WO2002053700A2 - Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof - Google Patents

Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof Download PDF

Info

Publication number
WO2002053700A2
WO2002053700A2 PCT/US2001/049442 US0149442W WO02053700A2 WO 2002053700 A2 WO2002053700 A2 WO 2002053700A2 US 0149442 W US0149442 W US 0149442W WO 02053700 A2 WO02053700 A2 WO 02053700A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
binding fragment
antigen
complex
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2001/049442
Other languages
English (en)
French (fr)
Other versions
WO2002053700A3 (en
Inventor
Janette Lazarovits
Yocheved Hagai
Daniel Plaksin
Tikva Vogel
Abraham Nimrod
Hagit Mar-Haim
Ester Szanthon
Tamar Richter
Boaz Amit
Lena Kooperman
Tuvia Peretz
Avigdor Levanon
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Savient Pharmaceuticals Inc
Original Assignee
Savient Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL15668901A priority Critical patent/IL156689A0/xx
Priority to BRPI0116764-2A priority patent/BR0116764A/pt
Priority to HU0700079A priority patent/HUP0700079A2/hu
Priority to EP01994330A priority patent/EP1406930A4/en
Priority to KR10-2003-7008890A priority patent/KR20030091953A/ko
Priority to CA002433225A priority patent/CA2433225A1/en
Application filed by Savient Pharmaceuticals Inc filed Critical Savient Pharmaceuticals Inc
Priority to MXPA03005945A priority patent/MXPA03005945A/es
Priority to JP2002555211A priority patent/JP2005503756A/ja
Publication of WO2002053700A2 publication Critical patent/WO2002053700A2/en
Anticipated expiration legal-status Critical
Publication of WO2002053700A3 publication Critical patent/WO2002053700A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3061Blood cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)

