in formulation with pharmaceutically acceptable excipients, a wide variety of which are known in the art (Gennaro, 2000; Ansel et al., 1999; Kibbe et al., 2000).
- pharmaceutically acceptable excipients such as vehicles, adjuvants, earners or diluents, are readily available to the public.
- pharmaceutically acceptable auxiliary substances such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public.
- compositions of the invention can be administered in the form of their pharmaceutically acceptable salts, or they can also be used alone or in appropriate association, as well as in combination, with other pharmaceutically active compounds.
- the subject compositions are formulated in accordance to the mode of potential administration. Administration of the agents can be achieved in various ways, including oral, buccal, nasal, rectal, parenteral, intraperitoneal, intradermal, transdermal, subcutaneous, intravenous, intra-arterial, intracardiac, intraventricular, intracranial, intratracheal, and intrathecal administration, etc., or otherwise by implantation or inhalation.
- compositions can be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols.
- solid, semi-solid, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols.
- the agents, polynucleotides, and polypeptides can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch, or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch, or gelatins; with disintegrators, such as corn starch, potato starch, or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives, and flavoring agents.
- conventional additives such as lactose, mannitol, corn starch, or potato starch
- binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch, or gelatins
- disintegrators such as corn starch, potato starch, or sodium carboxymethylcellulose
- Suitable excipient vehicles are, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof.
- the vehicle can contain minor amounts of auxiliary substances such as wetting or emulsifying agents or pH buffering agents. Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art (Remington, 1985).
- the composition or formulation to be administered will, in any event, contain a quantity of the agent adequate to achieve the desired state in the subject being treated.
- the agents, polynucleotides, and polypeptides can be formulated into preparations for injection by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives.
- an aqueous or nonaqueous solvent such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol
- solubilizers isotonic agents
- suspending agents emulsifying agents
- stabilizers and preservatives preservatives.
- Other formulations for oral or parenteral delivery can also be used, as conventional in the art
- the agents, polynucleotides, and polypeptides can be utilized in aerosol formulation to be administered via inhalation.
- the compounds of the present invention can be formulated into pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen, and the like.
- the agent, polynucleotides, or polypeptide composition may be converted to powder form for administration intranasally or by inhalation, as conventional in the art.
- the agents can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases.
- bases such as emulsifying bases or water-soluble bases.
- the compounds of the present invention can be administered rectally via a suppository.
- the suppository can include vehicles such as cocoa butter, carbowaxes and polyethylene glycols, which melt at body temperature, yet are solidified at room temperature.
- a polynucleotide, polypeptide, or other modulator can also be introduced into tissues or host cells by other routes, such as viral infection, microinjection, or vesicle fusion.
- expression vectors can be used to introduce nucleic acid compositions into a cell as described above.
- jet injection can be used for intramuscular administration (Furth et al., 1992).
- the DNA can be coated onto gold microparticles, and delivered intradermally by a particle bombardment device, or "gene gun” as described in the literature (Tang et al., 1992), where gold microprojectiles are coated with the DNA, then bombarded into skin cells.
- Unit dosage forms for oral or rectal administration such as syrups, elixirs, and suspensions can be provided wherein each dosage unit, for example, teaspoonful, tablespoonful, tablet, or suppository, contains a predetermined amount of the composition containing one or more agents.
- unit dosage forms for injection or intravenous administration can comprise the agent(s) in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier.
- nucleic acid, polypeptide, and modulator compositions of the subject invention find use as therapeutic agents in situations where one wishes to modulate an activity of a subject polypeptide in a host, particularly the activity of the subject polypeptides, or to provide or inhibit the activity at a particular anatomical site.
- the compositions are useful in treating disorders associated with an activity of a subject polypeptide.
- active agents of the present invention The following provides further details of active agents of the present invention.
- the active agent is an agent that modulates, and generally decreases or down regulates, the expression of a gene encoding a target protein in a host, i.e., antisense molecules.
- Anti-sense reagents include antisense oligonucleotides (ODN), i.e., synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA.
- ODN antisense oligonucleotides
- the antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products.
- Antisense molecules inhibit gene expression through various mechanisms, e.g., by reducing the amount of mRNA available for translation, through activation of RNase H, or steric hindrance.
- One or a combination of antisense molecules can be administered, where a combination can comprise multiple different sequences.
- Antisense molecules can be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule.
- the antisense molecule is a synthetic oligonucleotide.
- Antisense oligonucleotides can be chemically synthesized by methods known in the art (Wagner et al., 1993; Milligan et al., 1993) Oligonucleotides can be chemically modified from the native phosphodiester structure to increase their intracellular stability and binding affinity, for example, as described in detail above.
- Antisense oligonucleotides will generally be at least about 7, at least about 12, or at least about 20 nucleotides in length, and not more than about 500, not more than about 50, or not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, and specificity, including absence of cross-reactivity, and the like. Short oligonucleotides, of from about 7 to about 8 bases in length, can be strong and selective inhibitors of gene expression (Wagner et al., 1996). [0346] A specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence.
- Selection of a specific sequence for the oligonucleotide can use an empirical method, where several candidate sequences are assayed for inliibition of expression of the target gene in an in vitro or animal model.
- a combination of sequences can also be used, where several regions of the mRNA sequence are selected for antisense complementation.
- catalytic nucleic acid compounds e.g., ribozymes, or anti-sense conjugates can be used to inhibit gene expression.
- Ribozymes can be synthesized in vitro and administered to the patient, or can be encoded in an expression vector, from which the ribozyme is synthesized in the targeted cell (WO 9523225; Beigelman et al., 1995). Examples of oligonucleotides with catalytic activity are described in WO 9506764.
- the active agent is an interfering RNA (RNAi), including dsRNAi.
- RNA interference provides a method of silencing eukaryotic genes. Double stranded RNA can induce the homology-dependent degradation of its cognate mRNA in C. elegans, fungi, plants, Drosophila, and mammals (Gaudilliere et al., 2002).
- Use of RNAi to reduce a level of a particular mRNA and/or protein is based on the interfering properties of double-stranded RNA derived from the coding regions of a gene.
- RNAi can also help identify the biochemical mode of action of a drug and to identify other genes encoding products that can respond or interact with specific compounds.
- complementary sense and antisense RNAs derived from a substantial portion of the subject polynucleotide are synthesized in vitro.
- the resulting sense and antisense RNAs are annealed in an injection buffer, and the double-stranded RNA injected or otherwise introduced into the subject, i.e., in food or by immersion in buffer containing the RNA (Gaudilliere et al., 2002; O'Neil et al., 2001; WO99/32619).
- dsRNA derived from a gene of the present invention is generated in vivo by simultaneously expressing both sense and antisense RNA from appropriately positioned promoters operably linked to coding sequences in both sense and antisense orientations.
- the active agent is a peptide.
- Suitable peptides include peptides of from about 3 amino acids to about 50, from about 5 to about 30, or from about 10 to about 25 amino acids in length.
- a peptide has a sequence of from about 3 amino acids to about 50, from about 5 to about 30, or from about 10 to about 25 amino acids of conesponding naturally-occurring protein.
- a peptide exhibits one or more of the following activities: inhibits binding of a subject polypeptide to an interacting protein or other molecule; inhibits subject polypeptide binding to a second polypeptide molecule; inhibits a signal transduction activity of a subject polypeptide; inhibits an enzymatic activity of a subject polypeptide; or inhibits a DNA binding activity of a subject polypeptide.
- Peptides can include naturally-occurring and non-naturally occurring amino acids.
- Peptides can comprise D-amino acids, a combination of D- and L-amino acids, and various "designer" amino acids (e.g., ⁇ -methyl amino acids, C ⁇ -methyl amino acids, and N ⁇ -methyl amino acids, etc.) to convey special properties.
- peptides can be cyclic.
- Peptides can include non-classical amino acids in order to introduce particular conformational motifs. Any known non-classical amino acid can be used.
- Non-classical amino acids include, but are not limited to, 1 ,2,3,4-tetrahydroisoquinoline-3-carboxylate; (2S,3S)-methylphenylalanine, (2S,3R)- methyl-phenylalanine, (2R,3S)-methyl-phenylalanine and (2R,3R)-methyl- phenylalanine; 2-aminotetrahydronaphthalene-2-carboxylic acid; hydroxy- 1,2,3 ,4- tetrahydroisoquinoline-3-carboxylate; ⁇ -carboline (D and L); HIC (histidine isoquinoline carboxylic acid); and HIC (histidine cyclic urea).
- Amino acid analogs and peptidomimetics can be incorporated into a peptide to induce or favor specific secondary structures, including, but not limited to, LL-Acp (LL-3-amino-2- propenidone-6-carboxylic acid), a ⁇ -turn inducing dipeptide analog; ⁇ -sheet inducing analogs; ⁇ -turn inducing analogs; ⁇ -helix inducing analogs; ⁇ -turn inducing analogs; Gly- Ala turn analogs; amide bond isostere; or tretrazol, and the like.
- a peptide can be a depsipeptide, which can be linear or cyclic (Kuisle et al., 1999).