Definitions

  • the present invention relates to epitopes that are present on cells, such as cancer cells, metastatic cells, leukemia cells, and platelets, and that are important in such diverse physiological phenomena as cell rolling, metastasis, inflammation, auto-immune diseases, such as idiopathic tl rombocytopenia purpura (ITP), adhesion, thrombosis and/ or restenosis, and aggregation.
  • the present invention relates to therapeutic and diagnostic methods and compositions using antibodies directed against such epitopes.
  • the present invention also relates to the field of tissue targeting and identification, with the aid of phage display technology, of peptides and polypeptides that specifically bind to target cells.
  • Such peptides and polypeptides are antibodies and antigen binding fragments thereof, constructs thereof, fragments of either or constructs of a fragment. More particularly, the peptides and polypeptides may have anti-cancer activity, anti-metastatic activity, anti-leukemia activity, anti-viral activity, anti-infection activity, and/or activity against other diseases, such as inflammatory diseases, diseases involving abnormal or pathogenic adhesion, thrombosis and/ or restenosis, diseases involving abnormal or pathogenic aggregation, and autoimmune diseases, cardiovascular diseases such as myocardial infarction, retinopathic diseases, diseases caused by sulfated tyrosine- dependent protein-protein interactions, and diseased cells generally.
  • diseases such as myocardial infarction, retinopathic diseases, diseases caused by sulfated tyrosine- dependent protein-protein interactions, and diseased cells generally.
  • Tissue-selective targeting of therapeutic agents is an emerging discipline in the pharmaceutical industry. New cancer treatments based on targeting have been designed to increase the specificity and potency of the treatment, while reducing toxicity, thereby enhancing overall efficacy.
  • Mouse monoclonal antibodies (MAb's) to tumor- associated antigens have been employed - in an attempt to target toxin, radionucleotide, and chemotherapeutic conjugates to tumors.
  • differentiation antigens such as CD 19, CD20, CD22 and CD25, have been exploited as cancer specific targets in treating hematopoietic malignancies.
  • this approach has several limitations. One limitation is the difficulty of isolating appropriate monoclonal antibodies that display selective binding.
  • a second limitation is the need for high antibody immunogenicity as a prerequisite for successful antibody isolation.
  • a third limitation is that the final product comprises non-human sequences, which gives rise to an immune response to the non-human material (e.g., human anti-mouse antibody-HAMA response).
  • the HAMA response often results in a shorter serum half-life and prevents repetitive treatments, thus diminishing the therapeutic value of the antibody.
  • This latter limitation has stimulated interest both in engineering chimeric or humanized monoclonal antibodies of murine origin, and in discovering human antibodies.
  • Another limitation of this approach is that it enables the isolation of only a single antibody species directed against only known and purified antigens. Moreover, this method is not selective insofar as it allows for the isolation of antibodies against cell surface markers that are present on normal, as well as on malignant, cells.
  • MAb's There are many factors that influence the therapeutic efficacy of MAb's for treating cancer. These factors include specificity of antigen expression on tumor cells, level of expression, antigenic heterogeneity and accessibility of the tumor mass. Leukemia and lymphoma have been generally more responsive to treatment with antibodies than solid tumors, such as carcinomas. MAb's rapidly bind to leukemia and lymphoma cells in the bloodstream and easily penetrate to malignant cells in lymphatic tissue, thus making lymphoid tumors excellent candidates for MAb-based therapy. An ideal system entails identifying a MAb that recognizes a marker on the cell surface of stem cells that are producing malignant progeny cells.
  • Phage libraries are used to select random single chain Fv's (scFv's) that bind to isolated, pre-determined target proteins such as antibodies, hormones and receptors.
  • scFv's random single chain Fv's
  • target proteins such as antibodies, hormones and receptors.
  • antibody display libraries in general, and phage scFv libraries in particular, facilitates an alternative means of discovering unique molecules for targeting specific, yet unrecognized and undetermined, cell surface moieties.
  • Leukemia, lymphoma, and myeloma are cancers that originate in the bone marrow and lymphatic tissues and are involved in uncontrolled growth of cells.
  • Acute lymphoblastic leukemia (ALL) is a heterogeneous disease that is defined by specific clinical - and immunological characteristics. Like other forms of ALL, the definitive cause of most cases of B-cell ALL (B-ALL) is not known although, in many cases, the disease results from acquired genetic alterations in the DNA of a single cell, causing it to become abnormal and multiply continuously. Prognosis for patients afflicted with B- ALL is significantly worse than for patients with other leukemias, both in children and in adults.
  • AML Acute Myelogenous Leukemia
  • myeloid series erythrocytes, granulocytes, monocytes, and platelets.
  • AML is associated with acquired genetic alterations that result in replacement of normally differentiated myeloid cells with relatively undifferentiated blasts, exhibiting one or more type of early myeloid differentiation.
  • AML generally evolves in the bone marrow and, to a lesser degree, in the secondary hematopoietic organs.
  • AML primarily affects adults, peaking in incidence between the ages of 15-40 years, but it is also known to affect both children and older adults. Nearly all patients with AML require treatment immediately after diagnosis to achieve clinical remission, in which there is no evidence of abnormal levels of circulating undifferentiated blast cells.
  • a humanized version of the monoclonal ' antibody MuMAb4D5 directed to the extracellular domain of PI 85 - growth factor receptor (HER2) - was approved by the FDA and is being used to treat human breast cancer (US Patent Nos. 5,821,337 and 5,720,954).
  • the antibody is capable of inhibiting tumor cell growth that is dependent on the HER2 growth factor receptor.
  • a chimeric antibody against CD20 which causes rapid depletion of peripheral B cells, including those associated with lymphoma, was recently approved by the FDA (US Patent No. 5,843,439). The binding of this antibody to target cells results in complement-dependent lysis. This product has recently been approved and is currently being used in the clinic to treat low-grade B-cell non-Hodgkin's lymphoma.
  • an additional anti-CD33 antibody (HumM195), currently in clinical trials, was conjugated to several cytotoxic agents, including the gelonin toxin (McGraw et al, Cancer Immunol. Immunother, 39, 367-374 (1994)) and radioisotopes 131 I (Caron et al, Blood 83, 1760-1768 (1994)), 90 Y (Jurcic et al, Blood Supplement, 92, 613a (1998)) and 213 Bi (Humm et al, Blood Supplement, 38:231P (1997)).
  • gelonin toxin McGraw et al, Cancer Immunol. Immunother, 39, 367-374 (1994)
  • radioisotopes 131 I Caron et al, Blood 83, 1760-1768 (1994)
  • 90 Y Jurcic et al, Blood Supplement, 92, 613a (1998)
  • 213 Bi Human et al, Blood Supplement, 38:231P (1997)).
  • a chimeric antibody against the leukocyte antigen CD45 (cHuLym3) is in clinical studies for treatment of human leukemia and lymphoma (Sun et al, Cancer Immunol. Immunother., 48, 595-602 (2000)). h in vitro assays, specific cell lysis was observed in ADCC (antibody dependent cell-mediated cytotoxicity) assays (Henkart, Immunity, I, 343-346 (1994); Squier and Cohen, Current Opin. Immunol, 6, 447-452 (1994)). [10.] In contrast to mouse monoclonal humanization and construction of chimeric antibodies, the use of phage display technology enables the isolation of scFv's comprising fully human sequences.
  • Platelets, fibrinogen, GPIb, selectins, and PSGL-1 each play an important role in several pathogenic conditions or disease states, such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions, autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis and/ or restenosis, and abnormal or pathogenic aggregation.
  • pathogenic conditions or disease states such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions, autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis and/ or restenosis, and abnormal or pathogenic aggregation.
  • antibodies that crossreact with platelets and with these molecules would be useful in the diagnosis and treatment of diseases and disorders involving these and other pathogenic conditions.
  • Platelets are well-characterized components of the blood system and play several important roles in hemostasis, thrombosis and/ or restenosis, and restenosis. Damage to blood vessel sets in motion a process known as hemostasis, which is characterized by series of sequential events.
  • the initial reaction to damaged blood vessels is the adhesion of platelets to the affected region on the inner surface of the vessel.
  • the next step is the aggregation of many layers of platelets onto the previously adhered platelets, forming the hemostatic plug. This clump of platelets seals the vessel wall.
  • the hemostatic plug is strengthened by the deposition of fibrin polymers. The clot is degraded only when the damage has been repaired.
  • Tumor metastasis is perhaps the most important factor limiting the survival of cancer patients. Accumulated data indicate that the ability of tumor cells to interact with host platelets represents one of the indispensable determinants of metastasis. Leslie Oleksowicz, Z.M., "Characterization Of Tumor-Induced Platelet Aggregation: The Role Of Immunorelated GPIb And GPIIb/IIIa Expression By MCF-7 Breast Cancer Cells," Thrombosis Research 79: 261-274 (1995).
  • Each step in the process of hemostasis requires the presence of receptors on the platelet surface.
  • One receptor that is important in hemostasis is the glycoprotein Ib-IX complex (also known as CD42). This receptor mediates adhesion (initial attachment) of platelets to the blood vessel wall at sites of injury by binding von WiUebrand factor (vWF) in the subendothehum. It also has crucial roles in two other platelet functions important in hemostasis: (a) aggregation of platelets induced by high shear in regions of arterial stenosis and (b) platelet activation induced by low concentrations of thrombin.
  • the GPIb-IX complex is one of the major components of the outer surface of the platelet plasma membrane.
  • the GPIb-IX complex comprises three membrane- spanning polypeptides- a disulfide-linked 130 kDa ⁇ -chain and 25 kDa ⁇ -chain of GPIb and noncovalently associated GPIX (22 kDa). All four units are presented in equimolar amounts on the platelet membrane, for efficient cell-surface expression and function of CD42 complex, indicating that proper assembly of the three subunits into a complex is required for full expression on the plasma membrane.
  • the ⁇ -chain of GPIb consists of three distinct structural domains: (1) a globular N-terminal peptide domain containing leucine-rich repeat sequences and Cys-bonded flanking sequences; (2) a highly glycosylated mucin-like macroglycopeptide domain; and (3) a membrane-associated C- terminal region that contains the disulfide bridge to GPIb ⁇ and transmembrane and cytoplasmic sequences. [18.] Several lines of evidence indicate that the vWF and thrombin-binding domain of the GPIb-IX complex reside in a globular region that encompasses approximately 300 amino acids at the amino terminus of GPIb ⁇ .
  • the human platelets GPIb-IX complex is a key membrane receptor mediating both platelet function and reactivity. Recognition of subendothelial-bound vWF by GPIb allows platelets to adhere to damaged blood vessels. Further, binding of vWF to GPIb ⁇ also induces platelet activation, which may involve the interaction of a cytoplasmic domain of the GPIb-IX with cytoskeleton or phospolipase A2. Moreover, GPIb ⁇ contains a high-affinity binding site for ⁇ -thrombin, which, by an as-yet poorly defined mechanism, facilitates platelet activation.
  • the N-terminal globular domain of GPIb ⁇ contains a cluster of negatively charged amino.
  • Several lines of evidence indicate that, in transfected CHO cells expressing GPIb-IX complex and in platelet GPIb ⁇ , the three tyrosine residues contained in this domain (Tyr-276, Tyr-278, and Tyr-279) undergo sulfation.
  • Protein sulfation is a widespread posttranslational modification that involves enzymatic covalent attachment of sulfate, either to sugar side chains or to the polypeptide backbone. This modification occurs in the trans-Golgi compartment and, therefore affects only protein that traverses this compartment.
  • proteins include secretory proteins, proteins targeted for granules, and the extracellular regions of plasma membrane proteins.
  • Tyrosine is an amino acid residue presently known to undergo sulfation. J.W. Kehoe et al, Chemistry and Biol 7: R57-R61 (2000).
  • Other amino acids, for example threonine may perhaps also undergo sulfation, particularly in diseased cells.
  • GPIb ⁇ CD42
  • vWF subendothehum
  • the P-, E-, and L- Selectins are a family of adhesion molecules that, among other functions, mediate rolling of leukocytes on vascular endothelium.
  • P- Selectin is stored in granules in platelets and is transported to the surface after activation by thrombin, histamine, phorbol ester, or other stimulatory molecules.
  • P-Selectin is also expressed on activated endothelial cells.
  • E-Selectin is expressed on endothelial cells
  • L-Selectin is expressed on neutrophils, monocytes, T cells, and B cells.
  • P-Selectin Glycoprotein Ligand-1 (PSGL-1, also called CD162) is a mucin glycoprotein ligand for P-Selectin, E-Selectin, and L-Selectin.
  • PSGL-1 is a disulfide- linked homodimer that has a PACE (Paired Basic Amino Acid Converting Enzymes) cleavage site.
  • PSGL-1 also has three potential tyrosine sulfation sites followed by approximately 15 decamer repeats that are high in proline, serine, and threonine.
  • the extracellular portion of PSGL-1 contains three N-linked glycosylation sites and has numerous sialylated, fucosylated O-linked oligosaccharide branches.
  • PSGL-1 has 361 residues in HL60 cells, with a 267 residue extracellular region, a 25 residue trans-membrane region, and a 69 residue intracellular region.
  • the sequence encoding PSGL-1 is in a single exon, so alternative splicing should not be possible.
  • PSGL-1 in HL60 cells, and in most cell lines has 15 consecutive repeats of a 10 residue consensus sequences present in the extracellular region, but there are 14 and 16 repeats of this sequence, as well, in polymorphonuclear leukocytes, monocytes, and several other cell lines, including most native leukocytes.
  • PSGL-1 forms a disulfide-bonded homodimer on the cell surface.
  • PSGL-1 is expressed on neutrophils as a dimer, with apparent molecular weight of both 250 kDa and 160 kDa, whereas on HL60 the dimeric form is -220 kDa. When analyzed under reducing conditions, each subunit is reduced by half. Differences in molecular mass may be due to polymorphisms in the molecule caused by the presence of different numbers of decamer repeats. Leukocyte Typing NL Edited by T. Kishimoto et al. (1997).
  • PSGL-1 is expressed on most blood leukocytes, such as neutrophils, monocytes, leukocytes, subset of B cells, and all T cells and mediates rolling of neutrophils on P-Selectin. Leukocyte Typing NL Edited by T. Kishimoto et al. (1997). PSGL-1 may also mediate neutrophil-neutrophil interaction via binding with L-Selectin, thereby mediating inflammation. Snapp, et al, Blood 91(1): 154-64 (1998).
  • PSGL-1 mediates rolling of leukocytes on activated endothelium, on activated platelets, and on other leukocytes and inflammatory sites.
  • a commercially available monoclonal antibody to human PGSL-1, KPLl was generated and shown to inhibit the interactions between PGSL-1 and P-selectin and between PGSL-1 and L-selectin.
  • the ICPLl epitope was mapped to the tyrosine sulfation consensus motif of PGSL-1 (YEYLDYD).
  • KPLl recognizes only this particular epitope and does not cross-react with sulfated epitopes present on other cells, such as B-CLL cells, AML cells, metastatic cells, multiple myeloma cells, and the like.
  • Platelets are also involved in the process of metastasis; when metastatic cancer cells enter the blood stream, multicellular complexes composed of platelets and leukocytes coating the tumor cells are formed. These complexes, which may be referred to as microemboli, aid the tumor cells in evading the immune system.
  • the coating of tumor cells by platelets requires expression of P-selectin by the platelets.
  • PSGL-1 and GPIb share structural similarity, having mucin-like, highly glycosylated ligand binding regions. Afshar-Kharghan, et al, Blood 97(10): 3306-7 (2001).
  • PSGL-1 has been found on all leukocytes: neutrophils, monocytes, lymphocytes, activated peripheral T-cells, granulocytes, eosinophils, platelets and on some CD34 positive stem cells and certain subsets of B-cells.
  • P-Selectin is selectively expressed on activated platelets and endothelial cells. Interaction between P-Selectin and PSGL-1 promotes rolling of leukocytes on vessel walls, and abnormal accumulation of leukocytes at vascular sites results in various pathological inflammations. Stereo-specific contributions of individual tyrosine sulfates on PSGL-1 are important for the binding of P-Selectin to PSGL-1.
  • Normal fibrinogen which is the more abundant form (comprising -90% of the fibrinogen found in the body), is composed of two identical 55 kDa alpha ( ⁇ ) chains, two identical 95 kDa beta ( ⁇ ) chains, and two identical 49.5 kDa gamma ( ⁇ ) chains.
  • Normal variant fibrinogen which is the less abundant form (comprising -10%) of the fibrinogen found in the body), is composed of two identical 55 kDa alpha ( ⁇ ) chains, two identical 95 kDa beta ( ⁇ ) chains, one 49.5 kDa gamma ( ⁇ ) chain, and one 50.5 kDa gamma prime ( ⁇ ') chain.
  • the gamma and gamma prime chains are both coded for by the same gene, with alternative splicing occurring at the 3' end.
  • Normal gamma chain is composed of amino acids 1-411.
  • Normal variant gamma prime chain is composed of 427 amino acids: amino acids 1-407 are the same as those in the normal gamma chain, and amino acids 408-427 are NRPEHPAETEYDSLYPEDDL. This region is normally occupied with thrombin molecules.
  • Fibrinogen is converted into fibrin by the action of thrombin in the presence of ionized calcium to produce coagulation of the blood. Fibrin is also a component of thrombi, and acute inflammatory exudates.
  • Platelets, and molecules that play important roles in cell-cell interactions, cell-matrix interactions, platelet-platelet interactions, platelet-cell interactions, platelet-matrix interactions, cell rolling and adhesion, and hemostasis also play important roles in pathogenic conditions or disease states, such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions, autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis and/ or restenosis, and abnormal or pathogenic aggregation.
  • pathogenic conditions or disease states such as abnormal or pathogenic inflammation, abnormal or pathogenic immune reactions, autoimmune reactions, metastasis, abnormal or pathogenic adhesion, thrombosis and/ or restenosis, and abnormal or pathogenic aggregation.
  • antibodies that crossreact with platelets and with these molecules would be useful in the diagnosis and treatment of diseases and disorders involving these and other pathogenic conditions. There is therefore a need to identify common epitopes in or among these molecules and to identify antibodies capable of crossreacting therewith.
  • Antibodies may be provided in many forms, such as fragments, complexes, and multimers.
  • Examples of antibody fragments include single chain Fv (scFv) fragments and Fab fragments.
  • Single chain Fv (scFv) fragments are comprised of the variable domains of the heavy (N ⁇ ) and light (N L ) chains of an antibody tethered together by a polypeptide linker.
  • the linker is long enough to allow the (N ⁇ ) and the (V L ) domains to fold into a functional Fv domain enabling the scFv to recognize and bind its target with the similar or increased affinity of the parent antibody.
  • scFv monomers are designed with the C-terminal end of the N H domain tethered by a polypeptide linker to the ⁇ -terminal residue of the V L .
  • a polypeptide linker to the ⁇ -terminal residue of the V L .
  • an inverse orientation is employed: the C-terminal end of the NL domain is tethered to the ⁇ -terminal residue of N ⁇ through a polypeptide linker.
  • Power B., et al., J. Immun. Meth. 242, 193-204 (2000).
  • the polypeptide linker is typically around fifteen amino acids in length.
  • the scFvs can not fold into a functional Fv domain and instead associate with a second scFv to form a diabody. Further reducing the length of the linker to less than three amino acids forces the scFv association into trimers or tetramers, depending on the linker length, composition and Fv domain orientations.
  • a scFv may be employed as a blocking agent to bind a target receptor and thus block the binding of the "natural" ligand.
  • this higher affinity may be useful when the target receptors are involved in adhesion and rolling or when the target receptors are on cells present in areas of high sheer flow, such as platelets.
  • Another object of the invention is to provide methods of using such isolated epitopes to develop antibodies which recognize and crossreact with epitopes that are present on molecules that are instrumental in processes such as cell rolling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, and aggregation, and which are also present on diseased cells, such as AML cells, B-CLL cells, multiple myeloma cells, and metastatic cells.
  • Other objectives of the invention include the use of such antibodies in the development and provision of medicaments for the inhibition of cell rolling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, and aggregation, and for the treatment of diseases, such as AML, B-CLL, multiple myeloma, metastasis, cardiovascular diseases such as myocardial infarction, retinopathic diseases, diseases caused by sulfated tyrosine-dependent protein- protein interactions, or other diseases in which such cellular functions or actions play a significant role.
  • diseases such as AML, B-CLL, multiple myeloma, metastasis, cardiovascular diseases such as myocardial infarction, retinopathic diseases, diseases caused by sulfated tyrosine-dependent protein- protein interactions, or other diseases in which such cellular functions or actions play a significant role.
  • diseases such as AML, B-CLL, multiple myeloma
  • metastasis or other diseases in which such cellular functions or actions as cell rolling, inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, and aggregation play a significant role.
  • the present invention provides epitopes that are found on ligands and receptors that play important roles in such diverse processes as inflammation, immune reactions, metastasis, adhesion, thrombosis, restenosis, and aggregation. Epitopes according to the present invention are also found on leukemia and tumor cells, particularly on leukemias of myeloid origin. Thus, these epitopes are useful targets for the therapeutic mediation of these processes.
  • Antibodies directed against such epitopes are useful as therapeutic agents against cancers (both as anti-tumor agents and as anti- metastatic agents), leukemias, autoimmune diseases, inflammatory diseases, cardiovascular diseases such as myocardial infarction, retinopathic diseases and other diseases mediated by abnormal platelet function, and diseases caused by sulfated tyrosine-dependent protein-protein interactions.
  • the present invention provides such antibodies, compositions comprising the antibodies, and therapeutic and diagnostic methods using the antibodies.
  • the present invention provides an isolated epitope comprising the formula
  • W is any amino acid other than Aspartate and Glutamate
  • Y is any naturally occurring moiety that is capable of being sulfated
  • P is (A) m (A) n (X) u or (X) u (A) n (A) m or (A) n (X) u (A) m
  • S is sulfate or a sulfated molecule
  • X is any amino acid except Aspartate, Glutamate, or Tyrosine
  • A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine
  • z is 0, l, or 2
  • r is 0 or 1 t is 1, 2 or 3
  • u 0 to 2
  • n 0 to 3
  • m 0 to 3
  • the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ED NO: 20.
  • the present invention provides an isolated epitope comprising Formula I wherein the sulfated moiety is a peptido or glyco or lipo conjugate, or a combination thereof.
  • the present invention also provides an isolated epitope comprising
  • W is Glycine
  • Y is a peptido conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine
  • A is Glutamate, ⁇ Carboxy Glutamate or Aspartate
  • q is 1, 2, or 3.
  • Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
  • the present invention also provides an isolated epitope comprising the formula
  • W is any amino acid other than Aspartate and Glutamate
  • Y is any naturally occurring moiety that is capable of being sulfated
  • P is (A) m (A) n (X) u or (X) u (A) n (A) m or (A) n (X) u (A) m
  • S is a sulfate or a sulfated molecule
  • X is any amino acid except Aspartate, Glutamate or Tyrosine
  • A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine
  • z 0, 1, or 2
  • r is 0 or 1
  • t 1, 2 or 3
  • u 0 to 2
  • n 0 to 3
  • m 0 to 3
  • the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
  • the present invention provides an isolated epitope comprising Formula II wherein the sulfated moiety is a peptido or glyco or lipo conjugate, or a combination thereof. [56.] The present invention also provides an isolated epitope comprising
  • W is Glycine
  • Y is a peptide conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Tlireonine
  • A is Glutamate, ⁇ Carboxy Glutamate or Aspartate, Leucine, Isoleucine, Proline Phenylalanine, Serine or Glycine.
  • Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
  • the present invention provides an isolated epitope comprising the formula
  • G is Glycine
  • S is sulfate or a sulfated molecule
  • X is any amino acid except the above
  • z 0, 1, or 2
  • t 1, 2 or 3
  • r is 0 or 1
  • u 0 to 2
  • n 0 to 3
  • the present invention provides an isolated epitope comprising Formula III wherein r is 1.
  • Y may comprise a lipid, carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule.
  • the present invention also provides derivatives, homologs, mimetics, and variants of the above-described epitopes and provides epitopes as described above and having at least one post-translational modification in addition to sulfation.
  • compositions comprising one or more of the above-described isolated epitopes.
  • isolated polynucleotides encoding at least a portion of the above-described epitopes are also provided.
  • the present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof capable of binding to or cross-reacting with at least one of the above-described epitopes.
  • a process for producing an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, capable of binding to or cross reacting with at least one of the above-described epitopes comprises the steps of: (a) providing a phage display library; (b) providing one of the above-described epitopes; (c) panning the phage display library for a phage particle displaying an oligopeptide or polypeptide capable of binding to the isolated epitope; and (d) producing an antibody, binding fragment thereof, or complex comprising an antibody or binding fragment thereof, comprising the peptide or polypeptide capable of binding to the isolated epitope.
  • the present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof having the binding capabilities of the scFv antibody fragment of SEQ ID NO: 25 [Yl scFv] and/ or SEQ ID NO: 203 [Y17 scFv].
  • Antibodies, antibody fragments, and antibody complexes having the binding capabilities of a peptide or polypeptide, wherein the peptide or polypeptide has a first hypervariable region comprising SEQ ID NO: 8 [Yl CDR3] or SEQ ID NO: 20 [Y17 CDR3] are provided.
  • the peptide or polypeptide has a second hypervariable region comprising SEQ ID NO: 115 and/ or a third hypervariable region comprising SEQ ID NO: 114.
  • Antibodies, antibody fragments, and antibody complexes that are capable of binding to a peptide or polypeptide epitope of approximately 3 to 126 amino acid residues in length and comprising at least one sulfated tyrosine residue and at least two acidic amino acids are provided.
  • the epitope further comprises at least one leucine, isoleucine, proline, phenylalanine, serine or glycine residue.
  • one or more of the at least two acidic amino acid residues is replaced by a leucine, isoleucine, proline, Phenylalanine, Serine or Glycine residue.
  • the epitope comprises DYD or EYE. In certain embodiments, the epitope is DYD or EYE. In yet other embodiments, the epitope comprises DYE or EYD.
  • antibodies, antibody fragments, and antibody complexes provided according to the present invention are capable of binding to an epitope on a carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof according to the present invention are capable of binding to carbohydrate, peptide epitopes, glycolipid epitopes, glycoprotein epitopes, lipoprotein epitopes, and/ or lipopolysaccharide epitopes.
  • the carbohydrate, peptide, glycolipid, glycoprotein, lipoprotein, and/ or lipopolysaccharide molecule comprises at least one sulfated moiety.
  • the present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen ⁇ prime, GPIb ⁇ , heparin, lumican, complement compound 4 (CC4), inter-alpha-inhibitor, and prothrombin, albeit not necessarily simultaneously.
  • the antibodies, antibody fragments, or complexes of the present invention will bind to any analog of these proteins, as long as the receptor epitope is intact.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to at least two proteins selected from the group consisting of PSGL-1, fibrinogen ⁇ prime, GPIb ⁇ , lumican, complement compound 4, interalpha inhibitor, prothrombin, and heparin and capable of binding to diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells, are provided.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to each of PSGL-1, fibrinogen ⁇ prime, GPIb ⁇ , heparin, lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin are provided.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to each of PSGL-1, fibrinogen ⁇ prime, GPIb ⁇ , and heparin are provided; and, in certain preferred embodiments, these antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are also capable of binding to diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells.
  • the present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to at least two different molecules selected from the group consisting of PSGL-1, fibrinogen ⁇ prime, heparin, GPIb ⁇ , lumican, complement compound 4 (CC4), interalpha inhibitor, and prothrombin, and further is capable of binding to an epitope on a carbohydrate and/ or a lipid molecule.
  • the epitope on the carbohydrate and or lipid molecule comprises at least one sulfated moiety.
  • the present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with two or more epitopes, each epitope comprising one or more sulfated tyrosine residues within a cluster of acidic amino acids.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with PSGL-1.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with PSGL-1 bind to the epitope QATEYEYLDYDFLPETE wherein at least one tyrosine residue is sulfated.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with GPlb- ⁇ .
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with GPlb- ⁇ bind to the epitope DEGDTDLYDYYPEEDTEGD wherein at least one tyrosine residue is sulfated, the epitope TDLYDYYPEEDTE wherein at least one tyrosine residue is sulfated, the epitope GDEGDTDLYDYYP wherein at least one tyrosine residue is sulfated, the epitope YDYYPEE wherein at least one tyrosine residue is sulfated, and/or the epitope TDLYDYYP wherein at least one tyrosine residue is sulfated.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof are capable of crossreacting with fibrinogen ⁇ prime.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with fibrinogen ⁇ ' bind to the epitope EPHAETEYDSLYPED wherein at least one tyrosine residue is sulfated.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising an antibody or binding fragment thereof that are capable of crossreacting with heparin are provided.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising an antibody or binding fragment thereof that are capable of crossreacting with complement compound 4 are provided.
  • antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with CC4 bind to the epitope MEANEDYEDYEYDELPAK wherein at least one tyrosine residue is sulfated.
  • the present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to fragments, analogs, variants, and mimetics of the above-mentioned proteins, so long as the epitope is essentially intact.
  • the present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of crossreacting with at least one cell type selected from the group consisting of B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells;
  • the present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof, that are capable of inhibiting cell rolling; inhibiting inflammation; inhibiting auto-immune disease; inhibiting thrombosis; inhibiting restenosis; inhibiting metastasis; inhibiting growth and/ or replication of tumor cells; increasing mortality of tumor cells; inhibiting growth and/ or replication of leukemia cells; increasing the mortality rate of leukemia cells; increasing the susceptibility of diseased cells to damage by anti-disease agents; increasing the susceptibility of tumor cells to damage by anti-cancer agents; increasing the susceptibility of leukemia cells to damage by anti-leukemia agents; inhibiting increase in number of tumor cells in a patient having a tumor; decreasing the number of tumor cells in a patient having cancer; inhibiting increase in number of leukemia cells in a patient having leukemia; decreasing the number of leukemia cells in a patient having leukemia; inhibiting cell-cell, cell-matrix, platelet
  • compositions comprising antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof according to the present invention in amounts effective to inhibit, treat, ameliorate the effects of, or prevent diseases and/ or conditions of interest are provided.
  • the present invention provides for the use of antibodies, antigen-binding fragments thereof, or complexes thereof according to the present invention in the manufacture of a medicament to inhibit, treat, ameliorate the effects of, or prevent diseases and/ or conditions of interest.
  • the present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof according to the present invention for use as a medicament to inhibit, treat, ameliorate the effects of, or prevent diseases and/ or conditions of interest.
  • the present invention provides methods of inhibiting, treating, ameliorating the effects of, or preventing diseases and/ or conditions of interest comprising administering to a patient in need thereof a pharmaceutical composition comprising an effective amount of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to the present invention.
  • a pharmaceutical composition comprising an effective amount of an antibody, antigen-binding fragment thereof, or complex thereof comprising at least one antibody or binding fragment thereof, according to the present invention.
  • Antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof according to the present invention may be complexed with or coupled to agents.
  • the present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with an agent selected from the group consisting of anti- cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti- restenosis, anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti- inflammatory agents.
  • an agent selected from the group consisting of anti- cancer, anti-metastasis, anti-leukemia, anti-disease, anti-adhesion, anti-thrombosis, anti- restenosis, anti-autoimmune, anti-aggregation, anti-bacterial, anti-viral, and anti- inflammatory agents.
  • the present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with one or more toxins, radioisotopes, and pharmaceutical agents.
  • the present invention provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with a vehicle or carrier that are capable of being coupled or complexed to more than one agent.
  • vehicles and carriers include dextran, lipophilic polymers, HPMA, and liposomes.
  • the present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof coupled to or complexed with a radioactive isotope or other imaging agent.
  • Diagnostic kit comprising an antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof, according to the present invention are also provided.
  • the present invention provides an isolated epitope comprising GPIb ⁇ amino acid sequence Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated.
  • the epitope further comprises GPIb ⁇ amino acids 283-285.
  • the present invention also provides antibodies, antigen-binding fragments thereof, or complexes thereof comprising at least one antibody or binding fragment thereof that are capable of binding to the epitope comprising GPIb ⁇ amino acid sequence Tyr 276 to Glu 282, wherein at least one of amino acids 276, 278 and 279 is sulfated, wherein the binding is enhanced when the epitope further comprises GPIb ⁇ amino acids 283-285.
  • the present invention also provides polyclonal antibodies, antibody fragments or antibody complexes that cross-react with the variable light chain of human monoclonal antibody scFv Yl.
  • the polyclonal antibodies, antibody fragments or antibody complexes cross-react with a Ndel-EcoRl restriction fragment of the variable light chain of human monoclonal antibody Y-l. Diagnostic kits comprising such polyclonal antibodies are also provided.
  • Antibodies or immunoglobulins (IgG's), are protein molecules that bind to antigen. They are composed of units of four polypeptide chains (2 heavy and 2 light) linked together by disulfide bonds. Each of the chains has a constant and variable region. They can be divided into five classes, IgG, IgM. IgA, IgD, and IgE, based on their heavy chain component. The IgG class encompasses several sub-classes including, but not restricted to, IgGi, IgG 2 , IgG 3 , and IgG 4 . Immunoglobulins are produced in vivo by B lymphocytes and recognize a particular foreign antigenic determinant and facilitate clearing of that antigen.
  • Antibodies may be produced and used in many forms, including antibody complexes.
  • antibody complex or “antibody complexes” is used to mean a complex of one or more antibodies with another antibody or with an antibody fragment or fragments, or a complex of two or more antibody fragments.
  • antibody fragments include Fv, F(ab') 2 , F(ab'), Fc, and Fd fragments.
  • an Fv is defined as a molecule that is made up of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and in which the variable region of the heavy chain is connected, linked, fused or covalently attached to, or associated with, the variable region of the light chain.
  • the Fv can be a single chain Fv (scFv) or a disulfide stabilized Fv (dsFv).
  • An scFv is comprised of the variable domains of each of the heavy and light chains of an antibody, linked by a flexible amino-acid polypeptide spacer, or linker.
  • the linker may be branched or unbranched.
  • the linker is 0-15 amino acid residues, and most preferably the linker is (Gly Ser) 3 .
  • the Fv molecule itself is comprised of a first chain and a second chain, each chain comprising a first, second and third hypervariable region.
  • the hypervariable loops within the variable domains of the light and heavy chains are termed Complementary Determining Regions (CDR).
  • CDR Complementary Determining Regions
  • the most variable of these regions in nature being the CDR3 region of the heavy chain.
  • the CDR3 region is understood to be the most exposed region of the Ig molecule and as shown and provided herein is the site primarily responsible for the selective and/or specific binding characteristics observed.
  • a fragment of an Fv molecule is defined as any molecule smaller than the original Fv that still retains the selective and/or specific binding characteristics of the original Fv.
  • fragments include but are limited to (1) a minibody, which comprises a fragment of the heavy chain only of the Fv, (2) a microbody, which comprises a small fractional unit of antibody heavy chain variable region (PCT Application No. PCT/IL99/00581), (3) similar bodies comprising a fragment of the light chain, and (4) similar bodies comprising a functional unit of a light chain variable region.
  • Fab fragment is a monovalent antigen-binding fragment of an immunoglobulin. A Fab fragment is composed of the light chain and part of the heavy chain.
  • a F(ab') fragment is a bivalent antigen binding fragment of an immunoglobulin obtained by pepsin digestion. It contains both light chains and part of both heavy chains.
  • a Fc fragment is a non-antigen-binding portion of an immunoglobulm. It contains the carboxy-terminal portion of heavy chains and the binding sites for the Fc receptor.
  • a Fd fragment is the variable region and first constant region of the heavy chain of an immunoglobulin.
  • Polyclonal antibodies are the product of an immune response and are formed by a number of different B-lymphocytes. Monoclonal antibodies are derived from a single cell.
  • a cassette refers to a given sequence of consecutive amino acids that serves as a framework and is considered a single unit and is manipulated as such. Amino acids can be replaced, inserted into, removed, or attached at one or both ends. Likewise, stretches of amino acids can be replaced, inserted into, removed or attached at one or both ends.
  • epitope is used herein to mean the antigenic determinant or antigen site that interacts with an antibody, antibody fragment, antibody complex or a complex comprising a binding fragment thereof or T-cell receptor.
  • epitope is used interchangeably herein with the terms ligand, domain, and binding region.
  • Selectivity is herein defined as the ability of a targeting molecule to choose and bind one cell type or cell state from a mixture of cell types or cell states, all cell types or cell states of which may be specific for the targeting molecule.
  • affinity is a measure of the binding strength
  • association constant between a receptor (e.g., one binding site on an antibody) and a ligand (e.g., antigenic determinant).
  • the strength of the sum total of noncovalent interactions between a single antigen-binding site on an antibody and a single epitope is the affinity of the antibody for that epitope.
  • Low affinity antibodies bind antigen weakly and tend to dissociate readily, whereas high-affinity antibodies bind antigen more tightly and remain bound longer.
  • the term "avidity" differs from affinity because the former reflects the valence of the antigen-antibody interaction.
  • antigen-antibody reaction is specific, in some cases antibody elicited by one antigen can cross-react with another unrelated antigen. Such cross-reactions occur if two different antigens share an homologous or similar epitope or an anchor region thereof or if antibodies specific for one epitope bind to an unrelated epitope possessing similar chemical properties.
  • a platelet is a disc-like cytoplasmic fragment of a megakaryocyte that is shed in the marrow sinus and subsequently are circulating in the peripheral blood stream. Platelets have several physiological functions including a major role in clotting. A platelet contains granules in the central part and peripherally, clear protoplasm, but no definite nucleus.
  • Agglutination as used herein means the process by which suspended bacteria, cells, discs, or other particles of similar size are caused to adhere and form into clumps. The process is similar to precipitation but the particles are larger and are in suspension rather than being in solution.
  • aggregation means a clumping of platelets induced in vitro, and thrombin and collagen, as part of a sequential mechanism leading to the formation of a thrombus or hemostatic plug.
  • Conservative amino acid substitution is defined as a change in the amino acid composition by way of changing one or two amino acids of a peptide, polypeptide or protein, or fragment thereof.
  • the substitution is of amino acids with generally similar properties (e.g., acidic, basic, aromatic, size, positively or negatively charged, polar, non- polar) such that the substitutions do not substantially in a major way alter peptide, polypeptide or protein characteristics (e.g., charge, IEF, affinity, avidity, conformation, solubility) or activity.
  • Typical substitutions that may be performed for such conservative amino acid substitution maybe among the groups of amino acids as follows:
  • Conservative amino acid substitutions can be made in, as well as, flanking the hypervariable regions primarily responsible for the selective and/or specific binding characteristics of the molecule, as well as other parts of the molecule, e.g., variable heavy chain cassette. Additionally or alternatively, modification can be accomplished by reconstructing the molecules to form full-size antibodies, diabodies (dimers), triabodies (timers) and/or tetrabodies (tetramers) or to fonn minibodies or microbodies.
  • a phagemid is defined as a phage particle that carries plasmid DNA.
  • Phagemids are plasmid vectors designed to contain an origin of replication from a filamentous phage, such as ml 3 of fd. Because it carries plasmid DNA, the phagemid particle does not have sufficient space to contain the full complement of the phage genome. The component that is missing from the phage genome is information essential for packaging the phage particle. In order to propagate the phage, therefore, it is necessary to culture the desired phage particles together with a helper phage strain that complements the missing packaging information. [113.] A promoter is a region on DNA at which RNA polymerase binds and initiates transcription.
  • a phage display library (also termed phage peptide/antibody library, phage library, or peptide/antibody library) comprises a large population of phage (generally 10 8 10 9 ), each phage particle displaying a different peptide or polypeptide sequence. These peptide or polypeptide fragments may constructed to be of variable length.
  • the displayed peptide or polypeptide can be derived from, but need not be limited to, human antibody heavy or light chains.
  • a pharmaceutical composition refers to a formulation which comprises a peptide or polypeptide of the invention and a pharmaceutically acceptable carrier, excipient or diluent thereof.
  • a pharmaceutical agent refers to an agent that is useful in the prophylactic treatment or diagnosis of a mammal including, but not restricted to, a human, bovine, equine, porcine, murine, canine, feline, or any other warm-blooded animal.