- Linear depsipeptides can comprise rings formed through S-S bridges, or through an hydroxy or a mercapto group of an hydroxy-, or mercapto-amino acid and the carboxyl group of another amino- or hydroxy-acid but do not comprise rings formed only through peptide or ester links derived from hydroxy carboxylic acids.
- Cyclic depsipeptides contain at least one ring formed only through peptide or ester links, derived from hydroxy carboxylic acids.
- Peptides can be cyclic or bicyclic.
- the C-terminal carboxyl group or a C-terminal ester can be induced to cyclize by internal displacement of the -OH or the ester (-OR) of the carboxyl group or ester respectively with the N-terminal amino group to form a cyclic peptide.
- the free acid is converted to an activated ester by an appropriate carboxyl group activator such as dicyclohexylcarbodiimide (DCC) in solution, for example, in methylene chloride (CH C1 2 ), dimethyl formamide (DMF) mixtures.
- DCC dicyclohexylcarbodiimide
- CH C1 2 methylene chloride
- DMF dimethyl formamide
- the cyclic peptide is then formed by internal displacement of the activated ester with the N-terminal amine. Internal cyclization as opposed to polymerization can be enhanced by use of very dilute solutions. Methods for making cyclic peptides are well known in the art.
- a desamino or descarboxy residue can be incorporated at the terminal ends of the peptide, so that there is no terminal amino or carboxyl group, to decrease susceptibility to proteases or to restrict conformation.
- C-terminal functional groups include amide, amide lower alkyl, amide di (lower alkyl), lower alkoxy, hydroxy, and carboxy, and the lower ester derivatives thereof, and the pharmaceutically acceptable salts thereof.
- a peptide or peptidomimetic can be modified with or covalently coupled to one or more of a variety of hydrophilic polymers to increase solubility and circulation half- life of the peptide.
- Suitable nonproteinaceous hydrophilic polymers for coupling to a peptide include, but are not limited to, polyalkylethers as exemplified by polyethylene glycol and polypropylene glycol, polylactic acid, polyglycolic acid, polyoxyalkenes, polyvinylalcohol, polyvinylpynolidone, cellulose and cellulose derivatives, dextran, and dextran derivatives.
- hydrophilic polymers have an average molecular weight ranging from about 500 to about 100,000 daltons, from about 2,000 to about 40,000 daltons, or from about 5,000 to about 20,000 daltons.
- the peptide can be derivatized with or coupled to such polymers using any of the methods set forth in Zallipsky, 1995; Monfardini et al., 1995; U.S. Pat. Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; 4,179,337, or WO 95/34326. d) Antibodies
- the invention provides antibodies that specifically recognize a particular polypeptide.
- Antibodies are obtained by immunizing a host animal with peptides, polynucleotides encoding polypeptides, or cells, each comprising all or a portion of the target protein ("immunogen").
- Suitable host animals include rodents (e.g., mouse, rat, guinea pig, hamster), cattle (e.g., sheep, pig, cow, horse, goat), cat, dog, chicken, primate, monkey, and rabbit.
- the origin of the protein immunogen can be any species, including mouse, human, rat, monkey, avian, insect, reptile, or crustacean.
- the host animal will generally be a different species than the immunogen, e.g., a human protein used to immunize mice. Methods of antibody production are well known in the art (Howard and Bethell, 2000; Harlow et al., 1998; Harlow and Lane, 1988).
- the immunogen can comprise the complete protein, or fragments and derivatives thereof, or proteins expressed on cell surfaces. Immunogens comprise all or a part of one of the subject proteins, where these amino acids contain post- translational modifications, such as glycosylation, found on the native target protein. Immunogens comprising protein extracellular domains are produced in a variety of ways known in the art, e.g., expression of cloned genes using conventional recombinant methods, or isolation from tumor cell culture supernatants, etc. The immunogen can also be expressed in vivo from a polynucleotide encoding the immunogenic peptide introduced into the host animal.
- Polyclonal antibodies are prepared by conventional techniques. These include immunizing the host animal in vivo with the target protein (or immunogen) in substantially pure form, for example, comprising less than about 1% contaminant.
- the immunogen can comprise the complete target protein, fragments, or derivatives thereof.
- the target protein can be combined with an adjuvant; suitable adjuvants include alum, dextran, sulfate, large polymeric anions, and oil & water emulsions, e.g., Freund's adjuvant (complete or incomplete).
- suitable adjuvants include alum, dextran, sulfate, large polymeric anions, and oil & water emulsions, e.g., Freund's adjuvant (complete or incomplete).
- the target protein can also be conjugated to synthetic carrier proteins or synthetic antigens.
- the target protein is administered to the host, usually intradermally, with an initial dosage followed by one or more, usually at least two, additional booster dosages.
- blood from the host will be collected, followed by separation of the serum from blood cells.
- the immunoglobulin present in the resultant antiserum can be further fractionated using known methods, such as ammonium salt fractionation, or DEAE chromatography and the like.
- the method of producing polyclonal antibodies can be varied in some embodiments of the present invention. For example, instead of using a single substantially isolated polypeptide as an immunogen, one may inject a number of different immunogens into one animal for simultaneous production of a variety of antibodies.
- the immunogens can be nucleic acids (e.g., in the form of plasmids or vectors) that encode the proteins, with facilitating agents, such as liposomes, microspheres, etc, or without such agents, such as "naked" DNA.
- Antibodies can also be prepared using a library approach. Briefly, mRNA is extracted from the spleens of immunized animals to isolate antibody- encoding sequences. The extracted mRNA may be used to make cDNA libraries. Such a cDNA library may be normalized and subtracted in a manner conventional in the art, for example, to subtract out cDNA hybridizing to mRNA of non-immunized animals. The remaining cDNA may be used to create proteins and for selection of antibody molecules or fragments that specifically bind to the immunogen. The cDNA clones of interest, or fragments thereof, can be introduced into an in vitro expression system to produce the desired antibodies, as described herein.
- polyclonal antibodies can be prepared using phage display libraries, conventional in the art.
- phage display libraries conventional in the art.
- a collection of bacteriophages displaying antibody properties on their surfaces are made to contact subject polypeptides, or fragments thereof.
- Bacteriophages displaying antibody properties that specifically recognize the subject polypeptides are selected, amplified, for example, in E. coli, and harvested. Such a method typically produces single chain antibodies
- Monoclonal antibodies are also produced by conventional techniques, such as fusing an antibody-producing plasma cell with an immortal cell to produce hybridomas.
- Suitable animals will be used, e.g., to raise antibodies against a mouse polypeptide of the invention, the host animal will generally be a hamster, guinea pig, goat, chicken, or rabbit, and the like.
- the spleen and/or lymph nodes of an immunized host animal provide the source of plasma cells, which are immortalized by fusion with myeloma cells to produce hybridoma cells.
- Culture supernatants from individual hybridomas are screened using standard techniques to identify clones producing antibodies with the desired specificity.
- the antibody can be purified from the hybridoma cell supernatants or from ascites fluid present in the host by conventional techniques, e.g., affinity chromatography using antigen, e.g., the subject protein, bound to an insoluble support, i.e., protein A sepharose, etc.
- the antibody can be produced as a single chain, instead of the normal multimeric structure of the immunoglobulin molecule.
- Single chain antibodies have been previously described (i.e., Jost et al., 1994).
- DNA sequences encoding parts of the immunoglobulin, for example, the variable region of the heavy chain and the variable region of the light chain are ligated to a spacer, such as one encoding at least about four small neutral amino acids, i.e., glycine or serine.
- the protein encoded by this fusion allows the assembly of a functional variable region that retains the specificity and affinity of the original antibody.
- the invention also provides intrabodies that are intracellularly expressed single-chain antibody molecules designed to specifically bind and inactivate target molecules inside cells. Intrabodies have been used in cell assays and in whole organisms (Chen et al., 1994; Hassanzadeh et al., 1998). Inducible expression vectors can be constructed with intrabodies that react specifically with a protein of the invention. These vectors can be introduced into host cells and model organisms.
- the invention also provides "artificial" antibodies, e.g., antibodies and antibody fragments produced and selected in vitro.
- these antibodies are displayed on the surface of a bacteriophage or other viral particle, as described above.
- artificial antibodies are present as fusion proteins with a viral or bacteriophage structural protein, including, but not limited to, Ml 3 gene III protein. Methods of producing such artificial antibodies are well known in the art (U.S. Patent Nos. 5,516,637; 5,223,409; 5,658,727; 5,667,988; 5,498,538; 5,403,484; 5,571,698; and 5,625,033).
- the artificial antibodies selected for example, on the basis of phage binding to selected antigens, can be fused to a Fc fragment of an immunoglobulin for use as a therapeutic, as described, for example, in US 5,116,964 or WO 99/61630.
- Antibodies of the invention can be used to modulate biological activity of cells, either directly or indirectly.
- a subject antibody can modulate the activity of a target cell, with which it has primary interaction, or it can modulate the activity of other cells by exerting secondary effects, i.e., when the primary targets interact or communicate with other cells.
- the antibodies of the invention can be administered to mammals, and the present invention includes such administration, particularly for therapeutic and/or diagnostic purposes in humans.
- Antibodies may be administered by injection systemically, such as by intravenous injection; or by injection or application to the relevant site, such as by direct injection into a tumor, or direct application to the site when the site is exposed in surgery; or by topical application, such as if the disorder is on the skin, for example.
- the antigenicity of the antibody For in vivo use, particularly for injection into humans, in some embodiments it is desirable to decrease the antigenicity of the antibody.
- An immune response of a recipient against the antibody may potentially decrease the period of time that the therapy is effective.
- Methods of humanizing antibodies are known in the art.
- the humanized antibody can be the product of an animal having transgenic human immunoglobulin genes, e.g., constant region genes (e.g., Grosveld and Kolias, 1992; Murphy and Carter, 1993; Pinkert, 1994; and International Patent Applications WO 90/10077 and WO 90/04036).
- the antibody of interest can be engineered by recombinant DNA techniques to substitute the CHI, CH2, CH3, hinge domains, and/or the framework domain with the conesponding human sequence (see, e.g., WO 92/02190). Both polyclonal and monoclonal antibodies made in non-human animals may be "humanized” before administration to human subjects.
- Chimeric immunoglobulin genes constructed with immunoglobulin cDNA are known in the art (Liu et al. 1987a; Liu et al. 1987b). Messenger RNA is isolated from a hybridoma or other cell producing the antibody and used to produce cDNA.
- the cDNA of interest can be amplified by the polymerase chain reaction using specific primers (U.S. Patent nos. 4,683,195 and 4,683,202). Alternatively, a library is made and screened to isolate the sequence of interest. The DNA sequence encoding the variable region of the antibody is then fused to human constant region sequences.
- the sequences of human constant regions genes are known in the art (Kabat et al., 1991). Human C region genes are readily available from known clones. The choice of isotype will be guided by the desired effector functions, such as complement fixation, or antibody-dependent cellular cytotoxicity. IgGl, IgG3 and IgG4 isotypes, and either of the kappa or lambda human light chain constant regions can be used.
- the chimeric, humanized antibody is then expressed by conventional methods.
- Consensus sequences of heavy (“H”) and light (“L”) J regions can be used to design oligonucleotides for use as primers to introduce useful restriction sites into the J region for subsequent linkage of V region segments to human C region segments.
- C region cDNA can be modified by site directed mutagenesis to place a restriction site at the analogous position in the human sequence.
- a convenient expression vector for producing antibodies is one that encodes a functionally complete human CH or CL immunoglobulin sequence, with appropriate restriction sites engineered so that any VH or VL sequence can be easily inserted and expressed, such as plasmids, retroviruses, YACs, or EBV derived episomes, and the like.
- splicing usually occurs between the splice donor site in the inserted J region and the splice acceptor site preceding the human C region, and also at the splice regions that occur within the human CH exons. Polyadenylation and transcription termination occur at native chromosomal sites downstream of the coding regions.
- the resulting chimeric antibody can be joined to any strong promoter, including retroviral LTRs, e.g., SV-40 early promoter, (Okayama, et al. 1983), Rous sarcoma virus LTR (Gorman et al. 1982), and Moloney murine leukemia virus LTR (Grosschedl et al. 1985), or native immunoglobulin promoters.
- retroviral LTRs e.g., SV-40 early promoter, (Okayama, et al. 1983), Rous sarcoma virus LTR (Gorman et al. 1982), and Moloney murine leukemia virus LTR (Grosschedl et al. 1985), or native immunoglobulin promoters.
- the antibodies can be fully human antibodies.
- xenogenic antibodies which are produced in animals that are transgenic for human antibody genes, can be employed.
- xenogenic human antibodies antibodies that are fully human antibodies, with the exception that they are produced in a non-human host that has been genetically engineered to express human antibodies, (e.g., WO 98/50433; WO 98,24893 and WO 99/53049).
- Antibody fragments such as Fv, F(ab 2 and Fab can be prepared by cleavage of the intact protein, e.g., by protease or chemical cleavage. These fragments can include heavy and light chain variable regions.
- a truncated gene can be designed, e.g., a chimeric gene encoding a portion of the F(ab') 2 fragment that includes DNA sequences encoding the CHI domain and hinge region of the H chain, followed by a translational stop codon.
- the antibodies of the present invention may be administered alone or in combination with other molecules for use as a therapeutic, for example, by linking the antibody to cytotoxic agent, as discussed above, or to a radioactive molecule.
- Radioactive antibodies that are specific to a cancer cell, disease cell, or virus-infected cell may be able to deliver a sufficient dose of radioactivity to kill such cancer cell, disease cell, or virus-infected cell.
- the antibodies of the present invention can also be used in assays for detection of the subject polypeptides.
- the assay is a binding assay that detects binding of a polypeptide with an antibody specific for the polypeptide; the subject polypeptide or antibody can be immobilized, while the subject polypeptide and/or antibody can be detectably-labeled.
- the antibody can be directly labeled or detected with a labeled secondary antibody. That is, suitable, detectable labels for antibodies include direct labels, which label the antibody to the protein of interest, and indirect labels, which label an antibody that recognizes the antibody to the protein of interest.
- radioisotopes including, but not limited to 64 Cu, 67 Cu, 90 Y, 124 1, 125 1, 131 1, 137 Cs, 186 Re, 211 At, 212 Bi, 213 Bi, 223 Ra, 41 Am, and 244 Cm; enzymes having detectable products (e.g., luciferase, ⁇ -galactosidase, and the like); fluorescers and fluorescent labels, e.g., as provided herein; fluorescence emitting metals, e.g., 152 Eu, or others of the lanthanide series, attached to the antibody through metal chelating groups such as EDTA; chemiluminescent compounds, e.g., luminol, isolumixiol, or acridinium salts; and bioluminescent compounds, e.g., luciferin, or aequorin (green fluorescent protein), specific binding molecules, e.g., magnetic particles, microspheres, nano
- specific-binding pairs may be used, involving, e.g., a second stage antibody or reagent that is detectably-labeled and that can amplify the signal.
- a primary antibody can be conjugated to biotin, and horseradish peroxidase-conjugated strepavidin added as a second stage reagent.
- Digoxin and antidigoxin provide another such pair.
- the secondary antibody can be conjugated to an enzyme such as peroxidase in combination with a substrate that undergoes a color change in the presence of the peroxidase.
- Peptide aptamers are peptides or small polypeptides that act as dominant inhibitors of protein function. Peptide aptamers specifically bind to target proteins, blocking their functional ability (Kolonin and Finley, 1998). Due to the highly selective nature of peptide aptamers, they can be used not only to target a specific protein, but also to target specific functions of a given protein (e.g., a signaling function). Further, peptide aptamers can be expressed in a controlled fashion by use of promoters which regulate expression in a temporal, spatial or inducible manner. Peptide aptamers act dominantly, therefore, they can be used to analyze proteins for which loss-of-function mutants are not available.
- Peptide aptamers that bind with high affinity and specificity to a target protein can be isolated by a variety of techniques known in the art. Peptide aptamers can be isolated from random peptide libraries by yeast two-hybrid screens (Xu et al., 1997). They can also be isolated from phage libraries (Hoogenboom et al., 1998) or chemically generated peptides/libraries.
- the instant invention provides various therapeutic methods.
- methods of modulating, including increasing and inhibiting, a biological activity of a subject protein are provided.
- methods of modulating an enzymatic activity of a subject protein are provided.
- methods of increasing the level of enzymatically active subject protein are provided, while in some embodiments, methods of decreasing a level of enzymatically active subject protein are provided.
- methods of modulating enzymatic activity of a subject protein are provided.
- methods of modulating a signal transduction activity of a subject protein are provided.
- methods of modulating interaction of a subject protein with another, interacting protein or other macromolecule e.g., DNA, carbohydrate, lipid
- methods of modulating transport activity of a subject protein are provided.
- methods of modulating phopholipase activity of a subject protein are provided.
- methods of modulating polymerase activity of a subject protein are provided.
- methods of modulating nuclease activity of a subject protein are provided.
- an effective amount of the active agent e.g., small molecule, antibody specific for a subject polypeptide, a subject polypeptide, or a subject polynucleotide
- effective amount means a dosage sufficient to produce a desired effect or result.
- the desired result is at least a reduction in a given biological activity of a subject polypeptide as compared to a control, for example, a decreased level of enzymatically active subject protein in the individual, or in a localized anatomical site in the individual.
- the desired result is at least an increase in a biological activity of a subject polypeptide as compared to a control, for example an increased level of enzymatically active subject protein in the individual, or in a localized anatomical site in the individual.
- compositions of the instant invention will contain from less than about 1% to about 95%> of the active ingredient, about 10% to about 50%. Generally, between about 100 mg and about 500 mg will be administered to a child and between about 500 mg and about 5 grams will be administered to an adult.
- the active agent(s) can be administered to the host via any convenient means capable of resulting in the desired result. Administration is generally by injection and often by injection to a localized area. The frequency of administration will be determined by the care given based on patient responsiveness. For example, the agents may be administered daily, weekly, or as conventionally determined appropriate.
- the host, or patient may be from any animal species, and will generally be mammalian, e.g., primate sp., e.g., monkeys, chimpanzees, and particularly humans; rodents, including mice, rats and hamsters, guinea pig; rabbits; cattle, including equines, bovines, pig, sheep, goat, canines; felines; etc. Animal models are of interest for experimental investigations, providing a model for treatment of human disease.