  • the pharmaceutical agent is selected from the group comprising radioisotope, toxin, oligonucleotide, recombinant protein, antibody fragment, and anti-cancer agent.
  • Such pharmaceutical agents include, but are not limited to anti- viral agents including acyclovir, ganciclovir and zidovudine; anti-thrombosis/restenosis agents including cilostazol, dalteparin sodium, reviparin sodium, and aspirin; anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid; anti-autoimmune agents including leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide; and anti- adhesion/anti-aggregation agents including limaprost, clorcromene, and hy
  • An anti-leukemia agent is an agent with anti-leukemia activity.
  • anti- leukemia agents include agents that inhibit or halt the growth of leukemic or immature pre-leukemic cells, agents that kill leukemic or pre-leukemic, agents that increase the susceptibility of leukemic or pre-leukemic cells to other anti-leukemia agents, and agents that inhibit metastasis of leukemic cells.
  • an anti-leukemia agent may also be agent with anti-angiogenic activity that prevents, inhibits, retards or halts vascularization of tumors.
  • the expression pattern of a gene can be studied by analyzing the amount of gene product produced under various conditions, at specific times, in various tissues, etc.
  • a gene is considered to be "over expressed" when the amount of gene product is higher than that found in a normal control, e.g., non-diseased control.
  • a given cell may express on its surface a protein having a binding site (or epitope) for a given antibody, but that binding site may be exist in a cryptic form (e.g., be sterically hindered or be blocked, or lack features needed for binding by the antibody) in the cell in a state, which may be called a first stage (stage I ).
  • Stage I may be, for example, a normal, healthy, non-diseased status.
  • the epitope may be exposed by, e.g., undergoing modifications itself, or being unblocked because nearby or associated molecules are modified or because a region undergoes a conformational change.
  • modifications include changes in folding, changes in post-translational modifications, changes in phospholipidation, changes in sulfation, changes in glycosylation, and the like.
  • Such modifications may occur when the cell enters a different state, which maybe called a second stage (stage II).
  • second states, or stages include activation, proliferation, transformation, or in a malignant status.
  • the epitope may then be exposed, and the antibody may bind.
  • Peptido-mimetics are small molecules, peptides, polypeptides, lipids, polysaccharides or conjugates thereof that have the same functional effect or activity of another entity such as an antibody.
  • FIG. 1 shows cleavage sites of endoprotease on the ⁇ chain of GPIb.
  • FIG. 2 depicts a Western blot showing binding of Yl and Y17 to platelets in reduced and non-reduced conditions.
  • FIG. 3 is an outline of the optimal determinants for binding of Yl to its epitope.
  • FIG. 4 depicts a Western blot demonstrating that cleavage of platelet GPIb by O-Sialoglycoprotein endoprotease abolishes binding of both Yl and Y17.
  • FIG. 5 depicts a Western blot demonstrating that Yl and Y17 bind similar glycocahcin fragments after cleavage by O-Sialoglycoprotein endoprotease.
  • FIG. 6 depicts the results of FACS analysis demonstrating that specific
  • GPIb proteolysis abolishes Yl binding to platelets.
  • FIG. 7 depicts a Western blot demonstrating that Yl binds the N-terminal
  • FIG. 8 depicts a Western blot showing binding of Yl and Y17 to glycocahcin after cleavage by mocarhagin.
  • FIG. 9 depicts a Western blot showing the binding of Yl and Y17 to platelets.
  • FIG. 10 depicts a Western blot demonstrating that Yl and Y17 bind glycocahcin similarly after cleavage by Ficin.
  • FIG. 11 depicts a Western blot demonstrating that Yl reacts with the larger fragment generated by cathepsin G cleavage of GPIba ⁇ .
  • FIG. 12 depicts a Western blot demonstrating that Yl and Y17 react with the larger fragment generated by cathepsin G cleavage of GPIba ⁇ .
  • FIG. 13 depicts a Western blot demonstrating that cleavage of glycocahcin by mocarhagin and cathepsin G abolishes binding of Yl.
  • FIG. 14 depicts a Western blot showing the binding of Yl and Y17 to lysate of washed platelets cleaved by mocarhagin and cathepsin G.
  • FIG. 15 is a graph illustrating inhibition by Yl-scFv of agglutination of washed platelets.
  • FIG. 16 is a graph illustrating inhibition by Yl-scFv of aggregation of platelets in platelet-rich plasma.
  • FIG. 17 is a graph illustrating induction of agglutination of washed platelets by Yl -IgG.
  • FIG. 18 is a graph illustrating induction of platelet aggregation in platelet- rich-plasma by Yl-IgG.
  • FIG. 19 provides results of an ELISA assay.
  • FIG. 20 depicts a Western blot illustrating the specificity of binding of Yl and ⁇ -CD42 (Nl-19) to their ligands.
  • FIG. 21 depicts a Western blot Yl reactivity with Yl -ligand on KG-1 cell membrane purified using immunoprecipitation and RP-HPLC.
  • FIG. 22 depicts a Western blot showing the effect of O-Sialoglycoprotein endopeptidase cleavage on Yl binding.
  • FIG. 23 depicts a Western blot showing the effect after aryl-sulfatase cleavage on Yl binding to RP-HPLC -purified KG-1 cell lysates, and heparin-BSA.
  • FIG. 24 depicts the immunoprecipitation scheme used in the analysis of the specificity of Yl binding, the results of which are depicted in FIG. Tab 2A, page 17B.
  • FIG. 25 depicts Western blots comparing binding of Yl and anti-CD- 162 antibody to cells from AML patients and normal blood.
  • FIG. 26 depicts the results of a FACS analysis showing the ability of antibodies KPLl, PL1, and PL2 to compete with Yl for binding.
  • FIG. 27 depicts the results of a FACS analysis demonstrating the specificity of Yl binding.
  • FIG. 28 also depicts the results of a FACS analysis demonstrating the specificity of Yl binding.
  • FIG. 29 is a graph illustrating % inhibition of Yl binding in the presence of various peptides.
  • FIG. 30 is a graph depicting liver weights in mice in different treatment groups.
  • FIG. 31 is a graph depicting % MOLT cells in bone marrow in mice in different treatment groups.
  • FIG. 32 is a graph depicting % MOLT cells in blood in mice in different treatment groups.
  • FIG. 33 is a graph depicting liver weights (mean +/- SEM) of mice at day
  • FIG. 34 is a graph depicting liver weights (mean +/- SEM) of mice at day
  • FIG. 35 is a graph illustrating effect of treatment on survival.
  • FIG. 36 is a graph depicting % occurrence of leukemia in different treatment groups.
  • FIG. 37 is a graph depicting % KG-1 cells in blood in different treatment groups.
  • FIG. 38 is a graph illustrating %KG-1 cells in bone marrow of experimental animals.
  • FIG. 39 is a graph illustrating the pharmakokinetics of TCA-precipitable radioactivity in plasma after intravenous injection in mice.
  • the sequence of CONY1 is given as SEQ ID NO: 204.
  • FIG. 40 is a graph illustrating the specific radioactivity of various organs/ tissues after intravenous injection of I-CONYl in mice.
  • FIG. 41 is a graph illustrating the distribution of radioactivity of various organs/ tissues after intravenous injection of I-CONYl in mice.
  • FIG. 42 is a graph of the Superdex 75 profile of Yl-cys-kak.
  • FIG. 43 reveals the size of the dimers compared to the monomer in reducing and non-reducing conditions.
  • FIG. 44 depicts a FACS analysis showing the level of binding of the IgG-
  • FIG. 45 depicts Western blots showing binding of Yl and other antibodies to natural human platelet derived glycocahcin and to recombinant glycocahcin produced in E. coli.
  • FIG. 46 shows a binding comparison between a Yl dimer, the Yl scFv
  • FIG. 47 shows a binding comparison between a Yl sulfide bridge dimer with the Yl scFv (CONY1).
  • FIG. 48 provides the amino acid and nucleotide sequences of the heavy and light chains of Yl-IgG.
  • the open reading frame (ORF) of the nucleotide sequence of Yl-HC (S ⁇ Q ⁇ D NO: 205), the amino acid sequence of Yl-HC (S ⁇ Q ID NO: 206), the ORF of the nucleotide sequence of Yl-LC (S ⁇ Q ID NO: 207), and the amino acid sequence of Yl-LC (S ⁇ Q ID NO: 208) are provided.
  • FIG. 49 provides the amino acid sequence of TM1 (S ⁇ Q ID NO: 209).
  • FIG. 50 provides the amino acid and nucleotide sequences of the Y16 scFv
  • FIG. 51 provides the amino acid sequence of the Yl Biotag (SEQ ID NO:
  • FIG. 52 provides the amino acid sequence of the Y 1 -cys-kak scFv (SEQ
  • Certain epitopes that were identified by this multistep process are characterized by the presence of sulfated moieties, such as sulfated tyrosine residues or sulfated carbohydrate or lipid moieties, preferably within a cluster of two or more acidic amino acids, are found on ligands and receptors that play important roles in such diverse processes as inflammation, immune reactions, infection, autoimmune reactions, metastasis, adhesion, thrombosis and/ or restenosis, cell rolling, and aggregation. Such epitopes are also found on diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. These epitopes are useful targets for the therapeutic mediation of these processes and for diagnostic procedures.
  • antibodies directed against such sulfated epitopes are often capable of binding to, or crossreacting with, more than one such epitope on more than one molecule, albeit not necessarily simultaneously.
  • Such antibodies are useful as therapeutic agents against cancers (both as anti-tumor agents and as anti-metastatic agents), leukemias, autoimmune diseases, viral diseases, diseases involving abnormal aggregation, diseases involving abnormal adhesion, infarction, cardiovascular diseases and inflammatory diseases.
  • the human scFv Yl antibody was isolated from a human antibody phage display library that was used to screen fixed human platelets in order to identify antibodies that bind platelets.
  • Several clones (different scFv antibodies) were isolated and characterized.
  • One of these clones, designated as Yl unexpectedly was found to bind leukemia cells derived from AML patients and patients having certain other leukemias.
  • Another clone, Y17 was also isolated by panning on fixed platelets and was found to bind to human blood.
  • the human platelet derived glycocahcin extracellular fragment was purified from activated platelets. It was digested with various proteases, such as ficin, mocarhagin, cathepsin G, in order to localize precisely the Yl binding epitope on the glycocahcin molecule. Analysis was performed by the Western blot methodology using the Yl antibody as a detection tool. In addition, commercially available anti- glycocahcin antibodies (antibodies that are known to bind to different epitopes of glycocahcin) were used in a competition binding assay with the Yl antibody to determine the Yl binding epitope on glycocahcin.
  • glycocahcin was treated with enzymes (glycosidases) that remove N and O-linked sugar moieties from proteins and enzymes (sulfatases) that remove sulfate moieties from proteins.
  • enzymes glycosidases
  • sulfatases enzymes that remove sulfate moieties from proteins.
  • the binding of the Yl antibody to glycocahcin or glycocahcin derived fragments was not affected by the glycosidases. This result indicates that sulfated groups are essential for the binding of Yl to glycocahcin.
  • Yl antibody is located between amino acids 272 and 285 on glycocahcin in which there is cluster of negatively charged amino acids.
  • the Yl antibody was found to bind with relatively low affinity to two human plasma derived proteins, one in the size of ⁇ 50kD molecular weight, which was identified as fibrinogen ⁇ prime and a ⁇ 80kD molecular weight protein, which was identified as complement compound 4 (CC4) and human lumican. These proteins contain sulfated tyrosine residues accompanied by a stretch of negatively charged amino acids.
  • PSGL-1 The Yl ligand on KG-1 cells was identified as PSGL-1, which is a receptor for E, L- and P- selectins.
  • PSGL-1 was identified as the ligand of the Yl antibody on KG-1 cells based on competition assays (wherein binding of the Yl antibody to the KG-1 cells was carried out in the presence of different commercially available anti PSGL-1 antibodies) and upon a set of experiments using sulfated and non-sulfated synthetic peptides derived from the N-terminal site of PSGL-1.
  • the N-terminal site of PSGL-1 contains sulfated tyrosine residues accompanied by a cluster of negatively charged amino acids.
  • the Yl antibody binds to several molecules, such as the glycocahcin molecule on platelets, fibrinogen-gamma prime, the complement compound 4 of human plasma, and the PSGL-1 molecule on KG-1 cells
  • its affinity to primary leukemia cells derived from either AML or multiple myeloma (MM) patients is several magnitudes higher relative to the previously mentioned epitopes.
  • KPLl commercially available anti PSGL-1 antibody
  • sulfated epitopes include those delineated in Formulae I, II, and III, as well as derivatives, homologs, mimetics, and variants thereof.
  • W is any amino acid other than Aspartate and Glutamate
  • Y is any naturally occurring moiety that is capable of being sulfated
  • P is (A) m (A) n (X) u or (X) u (A) n (A) m or (A) n (X) u (A) m
  • X is any amino acid except Aspartate, Glutamate, or Tyrosine
  • A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine
  • z is O, l, or 2
  • r is 0 or 1
  • t 1, 2 or 3
  • u 0 to 2
  • n 0 to 3
  • m 0 to 3
  • the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
  • a preferred epitope is the epitope of Formula I wherein W is Glycine, Y is a peptido conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate, ⁇ Carboxy Glutamate or Aspartate; and q is 1, 2, or 3. Ln certain embodiments, Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
  • W is any amino acid other than Aspartate and Glutamate
  • Y is any naturally occurring moiety that is capable of being sulfated
  • P is (A) m (A) friendship(X) u or (X) u (A) n (A) m or (A) protest(X) u (A) m
  • S is a sulfate or a sulfated molecule
  • X is any amino acid except Aspartate, Glutamate or Tyrosine
  • A is any negatively charged amino acid or leucine, isoleucine, proline, phenylalanine, serine, or glycine
  • z 0, 1, or 2
  • r is 0 or 1
  • t 1, 2 or 3
  • u 0 to 2
  • n 0 to 3
  • m 0 to 3
  • the isolated epitope is capable of being bound by an antibody, antigen-binding fragment thereof, or complex thereof comprising an antibody or binding fragment thereof, comprising a first hypervariable region comprising SEQ ID NO: 8 or SEQ ID NO: 20.
  • a preferred epitope is the epitope of Formula II wherein: W is Glycine; Y is a peptide conjugate of Tyrosine or a glyco conjugate of Asparagine, Serine or Threonine; A is Glutamate, ⁇ Carboxy Glutamate or Aspartate, Leucine, Isoleucine Phenylalanine, Serine or Glycine.
  • Y is a peptido conjugate of Tyrosine; q is 3; and r is 1.
  • G is Glycine
  • S is sulfate or a sulfated molecule
  • X is any amino acid except the above
  • z 0, 1, or 2
  • t 1, 2 or 3
  • r is 0 or 1
  • u 0 to 2
  • n 0 to 3
  • a preferred epitope is the epitope of Formula III wherein r is 1.
  • the sulfated moiety of any of the Formulae may be also a peptido- or glyco- or lipo- conjugate.
  • Y may comprise a lipid and/ or carbohydrate molecule.
  • the epitopes may have at least one post-translational modification in addition to sulfation.
  • Such epitopes are found on such diverse molecules as GPIb and PSGL-1 and are found on certain diseased cells, such as B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells. Sulfation of tyrosine and/ or other moieties is particularly important for binding to these epitopes.
  • Human proteins known to be tyrosine sulfated include the following:
  • an antibody of the present invention that binds to epitopes of Formulae I-III is the fully human monoclonal antibody Yl.
  • the selection, production, and initial characterization of Yl are described in detail in U.S. Patent application Serial ⁇ os. 09/751,181 and 60/258,948. Briefly, a phage display library displaying scFv antibody fragments was utilized to obtain and produce targeting molecules, and flow cytometry, particularly fluorescence-activated cell sorting (FACS), was used for identifying and isolating specific phage clones, the peptide or polypeptide of which recognizes target cells.
  • the phage display library used herein was constructed from peripheral blood lymphocytes of a non-immunized human donor.
  • Phage clones were selected by and identified through a multi-step procedure known as biopanning. Biopanning was carried out by incubating phage displaying protein ligand variants (a phage display library) with a target, removing unbound phage by a washing technique, and specifically eluting the bound phage. The eluted phage were optionally amplified before being taken through additional cycles of binding and optional amplification which enriched the pool of specific sequences in favor of those phage clones bearing antibody fragments that display the best binding to the target. After several rounds, individual phage clones were characterized, and the sequences of the peptides displayed by the clones were determined by sequencing the corresponding D ⁇ A of the phage virion.
  • a desired target cell e.g., B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells
  • a desired target cell e.g., B-CLL cells, AML cells, multiple myeloma cells, and metastatic cells
  • Malignant and diseased blood cells e.g., leukemia or lymphoma
  • platelets are an attractive source for the identification of premature cell surface markers expressed on diseased or malignant blood cells.
  • Yl an scFv clone which binds to platelets and myleogenous leukemia cells, particularly AML cells, was selected.
  • Yl scFv has the sequence SEQ ID NO: 25.
  • the binding characteristics of Yl are primarily attributable to its heavy chain CDR3 region, which has the sequence SEQ ID NO: 8.
  • Full Yl-IgG antibodies were also produced.
  • Y17 A second scFv clone, Y17, which binds to platelets and cell lines derived from human myleogenous leukemia cells, particularly AML cells, was also selected.
  • Y17 scFv has the sequence SEQ ED NO: 203.
  • the binding characteristics of Y17 are primarily attributable to its heavy chain CDR3 region, which has the sequence SEQ ED NO: 20.
  • Full Y17-IgG antibodies were also produced.
  • CDRs according to the present invention may also be inserted into cassettes to produces antibodies.
  • a cassette as applied to polypeptides and as defined in the present invention, refers to a given sequence of consecutive amino acids that serves as a framework and is considered a single unit and is manipulated as such. Amino acids can be replaced, inserted into, removed, or attached at one or both ends. Likewise, stretches of amino acids can be replaced, inserted into, removed or attached at one or both ends.
  • the amino acid sequence of the cassette may ostensibly be fixed, whereas the replaced, inserted or attached sequence can be highly variable.
  • the cassette can be comprised of several domains, each of which encompasses a function crucial to the final construct.
  • the hypervariable regions of antibodies of the invention form the antigen binding sites of antibodies of the present invention.
  • the antigen-binding site is complementary to the structure of the epitopes to which the antibodies bind and therefore are referred to as complementarity-determining regions (CDRs). There are three CDRs on each light and heavy chain of an antibody, each located on the loops that connect the ⁇ strands of the N H and N domains..
  • the cassette of a particular embodiment of the present invention comprises, from the ⁇ -terminus, framework region 1 (FR1), CDRl, framework region 2 (FR2), CDR2, and framework region 3 (FR3).
  • the CDR2 and CDRl hypervariable regions of the cassette may be replaced or modified by non-conservative or, preferably, conservative amino acid substitutions. More specifically, the CDR2 and CDRl regions of a cassette of consecutive amino acids selected from the group comprising of SEQ ID ⁇ Os: 30-113 or a fragment thereof can be replaced by SEQ ID ⁇ Os: 115 and 114, respectively.
  • the CDR2 and CDRl regions of a cassette of consecutive amino acids selected from the group comprising of SEQ ID ⁇ Os: 30-32, 35, 37-39, 41, 43, 45, 46, 48, 51, 54, 57, 59-68, 70, 71, 76-85, 87, 89-92, 94, 97, 99, 103, 106, 112, and 113 or fragment thereof can be replaced by SEQ ID ⁇ Os: 115 and 114, respectively.
  • the peptide or polypeptide comprises a heavy and a light chain, and each chain comprises a first, second and third hypervariable region which are the CDR3, CDR2 and CDRl regions, respectively.
  • the binding selectivity and specificity are determined particularly by the CDR3 region of a chain, possibly by the CDR3 region of the light chain and, preferably, by the CDR3 region of the heavy chain, and secondarily by the CDR2 and CDRl regions of the light chain and, preferably, of the heavy chain.
  • the binding selectivity and specificity may also be secondarily influenced by the upstream or downstream regions flanking the first, second, and/or third hypervariable regions.
  • the CDR3 region of the peptide or polypeptide has an amino acid sequence selected from the group comprising SEQ ED NOs: 8-24.
  • the CDR3 region of the heavy chain has an amino acid sequence selected from the group comprising SEQ ID NOs:8-24, the CDR2 has an amino acid sequence identical to SEQ ID NO:l 15, and the CDRl region has an amino acid sequence identical to SEQ ED NO: 114.
  • the CDR3 region has an amino acid sequence identical to SEQ ID NO: 8.
  • a preferred embodiment of the invention is a scFv with a CDR3 sequence identical to SEQ ED NO: 8 and a full scFv sequence identical to SEQ ID NO:25.
  • CDRl regions have the amino acid SEQ ID NOs:8, 115 and 114, respectively.
  • the Fv peptide comprises a CDRl and
  • CDR2 region of the variable heavy chain which itself comprises a cassette with an amino acid sequence selected from the group comprising SEQ ED NOs: 30-113; a CDR3 region, preferably of the variable heavy chain, which has an amino acid sequence selected from the group comprising SEQ ID NO:8-24; an upstream region flanking the CDR3 region which has the amino acid sequence of SEQ ID NO: 117; a downstream region flanking the CDR3 region which has the amino acid sequence of SEQ ED NO:116; a spacer of 0-20 amino acid residues of SEQ ID NO: 123 or 124; a variable light chain region the sequence of which is SEQ ED NO:7.
  • the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ED NO: 119
  • the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ED NO:l 18
  • the upstream region flanking the CDRl region has the amino acid sequence of SEQ ED NO: 121
  • the downstream region flanking the CDRl region has the amino acid sequence of SEQ ED NO:120.
  • a preferred embodiment of the invention provides for a peptide or polypeptide wherein the second and third hypervariable regions are a CDR2 and a CDRl hypervariable region, respectively and wherein the CDR3 amino acid sequence is SEQ ED NO:8, wherein the CDR2 amino acid sequence is SEQ ID NO.115, wherein the CDRl amino acid sequence is SEQ ED NO:l 14, wherein the upstream region flanking the CDR3 region has the amino acid sequence of SEQ ED NO:l 17, wherein the downstream region flanking the CDR3 region has the amino acid sequence of SEQ ED NO: 116, wherein the upstream region flanking the CDR2 region has the amino acid sequence of SEQ ED NO:l 19, wherein the downstream region flanking the CDR2 region has the amino acid sequence of SEQ ED NO: 118, wherein the upstream region flanking the CDRl region has the amino acid sequence of SEQ ED NO: 121 and wherein the downstream region flanking the CDRl region has the amino acid sequence