- primate sp. e.g., monkeys, chimpanzees, and particularly humans
- rodents including mice, rats and hamsters, guinea pig
- rabbits including mice, rats and hamsters, guinea pig
- cattle including equines, bovines, pig, sheep, goat, canines; felines; etc.
- Animal models are of interest for experimental investigations, providing a model for treatment of human disease.
- a protein of the present invention is involved in the control of cell proliferation, and an agent of the invention inhibits undesirable cell proliferation.
- agents are useful for treating disorders that involve abnormal cell proliferation, including, but not limited to, cancer, psoriasis, and scleroderma.
- Whether a particular agent and/or therapeutic regimen of the invention is effective in reducing unwanted cellular proliferation, e.g., in the context of treating cancer can be determined using standard methods. For example, the number of cancer cells in a biological sample (e.g., blood, a biopsy sample, and the like), can be determined. The tumor mass can be determined using standard radiological or biochemical methods.
- Tumors that can be treated using the methods of the instant invention include carcinomas, e.g., colorectal, prostate, breast, bone, kidney, skin, melanoma, ductal, endometrial, stomach or other organ of the gastrointestinal tract, pancreatic, mesothelioma, dysplastic oral mucosa, invasive oral cancer, non-small cell lung carcinoma ("NSCL"), transitional and squamous cell urinary carcinoma; brain cancer and neurological malignancies, e.g., neuroblastoma, glioblastoma, astrocytoma, and gliomas; lymphomas and leukemias such as myeloid leukemia, myelogenous leukemia, hematological malignancies, such as childhood acute leukemia, non- Hodgkin's lymphomas, chronic lymphocytic leukemia, malignant cutaneous T-cell lymphoma, mycosis fungoides, non-MF cutaneous T-cell lymphoma
- the polynucleotides, polypeptides, and modulators of the present invention find use in immunotherapy of hyperproliferative disorders, including cancer, neoplastic, and paraneoplastic disorders. That is, the subject molecules can conespond to tumor antigens, of which 1770 have been identified to date (Yu and Restifo, 2002). Immunotherapeutic approaches include passive immunotherapy and vaccine therapy and can accomplish both generic and antigen-specific cancer immunotherapy.
- Passive immunity approaches involve antibodies of the invention that are directed toward specific tumor-associated antigens. Such antibodies can eradicate systemic tumors at multiple sites, without eradicating normal cells.
- the antibodies are combined with radioactive components, as provided above, for example, combining the antibody's ability to specifically target tumors with the added lethality of the radioisotope to the tumor DNA.
- Useful antibodies comprise a discrete epitope or a combination of nested epitopes, i.e., a 10-mer epitope and associated peptide multimers incorporating all potential 8-mers and 9-mers, or overlapping epitopes (Dutoit et al., 2002). Thus a single antibody can interact with one or more epitopes. Further, the antibody can be used alone or in combination with different antibodies, that all recognize either a single or multiple epitopes.
- Neutralizing antibodies can provide therapy for cancer and proliferative disorders.
- Neutralizing antibodies that specifically recognize a secreted protein or peptide of the invention can bind to the secreted protein or peptide, e.g., in a bodily fluid or the extracellular space, thereby modulating the biological activity of the secreted protein or peptide.
- neutralizing antibodies specific for secreted proteins or peptides that play a role in stimulating the growth of cancer cells can be useful in modulating the growth of cancer cells.
- neutralizing antibodies specific for secreted proteins or peptides that play a role in the differentiation of cancer cells can be useful in modulating the differentiation of cancer cells.
- Vaccine therapy involves the use of polynucleotides, polypeptides, or agents of the invention as immunogens for tumor antigens (Machiels et al., 2002).
- peptide-based vaccines of the invention include unmodified subject polypeptides, fragments thereof, and MHC class I and class Il-restricted peptide (Knutson et al., 2001), comprising, for example, the disclosed sequences with universal, nonspecific MHC class Il-restricted epitopes.
- Peptide-based vaccines comprising a tumor antigen can be given directly, either alone or in conjunction with other molecules.
- the vaccines can also be delivered orally by producing the antigens in transgenic plants that can be subsequently ingested (U.S. Patent No. 6,395,964).
- antibodies themselves can be used as antigens in anti-idiotype vaccines. That is, administering an antibody to a tumor antigen stimulates B cells to make antibodies to that antibody, which in turn recognize the tumor cells
- Nucleic acid-based vaccines can deliver tumor antigens as polynucleotide constructs encoding the antigen.
- Vaccines comprising genetic material, such as DNA or RNA, can be given directly, either alone or in conjunction with other molecules.
- nucleic acid-based vaccines encode subject antibodies.
- the vaccines e.g., DNA vaccines
- the vaccines can include post-transcriptional regulatory elements, such as the post-transcriptional regulatory acting RNA element (WPRE) derived from Woodchuck Hepatitis Virus. These post- transcriptional regulatory elements can be used to target the antibody, or a fusion protein comprising the antibody and a co-stimulatory molecule, to the tumor microenvironment (Pertl et al., 2003).
- WPRE post-transcriptional regulatory acting RNA element
- vaccines of the invention can also induce cellular responses, including stimulating T-cells that recognize and kill tumor cells directly.
- nucleotide-based vaccines of the invention encoding tumor antigens can be used to activate the CD8 + cytotoxic T lymphocyte arm of the immune system.
- the vaccines activate T-cells directly, and in others they enlist antigen-presenting cells to activate T-cells.
- Killer T-cells are primed, in part, by interacting with antigen-presenting cells, i.e., dendritic cells.
- plasmids comprising the nucleic acid molecules of the invention enter antigen-presenting cells, which in turn display the encoded rumor-antigens that contribute to killer T-cell activation.
- the tumor antigens can be delivered as plasmid DNA constructs, either alone or with other molecules.
- RNA can be used.
- dendritic cells can be transfected with RNA encoding tumor antigens (Heiser et al., 2002; Mitchell and Nair, 2000). This approach overcomes the limitations of obtaining sufficient quantities of tumor material, extending therapy to patients otherwise excluded from clinical trials.
- a subject RNA molecule isolated from tumors can be amplified using RT-PCR.
- the RNA molecule of the invention is directly isolated from tumors and transfected into dendritic cells with no intervening cloning steps.
- the molecules of the invention are altered such that the peptide antigens are more highly antigenic than in their native state.
- Another recognized problem of cancer vaccines is the presence of preexisting neutralizing antibodies.
- Some embodiments of the present invention overcome this problem by using viral vectors from non-mammalian natural hosts, i.e., avian pox viruses.
- Alternative embodiments that also circumvent preexisting neutralizing antibodies include genetically engineered influenza viruses, and the use of "naked" plasmid DNA vaccines that contain DNA with no associated protein. (Yu and Restifo, 2002).
- immunogenic molecules can be combined with other molecules that have a variety of antiproliferative effects, or with additional substances that help stimulate the immune response, i.e., adjuvants or cytokines.
- nucleic acid vaccines encode an alphaviral replicase enzyme, in addition to tumor antigens. This recently discovered approach to vaccine therapy successfully combines therapeutic antigen production with the induction of the apoptotic death of the tumor cell (Yu and Restifo, 2002).
- a DNA or RNA vaccine of the present invention can also be directed against the production of blood vessels in the vicinity of the tumor, a process called antiangiogenesis, thereby depriving the cancer cells of nutrients.
- the antiangiogenic molecules angiostatin (a fragment of plasminogen), endostatin (a fragment of collagen XVIII), interferon- ⁇ , interferon- ⁇ inducible protein 10, interleukin 12, thrombospondin, platelet factor-4, calreticulin, or its protein fragment vasostatin can be used to treat tumors by suppressing neovascularization and thereby inhibiting growth (Cheng et al., 2001).
- adjuvants can be used in conjunction with the antibodies and vaccines disclosed herein.
- Adjuvants help boost the general immune response, for example, concentrating immune cells to the specific area where they are needed. They can be added to a cancer vaccine itself or administered separately, and in some embodiments, a viral vector can be engineered to display adjuvant proteins on its surface.
- Cytokines can also be used to help stimulate immune response. Cytokines act as chemical messengers, recruiting immune cells that help the killer T- cells to the site of attack. An example of a cytokine is granulocyte-macrophage colony-stimulating factor (GM-CSF), which stimulates the proliferation of antigen- presenting cells, thus boosting an organism's response to a cancer vaccine. As with adjuvants, cytokines can be used in conjunction with the antibodies and vaccines disclosed herein. For example, they can be incorporated into the antigen-encoding plasmid or introduced via a separate plasmid, and in some embodiments, a viral vector can be engineered to display cytokines on its surface.
- GM-CSF granulocyte-macrophage colony-stimulating factor
- the invention provides agents for treating such inflammation or immune disorders.
- Disease states that are treatable using formulations of the invention include various types of arthritis such as rheumatoid arthritis and osteoarthritis, autoimmune thyroiditis, various chronic inflammatory conditions of the skin, such as psoriasis, the intestine, such as inflammatory bowel disease (IBD), insulin-dependent diabetes, autoimmune diseases such as multiple sclerosis (MS), intestinal immune disorders and systemic lupus erythematosis (SLE), allergic diseases, transplant rejections, adult respiratory distress syndrome, atherosclerosis, ischemic diseases due to closure of the peripheral vasculature, cardiac vasculature, and vasculature in the central nervous system (CNS).
- arthritis such as rheumatoid arthritis and osteoarthritis
- autoimmune thyroiditis various chronic inflammatory conditions of the skin, such as psoriasis, the intestine, such as inflammatory bowel disease (IBD), insulin-dependent diabetes, autoimmune diseases such as multiple
- Neutralizing antibodies can provide immunosuppressive therapy for inflammatory and autoimmune disorders.
- Neutralizing antibodies can be used to treat disorders such as, for example, multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, transplant rejection, and psoriasis.
- Neutralizing antibodies that specifically recognize a secreted protein or peptide of the invention can bind to the secreted protein or peptide, e.g., in a bodily fluid or the extracellular space, thereby modulating the biological activity of the secreted protein or peptide.
- neutralizing antibodies specific for secreted proteins or peptides that play a role in activating immune cells are useful as immunosuppressants.
- an agent of the invention is useful for treating conditions or disorders relating to cell death (e.g., DNA damage, cell death, apoptosis).
- Cell death-related indications that can be treated using the methods of the invention to reduce cell death in a eukaryotic cell, include, but are not limited to, cell death associated with Alzheimer's disease, Parkinson's disease, rheumatoid arthritis, autoimmune thyroiditis, septic shock, sepsis, stroke, central nervous system inflammation, intestinal inflammation, osteoporosis, ischemia, reperfusion injury, cardiac muscle cell death associated with cardiovascular disease, polycystic kidney disease, cell death of endothelial cells in cardiovascular disease, degenerative liver disease, multiple sclerosis, amyotropic lateral sclerosis, cerebellar degeneration, ischemic injury, cerebral infarction, myocardial infarction, acquired immunodeficiency syndrome (AIDS), myelodysplastic syndromes, a
- hypoxic or anoxic conditions e.g., conditions relating to or resulting from ischemia, myocardial infarction, cerebral infarction, stroke, bypass heart surgery, organ transplantation, and neuronal damage, etc.
- DNA damage can be detected using any known method, including, but not limited to, a Comet assay (commercially available from Trevigen, Inc.), which is based on alkaline lysis of labile DNA at sites of damage; and immunological assays using antibodies specific for abenant DNA structures, e.g., 8-OHdG.
- Cell death can be measured using any known method, and is generally measured using any of a variety of known methods for measuring cell viability. Such assays are generally based on entry into the cell of a detectable compound (or a compound that becomes detectable upon interacting with, or being acted on by, an intracellular component) that would normally be excluded from a normal, living cell by its structurally and functionally intact cell membrane.
- Such compounds include substrates for intracellular enzymes, including, but not limited to, a fluorescent substrate for esterase; dyes that are excluded from living cells, including, but not limited to, rrypan blue; and DNA-binding compounds, including, but not limited to, an ethidium compound such as ethidium bromide and ethidium homodimer, and propidium iodide.
- substrates for intracellular enzymes including, but not limited to, a fluorescent substrate for esterase
- dyes that are excluded from living cells including, but not limited to, rrypan blue
- DNA-binding compounds including, but not limited to, an ethidium compound such as ethidium bromide and ethidium homodimer, and propidium iodide.
- Apoptosis or programmed cell death, is a regulated process leading to cell death via a series of well-defined morphological changes.
- Programmed cell death provides a balance for cell growth and multiplication, eliminating unnecessary cells. The default state of the cell is to remain alive.
- a cell enters the apoptotic pathway when an essential factor is removed from the extracellular environment or when an internal signal is activated.
- Genes and proteins of the invention that suppress the growth of tumors by activating cell death provide the basis for treatment strategies for hyperproliferative disorders and conditions.
- Apoptosis can be assayed using any known method. Assays can be conducted on cell populations or an individual cell, and include morphological assays and biochemical assays. A non-limiting example of a method of determining the level of apoptosis in a cell population is TUNEL (TdT-mediated dUTP nick-end labeling) labeling of the 3 -OH free end of DNA fragments produced during apoptosis (Gavrieli et al., 1992).
- TUNEL TdT-mediated dUTP nick-end labeling
- the TUNEL method consists of catalytically adding a nucleotide, which has been conjugated to a chromogen system, a fluorescent tag, or the 3 -OH end of the 180-bp (base pair) oligomer DNA fragments, in order to detect the fragments.
- the presence of a DNA ladder of 180-bp oligomers is indicative of apoptosis.
- Procedures to detect cell death based on the TUNEL method are available commercially, e.g., from Boehringer Mannheim (Cell Death Kit) and Oncor (Apoptag Plus).
- Another marker that is cunently available is annexin, sold under the trademark APOPTESTTM.
- This marker is used in the "Apoptosis Detection Kit,” which is also commercially available, e.g., from R&D Systems.
- apoptosis a cell membrane's phospholipid asymmetry changes such that the phospholipids are exposed on the outer membrane.
- Annexins are a homologous group of proteins that bind phospholipids in the presence of calcium.
- a second reagent, propidium iodide (PI) is a DNA binding fluorochrome.
- disorders of carbohydrate, fat, and protein metabolism can be treated using the methods of the instant invention. These include disorders associated with glucose homeostasis, including those of glucose metabolism, insulin secretion, and insulin resistance, such as impaired glucose tolerance, which can lead to diabetes and/or metabolic syndrome.
- Diabetes mellitus is a chronic disorder of carbohydrate, fat, and protein metabolism characterized in its fully expressed clinical form by fasting hypergiycemia, glycosuria, and the tendency to develop atherosclerosis, angiopathy, nephropathy, neuropathy, and hypertension. Diabetes mellitus can be classified into three types, namely, type I, impaired glucose tolerance (IGT), and type II.
- type I diabetes the beta cells in the pancreas, probably through an autoimmune reaction, cease proving insulin to the bloodstream of the affected individual.
- IGT and Type II diabestes the pancreas continues to produce insulin, but some or all may fail to bind to insulin receptors. Internalization of insulin by target cells may also be reduced (U.S. Patent No. 6,291,495).
- IGT and type II diabetes are characterized by a decreased ability of the insulin receptor to facilitate glucose uptake into the cell, where it is used as an energy source. Insulin binding to the extracellular surface of the insulin receptor changes the conformation of the receptor. The conformational change in the transmembrane receptor results in the phosphorylation of catalytic sites of the receptor that reside intracellularly. The receptor, in turn, phosphorylates substrate proteins, and the resulting cascade of intracellular signals mediates the regulation of glucose and lipid metabolism by the insulin receptor.
- the resulting intracellular glucose deficiency increases appetite, leading to obesity in same patients.
- the insulin receptor also responds abnormally in its role in regulating lipid metabolism; as a result, plasma lipid levels increase.
- the elevated plasma lipids present in chronic diabetes generally include elevated plasma cholesterol and triglyceride concentrations and reduced high density lipoprotein cholesterol, and thus can play a role in the generation of atherosclerosis, which is present in diabetic patients to a greater extent than in the general population.
- the subject nucleic acid compositions find use in a variety of different investigative applications.
- Applications of interest include identifying genomic DNA sequence using molecules of the invention, identifying homologs of molecules of the invention, creating a source of novel promoter elements, identifying expression regulatory factors, creating a source of probes and primers for hybridization applications, identifying expression patterns in biological specimens; preparing cell or animal models to investigate the function of the molecules of the invention, and preparing in vitro models to investigate the function of the molecules of the invention.
- Human genomic polynucleotide sequences conesponding to molecules of the present invention are identified by conventional means, such as, for example, by probing a genomic DNA library with all or a portion of the polynucleotide sequences.
- Homologs are identified by any of a number of methods.
- probes particularly labeled probes of DNA sequences
- a fragment of the provided cDNA can be used as a hybridization probe against a cDNA library from the target organism of interest, under various stringency conditions, e.g., low stringency conditions.
- the probe can be a large fragment, or one or more short degenerate primers, and is typically labeled.
- Sequence identity can be determined by hybridization under stringent conditions, as described in detail above. Nucleic acids having a region of substantial identity or sequence similarity to the provided nucleic acid sequences, for example allelic variants, related genes, or genetically altered versions of the gene, bind to the provided sequences under less stringent hybridization conditions.
- the sequence of the 5' flanking region can be utilized as promoter elements, including enhancer binding sites that provide for tissue-specific expression and developmental regulation in tissues where the subject genes are expressed, providing promoters that mimic the native pattern of expression.
- mutations can be introduced into the promoter region to determine the effect of altering expression in experimentally defined systems.
- Methods for the identification of specific DNA motifs involved in the binding of transcriptional factors are known in the art, for example sequence similarity to known binding motifs, and gel retardation studies (Blackwell et al., 1995; Mortlock et al., 1996; Joulin and Richard-Foy, 1995).
- the regulatory sequences can be used to identify cis acting sequences required for transcriptional or translational regulation of expression, especially in different tissues or stages of development, and to identify cis acting sequences and trans-acting factors that regulate or mediate expression.