  • Another prefened embodiment of the invention provides for an Fv molecule that comprises a first chain having a first, a second and a third hypervariable region and a second chain having a first, a second and a third hypervariable region, wherein one of the hypervariable regions of the first chain has a sequence selected from the group consisting of SEQ ID NOs: 8-24, and wherein one of the hypervariable regions of the second chain has a sequence selected from the group consisting of SEQ ID NOs:l- 6 and 125-202, and wherein the first, second and third hypervariable regions are a CDR3, CDR2 and CDRl region, respectively and wherein the Fv is a scFv or a dsFv, and optionally having one or more tags.
  • Another embodiment of the invention provides for a peptide or polypeptide (i) wherein the first chain and the second chain each comprises a first hypervariable region selected from the group consisting of SEQ ID NOs: 8-24; or (ii) wherein the first hypervariable region of the first and second chains are identical and selected from the group consisting of SEQ ED NOs: 8-24; or (iii) wherein the first hypervariable region of the first chain is selected from the group consisting of SEQ ED NOs: 8-24, and the first hypervariable region of the second chain is selected from the group consisting of SEQ ID NOs:l-6 and 125-202; or (iv) wherein the first hypervariable region of the first chain is selected from the group consisting of SEQ ID NOs: 1-6 and 125-202, and the first hypervariable region of the second chain is selected from the group consisting of SEQ ID NOs: 8-24.
  • a further embodiment provides for the peptide or polypeptide of the invention wherein the second and third hypervariable regions of the first chain are SEQ ED NOs: 114 and 115, respectively.
  • amino acid sequences of ⁇ 25 amino acid residues described and detailed herein include within their scope one or two amino acid substitution(s) and that preferably the substitutions are conservative amino acid substitutions.
  • amino acid sequences of > 25 amino acid residues described and detailed herein it is to be understood and considered as an embodiment of the invention that these amino acid sequences include within their scope an amino acid sequence with > 90% sequence similarity to the original sequence (Altschul et al, Nucleic Acids Res., 25, 3389-3402 (1997)).
  • Similar or homologous amino acids are defined as non-identical amino acids which display similar properties, e.g., acidic, basic, aromatic, size, positively or negatively charged, polar, non- polar.
  • Percentage amino acid similarity or homology or sequence similarity is determined by comparing the amino acid sequences of two different peptides or polypeptides. The two sequences are aligned, usually by use of one of a variety of computer programs designed for the purpose, and amino acid residues at each position are compared. Amino acid identity or homology is then determined. An algorithm is then applied to determine the percentage amino acid similarity. It is generally preferable to compare amino acid sequences, due to the greatly increased sensitivity to detection of subtle relationships between the peptide, polypeptide or protein molecules.
  • Protein comparison can take into account the presence of conservative amino acid substitutions, whereby a mismatch may yet yield a positive score if the non-identical amino acid has similar physical and/or chemical properties (Altschul et al, Nucleic Acids Res., 25, 3389- 3402 (1997). [216.]
  • the three hypervariable regions of each of the light and heavy chains can be interchanged between the two chains and among the three hypervariable sites within and/or between chains.
  • oligo 5' -Ndel TTTCATATGGAGCTGACTCAGGACCCTGCT
  • oligo Y -EcoRI TTTTGAATTCCTATTTTGCTTTTGCGGC
  • telomere sequence was digested with Ndel and EcoRI restriction enzymes and cloned into Ndel and EcoRI restriction enzymes sites of a pre-digested plasmid, which is an IPTG inducible expression vector used for prokaryotic expression of recombinant proteins in E. coli.
  • E. coli cells were transformed with the ligation mixture and positive clones were selected by PCR amplification using the above oligonucleotide primers. Cells harboring this plasmid were grown and induced for expression by ⁇ PTG.
  • Bacterial cells were harvested by centrifugation from 1 liter of culture post induction with IPTG, inclusion bodies were isolated and solubilized in guanidine-HCl + DT ⁇ , and refolded by dilution in a buffer containing TRLS-ARGININ ⁇ - ⁇ DTA. After refolding at 5-10 ° for 48 hrs, the solution containing protein was dialyzed and concentrated to 20mM Glycine pH 9. The dialyzed solution containing proteins was re-purified by using an ionic exchange column, HiTrapQ, and eluted with a gradient of NaCl. The main peak was analyzed by SDS- PAG ⁇ and by gel filtration. At least 10 mgs of purified V L were obtained from an original 1 liter culture.
  • Nissim I antibody phage display library (Nissim et al., "Antibody fragments from a 'single pot' phage display library as immunochemical reagents," EMBO J. 13(3): 692-698 (1994))were cultured separately. After EPTG induction the cultures were grown at 22° C for 16 hours. The scFv antibody fragments were harvested from the bacterial cell periplasm and were purified on a Protein A-Sepharose column. All the procedures for bacterial clone culturing, induction protocol, scFv antibody fragment harvesting and antibody fragment purification were carried out in accordance with: Harrison J.L., Williams S.C, Winter G, and Nissim A.
  • any two or more individual scFv clones can be selected from the Nissim I antibody phage display library in order to prepare rabbit derived polyclonal antibodies that recognize any individual scFv antibody that is present in the Nissim library or any IgG or fragment thereof provided that it contains the same V L or a fragment thereof.
  • Circulating platelets are cytoplasmic particles released from the periphery of megakaryocytes. Platelets play an important role in hemostasis. Upon vascular injury, platelets adhere to damaged tissue surfaces and attach one another (cohesion). This sequence of events occurs rapidly, forming a structureless mass (commonly called a platelet plug or thrombus) at the site of vascular injury.
  • the cohesion phenomenon also known as aggregation, may be initiated in vitro by a variety of substances, or agonists, such as: collagen, adenosine-diphosphate (ADP), epinephrine, serotonin, and ristocetin. Aggregation is one of the numerous in vitro tests performed as a measure of platelet function.
  • Yl scFv was selected from phage antibody library by biopanning on human platelets and was found to bind to fixed and washed human platelets. Characterization of Yl was done by using ELISA assay and by FACS analysis.
  • the GPIb ⁇ chain is disulfide-linked to the GPIb ⁇ chain to form the platelet membrane protein GPIb.
  • Monoclonal antibodies, MCA466S (Serotec) and S.C7071(Santa Cruz) are known to bind respectively to the C-terminal fragment of GPIb ⁇ and to the N-terminal of GPIb ⁇ and were found to react to the same fragments with which Yl reacts under reducing and non-reducing conditions (the S.C. was used only under reducing conditions). These results further confirm that Yl binds to the GPIb ⁇ platelet surface protein.
  • O-Sialoglycoprotein endoprotease from Pasteurella haemolytica selectively cleaves human platelet GPIb and specifically cleaves only proteins containing sialylated, O-linked glycans.
  • O-Sialoglycoprotein endoprotease does not cleave N-linked glycoproteins or unglycosylated proteins.
  • This enzyme has been reported to cleave GPIb, which is heavily O-glycosylated, but not GPIIb-IIIa or other receptors on platelets.
  • GPIb ⁇ was digested with O-Sialoglycoprotein endoprotease in order to further establish the binding of Yl to the molecule.
  • Mocarhagin (Sigma L4515a] is a cobra venom metalloproteinase that cleaves platelet GPIb ⁇ specifically at a single site between residues glu-282 and asp-283, thereby generating two stable products: a ⁇ 45-kDa N-terminal fragment (Hisl-Glu282), which is released into the supernatant, and a membrane-bound -95 kDa C-terminal fragment.
  • Washed platelets were treated by mocarhagin, and platelet lysates were electrophoresed on SDS-polyacrylamide gels and transferred to nitrocellulose.
  • Western blot analysis of lysates of mocarhagin-treated washed platelets with Yl shows a loss of the band corresponding to GPIb ⁇ (135 kDa ) and binding of Yl to the N-terminal -45 kDa tryptic fragment.
  • GPIb ⁇ gave similar results to those observed with washed platelets, showing binding of Yl and monoclonal antibody S.C7071 to the -45 kDa N-terminal cleavage product fragment of GPIb ⁇ . (FIG. 8). These results suggest that the epitope for Yl is contained within the sequence Hisl-Glu282. Characterization of the Y17 Clone — Binding to GPIb
  • Y17 a second scFv human antibody fragment of the invention, which was selected in the same manner as Yl, was characterized using the methods used to characterize Yl.
  • Y17 was selected from a phage antibody library by biopanning on human platelets. Characterization of Y17 was done by using ELISA assay and FACS analysis. Y17 was found to bind to both fixed and washed human platelets. In order to further characterize the receptor on platelet membranes which bind Y17, platelet proteins were separated by SDS-PAGE and immunoblotted with biotin labeled- Yl 7 under reducing and non-reducing conditions.
  • Yl and Y17 also bind similarly to glycocalicin after cleavage of glycocalicin by O-Sialoglycoprotein Endoprotease or Ficin. (FIGS. 5 and 10).
  • Cathepsin G (Sigma C4428), a neutrophil serine protease, cleaves glycocalicin at a first cleavage site between residues Leu-275 and Tyr-276 and at a second cleavage site between residues Nal-296 and Lys-297.
  • Cathepsin G treatment of glycocalicin generates two ⁇ -terminal fragments: a small ⁇ -terminal 42 kDa fragment (Hisl-Leu275), a large ⁇ -terminal 45 kDa ⁇ -terminal fragment (Hisl-Nal-296), and corresponding -95 kDa C-terminal fragments. (FIG. 1).
  • ELISA assays were developed to evaluate the effect of the GPIb derived synthetic peptides on the binding of Yl to purified glycocalicin .
  • FACS analysis using washed platelets was carried out.
  • a competitive binding FACS analysis was used. Yl-scFv at a concentration of 1 ⁇ g was preincubated with different peptides at concentrations of 2.5 and 200 ⁇ M.
  • a polystyrene microtiter maxisorb plate was coated with (a) purified glycocalicin or (b) washed platelets. After extensive washing, 0.5 ⁇ g/well of Yl was added. The plate was then incubated with rabbit anti-scFv followed by addition of anti rabbit -HRP (horse radish peroxidase) and HRP substrate. The level of anti rabbit - HRP binding was measured by the intensity of the color produced, and the level of anti rabbit -HRP binding conelates with the level of binding of anti Yl-scFv and the level of binding of Yl . The optical density was measured at A 4 o 5 . Each sample was assayed in duplicate, and the average was calculated.
  • Y* is identical to Y which is sulfated tyrosine.
  • Yl has an inhibitory effect on platelet aggregation and agglutination induced by ristocetin; (2) the effect is dose dependent; (3) higher inhibitory effect is observed in washed platelets relative to PRP; (4) reversible inhibitory effect was detected in PRP; (5) neither TM1 not Y16 scFv antibody fragments has an effect; and (6) Y17 is a negative control in this assay.
  • the full IgG Yl Due to its natural structure the full IgG Yl has two binding sites on GPIb ⁇ and one binding site for an Fc receptor. It is likely that if full IgG Yl binds two GPIb ⁇ molecules, it will activate platelets and induce platelet agglutination. Furthermore, because platelets have an Fc-receptor, Yl-IgG can induce platelet agglutination by binding to GPIb ⁇ and to an Fc-receptor, thereby producing platelet agglutination by each IgG Yl binding to three platelets.
  • IgG Yl the effect of IgG Yl on aggregation of washed platelets was tested at different concentrations of Yl-IgG in the presence or absence of ristocetin. Induction of platelet aggregation by Yl-IgG was monitored for 4 min at 37°C, followed by addition of ristocetin.
  • Antibodies against GPIb ⁇ (CD42b) recognize platelet lysate and glycocalicin and but not KG-1 cell lysate (a Yl binding positive myeloid cell line) or Raji cell lysate (a B cell line that is negative for Yl binding at concentrations at which KG-1 cells are positive for Yl binding). In contrast, Yl recognized both glycocalicin, platelet lysate, and KG-1 cells, but not Raji cell extract. The negative control scFv-181, did not recognize any of the relevant proteins. (FIG. 20).
  • H P-ligand 1 Two proteins immunoreacted with Yl both in normal as well as in leukemia patients plasma. The first is designated H P-ligand 1, which has a molecular mass of -50 kDa under reducing conditions and >300 kDa under non-reducing conditions and which completely disappears from the serum after coagulation; and (2) H P-ligand 2, which has a molecular mass of -80 kDa under both reducing and non- reducing conditions and which remains in serum after coagulation.
  • the -50 kDa ligand was identified as the normal variant of the gamma chain ( ⁇ prime) of human fibrinogen.
  • the sequence NRPEHPAETEYDSLYPEDDL is present only in fibrinogen gamma prime, but not the abundant form of fibrinogen gamma, and is similar to GPIb anionic region containing sulfated tyrosine. Most likely this is the binding site for Yl.
  • the -80 kDa was identified as complement compound 4 (CC4) and Lumican. As above, it contains sulfated tyrosine residues accompanied by a stretch of negatively charged amino acids.
  • FACS analysis indicates that Yl binds selectively to leukemia cells, but not to normal blood cells both in normal blood sample and normal cells within the blood of leukemia samples.
  • a summary of the results from patient analysis is shown in the following tables.
  • KG-1 membrane preparations were found to contain at least 2 subunits to which Yl binds: a -110 kDa subunit and a -120 kDa subunit. Yl also binds to a -220 kDa subunit, which may be a dimer of the -110 kDa subunit. Purification of Yl epitope was accomplished by immunoprecipitation with Yl, and reverse phase (RP-HPLC). 2 ⁇ l of the pooled fractions were used for Western blotting with scFv Yl, and 40 ⁇ l were used for silver staining. (FIG. 21).
  • Yl ligand was further characterized using enzymatic treatments with proteases, glycanases, and sulfates; Western blotting with Yl, anti-CD42 antibodies, anti- CD162 antibodies and 181, immunoprecipitation using Yl and anti-CD162 antibodies; FACS analysis using Yl anti-CD 162 antibodies; and sequencing.
  • IP fraction was further immunoprecipitated either with scFv Yl antibody or with KPLl.
  • the non-precipitated (eluate) fractions were analyzed by Western blot, using either scFv Yl or KPLl antibodies.
  • KPLl does not recognize glycocalicin.
  • scFv Yl and KPLl antibodies recognize membrane proteins on KG-1 cells.
  • lysates from cell lines and primary white blood cells were immunoprecipitated with anti-CD 162 antibodies and centrifuged to produce a supernatant and an eluate.
  • Western blot analysis of the proteins present in the eluate and supernatant was performed using scFv Yl and anti-CD162 antibodies.
  • KG-1 membrane preparations contain two subunits (-110 kDa and -120 kDa) to which anti-CD162 (PSGL-1) antibodies bind, hi contrast, normal white blood cell membrane preparations have only the smaller subunit.
  • Membrane preparations from AML patients have only the larger subunit.
  • scFv Yl binds to a distinct species, which is found in the supernatant of the immunoprecipitation, and to which anti-CD 162 antibodies do not bind. (FIG. 25).
  • sulfated-tyrosine containing Yl -binding domains in GPIb ⁇ , Fng- ⁇ prime, and PSGL-1 are DEGDTDLYDYYPEEDTEGD (amino acids 269-287), EHPAETEYDSLYPED (amino acids 411-427), and QATEYELDYDFLPETE (amino acids 1-17), respectively.
  • An additional binding site, with a higher affinity to Yl, is most likely to be expressed on primary leukemia cells.
  • blood samples that are positive both to scFv Yl and anti-CD 162 were derived from AML patients, while B-cell were negative to anti-CD 162.
  • a competitive binding ELISA assay was used to assess the importance of the presence and position of sulfated tyrosines to the binding of peptides to Yl.
  • scFv Yl was preincubated with a peptide of interest for 10 minutes at three different concentrations (1, 10 and 100 ⁇ M) in order to observe a dose response. (Table 12). After preincubation, the mixture (Yl + peptide) was added to the plate, and binding of scFv Yl was assessed using polyclonal rabbit anti-N L , which recognizes the N L chain of scFv Yl, followed by anti-rabbit-HRP.
  • glycocalicin-derived peptide having the same sequence sulfated on three sulfates did inhibit the binding, with efficiency similar to that of P-Y Y*Y.
  • Yl resembles L-selectin which recognizes both sulfated protein and sugar moieties, and is distinct from the P-selectin which recognizes only sulfated proteins. Therefore, it can compete for the bonding of both proteins.
  • MOLT4 cells derived from a T cell leukemia patient.
  • CTX Cyclophosphamid for injection, Mead Johnson. Eleven days after CTX injection, MOLT-4 cells were injected intravenously into the tail vein. Control mice were injected with PBS alone. One week post-MOLT-4 injection mice were injected with CONY1- Doxorubicin, which is a conjugate between scFv CON Yl polypeptide, having KAK amino acid residues at its carboxy end and doxorubicin via a short organic linker; CONY1, which is a scFv antibody fragment derived from Yl scFv in which the DNA sequences encoding the myc tag of Yl were deleted and replaced with a DNA sequence encoding the amino acids lysine, alanine, lysine (KAK); or free Doxorubicin . The mice were injected three times per week for three weeks. Control mice were injected with PBS; and another control group did not receive any treatment. (Table M).
  • mice started to die 32 days post cell inoculation, and the surviving mice were sacrificed at this time. Bone marrow cells were analyzed by flow cytometry using anti-human CD44-FITC and Yl-Biotin/SAN-PE. Blood samples from several animals were monitored for platelet and white blood cell count. Livers were weighted and examined for tumor appearance. Other organs were also examined for tumor appearance.
  • livers of mice injected with MOLT-4 and treated with CO ⁇ Y1 or CO ⁇ Y1 -Doxorubicin conjugate weighted significantly less than those of mice injected with MOLT-4 and treated with free Doxorubicin or left untreated. (FIG 30).
  • MOLT-4 group treated with CO ⁇ Y1 scFv -Doxorubicin, 75 ⁇ g/mouse
  • MOLT-4 group treated with Doxorubicin, 0.1 mg/kg. [291.]
  • portions of liver tissue were taken for histology and cell harvesting for FACS analysis. The survival rate of another group of treated animals was recorded relative to that of control untreated mice.
  • liver weights, on day 35, are presented in (FIG. 33). As shown, liver size almost tripled in the tumor-infected mice, negative control PBS treated relative to PBS control, and non-MOLT-4-injected mice. The liver weights of mice treated with a low dose of Doxorubicin were similar to that of PBS treated tumor-infected mice. On the other hand, CONYl scFv and CONYl scFv-Doxorubicin conjugate treatments markedly inhibited tumor growth in the liver (much lower liver weights).
  • CYTOXAN® Four days post CYTOXAN® injection, KG-1 cells were injected intravenously into the tail vein of six groups of mice. (Table N, Groups 2 and 5-9). One group of mice (Table N, Group 1) was injected with PBS alone (control). [297.][[297.]
  • mice Beginning 19 days post KG-1 injection mice were treated with: CONYl, Doxorubicin, CONYl -Doxorubicin conjugate, or Mylotarg®.
  • Mylotarg® is a monoclonal antibody (anti CD33) conjugated chemically to calcheamicin recently approved by the FDA for treatment of AML patients age 60 and over in a first relapse.
  • Mice were treated once or three times per week for three weeks. One group (group 2) of KG-1 inoculated mice were left untreated. (Table N).
  • mice Two other groups of mice (groups 3 and 4) were injected with KG-1 cells that were previously incubated with CONYl or 181-scFv (a negative, non-specific control antibody) in serum free RPMI containing 1% BSA at 4°C for 1 h.
  • the antibodies were used at a concentration of 0.25mg scFv/10 8 cells (75 ⁇ g/mouse).
  • KG-1 cells were washed and resuspended in RPMI.
  • the KG-1 cells in RPMI were inoculated into mice at a concentration of 75 ⁇ g scFv/ 0.2 ml RPMI per mouse.
  • Group 3 mice were inoculated with KG-1 + CONYl, and group 4 mice were inoculated with KG-1 + 181-scFv. (Table N). This treatment (group 3 and 4) was carried out one day after the inoculation of groups 1-2 and 5-9, i.e., at five days after CYTOXAN injection.
  • mice were sacrificed from 60 to 65 days post cell injection. Bone marrow and blood samples were analyzed by flow cytometry using mouse anti human CD34- FITC (IQP 144F) (or anti CD44-FITC (MCA89F, Serotec)) and Yl-Biotin/SAN-PE. Mouse IgGl-FITC (IQP 191-F) was used as an isotype control, and mouse IgG2a-FITC (MCA929F, Serotec) was used as a negative control. Flow cytometry was performed using FACSCalibur system and CellQwest software, Becton Dickinson.
  • mice in this group contained about 30% KG-1 cells on average of bone marrow cell population. All mice in this group developed leukemia.
  • mice developed leukemia, with average of 30% KG-1 cells in the bone marrow (as determined by FACS analysis). In general, KG-1 engraftment was confined to the bone marrow. Less than 10% KG-1 cells were found in the blood h one case a solid tumor was observed on peritoneal wall.
  • Doxorubicin (group 6) had a statistically significant (p ⁇ 0.05) lower percentage of KG-1 cells in their bone marrow, as compared to group 2.
  • LPS lipopolysaccharides
  • This situation may have resulted from the following: A) choosing mice in worse physical condition in the first day, B) proliferation of KG-1 cells in mice from group 8 during the days after treatment termination, and C) the number of mice in each group was too small to generate statistically significant results.
  • KG 1 group treated with Doxorubicin, 3 mg/kg, once a week 7.
  • KG 1 group treated with MylotargTM, 7 ⁇ g/mouse, once a week (MylotargTM is antibody linked to a chemotherapeutic agent, and is FDA-approved for use in leukemia patients).
  • CONY 1 scFv was labeled with 125 I-Bolton Hunter reagent (to lysine).
  • the labeling reaction was carried out at 4° C in a borate buffer (pH 9.2) with I-Bolton Hunter reagent, then I-CONYl was purified on a PD-10 chromatography column.
  • the radioactive protein was then admixed with unlabeled CONY-1 to yield a solution of 75 ⁇ g/ml CONY-1 containing 2.5x10 6 CPM/ml in saline.
  • mice Male Balb-C mice were preheated by intraperitoneal injection of 0.5 ml/mouse of 0.9% Nal. After 2 hours, the mice were injected intravenously with 0.2 ml of the labeled CONY-1 solution, resulting in a 125 I-CONY-l dose of 15 ⁇ g (5xl0 5 CPM) per mouse.
  • mice were sacrificed, and tissues were excised. Samples and organs were taken at 5, 15, and 30 minutes and at 1, 2, 4, 8, and 24 hours after injection. Two to four mice were used per time point. Plasma was separated and either counted for gamma radioactivity or subjected to precipitation with trichloroacetic acid (TCA). After centrifugation, TCA precipitates were subjected to gamma radioactivity counting. Liver, lung, kidney, spleen, and bone marrow samples were weighed and counted for gamma radioactivity. Plasma TCA precipitated radioactivity was plotted against time, and a two-compartment kinetics model was fitted. Organ/ tissue total and specific radioactivity values were calculated. The results are shown in (FIGS. 39, 40 and 41).