- Such transcription or translational control regions can be operably linked to a gene in order to promote expression of wild type genes or of proteins of interest in cultured cells, embryonic, fetal or adult tissues, and for gene therapy (Hooper, 1993).
- RNA fragments are useful as primers for reactions that involve nucleic acid hybridization, as described in detail above. Briefly, pairs of primers will be used in amplification reactions, such as PCR. Amplification primers hybridize to complementary strands of DNA, for example, under stringent conditions, and will prime towards each other. In some embodiments a pair of primers will generate an amplification product of at least about 50 nt, or at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages.
- the nucleotides can also be used as probes to identify genomic DNA or gene expression in a biological specimen, as described above and as is well established in the art. Briefly, DNA or mRNA is isolated from a cell sample. Detection of mRNA hybridizing to the subject sequence is indicative of gene expression in the sample. The mRNA can be amplified by RT-PCR, using reverse transcriptase to form a complementary DNA strand, followed by polymerase chain reaction amplification using primers specific for the subject DNA sequences.
- the mRNA sample is separated by gel electrophoresis, transfened to a suitable support, e.g., nitrocellulose, nylon, etc., and then probed with a fragment of the subject nucleotides as a probe.
- a suitable support e.g., nitrocellulose, nylon, etc.
- Other techniques such as oligonucleotide ligation assays, in situ hybridizations, and hybridization to probes anayed on a solid chip may also find use.
- sequence of a gene according to the subject invention can be mutated in various ways known in the art to generate targeted changes, i.e., changes in promoter strength, or sequence of the encoded protein, etc.
- the DNA sequence or protein product of such a mutation will usually be substantially similar to the sequences provided herein.
- the sequence changes can be substitutions, insertions, deletions, or a combination thereof. Deletions can further include larger changes, such as deletions of a domain or exon.
- the subject nucleic acids can be used to generate transgenic, non- human animals and/or site-specific gene modifications in cell lines; suitable methods are known in the art (Grosveld and Kollias, 1992; Hooper, 1993; Murphy and Carter, 1993; Pinkert, 1994).
- the invention provides a non- human transgenic animal comprising, as a transgene integrated into the genome of the animal, a nucleic acid molecule comprising a sequence encoding a subject polypeptide in operable linkage with a promoter, such that the subject polypeptide- encoding nucleic acid molecule is expressed in a cell of the animal. Either a complete or partial sequence of a gene native to the host can be introduced.
- a complete or partial sequence of a gene exogenous to the host animal e.g., a human sequence of the subject invention
- Transgenic animals can be made through homologous recombination, where the endogenous locus is altered.
- DNA constructs for homologous recombination will comprise at least a portion of the human gene or of a gene native to the species of the host animal, wherein the gene has the desired genetic modification(s), and includes regions of homology to the target locus.
- nucleic acid construct is randomly integrated into the genome.
- Vectors for stable integration include plasmids, retroviruses and other animal viruses, and YACs.
- DNA constructs for random integration need not include regions of homology to mediate recombination.
- markers for positive and negative selection are included.
- a detectable marker such as lac Z can be introduced into a locus at which up-regulation of expression will result in a detectable change in phenotype.
- Transformed ES or embryonic cells can be used to produce transgenic animals.
- An embryonic stem (ES) cell line can be a source of embryonic stem cells, or they can be newly obtained from a host animal, e.g., a mouse, rat, or guinea pig.
- the cells are grown on an appropriate fibroblast-feeder layer or in the presence of leukemia inhibiting factor (LIF).
- LIF leukemia inhibiting factor
- the cells are plated for growth onto a feeder layer in an appropriate medium.
- Cells containing the relevant construct can be detected by employing a selective medium and analyzing them for the occunence of homologous recombination or integration of the construct. Positive colonies can be used for embryo manipulation and blastocyst injection.
- Blastocysts are obtained from 4 to 6 week old super-ovulated females.
- the ES cells are trypsinized, and the modified cells are injected into the blastocoel of the blastocyst. After injection, the blastocysts are returned to each uterine horn of pseudopregnant female animals that proceed to term. The resulting offspring are screened for the construct.
- chimeric progeny can be readily detected.
- the chimeric animals are screened for the presence of the modified gene and males and females having the modification are mated to produce homozygous progeny. If the gene alterations cause lethality at some point in development, tissues or organs can be maintained as allogeneic or cong ⁇ nic grafts or transplants, or in in vitro culture.
- the transgenic animals can be any non-human mammal.
- the modified cells or animals are useful in the study of gene function and regulation. For example, a series of small deletions and/or substitutions can be made in the host's native gene to determine the role of different exons in biological processes such as oncogenesis or signal transduction. Of interest is the use of genes to construct transgenic animal models for cancer, where expression of the subject protein is specifically reduced or absent. Specific constructs of interest include anti-sense constructs, which will block expression, expression of dominant negative mutations, and gene over-expression.
- transgenic animals can also be used in functional studies, for example drug screening, to determine the effect of a candidate drug on a biological activity of a subject polypeptide.
- HG1009679 SEQ.ID.NO. 44 SEQ.ID.NO. 167 FP ID SEQ.ID.NO. (NI) SEQ.ID.NO. (PI)
- HG1011836 SEQ.ID, .NO.93 SEQ.ID.NO.216 HG1011837 SEQ.ID.NO.94 SEQ.ID.NO.217 HG1011839 SEQ.ID.NO.95 SEQ.ID.NO.218 HG1011840 SEQ.ID,.NO.96 SEQ.ID.NO.219 HG1011841 SEQ.ID.NO.97 SEQ.ID.NO.220 HG1011842 SEQ.ID.NO.98 SEQ.ID.NO.221 HG1011843 SEQ.ID..NO.99 SEQ.ID.NO.222 HG1011844 SEQ.ID..NO.100 SEQ.ID.NO.223 HG1011845 SEQ.ID.NO.101 SEQ.ID.NO.224 HG1011846 SEQ.ID,.NO.102 SEQ.ID.NO.225 HG1011848 SEQ.ID,.NO.103 SEQ.ID.NO.226 HG1011849 SEQ.ID,
- HG1009529P1 0 (1-671) 1 (397-419) (l-396)(420-671)
- HG1009552P1 0.02 (1-677) (26-677) (1-25) 2 (50-72)(131-150) (l-49)(73-130)(151-
- HG1009568P1 (35-561) (1-561) 1 (465-487) (l-464)(488-561)
- HG1009577P1 0 (35-234) (1-234) 2 (159-181)(190- (1-158)(182-189X213 212) 234)
- HG1009607P1 0 (1-438) 1 (346-368) (l-345)(369-438)
- HG1009798P1 0.01 (1-300) (47-300) (14-46) 1 (45-67) (1-44X68-300)
- HG1009800P1 0 (1-424) 1 (33-55) (1-32X56-424)
- HG1009834P1 0 (1-691) 1 (42-61) (1-41)(62-691)
- HG1009847P1 0.02 (1-1134) 3 (129-151)(255- (l-128)(152-254)(278- 277)(954-976) 953)(977-1134)
- HG1009864P1 0.02 ⁇ (33-501) (1-32) 1 (21-43) (1-20X44-501)
- HG1011836P1 0 (1-135) 1 (115-134) (1-114)(135-135)
- HG1009530P1 258 gi[225047
- HG1009552P1 677 gi
- DGA ⁇ UMAN alpha (Diglyceride DGA_HUMAN kinase, alpha kinase) (DGK-alpha) (Diglyceride kinase) (DAG kinase alpha) (80 (DGK-alpha) (DAG kDa diacylglycerol kinase alpha) (80 kDa kinase) diacylglycerol kinase) HG1009618P1 297gi
- HG1009632P1 349 gi
- HG1009657P1 551 gi
- HG1009662P1 206gi
- HG1009679P1 185gi
- HG1009699P1 455 gi
- HG1009765P1 1126 gi
- HG1009776P1 833gi
- HG1009847P1 1134gi
- HG1009888P1 171 gi
- HG1011828P1 72gi
- HG1011830P1 105gi
- HG1011870P1 110gi
- HG1011872P1 463 gi
- HG1009834P Ribosomal_L7Ae (547-641)
- HG1011868P Ribosomal_L35 Ae (5-101)
- Example 1 Cell-Free Expression in a Wheat Germ Protein Synthesis System: The PROTEIOSTM Kit.
- Protein synthesis is performed using the PROTEIOSTM wheat germ cell-free protein synthesis system described by Madin et al., 2000. This system layers a "buffer mix” layer containing lower molecular weight substances such as amino acids and energy sources, e.g., inter alia, ATP and GTP underneath a "reaction mix” layer containing wheat germ extract, mRNA, creatine kinase, and creatine phosphate.
- amino acids and energy sources e.g., inter alia, ATP and GTP
- reaction mix containing wheat germ extract, mRNA, creatine kinase, and creatine phosphate.
- One or more of the amino acids can be labeled for detection, e.g., with a radioactive label.
- the buffer mix layer and the reaction mix layer mix together gradually, providing a continuously replenishing source of energy and amino acids over approximately 16-24 hours, during which protein synthesis proceeds.
- plasmid DNA is prepared from a target gene open reading frame operably linked to a promoter.
- the plasmid vector is one suitable for expression in plants, e.g., the pEU vector (PROTEIOSTM Plasmid Set).
- DNA is transcribed into mRNA, which is in turn translated to polypeptides in a wheat germ extract with an energy replenishing system.
- a reaction mix is prepared by mixing 33.5 ⁇ l mRNA at a concentration of about 0.3 to about 0.4 ⁇ g/ ⁇ l, and 1.8 ⁇ l distilled water with 10.0 ⁇ l wheat germ extract, 1.0 ul RNase inhibitor (40 U/ ⁇ l), 1.7 ul creatine kinase (10 mg/ml), and 2.0 ⁇ l Buffer #2 as provided by the ProteiosTM wheat germ cell-free protein synthesis core kit, Invitrotech Co., Ltd. (Kyoto, Japan).
- the reaction mix is placed under 250 ⁇ l of "buffer mix" as provided by the ProteiosTM kit in a flat- bottom reaction well. The wells are sealed to prevent vaporization, and the reaction proceeded at 23-26°C for 16 hours.
- Example 2 Cell-Free Expression in a Wheat Germ Protein Synthesis
- Cell-free extract is prepared from wheat embryos by the method of Madin et al., 2000. This extract (300 ⁇ l) is added to the following components to a final volume of 500 ⁇ l reaction mixture: Hepes/KOH, pH 7.8 (24 mM), ATP (1.2 mM), GTP (0.25 mM), creatine phosphate (16 mM), creatine kinase (0.45 mg/ml), DTT (2 mM), spermidine (0.4 mM), each of the 20 amino acids including 2 ⁇ Ci/ml [ 14 C] leucine (0.3 mM), magnesium acetate (2.5 mM), potassium acetate (100 mM), 50 ⁇ g/ml deacylated tRNA prepared from wheat embryos, Nonidet P-40 (0.05%), E- 64 proteinase inhibitor (1 ⁇ M), NaN 3 (0.005%), and mRNA corresponding to the polypeptide of interest (0.02 nmol).
- a dialysis bag with this reaction mixture is added to 5 ml of dialysate solution containing all of the ingredients of the reaction mixture with the exception of creatine kinase. Dialysis is conducted at 23°C. At 24 hour intervals the reaction mixture is supplemented with 0.05 nmol of mRNA corresponding to the polypeptide of interest and 50 ⁇ g creatine kinase. The dialysate solution is replaced every 24 hours. This method has been previously demonstrated to produce protein at a linear rate for a minimum of 72 hours and to be suitable for large-scale preparation of proteins (Madin et al., 2000).
- transmembrane polypeptides are expressed on NanodiscsTM directly upon their production by the cell-free translation system described below in the absence of detergent.
- transmembrane_polypeptides are expressed on NanodiscsTM directly upon their production by the cell-free translation system described below in the presence of detergent.
- the types of detergent and their concentrations beneficial for promoting transmembrane protein synthesis may need to be determined for each individual protein.
- the detergents NP-40 (0.05%), Tween 20 (0.1%), Tween 80 (0.1%), Octylglucoside (0.2%), and Chaps (0.1%) were compatible with the production of proteins in the cell-free expression system described below.
- a 38 nucleotide primer is designed and synthesized which contains the following nineteen nucleotides "5'CCACCCACCACCACCAATG 3'” followed by nucleotides predicted to encode the amino terminus of the transmembrane polypeptide of interest.
- a second reverse primer is designed to a region of the plasmid (containing the cDNA encoding the protein to be expressed) approximately 400 nucleotides downstream from the coding sequence of the gene to be expressed.
- the second primer is designed as the reverse complement of the vector sequence in this region such that this primer will be useful for doing PCR amplification of the coding sequence of the open reading frame to be expressed.
- the second primer is typically 17-23 nucleotides in length with a Tm of approximately 55-65°C.
- a purified plasmid containing the cDNA to be expressed or E. coli cells containing the plasmid that contains the cDNA to be expressed is then added as template to a standard PCR reaction that includes the two primers described above, standard PCR reagents, and a DNA polymerase that has proof-reading activity, and subjected to 15-30 cycles of PCR amplification.
- the product of this PCR reaction is called "PCR1 coding template.”
- a separate PCR reaction is used to prepare a "GST-Mega primer" for a GST- fusion expression template.
- a PCR reaction is prepared using the primer 5'GGTGACACTATAGAACTCACCT ATCTCCCCAACA 3' and the primer 5'GGGCCCCTGGAACAGAACTTC 3' and amplified in a standard PCR reaction that includes the two primers described above, standard PCR reagents, and a DNA polymerase that has proof-reading activity, then subjected to 15-30 cycles of PCR amplification.
- the PCR product is subjected to exonuclease I treatment for 30 min at 37°C, then heat-inactivated at 80 °C for 30 min, and the PCR product purified by agarose gel electrophoresis and extracted using a gel purification kit (Amersham) to produce the "GST-Mega primer.”
- the "GST-Mega primer” is then used to create a GST-fusion expression template by combining it with the product of the first PCR reaction (PCR1 coding template) containing the coding region of the cDNA to be expressed.
- An aliquot of the PCR1 coding template (0.5 ⁇ l) is mixed with an aliquot of the GST-Mega primer (1 ⁇ l) and a primer 5'GCGTAGCATTTAGGTGACACT 3' that encodes part of the SP6 promoter sequence and anneals to the 5' end of the GST Mega primer, and a second primer that is designed to a region of the plasmid approximately 300-350 nucleotides downstream from the coding sequence of the gene to be expressed.
- This second primer is designed as the reverse complement of the vector sequence in this region such that this primer will be useful for doing PCR amplification from the PCR1 coding template.
- This second primer is typically 17- 23 nucleotides in length with a Tm of approximately 55-65 °C.
- the "GST-fusion expression template” is then generated by doing a standard PCR reaction using standard PCR reagents, and a DNA polymerase that has proof-reading activity and subjected to 15-30 cycles of PCR amplification.
- An in vitro transcription reaction (50 ⁇ l) is then prepared using 5 ⁇ l of the GST-fusion expression template in the following buffer, 80 mM Hepes KOH pH 7.8, 16 mM Mg(OAc) 2 , 2 mM spermidine, 10 mM DTT containing 1 unit of SP6 (Promega), and 1 unit of RNasin (Promega) and incubated for 3 hours at 37°C.
- the mRNA is then subjected to ethanol precipitation by the addition of 200 ⁇ l of RNase- free water, 37.5 ⁇ l of 5 M ammonium acetate, and 862 ⁇ l of 99% ethanol, mixed by vortexing and then pelleted by centrifugation at 15,000 x g for 10 min at 4°C.
- the mRNA pellet is then washed in 70% ethanol and again pelleted by centrifugation at 15,000 x g for 5 min at 4°C.
- the in vitro translation reaction is performed with a stock of 2x Dialysis Buffer of 20 mM Hepes buffer pH 7.8 (KOH), 200 mM KOAc, 5.4 mM Mg(OAc) 2 , 0.8 mM Spermidine, 100 micromolar DTT, 2.4 mM ATP, 0.5 mM GTP, 32 mM creatine phosphate, 0.02 % NaN 3 , and 0.6 mM Amino Acid Mix minus ASP, TRP, GLU, ILE, LEU, PHE, and TYR.
- amino acids ASP, TRP, GLU, ILE, LEU, PHE, and TYR are prepared separately as an 80 mM stock in IN HCl and after complete dissolution are added to a final concentration of 0.6 mM. After addition of all ingredients, the 2x Dialysis Buffer stock is adjusted to pH 7.6 using 5N KOH, filter sterilized, and stored frozen in aliquots at -80°C.
- a 50 ⁇ l translation mixture is prepared that includes Wheat Germ Reagent at a final OD 260nm of 60 plus the volume of lx Dialysis Buffer (to which 2 mM DTT has been added) that brings the final volume to 50 ⁇ l (Wheat Germ Reagent comprises a concentration of lx Dialysis Buffer).
- Wheat Germ Reagent comprises a concentration of lx Dialysis Buffer.
- the complete translation mixture containing the resuspended mRNA is then layered under 250 ⁇ l of lx Dialysis Buffer present in one well of 96 well round-bottom microtiter plate to set up the Bilayer Reaction.
- the plate is then sealed manually with a plate seal and incubated for 20 hours at 26°C.
- the translation mixture is transferred to a tube and 10 ⁇ l of glutathione-Sepharose is added and incubated, with mixing, for 1 hour at 4°C.
- the Sepharose beads containing the bound GST fusion protein are then washed three times in phosphate buffered-saline containing 0.25 M sucrose and 2 mM DTT.
- a fourth wash is then performed with protease cleavage buffer containing 50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 2 mM DTT, and 0.25 M sucrose.
- the melting point of the first 20 to 24 bases of the primer can be calculated by counting total A and T residues, then multiplying by 2.
- the melting point of the first 20 to 24 bases of the reverse complement with the sequences written from 5-prime to 3-prime can be calculated by counting the total G and C residues, then multiplying by 4. Both start and stop codons can be present in the final amplified clone.
- the length of the primers is such to obtain melting temperatures within 63 degrees C to 68 degrees C. Adding the bases "CACC" to the forward primer renders it compatible for cloning the PCR product with the TOPO pENTR/D (Invitrogen, CA).