  • FIG. 39 shows CO ⁇ Y-1 levels in the plasma at various time points after administration. The values were fitted statistically to a two-compartment model, and the half-life values of blood clearance obtained were 35 and 190 minutes, respectively.
  • Antibodies, fragments thereof, constructs thereof, peptides, polypeptides, proteins, and fragments and constructs thereof can be produced in either prokaryotic or eukaryotic expression systems. Methods for producing antibodies and fragments in prokaryotic and eukaryotic systems are well-known in the art.
  • a eukaryotic cell system refers to an expression system for producing peptides or polypeptides by genetic engineering methods, wherein the host cell is a eukaryote.
  • a eukaryotic expression system may be a mammalian system, and the peptide or polypeptide produced in the mammalian expression system, after purification, is preferably substantially free of mammalian contaminants.
  • Other examples of a useful eukaryotic expression system include yeast expression systems.
  • a preferred prokaryotic system for production of the peptide or polypeptide of the invention uses E. coli as the host for the expression vector.
  • the peptide or polypeptide produced in the E. coli system, after purification, is substantially free of E. coli contaminating proteins.
  • Use of a prokaryotic expression system may result in the addition of a methionine residue to the N-terminus of some or all of the sequences provided for in the present invention. Removal of the N-terminal methionine residue after peptide or polypeptide production to allow for full expression of the peptide or polypeptide can be performed as is known in the art, one example being with the use of Aeromonas aminopeptidase under suitable conditions (U.S. Patent No. 5,763,215).
  • the present invention provides for a peptide or polypeptide comprising an antibody or antigen binding fragment thereof, a construct thereof, or a construct of a fragment.
  • Antibodies according to the present invention include IgG, IgA, IgD, Ig ⁇ , or IgM antibodies.
  • the IgG class encompasses several sub-classes including IgGi, IgG , IgG 3 , and IgG 4 .
  • Antibody fragments according to the present invention include Fv, scFv, dsFv, Fab, Fab 2 , and Fd molecules. Smaller antibody fragments, such as fragments of Fv's, are also included in the term "fragments", as long as they retain the binding characteristics of the original antibody or larger fragment. Examples of such fragments would be (1) a minibody, which comprises a fragment of the heavy chain only of the Fv, (2) a microbody, which comprises a small fractional unit of antibody heavy chain variable region (PCT Application No. PCT/IL99/00581), (3) similar bodies comprising a fragment of the light chain, and (4) similar bodies comprising a functional unit of a light chain variable region.
  • Constructs include, for example, multimers such as diabodies, triabodies, and tefrabodies.
  • the phrases "antibody, binding fragment thereof, or complex comprising an antibody or binding fragment thereof and “antibody or fragment” are intended to encompass all of these molecules, as well as derivatives and homologs, mimetics, and variants thereof, unless it is specified otherwise or indicated otherwise based on context and/ or knowledge in the art.
  • Antibodies and fragments according to the present invention may also have a tag may be inserted or attached thereto to aid in the preparation and identification thereof, and in diagnostics. The tag can later be removed from the molecule.
  • tags include: AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S-Tag®, T7, N5, and NSN-G (Jarvik and Telmer, Ann. Rev. Gen., 32, 601-618 (1998)).
  • the tag is preferably c-myc.
  • the present invention provides for a Yl or Y17 peptide or polypeptide comprising an scFv molecule.
  • a scFv is defined as a molecule which is made up of a variable region of a heavy chain of a human antibody and a variable region of a light chain of a human antibody, which may be the same or different, and in which the variable region of the heavy chain is connected, linked, fused or covalently attached to, or associated with, the variable region of the light chain.
  • a Yl and Y17 scFv construct may be a multimer (e.g., dimer, trimer, tetramer, and the like) of scFv molecules that incorporate one or more of the hypervariable domains of the Yl or Y17 antibody. All scFv derived constructs and fragments retain enhanced binding characteristics so as to bind selectively and/or specifically to a target cell in favor of other cells. The binding selectivity and/or specificity is primarily determined by hypervariable regions.
  • CDR Complementary Determining Regions
  • the CDR3 region is understood to be the most exposed region of the Ig molecule, and as provided herein, is the site primarily responsible for the selective and/or specific binding characteristics observed.
  • the Yl and Y17 peptide of the subject invention can be constructed to fold into multivalent Fv forms. Yl and Y17 multimeric forms were constructed to improve binding affinity and specificity and increased half-life in blood.
  • a free cysteine is introduced in the protein of interest.
  • a peptide-based cross linker with variable numbers (2 to 4) of maleimide groups was used to cross link the protein of interest to the free cysteines.
  • the phage library (as described herein above) was designed to display scFvs, which can fold into the monovalent form of the Fv region of an antibody. Further, and also discussed herein above, the construct is suitable for bacterial expression.
  • the genetically engineered scFvs comprise heavy chain and light chain variable regions joined by a contiguously encoded 15 amino acid flexible peptide spacer.
  • the preferred spacer is (Gly 4 Ser) 3 .
  • the length of this spacer, along with its amino acid constituents provides for a nonbulky spacer, which allows the V H and the V L regions to fold into a functional Fv domain that provides effective binding to its target.
  • the present invention is directed to Yl and Y17 multimers prepared by any known method in the art.
  • a preferred method of forming multimers, and especially dimers employs the use of cysteine residues to form disulfide bonds between two monomers.
  • dimers are formed by adding a cysteine on the carboxyl tenninus of the scFvs (refened to as Yl-cys scFv or Yl dimer) in order to facilitate dimer formation.
  • Yl dimers were expressed in a production vector and refolded in vitro. The protein was analyzed by SDS-PAGE, HPLC, and FACS.
  • dimers required only 1/100 the amount of the monomeric antibody for the same level of staining, indicating that the dimer has greater avidity.
  • Conditions for dimer refolding were determined, and material comprising >90% dimers (mg quantities) was produced after subsequent dialysis, chromatographic, and gel filtration steps.
  • the purified dimer was characterized by gel filtration and by SDS-PAGE analysis under oxidizing conditions. The dimer' s binding capacity was confirmed by radioreceptor assay, ELISA, and FACS analyses.
  • the Yl-cys-kak was produced in a ⁇ -pL vector in bacteria. Expression in the ⁇ -pL vector was induced by increasing the temperature to 42°C. Inclusion bodies were obtained from induced cultures and semi-purified by aqueous solutions, to remove unwanted soluble proteins. The inclusion bodies were solubilized in guanidine, reduced by DTE, and refolded in vitro in a solution based on arginine/ox-glutathione. After refolding, the protein was dialyzed and concentrated by tangential flow filtration to a buffer containing Urea/phosphate buffer. The protein was repunfied and concentrated by ionic-chromatography in an SP-column.
  • the dimer was characterized by SDS-page electrophoresis, gel filtration chromatography, ELISA, radioreceptor binding, and FACS.
  • the apparent affinity of the dimer was higher than the monomer due to the avidity effect. This effect was confirmed by ELISA to glycocalicin, FACS to KG-1 cells, and competition in a radioreceptor assay.
  • FIG. 43 a gel is shown with a mixed population of dimers and monomers.
  • the monomers are seen due to the reduction between the two monomers and in the non reduced form, two population are seen (as in the gel filtration experiment) a monomer fraction of about 30kDa and a dimer of about 60kDa.
  • Varying the length of the spacers is yet another preferred method of forming dimers, trimers, and triamers (often refened to in the art as diabodies, triabodies and tefrabodies, respectively). Dimers are formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally 5-12 amino acid residues. This shortened spacer prevents the two variable chains from the same molecule from folding into a functional Fv domain. Instead, the domains are forced to pair with complimentary domains of another molecule to create two binding domains. In a preferred method, a spacer of only 5 amino acids (Gly Ser) was used for diabody construction. This dimer can be formed from two identical scFvs, or from two different populations of scFvs and retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/ or show increased binding strength or affinity.
  • triabodies are formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains from the same molecule from folding into a functional Fv domain. Instead, three separate scFv molecules associate to form a trimer. In a prefened method, triabodies were obtained by removing this flexible spacer completely.
  • the triabody can be formed from three identical scFvs, or from two or three different populations of scFvs and retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/or show increased binding strength or affinity.
  • Tefrabodies are similarly formed under conditions where the spacer joining the two variable chains of a scFv is shortened to generally less than 5 amino acid residues, preventing the two variable chains from the same molecule from folding into a functional Fv domain. Instead, four separate scFv molecules associate to form a tetramer.
  • the tetrabody can be formed from four identical scFvs, or from 1-4 individual units from different populations of scFvs and should retain the selective and/or specific enhanced binding activity of the parent scFv(s), and/or show increased binding strength or affinity.
  • tetramers are formed via a biotin streptavidin association.
  • a novel fermentation construct that is capable of being enzymatically labeled with biotin (referred to herein as Yl-biotag or Yl-B) was created.
  • a sequence that is a substrate for the BirA enzyme was added at the Yl C-terminus.
  • the BirA enzyme adds a biotin to the lysine residue within the sequence.
  • Yl-biotag was expressed in E. coli.
  • the inclusion body material was isolated and refolded. The purity of the folded protein was >95%, and >100 mg were obtained from a 1-L culture (small-scale, non-optimized conditions).
  • the tetramers were incubated with the cell samples.
  • a low dose of the Yl tetramers (5 ng) binds well to the cell line (KG-1) providing a 10 to 20-fold higher response than previously observed with other Yl antibody forms.
  • a minor reaction was observed when a negative cell line was examined with varying doses of the tetramers.
  • the antibodies and binding fragments thereof of the subject invention can be associated with, combined, fused or linked to various pharmaceutical agents, such as drugs, toxins, and radioactive isotopes with, optionally, a pharmaceutically effective carrier, to form drug-peptide compositions, fusions or conjugates having anti-disease and/or anti-cancer activity. Such conjugates and fusions may also be used for diagnostic purposes.
  • pharmaceutical agents such as drugs, toxins, and radioactive isotopes
  • a pharmaceutically effective carrier to form drug-peptide compositions, fusions or conjugates having anti-disease and/or anti-cancer activity.
  • conjugates and fusions may also be used for diagnostic purposes.
  • Examples of carriers useful in the invention include dextran, HPMA (a lipophilic polymer) or any other polymer.
  • decorated liposomes can be used, such as liposomes decorated with scFv Yl molecules, such as Doxil, a commercially available liposome containing large amounts of doxorubicin.
  • Such liposomes can be prepared to contain one or more desired pharmaceutical agents and be admixed with the antibodies of the present invention to provide a high drug to antibody ratio.
  • the link between the antibody or fragment thereof and the pharmaceutical agent may be a direct link.
  • a direct link between two or more neighboring molecules may be produced via a chemical bond between elements or groups of elements in the molecules.
  • the chemical bond can be for example, an ionic bond, a covalent bond, a hydrophobic bond, a hydrophilic bond, an electrostatic bond or a hydrogen bond.
  • the bonds can be, for example, amine, carboxy, amide, hydroxyl, peptide and/ or disulfide bonds.
  • the direct link may preferably be a protease resistant bond.
  • linker compound is defined as a compound that joins two or more moieties together.
  • the linker can be straight-chained or branched.
  • a branched linker compound may be composed of a double-branch, triple branch, or quadruple or more branched compound.
  • Linker compounds useful in the present invention include those selected from the group comprising dicarboxylic acids, malemido hydrazides, PDPH, carboxylic acid hydrazides, and small peptides.
  • linker compounds useful according to the present invention include: a. Dicarboxylic acids such as succinic acid, glutaric acid, and adipic acid;
  • Maleimido hydrazides such as N-[ -maleimidocaproic acid] hydrazide, 4-[N- maleimidomethyl]cyclohexan-l-carboxylhydrazide, and N-[ -maleimidoundcanoic acid] hydrazide;
  • PDPH linkers such as (3-[2-pyridyldithio]propionyl hydrazide) conjugated to sulfurhydryl reactive protein
  • Carboxylic acid hydrazides selected from 2-5 carbon atoms.
  • Linking via direct coupling using small peptide linkers is also useful.
  • direct coupling between the free sugar of, for example, the anti-cancer drug doxorubicin and a scFv may be accomplished using small peptides.
  • small peptides include AU1, AU5, BTag, c-myc, FLAG, Glu-Glu, HA, His6, HSV, HTTPHH, IRS, KT3, Protein C, S- Tag ® , T7, V5, and VSV-G.
  • Antibodies, and fragments thereof, of the present invention may be bound to, conjugated to, complexed with or otherwise associated with imaging agents (also called indicative markers), such as radioisotopes, and these conjugates can be used for diagnostic and imaging purposes. Kits comprising such radioisotope-antibody (or fragment) conjugates are provided.
  • radioisotopes useful for diagnostics include indium,
  • the indicative marker molecule may also be a fluorescent marker molecule.
  • fluorescent marker molecules include fluorescein, phycoerythrin, or rhodamine, or modifications or conjugates thereof.
  • Antibodies or fragments conjugated to indicative markers may be used to diagnose or monitor disease states. Such monitoring may be carried out in vivo, in vitro, or ex vivo. Where the monitoring or diagnosis is carried out in vivo or ex vivo, the imaging agent is preferably physiologically acceptable in that it does not harm the patient to an unacceptable level. Acceptable levels of harm may be determined by clinicians using such criteria as the severity of the disease and the availability of other options.
  • the present invention provides for a diagnostic kit for in vitro analysis of treatment efficacy before, during, or after treatment, comprising an imaging agent comprising a peptide of the invention linked to an indicative marker molecule, or imaging agent.
  • the invention further provides for a method of using the imaging agent for diagnostic localization and imaging of a cancer, more specifically a tumor, comprising the following steps:
  • imaging agents include fluorescent dyes, such as
  • fluorescent proteins such as green fluorescent proteins.
  • Other examples include radioactive molecules and enzymes that react with a substrate to produce a recognizable change, such as a color change.
  • the imaging agent of the kit is a fluorescent dye, such as
  • FITC and the kit provides for analysis of treatment efficacy of cancers, more specifically blood-related cancers, e.g., leukemia, lymphoma and myeloma.
  • FACS analysis is used to determine the percentage of cells stained by the imaging agent and the intensity of staining at each stage of the disease, e.g., upon diagnosis, during treatment, during remission and during relapse.
  • Antibodies, and fragments thereof, of the present invention may be bound to, conjugated to, or otherwise associated with anti-cancer agents, anti-leukemic agents, anti-viral agents, anti-metastatic agents, anti-inflammatory agents, anti-thrombosis agents, anti-restenosis agents, anti-aggregation agents, anti-autoimmune agents, anti-adhesion agents, anti-cardiovascular disease agents, or other anti-disease agents or pharmaceutical agent.
  • a pharmaceutical agent refers to an agent that is useful in the prophylactic treatment or diagnosis of a mammal including, but not restricted to, a human, bovine, equine, porcine, murine, canine, feline, or any other warm-blooded animal.
  • anti-viral agents including acyclovir, ganciclovir and zidovudine
  • anti-thrombosis/restenosis agents including cilostazol, dalteparin sodium, reviparin sodium, and aspirin
  • anti-inflammatory agents including zaltoprofen, pranoprofen, droxicam, acetyl salicylic 17, diclofenac, ibuprofen, dexibuprofen, sulindac, naproxen, amtolmetin, celecoxib, indomethacin, rofecoxib, and nimesulid
  • anti-autoimmune agents including leflunomide, denileukin diftitox, subreum, WinRho SDF, defibrotide, and cyclophosphamide
  • anti-adhesion/anti-aggregation agents including limaprost, clorcro
  • exemplary pharmaceutical agents include doxorubicin, methoxymorpholinyldoxorubicin (morpholinodoxorubicin), adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives and combinations thereof
  • An anti-cancer agent is an agent with anti-cancer activity.
  • anti-cancer agents include agents that inhibit or halt the growth of cancerous or immature pre-cancerous cells, agents that kill cancerous or pre-cancerous, agents that increase the susceptibility of cancerous or pre-cancerous cells to other anti-cancer agents, and agents that inhibit metastasis of cancerous cells.
  • an anti-cancer agent may also be agent with anti-angiogenic activity that prevents, inhibits, retards or halts vascularization of tumors.
  • Inhibition of growth of a cancer cell includes, for example, the (i) prevention of cancerous or metastatic growth, (ii) slowing down of the cancerous or metastatic growth, (iii) the total prevention of the growth process of the cancer cell or the metastatic process, while leaving the cell intact and alive, or (iv) killing the cancer cell.
  • An anti-leukemia agent is an agent with anti-leukemia activity.
  • anti-leukemia agents include agents that inhibit or halt the growth of leukemic or immature pre-leukemic cells, agents that kill leukemic or pre-leukemic, agents that increase the susceptibility of leukemic or pre-leukemic cells to other anti-leukemia agents, and agents that inhibit metastasis of leukemic cells.
  • an anti-leukemia agent may also be agent with anti-angiogenic activity that prevents, inhibits, retards or halts vascularization of tumors.
  • Inhibition of growth of a leukemia cell includes, for example, the (i) prevention of leukemic or metastatic growth, (ii) slowing down of the leukemic or metastatic growth, (iii) the total prevention of the growth process of the leukemia cell or the metastatic process, while leaving the cell intact and alive, or (iv) killing the leukemia cell.
  • anti-disease, anti-cancer, and anti-leukemic agents examples include toxins, radioisotopes, and pharmaceuticals.
  • toxins include gelonin, Pseudomonas exotoxin (PE), PE40,
  • PE38 diphtheria toxin, ricin, or modifications or derivatives thereof.
  • radioisotopes examples include gamma-emitters, positron-emitters, and x-ray emitters that may be used for localization and/or therapy, and beta-emitters and alpha-emitters that may be used for therapy.
  • therapeutic radioisotopes include n ⁇ indium,
  • Non-limiting examples of anti-cancer or anti-leukemia pharmaceutical agents include doxorubicin, adriamycin, cis-platinum, taxol, calicheamicin, vincristine, cytarabine (Ara-C), cyclophosphamide, prednisone, daunorubicin, idarubicin, fludarabine, chlorambucil, interferon alpha, hydroxyurea, temozolomide, thalidomide and bleomycin, and derivatives thereof, an combinations thereof.
  • Antibodies, constructs, conjugates, and fragments of the subject invention may be administered to patients in need thereof via any suitable method.
  • Exemplary methods include intravenous, intramuscular, subcutaneous, topical, intratracheal, intrathecal, intraperitoneal, intralymphatic, nasal, sublingual, oral, rectal, vaginal, respiratory, buccal, intradermal, transdermal or intrapleural administration.
  • the formulation preferably will be prepared so that the amount administered to the patient will be an effective amount from about 0.1 mg to about lOOOmg of the desired composition. More preferably, the amount administered will be in the range of about lmg to about 500mg of the desired composition.
  • the compositions of the invention are effective over a wide dosage range, and depend on factors such as the particulars of the disease to be treated, the half-life of the peptide or polypeptide-based pharmaceutical composition in the body of the patient, physical and chemical characteristics of the pharmaceutical agent and of the pharmaceutical composition, mode of administration of the pharmaceutical composition, particulars of the patient to be treated or diagnosed, as well as other parameters deemed important by the treating physician.
  • composition for oral administration may be in any suitable form. Examples include tablets, liquids, emulsions, suspensions, syrups, pills, caplets, and capsules. Methods of making pharmaceutical compositions are well known in the art. See, e.g., Remington, The Science and Practice of Pharmacy, Alfonso R. Gennaro (Ed.) Lippincott, Williams & Wilkins (pub). [378.]
  • the pharmaceutical composition may also be formulated so as to facilitate timed, sustained, pulsed, or continuous release.
  • the pharmaceutical composition may also be administered in a device, such as a timed, sustained, pulsed, or continuous release device.
  • composition for topical administration can be in any suitable form, such as creams, ointments, lotions, patches, solutions, suspensions, and gels.
  • compositions comprising antibodies, constructs, conjugates, and fragments of the subject invention may comprise conventional pharmaceutically acceptable diluents, excipients, carriers, and the like.
  • Tablets, pills, caplets and capsules may include conventional excipients such as lactose, starch and magnesium stearate.
  • Suppositories may include excipients such as waxes and glycerol.
  • injectable solutions comprise sterile pyrogen-free media such as saline, and may include buffering agents, stabilizing agents or preservatives. Conventional enteric coatings may also be used.
  • Platelet concentrate in acid-citrate-dextrose was obtained from a blood banlc, platelets were isolated, washed once in buffer containing ACD and saline in a ratio of 1:7. The platelets were centrifuged at 800 g for 10 min after each wash and were resuspended in Tyrodes solution (2 mM MgCl 2 , 137 mM NaCl, 2.68 mM KC1, 3 mM NaH 2 PO 4 , 0.1 % glucose, 5 mM Hepes and 0.35 % albumin, pH 7.35) and count the number of cells.
  • Tyrodes solution 2 mM MgCl 2 , 137 mM NaCl, 2.68 mM KC1, 3 mM NaH 2 PO 4 , 0.1 % glucose, 5 mM Hepes and 0.35 % albumin, pH 7.35
  • O-Sialoglycoprotein endoprotease final concentration for 15 min at 37 °C and digestion was stopped by adding sample buffer (as described in Example 3(YH) and boiling.
  • the open reading frame (ORF) of the nucleotide sequence of Yl-HC (SEQ ID NO: 205), the amino acid sequence of Yl-HC (SEQ TD NO: 206), the ORF of the nucleotide sequence of Yl-LC (SEQ ID NO: 207), and the amino acid sequence of Yl-LC (SEQ ID NO: 208) are presented.
  • a leader sequence compatible for a mammalian expression system An exchangeable system was designed to allow convenient insertion of elements required for a full IgG molecule. The following complimentary double stranded oligonucleotides encoding a putative leader sequence were synthesized, annealed, and ligated into the Xliol site of the pBJ-2 mammalian expression vector (under the SR ⁇ 5 promoter).
  • the NL encoding sequence derived from the Yl scFv cD ⁇ A sequence was inserted between the leader and the constant light region-encoding sequence.
  • the V H encoding sequence derived from the Yl scFv cD ⁇ A sequence was inserted between the leader and the constant heavy region-encoding sequence This was accomplished by PCR amplification of the vector pH ⁇ -Yl, encoding for the original Yl, to obtain the V L and the V H regions, individually.
  • 5'-GCTGACCTAGGACGGTCAGCTTGGT (anti-sense) were used for the V L PCR reaction.
  • the cD ⁇ A product of the expected size of -350 bp was purified, sequenced and digested with EcoRV and Avrll restriction enzymes. The same procedure was employed to amplify and purify the V H CDNA region, using the sense and the anti-sense oligonucleotides
  • Constant regions The constant ⁇ 3 (CL- ⁇ 3) region and the constant heavy regions CH1-CH3 derived for IgGl cDNA were individually synthesized as follows:
  • RT-PCR was performed on mRNA extracted from a pool of normal peripheral B-cells (CD 19+ cells) in combination with the sense 5'- CCGTCCTAGGTCAGCCCAAGGCTGC and the anti-sense 5'-TTTGCGGCCGCTCATGAACATTCTGTAGGGGCCACTGT oligonucleotides.
  • the PCR product of the expected size (-400 bp) was purified, sequenced, and digested with Avr ⁇ and Notl restriction enzymes.
  • CMN - clone #40 human B cell clone
  • This clone was shown to secrete IgGl against human CMN and was also shown to induce ADCC response in in-vitro assays.
  • CH1-CH3 cD ⁇ A oligonucleotides
  • LC to allow double selection based on the puromycin resistant gene (PAC).
  • PAC puromycin resistant gene
  • the neomycin-resistant gene of the pBJ-Yl-LC plasmid was replaced with a fragment of ⁇ 1600bp encoding for the PAC gene (from the pMCC-ZP vector).
  • the leader sequence is underlined.
  • the NH and N regions are each encoded by amino acid sequences that are bolded, followed by either the IgGl (for the heavy chain) or the ⁇ 3 (for the light chain) constant region sequences.
  • Nectors pBJ-Yl-HC and pBJ-Yl-LC were used individually for the transfection and selection of stable cells expressing the heavy or light chains. Following selection on G418 and cell growth, the secreted protein in the supernatant was analyzed for IgGl expression by the capture EIA assay and by Western blot analysis, as described below:
  • Capture EIA assay The wells of 96 well-plates were pre-coated with mouse anti-human IgGl Fc (Sigma). The supernatant from above was added to the wells, and the presence of heavy chain IgGl was detected with biotinylated goat anti- ⁇ chain specific antibody (Sigma), streptavidin-HRP and substrate. An ELISA plate reader monitored development of the color at 05 .
  • CHO cells were cultivated in F-12 medium with 10% fetal calf serum and 40 ⁇ g/ml gentamicin at 37°C in 5% CO atmosphere. One day before transfection 0.8-lxl 0 6 cells were seeded on 90mm dishes. The cultures were co-transfected with lO ⁇ g of light and heavy chains DNA by the FuGene (Roche) transfection reagent technique. After 2 days of growth in nonselective medium, the cells were cultured for 10-12 days in F-12 medium containing 550 ⁇ g/ml neomycin and 3 ⁇ g/ml puromycin. The cells were trypsinized and cloned by limiting dilution of 0.5 cell/well in Costar 96-well plates. Individual colonies were picked, grown in six- well dishes and transfened to flasks.
  • a sandwich ELISA assay was used to determine the concentration of the antibody secreted into the supernatant of transfected CHO cells, hi order to determine the concentration of the antibody, the following reagents were used: monoclonal anti human IgGl(Fc) (Sigma) as the coated antibody, goat anti-human IgG ( ⁇ -chain specific) biotin conjugate as the detector (Sigma), and pure human IgGl, lambda (Sigma) as standard. Based on this ELISA assay the production rate varied between 3-4 ⁇ g/ml.
  • Binding of full size IgG-Yl molecule Binding experiments were performed to determine the level of binding of the IgG-Yl molecule compared to the binding level of the scFv-Yl molecule. A two-step staining procedure was employed, wherein 5 ng of IgG-Yl were reacted with both RAJI cells (negative control, Figure 44) and Jurkat cells (Yl positive cells, Figure 44). For detection, PE-labeled goat anti-human IgG was used. Similarly, 1 ⁇ g of scFv-Yl was reacted with Jurkat cells ( Figure 44), and PE-labeled rabbit anti-scFv was used for detection.
  • Results indicate that both IgG-Yl and scFv-Yl bind to Jurkat cells, with approximately 10 3 -fold more scFv-Yl molecules needed to obtain a level of detection similar to that of the IgG-Yl .
  • Example 6 Preparation of Fab and F(ab' 2 fragments derived from the full IgG Yl antibody.
  • CHO " cells were cultivated in F-12 medium supplemented with 10% fetal calf serum and 40 ⁇ g/ml gentamicin at 37°C in 5% CO 2 atmosphere. One day before transfection 1-1.5-lxl 0 6 cells were seeded on 90mm dishes. The cultures were co- transfected with 10 ⁇ g of DNA encoding the variable light and variable heavy chains of the Yl antibody, each in a separate eukaryotic expression system. Transfection was carried out with the FuGene (Roche) transfection reagent technique.
  • the cells were cultured for 10-12 days in F-12 medium containing 550 ⁇ g/ml neomycin and 3 ⁇ g/ml puromycin. The cells were trypsinized and cloned by limiting dilution of 0.5 cell/well in Costar 96-well plastic plates. Individual colonies were picked, grown in six-well dishes and transferred to flasks for further selection (to determine level of expression and antibody secretion to the growth media).
  • CHO " cells were cultivated in F-12 medium supplemented with 10% fetal calf serum and 40 ⁇ g/ml gentamicin at 37°C in 5% CO atmosphere. One day before transfection 0.8-1x10 cells were seeded on 90mm dishes. The cultures were transfected with 10 ⁇ g of DNA encoding the variable light and variable heavy chains of the Yl antibody cloned under the CMV (cytomegalovirus) promoter and the dhfr gene under the sv-40 promoter. Transfection was carried out using the FuGene (Roche) transfection reagent technique.
  • the cells were cultured in a media containing 100nM-5 ⁇ M methotrexate (MTX) and dialyzed fetal calf serum in order to select for clones (after limiting dilution) that express increased levels of the full Yl antibody.
  • MTX methotrexate
  • fetal calf serum dialyzed fetal calf serum
  • a sandwich ELISA assay was established to determine the concentration of the antibody that is being secreted into the supernatant of transfected CHO cells.
  • the following reagents were used: a monoclonal anti human IgGl(Fc) (Sigma) as the coated antibody, a goat anti human IgG( ⁇ -chain specific) biotin conjugate as the detector (Sigma) and a purified human IgGl, lambda (Sigma) as standard.
  • the IgG molecule is composed of two identical light chains and two identical heavy chains. These chains are held together in folds (domains) by a combination of non-covalent interactions and covalent bonds (disulfide linkages).
  • the light chain consists of one variable domain and one constant domain.
  • the heavy chain consists of a variable domain (V H ) and three separate constant domains (CH 1,2 and 3).
  • the "hinge" region between constant heavy domain one (CHI) and constant heavy domain two (CH2) is readily accessible to proteolytic attack by enzymes. Cleavage at this point produces Fab or F(ab') 2 fragments and the Fc portion.
  • the Fab portion of the molecule retains the antigen binding capability of the molecule, but has low nonspecific binding. The Fab portion is best suited to those situations where the antigen binding capabilities without effector functions are desired.
  • Fab and F(ab') 2 fragments are used as diagnostic and therapeutic agents.
  • the agents can be linked to antibodies that bind to cell surface antigens of tumors.
  • Fab or F(ab') 2 fragments in place of intact IgG offers several advantages:
  • fragments can more easily cross capillaries and diffuse to tissue surfaces.
  • Fragments not bound to conjugate will be cleared more rapidly than intact unbound IgG; and, therefore, more of the fragment-therapeutic agent will reach the target area.
  • fragments are purified on an immobilized Protein A column.
  • the F(ab') 2 and Fab fragments were concentrated using a microconcentrator with either a 10,000 or 30,000 Dalton molecular weight cutoff. Protein recovery was determined using absorbance at 280 nm. Fragment purity was determined using gel electrophoresis.
  • HCL for the preparation of F(ab') fragments
  • 20mg/ml for the preparation of Fab fragments
  • Reaction was terminated by eluting the digest with 4 ml of Immunopure Binding buffer. Separation of Fab or F(ab') 2 fragments from undigested IgG and Fc fragments was done by using Protein A column with Binding buffer. The Fab or F(ab') was contained in the flow through.
  • lysis buffer 200 ⁇ l/20x 10 6 cell pellet.
  • the lysis buffer used was 50 mM Tris pH 7.4, 1 mm PMSF 1 % NP-40, and 1 mM EDTA, although other suitable lysis buffers may be used.
  • the suspension was incubated for about 60 minutes on ice, then centrifuged (3000 rpm, 4 °C, 5 min). The supernatant was collected and divided into aliquots.
  • the homogenization buffer used was 2% (w/v) Tween 20, 1 mM MgSO 4 , 2 mM CaCl 2 , 150 mM NaCl, and 25 mM Tris-HCl, pH 7.4.
  • the following protease inhibitors were also added: ImM PMSF, 5 ⁇ g/ml Leupeptin, and 5 ⁇ g/ml Aprotonin.
  • the cells were homogenized using three to five strokes in a Potter-Elvehjem homogenizer with a rotating Teflon pestle (Ultra-Tor ex).
  • the sample was kept cold during homogenization, then stined for 1 hour in an ice-bath.
  • the sample was subjected to a few additional strokes in the homogenizer, then centrifuged at 3000 g for 30 min at 4 °C.
  • the supernatant was collected and centrifuged at 45000 g (19000 rpm rotor ss-34) for 1 hour at 4 °C.
  • the supernatant from the 45000g centrifugation was discarded.
  • a solution of 50 mM Tris 7.4, ImM EDTA, 1% NP-40 and protease inhibitors was added to the pellet, and the dissolved pellet was put it on ice for one hour.
  • the proteins were eluted from the column according to the following program: 5 minutes with 80% A, then 40 minutes gradient of 80-0% of A and 20-100%) B. A second gradient was then applied to bring the composition of the flow to 80% A, and this composition was used to wash the column for 5 more minutes. The elution liquid was collected in a fraction collector, in 1 ml fraction sizes.
  • the column was washed with buffer A until the optic density of the flow declined to zero.
  • the proteins were eluted from the column according to the following program: 5 minutes with 90% A, then 40 minutes gradient of 90-0% of A and 10-100% B. A second gradient was then used to bring the composition of the flow to 90% A, and this composition was used to continue washing the column for 5 more minutes.
  • the buffers used were (A) 0.1% TFA in DDW and (B) 80% CAN and 0.1% TFA in DDW. The flow rate was 1 ml/minute, with the exception of the wash step, during which the flow rate was 2 ml/ minute.
  • the electrophoresed samples were transfereed onto a nitrocellulose membrane overnight on 20 Volts in Tris Glycine buffer (20% MeOH, 192 mM glycine, 25 mM TRIS, pH 8.3) at room temperature.
  • the nitrocellulose membrane was blocked using 5%> skim milk in PBS (phosphate buffered saline) for one hour at room temperature.
  • the nitrocellulose membrane was washed 3 times for 5 minutes each with 0.05% Tween 20 in PBS.
  • the membrane was incubated with Super Signal mixture (Pierce) for 5 minutes as directed in the commercial protocol, then excess solution was dried.
  • the membrane was use to expose it to X-ray film (Fuji), and the film was developed.
  • nitrocellulose membrane was blocked using 5% skim milk for one hour at room temperature. The membrane was then washed 3 times for 5 minutes each with 0.05% Tween 20 in PBS at room temperature. The membrane was incubated with 5 ⁇ g/ml Yl -biotin (or 181-biotin) in 2% skim milk in PBS for one hour at room temperature. The membrane was then washed 3 times for 5 minutes each with cold 0.05% Tween 20 in PBS in the cold room (about 4 to about 10 °C ).
  • the membrane was then incubated in the cold room with a 1:1000 dilution of SAV-HRP (streptavidin-HRP) (at a final concentration of 1 g/ ml) in 2% skim milk, 0.05%> Tween.
  • SAV-HRP streptavidin-HRP
  • the dilution was carried out at room temperature (about 25 °C), then the diluted SAV-HRP was cooled on ice for 10-15 minutes before use.
  • the incubation was carried out for 1 hour with gentle shaking.
  • the membrane was washed, as above.
  • the membrane was then incubated with Super Signal mixture (Pierce) for 5 minutes as directed in the commercial protocol, then excess solution was dried.
  • the membrane was use to expose it to X-ray film (Fuji), and the film was developed.
  • SDS-polyacrylamide gel loaded either with semi-purified human platelet derived glycocalicin ("GC") or with E. coli cell lysates ("total") derived from induced and non-induced cells were analyzed.
  • Western blot analysis was performed with biotinylated Yl-scFv, polyclonal rabbit anti-human glycocalicin antibody, commercially available mouse anti-human CD42 monoclonal antibody (SZ2 Immunotech, PM640 Serotec, HEP1 Pharmigen, AN51 DAKO), and polyclonal antibody against the N-terminus of GPIb ⁇ (Sc-7071, Santa Cruz).
  • the two polyclonal antibodies recognized both the recombinant bacterial derived glycocalicin and the natural human platelet derived glycocalicin.
  • the Yl- scFv and the commercially available antibodies recognized the natural human-derived glycocalicin, but did not recognize the bacterial derived recombinant platelet glycocalicin.
  • the prokaryotic (e.g., E. coli) system lacks post-translational modification mechanisms, such as mechanisms for glycosylation and sulfation.
  • post-translational modification such as glycosylation and sulfation
  • CD33-APC for AML
  • CD19-APC for B-CLL
  • CD38-APC for Multiple Myeloma
  • Lysis of the red blood cells is the final step in the assay, followed by resuspension with 500 ⁇ l PBS.
  • the vector pHEN-Yl encoding the original Yl, was amplified using PCR for both the V and the V H regions, individually.
  • the sense oligonucleotide 5'- AACTCGAGTGAGCTGACACAGGACCCT, and the anti-sense oligonucleotide 5'-TTTGTCGACTCATTTCTTTTTTGCGGCCGCACC were used for the V L PCR reaction.
  • the cDNA product of the expected size of -350 bp was purified, sequenced, and digested with Xhol and Notl restriction enzymes.
  • the pTria-Yl vector from above was linearized with Xliol restriction enzyme, and synthetic complimentary double stranded oligonucleotides (5'-TCGAGAGGTGGAGGCGGT and 5' TCGAACCGCCTCCACCTC) were pre-annealed and ligated into the Xhol site, between the Yl-heavy and Yl-light chains.
  • This new vector was designated pDia-Yl .
  • the DNA sequence and protein expression was confirmed.
  • periplasmic proteins extracted from the bacteria were precipitated over-night with 60% ammonium sulfate, resuspended in H 0, and loaded onto a Sephacryl-200 (Pharmacia) size exclusion column pre-equilibrated with O.l.xPBS. Fractions were collected and analyzed by HPLC, and separate fractions containing either the dimer or timer forms were collected for FITC labeling and FACS analysis.
  • FACS analysis was performed on Jurkat cells using a "three step staining procedure.” First, crude extracts or purified unlabeled scFv are stained, then mouse anti-myc antibodies, and finally, FITC- or PE-conjugated anti-mouse antibodies. FACS analysis requires 5-8xl0 5 cells, which have been Ficoll-purified and resuspended in PBS+1 % BSA. Binding was carried out for 1 hour at 4°C. After each step, cells were washed and resuspended in PBS+1 %> BSA. After the final staining step, cells were fixed by re- suspending in PBS, 1 % BSA, 2 % formaldehyde, and then read by FACS (Becton-Dickinson).
  • the assay system involved the use of radioactive ligands that were prepared by iodination with 125 I using chloramine T on the Yl-IgG construct or the Bolton-Hunter (CONYl) reagent.
  • the assay tubes contained 5xl0 6 KG-1 cells per 0.2 ml and a labeled tracer with varying amounts of unlabeled competitor, in PBS + 0.1 %> BSA, pH 7.4. After one hour incubation with agitation at 4 °C, the cells were thoroughly washed with cold buffer and taken for radioactivity counting.
  • the pellet was resuspended in TE with the aid of a tissuemiser (or homogenizer). This process was repeated 3-4 times until the inclusion bodies (pellet) were gray/light brown in color.
  • the inclusion bodies were solubilized in 6M Guanidine-HCl, 0.1M Tris pH 7.4, 2 mM EDTA (1.5 grams of inclusion bodies in 10 ml solubilization buffer provided -10 mg/ml soluble protein). This was incubated for at least 4 hrs. The protein concentration was measured and brought to a concentration of 10 mg/ml. DTE was added to a final concentration of 65 mM and incubated overnight at room temperature.
  • Re-folding was initiated by dilution of 10 ml of protein (drop by drop) to a solution containing 0.5 M Arginine, 0.1 M Tris pH 8, 2 mM EDTA, 0.9 mM GSSG. The re-folding solution was incubated at -10° C for 48 hrs. The re-folding solution containing the protein was dialyzed in a buffer containing 25 mM Phosphate buffer pH 6, 100 mM Urea, and concentrated to 500 ml. The concentrated/dialyzed solution was bound to an SP-sepharose column, and the protein was eluted by a gradient of NaCl (up to 1M).
  • EXAMPLE 14 ELISA to GC (glycocalicin)
  • the plate was washed and anti-rabbit HRP was added for an additional hour.
  • the plate was washed 5 times and 100 ⁇ l TMB substrate was added for approximately 15 minutes then 100 ⁇ l of 0.5 H 2 SO 4 was added to stop the reaction.
  • the optical density of the plate was measured at 450nm in an ELISA reader.
  • EXAMPLE 15 E. coli expression of recombinant glycocalicin (GC)
  • GPIb - glycocalicin (GC, amino acid 1 to amino acid 493) was cloned into an EPTG inducible prokaryotic vector cassette.
  • E. coli (BL21 DE3) cells harboring the newly constructed plasmid were grown at 37°C to O.D. 0.7-0.8, than at 37°C for 3 hours for in the presence of PTG for induction.
  • SDS-polyacrylamide gel loaded either with semi-purified human platelet derived GC or with E. coli cell lysates (total protein content) derived from induced and non-induced cells were analyzed.
  • Post-translational modification such as glycosylation and sulfation is essential for scFv and commercially available antibodies binding to GC.
  • the prokaryotic (E. coli) system lacks post-translation modification mechanisms, such as glycosylation and sulfation.
  • LNDEFEAQKIEWHE was added at the C-terminus of the Yl by PCR and cloning into an IPTG inducible expression vector cassette.
  • the clone was named Yl-biotag.
  • This sequence is a substrate for the enzyme BirA, that in the presence of free biotin, the enzyme is capable of covalently connecting biotin to the lysine (K) residue (Phenotypic analysis of antigen-specific T lymphocytes. Science. 1996 Oct 4;274(5284):94-6, Altman JD et al).
  • This construct was produced as inclusion bodies in BL21 bacterial cells. Refolding was performed as described previously. Inclusion bodies were solubilized in guanidine-DTE. Refolding was done by dilution in a buffer containing arginine-tris- EDTA. Dialysis and concentration was performed followed by HiTrapQ ionic exchange purification.
  • the purified Yl-biotag scFv was incubated with BirA enzyme (purchased from Avidity) and biotin as recommended by the provider.
  • BirA enzyme purchased from Avidity
  • biotin as recommended by the provider.
  • the biotinylated Yl-biotag was analyzed by HABA test (that estimates the amount of biotin per molecule) and demonstrated that there was around >0.8 biotin residues/molecule.
  • sequence of Yl-biotag is as follows, and is SEQ ED NO: 211:
  • the O-Sialoglycoprotein endoprotease specifically cleaved only proteins containing sialyated, O-linked glycans, and does not cleave N-linked glycoproteins or unglycosylated proteins. This enzyme has been reported to cleave GPIb, which is heavily O-glycosylated, but not GPIIb-IIIa or other receptors on the platelets.
  • GPIb is to use endoproteases enzyme whose cleavage sites on platelets GPIb are fully characterized.
  • Mocarhagin a cobra venom metalloproteinase cleaves platelet GPIb ⁇ specifically at a single site between residues glu-282 and asp-283, generates two stable products, a 45-kDa N-terminal fragment (His- 1 -Glu-282) found in the supernatant and a membrane bound 100 kDa C-terminal fragment.
  • Washed platelets were treated by mocarhagin and, platelets lysate were separated on SDS-polyacrylamide gels and transfened to nitrocellulose. Analysis of mocarhagin-treated washed platelets by Western blot analysis with Yl -results in loss of the band corresponding to GPIb (135 kDa) and, binding of Y17 to the N-terminal 45 kDa tryptic fragment.
  • Cathepsin G a neutrophil serine protease, cleaved glycocalicin between residues leu-275 and Tyr-276 and a second cleavage site between residues Val-296 and Lys-297.
  • Glycocalicin treated by cathepsin G generated two N-terminal fragments, a small fragment 42 kDa fragment (Hisl-Leu275) and a large 45 kDa N-terminal fragment (Hisl-Val-296), in addition to a ⁇ 95 kDa C-terminal fragment.
  • Glycocalicin and glycocalicin fragments generated by cathepsin G digestion were separated on SDS- polyacrylamide gels and transferred to nitrocellulose.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Oncology (AREA)
  • Diabetes (AREA)
  • Pain & Pain Management (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Rheumatology (AREA)
  • Urology & Nephrology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2001/049442 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof Ceased WO2002053700A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
BRPI0116764-2A BR0116764A (pt) 2000-12-29 2001-12-31 moléculas isoladas compreendendo epitopos contendo porções sulfatadas, anticorpos para os referidos epitopos e seus usos
HU0700079A HUP0700079A2 (en) 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
EP01994330A EP1406930A4 (en) 2000-12-29 2001-12-31 "ISOLATED MOLECULES WITH SULFATED GROUPING CONTAINING EPITOPES, ANTIBODIES AGAINST SUCH EPITOPES AND USES THEREOF"
KR10-2003-7008890A KR20030091953A (ko) 2000-12-29 2001-12-31 황산화된 부분을 함유하는 에피토프를 포함하는 분리된분자, 그러한 에피토프에 대한 항체, 및 그들의 용도
CA002433225A CA2433225A1 (en) 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
IL15668901A IL156689A0 (en) 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
MXPA03005945A MXPA03005945A (es) 2000-12-29 2001-12-31 Moleculas aisladas que comprenden epitopes que contienen grupos sulfato, anticuerpos para tales epitopes y usos de ellos.
JP2002555211A JP2005503756A (ja) 2000-12-29 2001-12-31 硫酸化部分を含むエピトープを含む単離分子、当該エピトープに対する抗体、及びその使用

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US25894800P 2000-12-29 2000-12-29
US75118100A 2000-12-29 2000-12-29
US09/751,181 2000-12-29
US60/258,948 2000-12-29

Publications (2)

Publication Number Publication Date
WO2002053700A2 true WO2002053700A2 (en) 2002-07-11
WO2002053700A3 WO2002053700A3 (en) 2004-02-12

Family

ID=26946974

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/049442 Ceased WO2002053700A2 (en) 2000-12-29 2001-12-31 Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof

Country Status (13)

Country Link
EP (1) EP1406930A4 (https=)
JP (1) JP2005503756A (https=)
KR (1) KR20030091953A (https=)
CN (1) CN100347194C (https=)
BR (1) BR0116764A (https=)
CA (1) CA2433225A1 (https=)
CZ (1) CZ20031982A3 (https=)
HU (1) HUP0700079A2 (https=)
IL (1) IL156689A0 (https=)
MX (1) MXPA03005945A (https=)
PL (1) PL366223A1 (https=)
RU (1) RU2003123101A (https=)
WO (1) WO2002053700A2 (https=)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1551452A4 (en) * 2002-07-01 2006-08-30 Savient Pharmaceuticals Inc COMPOSITIONS AND METHODS FOR THERAPEUTIC TREATMENT
US20060211646A1 (en) * 2003-09-05 2006-09-21 Ferro Laura I Formulations with anti-tumour action
EP1646401A4 (en) * 2003-06-30 2007-07-18 Bio Technology General Israel SPECIFIC HUMAN ANTIBODIES
WO2005010153A3 (en) * 2003-06-30 2008-03-13 Bio Technology General Israel Antibodies and uses thereof
JP2008509084A (ja) * 2004-05-11 2008-03-27 アブゲノミクス コーポレイション T細胞死誘導エピトープ
US7744888B2 (en) 2001-08-03 2010-06-29 Abgenomics Cooperatief U.A. Methods of modulating T cell or natural killer cell activity with anti-P-selectin glycoprotein ligand 1 antibodies
JP2011200247A (ja) * 2004-05-10 2011-10-13 Abgenomics Cooeperatief Ua 抗体
US8628775B2 (en) 2001-08-03 2014-01-14 Abgenomics Cooperatief U.A. Methods of reducing T cell-mediated immune responses with multimeric P-selectin and/or E-selectin compounds
US8980862B2 (en) 2010-11-12 2015-03-17 Gentium S.P.A. Defibrotide for use in prophylaxis and/or treatment of Graft versus Host Disease (GVHD)
US9902952B2 (en) 2012-06-22 2018-02-27 Gentrum S.R.L. Euglobulin-based method for determining the biological activity of defibrotide
WO2019027034A1 (ja) * 2017-08-04 2019-02-07 公立大学法人福島県立医科大学 新規ポリペプチド及びその用途
US10393731B2 (en) 2014-11-27 2019-08-27 Gentium S.R.L. Cellular-based method for determining the biological activity of defibrotide
US11897964B2 (en) 2011-06-13 2024-02-13 Altrubio Inc. Anti-PSGL-1 antibodies and uses thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016013828A1 (ko) * 2014-07-21 2016-01-28 연세대학교 산학협력단 황산화된 더피 케모카인 수용체의 세포 외 도메인 1 변이체 및 이의 용도
CN109929036B (zh) * 2017-12-19 2024-12-03 泰州迈博太科药业有限公司 一种表位特异的抗体筛选方法及所筛选到的抗体

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993011778A1 (en) * 1991-12-12 1993-06-24 The Scripps Research Institute Bifunctional antithrombotic molecules and antithrombotic polypeptides
CZ401497A3 (cs) * 1995-06-14 1998-07-15 The General Hospital Corporation P-selektinové ligandy a příbuzné molekuly a způsoby
KR100523506B1 (en) * 1995-08-03 2005-10-24 Peptide and O-glycan inhibitors of selectin mediated inflammation
US5985833A (en) * 1996-09-17 1999-11-16 Wisconsin Alumni Research Foundation Thrombin inhibitor
JP2002518354A (ja) * 1998-06-16 2002-06-25 ザ ボード オブ リージェンツ オブ ザ ユニヴァーシティー オブ オクラホマ 糖硫酸ペプチド、その合成方法および使用方法

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of EP1406930A2 *
SNAPP ET AL.: 'A novel P-selectin glycoprotein ligand-1 monoclonal antibody recognizes an epitope within the tyrosine sulfate motif of human PSGL-1 and blocks recognition of both P- and L-selectin' BLOOD vol. 91, no. 1, 01 January 1998, pages 154 - 164, XP002968095 *

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7744888B2 (en) 2001-08-03 2010-06-29 Abgenomics Cooperatief U.A. Methods of modulating T cell or natural killer cell activity with anti-P-selectin glycoprotein ligand 1 antibodies
US8628775B2 (en) 2001-08-03 2014-01-14 Abgenomics Cooperatief U.A. Methods of reducing T cell-mediated immune responses with multimeric P-selectin and/or E-selectin compounds
US8298540B2 (en) 2001-08-03 2012-10-30 Abgenomics Cooperatief U.A. Methods of modulating T cell-mediated immune responses with anti-P-selectin glycoprotein ligand 1 antibodies
US8557579B2 (en) 2001-08-03 2013-10-15 Abgenomics Cooperatief U.A. Screening for modulators of PSGL-1 with respect to T cell or NK cell death
EP1551452A4 (en) * 2002-07-01 2006-08-30 Savient Pharmaceuticals Inc COMPOSITIONS AND METHODS FOR THERAPEUTIC TREATMENT
EP1646401A4 (en) * 2003-06-30 2007-07-18 Bio Technology General Israel SPECIFIC HUMAN ANTIBODIES
JP2007527393A (ja) * 2003-06-30 2007-09-27 バイオ−テクノロジー・ジェネラル(イスラエル)リミテッド 特異的ヒト抗体
WO2005010153A3 (en) * 2003-06-30 2008-03-13 Bio Technology General Israel Antibodies and uses thereof
US8551967B2 (en) * 2003-09-05 2013-10-08 Gentium Spa Formulations with anti-tumour action
US20060211646A1 (en) * 2003-09-05 2006-09-21 Ferro Laura I Formulations with anti-tumour action
US8828397B2 (en) 2004-05-10 2014-09-09 Abgenomics Cooperatief U.A. Anti-PSGL-1 antibodies and methods of inducing cell death of an activated T cell
US9631019B2 (en) 2004-05-10 2017-04-25 Abgenomics Cooperatief U.A. Methods of treating GVHD and transplant rejection with anti-PSGL-1 antibodies
US8361472B2 (en) 2004-05-10 2013-01-29 Abgenomics Cooperatief U.A. Anti-PSGL-1 antibodies
JP2011200247A (ja) * 2004-05-10 2011-10-13 Abgenomics Cooeperatief Ua 抗体
US8663641B2 (en) 2004-05-10 2014-03-04 Abgenomics Cooperatief U.A. Anti-PSGL-1 antibodies
JP2014094010A (ja) * 2004-05-10 2014-05-22 Abgenomics Cooeperatief Ua 抗体
US10030075B2 (en) 2004-05-10 2018-07-24 Abgenomics Cooperatief U.A. Methods of treating with anti-PSGL-1 antibodies
JP2008509084A (ja) * 2004-05-11 2008-03-27 アブゲノミクス コーポレイション T細胞死誘導エピトープ
US9494574B2 (en) 2004-05-11 2016-11-15 Abgenomics Cooperatief U.A. T-cell death-inducing epitopes
JP2013049679A (ja) * 2004-05-11 2013-03-14 Abgenomics Cooeperatief Ua T細胞死誘導エピトープ
US9867843B2 (en) 2010-11-12 2018-01-16 Gentium S.R.L. Defibrotide for use in prophylaxis and/or treatment of graft versus host disease (GVHD)
US9539277B2 (en) 2010-11-12 2017-01-10 Gentium S.R.L. Defibrotide for use in prophylaxis and/or treatment of graft versus host disease (GVHD)
US8980862B2 (en) 2010-11-12 2015-03-17 Gentium S.P.A. Defibrotide for use in prophylaxis and/or treatment of Graft versus Host Disease (GVHD)
US11897964B2 (en) 2011-06-13 2024-02-13 Altrubio Inc. Anti-PSGL-1 antibodies and uses thereof
US9902952B2 (en) 2012-06-22 2018-02-27 Gentrum S.R.L. Euglobulin-based method for determining the biological activity of defibrotide
US11085043B2 (en) 2012-06-22 2021-08-10 Gentium S.R.L. Euglobulin-based method for determining the biological activity of defibrotide
US11236328B2 (en) 2012-06-22 2022-02-01 Gentium S.R.L. Euglobulin-based method for determining the biological activity of defibrotide
US11746348B2 (en) 2012-06-22 2023-09-05 Gentium S.R.L. Euglobulin-based method for determining the biological activity of defibrotide
US12529052B2 (en) 2012-06-22 2026-01-20 Gentium S.R.L. Euglobulin-based method for determining the biological activity of defibrotide
US12534722B2 (en) 2012-06-22 2026-01-27 Gentium S.R.L. Euglobulin-based method for determining the biological activity of defibrotide
US10393731B2 (en) 2014-11-27 2019-08-27 Gentium S.R.L. Cellular-based method for determining the biological activity of defibrotide
US12584903B2 (en) 2014-11-27 2026-03-24 Gentium S.R.L. Cellular-based method for determining the potency of defibrotide
WO2019027034A1 (ja) * 2017-08-04 2019-02-07 公立大学法人福島県立医科大学 新規ポリペプチド及びその用途

Also Published As

Publication number Publication date
HUP0700079A2 (en) 2007-05-02
JP2005503756A (ja) 2005-02-10
CN1649900A (zh) 2005-08-03
PL366223A1 (en) 2005-01-24
CA2433225A1 (en) 2002-07-11
BR0116764A (pt) 2007-01-09
MXPA03005945A (es) 2004-10-15
WO2002053700A3 (en) 2004-02-12
EP1406930A4 (en) 2007-01-10
KR20030091953A (ko) 2003-12-03
CN100347194C (zh) 2007-11-07
IL156689A0 (en) 2004-01-04
EP1406930A2 (en) 2004-04-14
RU2003123101A (ru) 2005-03-10
CZ20031982A3 (cs) 2004-09-15

Similar Documents

Publication Publication Date Title
US20040002450A1 (en) Y17 - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001822A1 (en) Y1-isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20040001839A1 (en) Multimers - isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
US20090220486A1 (en) Antibodies and uses thereof
AU2002246737B2 (en) Specific human antibodies for selective cancer therapy
WO2002053700A2 (en) Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof
AU2002246737A1 (en) Specific human antibodies for selective cancer therapy
US7132510B2 (en) Specific human antibodies for selective cancer therapy
JP2005503756A5 (https=)
US20040202665A1 (en) Compositions and methods for therapeutic treatment
WO2004003166A2 (en) Antibodies and uses thereof
WO2005010153A2 (en) Antibodies and uses thereof
CA2491427A1 (en) Compositions and methods for therapeutic treatment
US20080274100A1 (en) Antibodies and uses thereof
US20040208877A1 (en) Antibodies and uses thereof
AU2002246738A1 (en) Isolated molecules comprising epitopes containing sulfated moieties, antibodies to such epitopes, and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: PA/a/2003/005945

Country of ref document: MX

Ref document number: 2433225

Country of ref document: CA

Ref document number: 2002555211

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 156689

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 1020037008890

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 200305336

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: PV2003-1982

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 527150

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2001994330

Country of ref document: EP

Ref document number: 2002246738

Country of ref document: AU

Ref document number: 01171/DELNP/2003

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 018228844

Country of ref document: CN

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1020037008890

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2001994330

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: PV2003-1982

Country of ref document: CZ

ENP Entry into the national phase

Ref document number: PI0116764

Country of ref document: BR