- cDNA can be prepared by the following method. Between 200 ng and 1.0 ⁇ g mRNA is added to 2 ⁇ l DMSO and the volume adjusted to 11 ⁇ l with DEPC-treated water. One ⁇ l Oligo dT is added to the tube, and the mixture is heated at 70° C for 5 min., quickly chilled on ice for 2 min., and the mixture is collected at the bottom of the tube by brief centrifugation.
- 1 st strand components are then added to the mRNA mixture: 2 ⁇ l 10X Stratascript (Stratagene, CA) 1 st strand buffer, 1 ⁇ l 0.1 M DTT, 1 ⁇ l 10 mM dNTP mix (10 mM each of dG, dA, dT and dCTP), 1 ⁇ l RNAse inhibitor, 3 ⁇ l Stratascript RT (50 U/ ⁇ l).
- the contents are gently mixed and the mixture collected by brief centrifugation.
- the mixture is incubated in a 42° C water bath for 1 hour, placed in a 70° C water bath for 15 min.
- RNAse H is then added to the tube, the contents are mixed well, incubated at 37° C in a water bath for 20 min., and centrifuged briefly in a microfuge to collect the reaction product at the bottom of the reaction vessel.
- the reaction mixture can proceed directly to PCR or be stored at - 20° C.
- Full length PCR can be achieved by placing the products of the reaction described in Example 7, with primers diluted to 5 ⁇ M in water, into a reaction vessel and adding a reaction mixture composed of lx Taq buffer, 25 mM dNTP, 10 ng cDNA pool, TaqPlus (Stratagene, CA) (5u/ul), PfuTurbo (Stratagene, CA) (2.5u/ul), water.
- the contents of the reaction vessel are then mixed gently by inversion 5-6 times, placed into a reservoir where 2 ⁇ l F t /Ri primers are added, the plate sealed and placed in the thermocycler.
- the PCR reaction is comprised of the following eight steps. Step 1: 95° C for 3 min.
- Step 2 94° C for 45 sec.
- Step 3 0.5° C/sec to 56-60° C.
- Step 4 56-60° C for 50 sec.
- Step 5 72° C for 5 min.
- Step 6 Go to step 2, perform 35-40 cycles.
- Step 7 72° C for 20 min.
- Step 8 4° C.
- the products can then be separated on a standard 0.8 to 1.0% agarose gel at 40 to 80 V, the bands of interest excised by cutting from the gel, and stored at -20° C until extraction.
- the material in the bands of interest can be purified with QIAquick 96 PCR Purification Kit (Qiagen, CA) according to the manufacturer instructions. Cloning can be performed with the Topo Vector pENTR/D-TOPO vector (Invitrogen, CA) according to the manufacturer's instructions.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Applications Claiming Priority (20)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US46371603P | 2003-04-18 | 2003-04-18 | |
US60/463,716 | 2003-04-18 | ||
US46720103P | 2003-05-02 | 2003-05-02 | |
US60/467,201 | 2003-05-02 | ||
US47664103P | 2003-06-09 | 2003-06-09 | |
US47662103P | 2003-06-09 | 2003-06-09 | |
US60/476,641 | 2003-06-09 | ||
US60/476,621 | 2003-06-09 | ||
US48521703P | 2003-07-08 | 2003-07-08 | |
US48521803P | 2003-07-08 | 2003-07-08 | |
US60/485,217 | 2003-07-08 | ||
US60/485,218 | 2003-07-08 | ||
US48689103P | 2003-07-15 | 2003-07-15 | |
US60/486,891 | 2003-07-15 | ||
US49335603P | 2003-08-08 | 2003-08-08 | |
US49334103P | 2003-08-08 | 2003-08-08 | |
US60/493,341 | 2003-08-08 | ||
US60/493,356 | 2003-08-08 | ||
US50505903P | 2003-09-08 | 2003-09-08 | |
US60/505,059 | 2003-09-24 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2004094598A2 true WO2004094598A2 (fr) | 2004-11-04 |
WO2004094598A3 WO2004094598A3 (fr) | 2005-10-27 |
Family
ID=33314652
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2004/011912 WO2004094598A2 (fr) | 2003-04-18 | 2004-04-19 | Procedes d'utilisation pour de nouveaux polypeptides humains codes par des polynucleotides |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2004094598A2 (fr) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007119759A1 (fr) * | 2006-04-11 | 2007-10-25 | Eisai R & D Management Co., Ltd. | Marqueur 187a5 d'une cellule progénitrice de neurones synthétisant de la dopamine |
US8945876B2 (en) | 2011-11-23 | 2015-02-03 | University Of Hawaii | Auto-processing domains for polypeptide expression |
US9453840B2 (en) | 2011-07-27 | 2016-09-27 | Kyoto University | Markers for dopaminergic neuron progenitor cells |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6221658B1 (en) * | 1996-04-22 | 2001-04-24 | University Of Utah Research Foundation | Diacylglycerol kinase isoforms epsilon and zeta and methods of use thereof |
-
2004
- 2004-04-19 WO PCT/US2004/011912 patent/WO2004094598A2/fr active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6221658B1 (en) * | 1996-04-22 | 2001-04-24 | University Of Utah Research Foundation | Diacylglycerol kinase isoforms epsilon and zeta and methods of use thereof |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007119759A1 (fr) * | 2006-04-11 | 2007-10-25 | Eisai R & D Management Co., Ltd. | Marqueur 187a5 d'une cellule progénitrice de neurones synthétisant de la dopamine |
US8198081B2 (en) | 2006-04-11 | 2012-06-12 | Eisai R&D Management Co., Ltd. | Dopaminergic neuron progenitor cell marker 187A5 |
JP5033121B2 (ja) * | 2006-04-11 | 2012-09-26 | エーザイ・アール・アンド・ディー・マネジメント株式会社 | ドーパミン産生ニューロン前駆細胞マーカー187a5 |
US8604173B2 (en) | 2006-04-11 | 2013-12-10 | Eisai R&D Management Co., Ltd. | Dopaminergic neuron progenitor cell marker 187A5 |
US9453840B2 (en) | 2011-07-27 | 2016-09-27 | Kyoto University | Markers for dopaminergic neuron progenitor cells |
US8945876B2 (en) | 2011-11-23 | 2015-02-03 | University Of Hawaii | Auto-processing domains for polypeptide expression |
Also Published As
Publication number | Publication date |
---|---|
WO2004094598A3 (fr) | 2005-10-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20020102569A1 (en) | Diagnostic marker for cancers | |
WO2004093804A2 (fr) | Polypeptides humains codes par des polynucleotides et methodes d'utilisation associees | |
WO2004035732A2 (fr) | Polypeptides humains codes par des polynucleotides et procedes d'utilisation de ces polypeptides | |
WO2004020595A2 (fr) | Nouveaux polypeptides humains codes par des polynucleotides | |
WO2006014999A2 (fr) | Compositions et methodes d'utilisation de modulateurs de nectine 4, de semaphorine 4b, d'igsf9 et de kiaa0152 dans le traitement de maladies | |
US7335475B2 (en) | PR/SET-domain containing nucleic acids, polypeptides, antibodies and methods of use | |
US20090239219A1 (en) | Telomerase expression repressor proteins and methods of using the same | |
US7795416B2 (en) | Telomerase expression repressor proteins and methods of using the same | |
US20090286954A1 (en) | Human cDNA Clones Comprising Polynucleotides Encoding Polypeptides and Methods of Their Use | |
US20040010119A1 (en) | Novel proteins and nucleic acids encoding same | |
US20070258949A1 (en) | Human Cdna Clones Comprising Polynucleotides Encoding Polypeptides and Methods of Their Use | |
WO2004094651A2 (fr) | Nouveaux polypeptides humains codes par des polynucleotides | |
WO2004094598A2 (fr) | Procedes d'utilisation pour de nouveaux polypeptides humains codes par des polynucleotides | |
US20020076794A1 (en) | Mammalian pro-apoptotic Bok genes and their uses | |
WO2005070448A2 (fr) | Procedes d'utilisation de la proteine sfrp-3 dans la prevention et le traitement de maladies | |
WO2004020591A2 (fr) | Methodes d'utilisation de nouveaux polypeptides humains codes par des polynucleotides | |
WO2004038003A2 (fr) | Polypeptides humains codes par des polynucleotides et methodes d'utilisation | |
US20040253598A1 (en) | Vesicle-associated proteins | |
US20040254350A1 (en) | Immune response associated proteins | |
WO2004039952A2 (fr) | Procedes d'utilisation de polypeptides humains codes par des polynucleotides | |
US20070274988A1 (en) | Kiaa0779, Splice Variants Thereof, and Methods of Their Use | |
CA2497937A1 (fr) | Facteur nucleaire du recepteur des cellules t activees | |
WO2004046310A2 (fr) | Nouveaux polypeptides de souris codes par des polynucleotides et leurs procedes d'utilisation | |
US20030049623A1 (en) | PR/SET-domain containing nucleic acids, polypeptides, antibodies and methods of use | |
WO2005005597A2 (fr) | Nouveaux polypeptides de souris codes par des polynucleotides et leurs procedes d'utilisation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase |